 |
Previous Article | Next Article 
The Journal of Neuroscience, May 15, 2001, 21(10):3342-3349
High-Fidelity Transmission Acquired via a Developmental Decrease
in NMDA Receptor Expression at an Auditory Synapse
Kensuke
Futai,
Masayoshi
Okada,
Kyoko
Matsuyama, and
Tomoyuki
Takahashi
Department of Neurophysiology, University of Tokyo Faculty of
Medicine, Tokyo 113-0033, Japan
 |
ABSTRACT |
Central auditory relay synapses in mature animals follow
high-frequency inputs for computation of sound localization. In
immature mice, however, transmission at the calyx of Held synapse in
auditory brainstem was inaccurate for high-frequency inputs because the summed slow synaptic potential components caused aberrant firings or
blocked action potentials. As the mice matured, synaptic potentials became shorter, with smaller and faster NMDA receptor
components, thereby establishing the precise one-to-one transmission
for high-frequency inputs. Developmental acquisition of this
high-fidelity transmission could be mimicked experimentally in
immature mice by blocking NMDA receptors with
D( )2-amino-5-phosphonovaleric acid (D-APV). Furthermore, bilateral cochlear ablations at postnatal day 7 (P7) attenuated the developmental decrease of NMDA receptor expression and
prevented the acquisition of high-fidelity transmission. We suggest
that auditory activity, which begins at P10-P12 in mice, downregulates
the expression of postsynaptic NMDA receptors, thereby contributing to
the establishment of high-fidelity synaptic transmission.
Key words:
NMDA receptor; high-fidelity synaptic transmission; postnatal development; the calyx of Held; cochlear ablation; excitatory
postsynaptic current; AMPA receptor
 |
INTRODUCTION |
In the mammalian auditory system,
sound localization is achieved via the comparison of the timing and
strength of sound detected at each cochlea (Oertel, 1997 ; Trussell,
1997 ). The principal cell in the medial nucleus of the trapezoid body
(MNTB) is a glycinergic inhibitory neuron that receives a single
excitatory glutamatergic input from a contralateral globular bushy cell
in anterior ventral cochlear nucleus. The giant nerve terminal called
the calyx of Held forms an axo-somatic synapse on the MNTB principal
neuron (Held, 1893 ). The MNTB neurons send projections to the lateral superior olivary neurons, which also receive excitatory inputs from
ipsilateral cochlear neurons, allowing the sound intensities from each
cochlea to be compared. Such temporal cues rely on a high-fidelity
synaptic transmission along the auditory pathway.
The calyx of Held synapse is formed at P4-P6 but undergoes
developmental changes during the second postnatal week, when the animals begin to detect sound (Mikaelian and Ruben, 1964 ;Kikuchi and
Hilding, 1965 ). During this period the nerve terminal is reformed from
"spoon-shaped" to "finger-like" via "fenestration" (Kandler and Friauf, 1993 ), and presynaptic Ca2+
channels switch from a mixture of N, P/Q, and R types to the P/Q type
(Iwasaki and Takahashi, 1998 ). We report here that during this period
the synaptic transmission acquires fidelity for high-frequency inputs
mainly via an auditory activity-dependent downregulation of
postsynaptic NMDA receptor expression.
 |
MATERIALS AND METHODS |
Electrophysiology. All experiments were performed in
accordance with the guidelines of the Physiological Society of Japan. Transverse brainstem slices (200-250 µm thick) containing the MNTB
were prepared from 5- to 7-d-old C57BL mice that were decapitated under
halothane anesthesia (Forsythe and Barnes-Davies, 1993 ). Slices were
incubated for 30 min at 37°C and maintained at room temperature. The
extracellular artificial CSF (aCSF) for perfusion contained (in
mM): 120 NaCl, 2.5 KCl, 26 NaHCO3,
1.25 NaH2PO4, 2 CaCl2, 1 MgCl2, 10 D-glucose, 3 myo-inositol, 2 sodium pyruvate, and 0.5 ascorbate, pH-adjusted to 7.4 when saturated with 5%
CO2 and 95% O2. For
electrophysiological recordings the slices were mounted on an upright
microscope (BX50WI, Olympus, Tokyo, Japan), and MNTB principal neurons
were identified visually with an infrared (IR) differential
interference contrast video microscopy attached with an IR-CCD camera
(Hamamatsu Photonics, Ichinocho, Japan). The patch pipette solution for
voltage-clamp recordings contained (in mM): 115 Cs-gluconate, 20 CsCl, 10 HEPES, 0.5 EGTA, 10 phosphocreatine, 4 ATP,
and 0.3 GTP, pH-adjusted to 7.3 with CsOH. To suppress action potential
generation, we included
N-(2,6-dimethylphenylcarbamoylmethyl) triethylammonium
chloride (QX314; 5 mM, Alomone Labs, Jerusalem, Israel) in the pipette solution.
For current-clamp recordings the cesium was replaced by potassium and
QX314 was omitted. Recording pipettes were made of thick-walled borosilicate glass pipettes (Clark Electrochemical, Pangbourne, UK)
pulled to the resistance of 2-3 M . Whole-cell recordings were made
with an Axopatch 200B amplifier (Axon Instruments, Foster City, CA). In
voltage-clamp experiments the series resistance was typically 10-15
M and compensated by >85%. Membrane potentials were corrected for
a liquid junction potential ( 9 mV) between the extracellular and
pipette solutions. All experiments were performed at 26-27°C, using
a bath temperature controller (DTC-200, DIA Medical System).
Postsynaptic responses were evoked in MNTB principal neurons at 0.1 Hz,
using a bipolar tungsten electrode positioned half-way between the
midline of the slice and the MNTB (Forsythe and Barnes-Davies, 1993 ).
Before a gigaohm seal was formed, principal neurons receiving an
excitatory input were identified from orthodromic spikes recorded
extracellularly from a patch pipette. EPSCs evoked in an
all-or-none manner for a graded stimulus intensity and having
amplitudes >1 nA at 79 mV were selected as those derived from the
calyx of Held (Forsythe and Barnes-Davies, 1993 ). To isolate
NMDA-EPSCs, we added 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX; 20 µM; Tocris, Bristol, UK) or GYKI 52466 (100 µM; Research Biochemicals, Natick, MA) to the bath
solution, and neurons were voltage-clamped at +51 mV. The aCSF
routinely contained 100 µM picrotoxin (Wako, Osaka,
Japan) and 0.5 µM strychnine (Sigma, St. Louis, MO) to
block inhibitory synaptic responses.
Records were filtered at 5 kHz and sampled at 10 kHz by an LM-12
interface (Dagan, Minneapolis, MN). The fidelity of synaptic transmission was evaluated from the number of aberrant action potentials (na) during 10 trains each,
comprising 21 stimuli and expressed as (210 na)/210. Postsynaptic responses having
a half-width >2 msec were not counted into action potentials. Values
in the text and figures are given as means ± SEM; the
significance of difference was evaluated by Welch's test or paired
t test.
Biochemistry. Messenger RNAs encoding NMDA receptor subunits
were measured by the reverse transcription-PCR (RT-PCR) method. Tissues
including the MNTB regions were trimmed from transverse brainstem
slices from five mice each at different postnatal ages, and total RNA
was extracted by using the acid guanidine phenol chloroform method. The
cDNAs were synthesized by using SuperScript II (Life
Technologies, Gaithersburg, MD) and random hexamers as primers.
Then the RT products were amplified by PCR with Taq DNA polymerase (Promega, Madison, WI). The subunit cDNAs were amplified with primers specific to the 1 subunit (Mizuta et al., 1998 ) and
primers common to the 1 and 2 subunits (Sakaguchi et al., 1997 ).
The PCR primers used for the 1 subunit were CTGGTGCTGGATAGGCCTGA and
GCTGCATCTGCTTCCTACGG, and those for the 1/2 subunits were GTGATGCTGCTCATTGTCTCTGC and CAGATGAAGGTGATGAGGCTGAG. The primer for
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was purchased from
Clontech (Palo Alto, CA). The PCR program was as follows: (1) the
initial denaturation at 95°C for 5 min; (2) 20 cycles of 95°C for
50 sec, 63°C for 50 sec, and 72°C for 50 sec for 1, 25 cycles
for 1/2, and 18 cycles for G3PDH; (3) the final elongation at 72°C
for 5 min. To ensure the specificity of this PCR method, we subcloned
PCR products into pCR2.1 plasmid and subsequently sequenced them.
Randomly sampled clones ( 1, 1/2; n = 22 and 20, respectively) contained only 1 and 1/2 subunit DNAs. Plasmids were prepared with Qiagen plasmid kits (Hilden, Germany). To measure the amount of subunit mRNA, we performed PCR amplification in the
presence of 32P-radiolabeled dCTP (1.48 MBq/ml), followed by acrylamide gel electrophoresis and quantification
with a BAS2000 image analyzer (Fuji Film, Tokyo, Japan). In cochlear
ablation experiments, mRNAs were quantified with FluoroImager 595 (Molecular Dynamics, Sunnyvale, CA) after the gels were stained with
SYBR GreenI (Molecular Probes, Eugene, OR). In these experiments PCR
cycles were 20 for 1, 26 for , and 19 for G3PDH.
The amount of NMDA receptor subunit protein expressed in the MNTB
region was examined at different postnatal ages by immunoblotting. The
tissues trimmed for the MNTB regions from brainstem slices of 10 mice
were pooled and homogenized with 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 2 mM EDTA, 2 µg/ml
leupeptin, and 2 µg/ml pepstatin A. The homogenates were fractionated
on an SDS-polyacrylamide gel (6%), electroblotted onto Immobilon-P
membrane (Millipore, Bedford, MA), and reacted with an anti- 1
subunit antibody (Chemicon, Temecula, CA) or with anti- 1 or
anti- 2 subunit antibodies (generous gift from Drs. Mishina and Mori,
University of Tokyo, Japan). The antibodies were visualized with a
secondary antibody labeled with HRP (Promega) and an ECL Western
detection kit (Amersham Japan, Tokyo, Japan). The amount of receptors
was quantified with a densitometer (GS-700, Bio-Rad, Hercules, CA).
Cochlear ablation. Bilateral cochlear ablation was made at
P7. Mice were anesthetized with diethyl ether, and an incision was made
just behind the pinna. Under a dissecting microscope the middle ear
cavity was exposed and the bony wall of the cochlea was identified.
Then the cochlea was destroyed carefully by using a needle. In control
sham-operated mice only incisions behind the pinna were made. After
suturing the incision, we placed the animals on a heating pad. After
recovery from anesthesia the pups were returned to the original cage
and reared until P13. At P13 the auditory brainstem response (ABR) was
measured under pentobarbital anesthesia by using four subcutaneous
electrodes: two electrodes inserted under both ears, one at the top of
skull, and a ground electrode inserted under the back. A 5 kHz click
sound (duration, 1 msec) of 85 dB in intensity was given to the mice
through an earphone. The sound intensity through the earphone was
calibrated by a sound pressure meter (NL-04, Rion). The ABR was
amplified and averaged with bio-amplifier DAM80 (World Precision
Instruments, Everett, WA) and pClamp 8 (Axon Instruments). Control and
test mice were derived from the same litter.
 |
RESULTS |
Maturation of high-fidelity transmission at the calyx of
Held synapse
We recorded EPSPs associated with action potentials from a
principal neuron in the MNTB in P7 mice after the extracellular stimulation of presynaptic bushy cell axons. When the stimulation frequency was lower than 10 Hz, postsynaptic cells fired in response to
inputs in a one-to-one manner (Fig.
1A, at 26-27°C).
However, at a frequency higher than 20 Hz, depolarization caused by
summed tails of EPSPs triggered aberrant firings. At 100 Hz, in a
subset of cells in P7 mice, action potentials eventually were blocked (Fig. 1A,B), as reported at the same synapse in P6
rats (Taschenberger and Gersdorff, 2000 ). Thus synaptic transmission at
high frequency was inaccurate in P7 mice. In P15 mice, however,
transmission was more precise, with fewer aberrant firings, and action
potentials no longer were blocked during 100 Hz stimulation (Fig.
1A,B; see also Taschenberger and Gersdorff, 2000 ). At
P27, neither the aberrant firing nor the block was observed at 100 Hz
(Fig. 1B) or at a higher frequency up to 400 Hz (data
not shown). The fidelity of transmission evaluated from the number of
aberrant firings (see Materials and Methods) was higher at a lower
frequency of stimulation and in more mature animals for a given
frequency of stimulation (Fig. 1C).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 1.
Postnatal development of high-fidelity synaptic
transmission. A, Postsynaptic responses evoked by a
train of high-frequency stimuli (21 pulses at 10, 20, 50, or 100 Hz) in
mice at different postnatal periods (P7, P15, P27). Dots
and asterisks indicate the timing of stimuli and
aberrant action potentials, respectively, in this figure and in Figure
3. Resting potentials were 71 mV (P7), 69 mV (P15), and 72 mV
(P27), respectively. B, Number of postsynaptic action
potentials for 210 stimuli at 100 Hz at different postnatal periods. Of
27 cells, 16 cells showed a block and 8 cells showed aberrant firings
at P7. Aberrant firings were found in 8 of 17 cells at P15 and none in
10 cells at P27. C, Developmental increase in the
fidelity of transmission. "Fidelity" in the ordinate is defined as
(210 na)/210, where
na represents the number of aberrant spikes
during 210 stimuli (for details, see Materials and Methods). Data
points and error bars in this and the following figures indicate
means ± SEM. Each data point was derived from 8-27 cells. In P7
mice the data of action potential block are excluded from this
plot.
|
|
Pharmacological characterization of synaptic responses
To determine mechanisms underlying the development of
high-fidelity transmission, we first characterized the pharmacological properties of the postsynaptic responses. Application of the AMPA receptor antagonist GYKI 52466 (100 µM) in large part
suppressed EPSPs to levels below the action potential threshold, but a
slow component remained unblocked (Fig.
2A). This component was
abolished by the additional application of the NMDA receptor antagonist D( )2-amino-5-phosphonovaleric acid
(D-APV; 50 µM). The
effect of GYKI was reversible after wash out (data not shown). Under voltage clamp the AMPA and NMDA receptor components of EPSCs also were
recorded in isolation (Fig. 2B). At a holding
potential of 79 mV, large EPSCs typical of those derived from the
calyceal nerve terminal (Forsythe and Barnes-Davies, 1993 ) were
recorded. These EPSCs were blocked almost completely (>99%) by GYKI
(100 µM; Fig. 2B). Thus the
excitatory transmission at this calyceal synapse is mediated by both
AMPA and NMDA receptors, but to a much lesser extent by kainate
receptors. Although the NMDA component of EPSCs was not detected at the
holding potential of 79 mV in the presence of GYKI, presumably
because of voltage-dependent Mg2+-block,
it was revealed as an outward current at +51 mV. These currents were
abolished by D-APV (50 µM), confirming that they were mediated by NMDA
receptors.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 2.
Pharmacological properties of EPSPs and EPSCs
recorded from MNTB neurons. A, Action potentials
triggered by EPSPs elicited by extracellular stimulation of an MNTB
principal neuron at P7. GYKI 52466 (100 µM) abolished
action potentials but did not block the slow EPSP component. This
component was abolished by the additional application of
D-APV (50 µM). Averaged records before
(Control) and during applications of GYKI and
GYKI + D-APV are superimposed. The resting potential was
67 mV. B, Left, EPSCs evoked at the holding potential
of 79 mV under voltage clamp in another MNTB neuron at P7. EPSCs were
blocked by GYKI 52466 (100 µM; before and after GYKI
records are superimposed). Right, In the presence of
GYKI, EPSCs appeared as outward current at the holding potential of +51
mV. These EPSCs were abolished by D-APV (50 µM; superimposed).
|
|
Negative contribution of NMDA receptors to
high-fidelity transmission
Because the duration of synaptic potentials is very short in
mature animals, temporal summation occurs only over short times; therefore, the firing patterns of auditory nerve inputs are preserved (Oertel, 1997 ). In immature mice, however, aberrant firings and the
block of action potentials occur as a result of the summed EPSPs. Given
that the slow component of EPSPs is mediated by NMDA receptors (Fig.
2), we examined whether NMDA receptors might be responsible for the
inaccurate transmission in immature mice. After bath application of
D-APV (50 µM), 100 Hz stimulation no longer
caused aberrant firings or blocked action potentials (Fig. 3A). Thus
D-APV converted low-fidelity transmission in
immature mice into high-fidelity transmission (Fig. 3C). In
the presence of D-APV, however, EPSPs still
summed to produce a sustained depolarization in P7 and P15 mice, but
not in P27 mice (Fig. 3A). During 200 Hz stimulation in P7
mice, this depolarization exceeded the action potential threshold and
produced aberrant firings (data not shown). Thus, there seems to be a
factor or factors in addition to NMDA receptors that can interfere with
the fidelity of transmission.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3.
Gain in fidelity of transmission by blocking NMDA
receptors. A, Postsynaptic responses during a train of
100 Hz stimuli in MNTB neurons at different postnatal periods. In
immature mice D-APV (50 µM) abolished
aberrant firings and relieved action potentials from block, thereby
making synaptic transmission accurate. Resting potentials were 69 mV
(P7), 72 mV (P15), and 67 mV (P27). B, A similar
effect of D-APV on postsynaptic responses at 35°C in a P7
mouse. Resting potential was 66 mV. C, Summary of the
effects of D-APV on the fidelity of transmission at 100 Hz
(n = 10-11) before ( ) and after ( )
D-APV application at 26-27°C. D-APV had no
effects on synaptic fidelity in P27 mice.
|
|
We next examined whether the above results observed at 26-27°C
were reproducible at a physiological temperature in P7 mice. At 35°C,
100 Hz stimulation induced many aberrant firings, but action potentials
no longer were blocked (in all 13 cells that were examined), presumably
because of faster kinetics of EPSPs at higher temperature (Fig.
3B). After the application of D-APV (50 µM), aberrant firings were eliminated
completely, resulting in accurate synaptic transmission as observed at
26-27°C. Similar results also were obtained after removing
picrotoxin and strychnine from superfusates (at 35°C; data not
shown), suggesting that inhibitory inputs are not involved in the
fidelity of transmission at this synapse.
Developmental changes of NMDA-EPSCs and AMPA-EPSCs
Given that NMDA receptors negatively contribute to the fidelity of
transmission and that the high-fidelity transmission is acquired
through development, we examined whether the amplitude of NMDA-EPSCs
might decrease with development at this calyceal synapse. NMDA-EPSCs
were recorded at a holding potential of +51 mV in the presence of the
AMPA/kainate receptor antagonist CNQX (20 µM), which
blocked EPSCs almost completely at 79 mV (data not shown). The mean
amplitude of NMDA-EPSCs was large until P11 but diminished steeply
thereafter (Fig. 4). As mice matured,
NMDA-EPSCs became faster, particularly in their decay time kinetics, as
reported at other synapses (Carmignoto and Vicini, 1992 ; Hestrin,
1992 ), partly because of the 2-to- 1 subunit switch (Takahashi et
al., 1996 ; Flint et al., 1997 ; Cathala et al., 2000 ).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 4.
Developmental changes in NMDA-EPSCs.
A, Developmental decrease in the mean amplitude of
NMDA-EPSCs recorded at +51 mV holding potential in the presence of CNQX
(20 µM). Each data point was derived from 15-23 MNTB
neurons. Sample traces are averaged NMDA-EPSCs (10 events) in P7, P13,
and P27 mice, superimposed (top column), and shown with
their peak amplitudes normalized and aligned at the stimulus artifact
(bottom column).
|
|
In contrast to NMDA-EPSCs, the mean amplitude of AMPA-EPSCs increased
with postnatal development (Fig.
5A), although AMPA-EPSCs in
rats are reported to remain constant throughout development (Iwasaki
and Takahashi, 2000 ; Taschenberger and Gersdorff, 2000 ). As mice
matured, both the rise time (10-90%) and decay time constant of
AMPA-EPSCs became faster (Fig. 5B). These changes occurred between P5 and P14 in mice, just as reported in rats (Taschenberger and
Gersdorff, 2000 ), and reached minimal levels thereafter. The amplitude
and kinetics of AMPA-EPSCs might be distorted if the voltage clamp of
cells was inadequate, and these distortions must be greater for larger
EPSCs in more mature animals. Thus the developmental changes in the
amplitude and kinetics of AMPA-EPSCs might be even greater than they
looked.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5.
Developmental changes in AMPA-EPSCs.
A, Developmental increase in the mean amplitude of
AMPA-EPSCs recorded at 79 mV holding potential (n = 15-23). After EPSCs were recorded, CNQX (20 µM) was
applied, and the small CNQX-resistant component was subtracted for the
data plotted in this graph. The superimposed sample traces are averaged
EPSCs (10 events) at 79 mV holding potential in P7, P13, and P27 mice
aligned at the stimulus artifact. Note that the synaptic latency is
shorter at more mature mice. B, The 10-90% rise time
and the decay time constant of AMPA-EPSCs at different postnatal age.
The decay time could be fit adequately by a single exponential function
for the data presented in the time plot. The superimposed sample traces
are AMPA-EPSCs at P7, P13, and P27 normalized in amplitude and aligned
at their peak.
|
|
Developmental changes in the expressions of mRNAs and proteins of
NMDA receptor subunits
We next examined developmental changes in the NMDA receptors in
the MNTB region. Expressions of mRNAs encoding 1 (equivalent to NR1
in rat) and 1 (NR2A) plus 2 (NR2B) subunits in the MNTB region
were measured at different postnatal days by using mRNA encoding the
housekeeping enzyme G3PDH as a standard. Messenger RNAs encoding 1
subunits as well as those encoding 1/2 subunits decreased with
development, with the slope of decrease of the latter being steeper
(Fig. 6A,B).
Expressions of NMDA receptor subunit proteins also were examined by
using antibodies specific to each subunit (Fig. 6C,D).
Similar to the transcripts, 1, 1, and 2 subunit proteins
decreased with development (Fig. 6C,D). These results
suggest that the developmental decrease in the amplitude of NMDA-EPSCs
is caused by the decrease in the expression of NMDA receptors rather
than by their redistribution. A steeper decline of 1 protein
compared with its transcript may suggest a post-transcriptional regulation of 1 subunit, as reported for cultured cell lines (Sucher
et al., 1993 ; Boeckman and Aizenman, 1994 ).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 6.
Developmental changes in the expression of NMDA
receptor subunit mRNAs and proteins. A, mRNAs encoding
1, 1 and 2, and G3PDH were detected by RT-PCR, using primers
specific for 1, common to 1 and 2, or specific for G3PDH.
B, Relative amounts of mRNA encoding 1 ( ) and
1/2 ( ) expressed at different postnatal days. Amounts of mRNA
relative to G3PDH mRNA were measured and normalized to those at P5.
Mean values were derived from three experiments. C,
Immunoblots of 1, 1, and 2 subunit proteins at different
postnatal days. D, Relative amounts of 1 ( ), 1
( ), and 2 ( ) protein expressed at different postnatal days,
deduced from immunoreactivity (from 3 experiments), and normalized to
the values at P5.
|
|
Activity-dependent downregulation of NMDA receptor expression
Steep declines both in the amplitude of NMDA-EPSCs (see Fig. 4)
and in the NMDA receptor expression (Fig. 6D) were
observed during the second postnatal week when mice begin to detect
sound (Mikaelian and Ruben, 1964 ; Kikuchi and Hilding, 1965 ). Using the
auditory brainstem response (ABR) as an index, we examined when the
mice of the strain used in the present experiments begin to detect
sound (Fig. 7A). Until P9, no
ABR was observed in response to a "click" of 85 dB in intensity
(n = 20 mice). At P10 ~20% of mice showed positive
ABR to the click. The percentage increased steeply with postnatal days,
and at P13 all mice showed positive ABR. We then addressed the question
of whether auditory activity might downregulate postsynaptic NMDA
receptor expression by performing bilateral cochlear ablations in P7
mice. Bilateral ablation was preferred to unilateral ablation because
the latter induces reorganization of the superior olivary complex
(Russell and Moore, 1995 ). Successful cochlear ablation was confirmed
at P13 by the absence of ABR to an 85 dB click (Fig. 7A).
The ABR was normal in sham-operated mice. Whole-cell recordings were
made from MNTB neurons in P14-P16 mice with their hearing activity
ablated (Fig. 7B). In such mice the fidelity of synaptic
transmission during 100 Hz stimulation (ratio, 0.73 ± 0.06;
n = 10) was significantly lower than that of
sham-operated controls (0.98 ± 0.001; n = 10;
p < 0.01, Welch's test). Also, in operated mice the
mean amplitude of NMDA-EPSC (3.6 ± 0.6 nA; n = 10) was significantly larger than that of sham-operated control mice
(1.9 ± 0.2 nA; n = 10; p < 0.05)
(Fig. 7C). Furthermore, the expression of mRNAs encoding
NMDA receptor 1/2 subunits in the MNTB region was significantly
higher in the mice with cochlear ablation than in sham-operated
controls (p < 0.02, paired t test), although the difference was not significant for the subunit (p > 0.1; Fig. 7D). Taken together,
these results suggest that auditory activity downregulates postsynaptic
NMDA receptors, thereby contributing to the establishment of the
high-fidelity transmission through postnatal development.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 7.
Effects of bilateral cochlear ablation on synaptic
fidelity and NMDA receptor expression. A, Percentage of
mice showing positive ABR to 85 dB clicks. Inset records
are ABRs from sham-operated ( ) and operated P13 mice ( ; bilateral
cochlea ablated at P7) derived from the same litter. Numbers of
untreated mice ( )were 10 for each period and 40 and 39, respectively, for sham-operated and operated mice. B,
Synaptic fidelity during 100 Hz stimulation in operated and
sham-operated control mice at P14-P16 (n = 10 mice
each). C, Mean amplitude of NMDA-EPSCs in P14-P16 mice
(n = 10). D, Amounts of 1/2 mRNA
(left) and 1 mRNA (right) expressed in
the MNTB region in sham-operated and operated mice at P14-P16.
Ordinates indicate the amount of mRNA encoding NMDA receptor subunits
relative to G3PDH mRNA. Data measured from the same experiments (using
5 mice each) are connected with lines (4 experiments).
Difference was significant (p < 0.02, paired t test) for 1/2 mRNAs but was not significant
for 1 mRNAs (p > 0.1).
|
|
 |
DISCUSSION |
Establishment of high-fidelity synaptic transmission at the
calyx-MNTB synapse
Mature principal neurons in the MNTB can follow inputs at
frequencies as high as several hundred Hertz (Guinan and Li, 1990 ; Wu
and Kelly, 1993 ) and above 500 Hz for a short train (Wu and Kelly,
1993 ; Taschenberger and von Gersdorff, 2000 ). In contrast, in immature
mice the synaptic transmission in response to high-frequency inputs was
inaccurate mainly because of the summed effect of large NMDA components
in EPSPs, which triggered aberrant firings or blocked action potential
generation. As animals matured, the expression of postsynaptic NMDA
receptors decreased, thereby supporting the acquisition of
high-fidelity synaptic transmission. The developmental speeding in the
kinetics of NMDA-EPSCs additionally may contribute to this functional
maturation. Contrary to our results, it recently has been reported that
D,L-APV (50 µM) does not affect
the number of action potentials generated during 100 Hz stimulation at
the rat calyceal synapse in P6 rats at 21-23°C (Taschenberger and von Gersdorff, 2000 ). In addition to differences in species (rat vs
mice) and postnatal days (P6 vs P7), our experiments were performed at
higher temperature (26-27°C) and with the NMDA receptor blocker at a
concentration (D-APV, 50 µM) sufficient to
block completely the NMDA-EPSPs in P7 mice. Thus EPSPs recorded in our
experiments in the presence of the NMDA receptor blocker might be
shorter than those recorded in rats, therefore resulting in higher
synaptic fidelity.
After NMDA receptors were blocked, stimulation at frequencies higher
than 200 Hz still caused aberrant firings in P7 mice, but not in P27
mice, suggesting that additional factors might be involved in the
development of synaptic fidelity. One important factor may be the
kinetics of AMPA-EPSCs, which undergo developmental speeding, thereby
possibly reducing the sustained depolarization during high-frequency
transmission. At the calyx of Held synapse, repetitive stimulation
causes a synaptic depression (von Gersdorff et al., 1997 ), and the
magnitude of depression decreases as the animals mature (Iwasaki and
Takahashi, 2000 ; Taschenberger and von Gersdorff, 2000 ). This
additionally may contribute to the developmental acquisition of
fidelity in transmission. Developmental changes in the
voltage-dependent conductance and passive membrane properties of
postsynaptic cells also may contribute to the maturation of
high-fidelity transmission. It has been suggested that a high-threshold potassium conductance in MNTB neurons contributes to a high-fidelity transmission via rapid repolarization of action potentials (Brew and
Forsythe, 1995 ). It remains to be seen whether the expression of this
potassium conductance changes with postnatal development.
Activity-dependent downregulation of NMDA receptors
Mice begin to detect sound between P10 and P12, during which time
the NMDA component of EPSCs rapidly decreases. Cochlear ablation before
this critical period attenuated the developmental diminishment of
NMDA-EPSCs and interfered with the acquisition of high-fidelity
synaptic transmission. These results suggest that the developmental
downregulation of postsynaptic NMDA receptors and resultant acquisition
of high-fidelity synaptic transmission are dependent on acoustic
activity, although other factors secondary to neuronal degeneration of
afferent fibers might not be excluded from the present experiments. A
steep decrease in the mean amplitude of NMDA-EPSCs was observed soon
after the hearing onset. However, NMDA receptor subunit proteins in the
MNTB regions begin to decrease earlier than this critical period,
suggesting that there may be additional downregulatory mechanisms,
particularly for the extrasynaptic NMDA receptors.
Similar to our results in mice auditory brainstem, the NMDA component
of visual responses in the developing cat visual cortex decreases as
the animals mature (Tsumoto et al., 1987 ; Fox et al., 1989 ). Also, this
decrease is attenuated in dark-reared animals (Fox et al., 1991 ). In
the developing rat visual cortex, however, the mean amplitude of
NMDA-EPSCs does not change, although their decay time kinetics become
faster with development in an activity-dependent manner (Carmignoto and
Vicini, 1992 ). It has been suggested that the developmental decrease in
the NMDA component of visual responses in cats might result from the
acceleration of synaptic currents. In contrast, in the mice auditory
brainstem the mean amplitude of NMDA-EPSCs did decrease with
development, and cochlear ablation attenuated this decrease. In the cat
visual cortex the NR1 ( ) subunit immunoreactivity decreases with
development, but this change is not attenuated by dark rearing
(Catalano et al., 1997 ). In the mice auditory brainstem, cochlear
ablations had no effect on subunit mRNA but significantly
attenuated the developmental decrease of subunit mRNA. The subunits in combination with the subunit are essential for the
activity of functional NMDA receptors (Meguro et al., 1992 ; Boeckman
and Aizenman, 1994 ; Kutsuwada et al., 1996 ). Therefore, a developmental
decrease in the subunit and attenuation of this decrease by
cochlear ablations can explain the concomitant changes in the amplitude
of NMDA-EPSCs.
During the early period of ontogeny NMDA receptors contribute to
neuronal migration (Komuro and Rakic, 1993 ; Farrant et al., 1994 ) and
functional synaptic formation (Durand et al., 1996 ). Thereafter, at the
calyx of Held synapse, NMDA receptors undergo a developmental
downregulation partly via auditory activity, thereby differentiating
this synapse into the high-fidelity one that is suitable for the sound
source localization.
 |
FOOTNOTES |
Received Dec. 27, 2000; revised Feb. 14, 2001; accepted Feb. 27, 2001.
This study was supported by the Research for the Future Program
of The Japan Society for the Promotion of Science. We thank Katsunori Kobayashi, David Saffen, and Tetsuhiro Tsujimoto for discussion and comments on this manuscript. We are also grateful to
Masayoshi Mishina and Hisashi Mori for providing us with anti- subunit antibodies and to Yasuhiro Kakazu and Junichi Nabekura for
technical instructions on cochlear ablation.
K.F. and M.O. contributed equally to this work.
Correspondence should be addressed to Tomoyuki Takahashi, Department of
Neurophysiology, University of Tokyo Faculty of Medicine, Tokyo
113-0033, Japan. E-mail: ttakahas-tky{at}umin.u-tokyo.ac.jp.
 |
REFERENCES |
-
Boeckman FA,
Aizenman E
(1994)
Stable transfection of the NR1 subunit in Chinese hamster ovary cells fails to produce a functional N-methyl-D-aspartate receptor.
Neurosci Lett
173:189-192[Web of Science][Medline].
-
Brew HM,
Forsythe ID
(1995)
Two voltage-dependent K+ conductances with complementary functions in postsynaptic integration at a central auditory synapse.
J Neurosci
15:8011-8022[Abstract].
-
Carmignoto G,
Vicini S
(1992)
Activity-dependent decrease in NMDA receptor responses during development of the visual cortex.
Science
258:1007-1011[Abstract/Free Full Text].
-
Catalano SM,
Chang CK,
Shatz CJ
(1997)
Activity-dependent regulation of NMDAR1 immunoreactivity in the developing visual cortex.
J Neurosci
17:8376-8390[Abstract/Free Full Text].
-
Cathala L,
Misra C,
Cull-Candy S
(2000)
Developmental profile of the changing properties of NMDA receptors at cerebellar mossy fiber-granule cell synapses.
J Neurosci
20:5899-5905[Abstract/Free Full Text].
-
Durand GM,
Kovalchuk Y,
Konnerth A
(1996)
Long-term potentiation and functional synapse induction in developing hippocampus.
Nature
381:71-75[Medline].
-
Farrant M,
Feldmeyer D,
Takahashi T,
Cull-Candy SG
(1994)
NMDA receptor channel diversity in the developing cerebellum.
Nature
368:335-339[Medline].
-
Flint AC,
Maisch US,
Weishaupt JH,
Kriegstein AR,
Monyer H
(1997)
NR2A subunit expression shortens NMDA receptor synaptic currents in developing neocortex.
J Neurosci
17:2469-2476[Abstract/Free Full Text].
-
Forsythe ID,
Barnes-Davies M
(1993)
The binaural auditory pathway: membrane currents limiting multiple action potential generation in the rat medial nucleus of the trapezoid body.
Proc R Soc Lond [Biol]
251:143-150[Medline].
-
Fox K,
Sato H,
Daw N
(1989)
The location and function of NMDA receptors in cat and kitten visual cortex.
J Neurosci
9:2443-2454[Abstract].
-
Fox K,
Daw N,
Sato H,
Czepita D
(1991)
Dark-rearing delays the loss of NMDA-receptor function in kitten visual cortex.
Nature
350:342-344[Medline].
-
Guinan Jr JJ,
Li RY-S
(1990)
Signal processing in brainstem auditory neurons which receive giant endings (calyces of Held) in the medial nucleus of the trapezoid body of the cat.
Hear Res
49:321-334[Web of Science][Medline].
-
Held H
(1893)
Die centrale Gehörleitung.
Arch Anat Physiol Anat Abt
17:201-248.
-
Hestrin S
(1992)
Developmental regulation of NMDA receptor-mediated synaptic currents at a central synapse.
Nature
357:686-689[Medline].
-
Iwasaki S,
Takahashi T
(1998)
Developmental changes in calcium channel types mediating synaptic transmission in rat auditory brainstem.
J Physiol (Lond)
509:419-423[Abstract/Free Full Text].
-
Iwasaki S,
Takahashi T
(2000)
Developmental changes in synaptic efficacy at the medial nucleus of trapezoid body in rats.
Jpn J Physiol (Lond) Suppl
50:S135.
-
Kandler K,
Friauf E
(1993)
Pre- and postnatal development of efferent connections of the cochlear nucleus in the rat.
J Comp Neurol
328:161-184[Web of Science][Medline].
-
Kikuchi K,
Hilding D
(1965)
The development of the organ of Corti in the mouse.
Acta Otolaryngol
60:207-222[Medline].
-
Komuro H,
Rakic P
(1993)
Modulation of neuronal migration by NMDA receptors.
Science
260:95-97[Abstract/Free Full Text].
-
Kutsuwada T,
Sakimura K,
Manabe T,
Takayama C,
Katakura N,
Kushiya E,
Natsume R,
Watanabe M,
Inoue Y,
Yagi T,
Aizawa S,
Arakawa M,
Takahashi T,
Nakamura Y,
Mori H,
Mishina M
(1996)
Impairment of suckling response, trigeminal neuronal pattern formation, and hippocampal LTD in NMDA receptor
2 subunit mutant mice.
Neuron
16:333-344[Web of Science][Medline]. -
Meguro H,
Mori H,
Araki K,
Kushiya E,
Kutsuwada T,
Yamazaki M,
Kumanishi T,
Arakawa M,
Sakimura K,
Mishina M
(1992)
Functional characterization of a heteromeric NMDA receptor channel expressed from cloned cDNAs.
Nature
357:70-74[Medline].
-
Mikaelian D,
Ruben RJ
(1964)
Development of hearing in the normal CBA-J mouse.
Acta Otolaryngol
59:451-461.
-
Mizuta I,
Katayama M,
Watanabe M,
Mishina M,
Ishii K
(1998)
Developmental expression of NMDA receptor subunits and the emergence of glutamate neurotoxicity in primary cultures of murine cerebral cortical neurons.
Cell Mol Life Sci
54:721-725[Web of Science][Medline].
-
Oertel D
(1997)
Encoding of timing in the brain stem auditory nuclei of vertebrates.
Neuron
19:959-962[Web of Science][Medline].
-
Russell FA,
Moore DR
(1995)
Afferent reorganization within the superior olivary complex of the gerbil: development and induction by neonatal, unilateral cochlear removal.
J Comp Neurol
352:607-625[Web of Science][Medline].
-
Sakaguchi T,
Okada M,
Kuno M,
Kawasaki K
(1997)
Dual mode of N-methyl-D-aspartate-induced neuronal death in hippocampal slice cultures in relation to N-methyl-D-aspartate receptor properties.
Neuroscience
76:411-423[Web of Science][Medline].
-
Sucher NJ,
Brose N,
Deitcher DL,
Awobuluyi M,
Gasic GP,
Bading H,
Cepko CL,
Greenberg ME,
Jahn R,
Heinemann SF,
Lipton SA
(1993)
Expression of endogenous NMDAR1 transcripts without receptor protein suggests post-transcriptional control in PC12 cells.
J Biol Chem
268:22299-22304[Abstract/Free Full Text].
-
Takahashi T,
Feldmeyer D,
Suzuki N,
Onodera K,
Cull-Candy SG,
Sakimura K,
Mishina M
(1996)
Functional correlation of NMDA receptor
subunits expression with the properties of single-channel and synaptic currents in the developing cerebellum.
J Neurosci
16:4376-4382[Abstract/Free Full Text]. -
Taschenberger H,
von Gersdorff H
(2000)
Fine-tuning an auditory synapse for speed and fidelity: developmental changes in presynaptic waveform, EPSC kinetics, and synaptic plasticity.
J Neurosci
20:9162-9173[Abstract/Free Full Text].
-
Trussell LO
(1997)
Cellular mechanisms for preservation of timing in central auditory pathways.
Curr Opin Neurobiol
7:487-492[Web of Science][Medline].
-
Tsumoto T,
Hagihara K,
Sato H,
Hata Y
(1987)
NMDA receptors in the visual cortex of young kittens are more effective than those of adult cats.
Nature
327:513-514[Medline].
-
von Gersdorff H,
Schneggenburger R,
Weis S,
Neher E
(1997)
Presynaptic depression at a calyx synapse: the small contribution of metabotropic glutamate receptors.
J Neurosci
17:8137-8146[Abstract/Free Full Text].
-
Wu SH,
Kelly JB
(1993)
Response of neurons in the lateral superior olive and medial nucleus of the trapezoid body to repetitive stimulation: intracellular and extracellular recordings from mouse brain slice.
Hear Res
68:189-201[Web of Science][Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21103342-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. A. M. Lorteije, S. I. Rusu, C. Kushmerick, and J. G. G. Borst
Reliability and Precision of the Mouse Calyx of Held Synapse
J. Neurosci.,
November 4, 2009;
29(44):
13770 - 13784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Pliss, H. Yang, and M. A. Xu-Friedman
Context-Dependent Effects of NMDA Receptors on Precise Timing Information at the Endbulb of Held in the Cochlear Nucleus
J Neurophysiol,
November 1, 2009;
102(5):
2627 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sonntag, B. Englitz, C. Kopp-Scheinpflug, and R. Rubsamen
Early Postnatal Development of Spontaneous and Acoustically Evoked Discharge Activity of Principal Cells of the Medial Nucleus of the Trapezoid Body: An In Vivo Study in Mice
J. Neurosci.,
July 29, 2009;
29(30):
9510 - 9520.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Kochubey, Y. Han, and R. Schneggenburger
Developmental regulation of the intracellular Ca2+ sensitivity of vesicle fusion and Ca2+\#8211;secretion coupling at the rat calyx of Held
J. Physiol.,
June 15, 2009;
587(12):
3009 - 3023.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nakamura, T. Yamashita, N. Saitoh, and T. Takahashi
Developmental changes in calcium/calmodulin-dependent inactivation of calcium currents at the rat calyx of Held
J. Physiol.,
May 1, 2008;
586(9):
2253 - 2261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koike-Tani, T. Kanda, N. Saitoh, T. Yamashita, and T. Takahashi
Involvement of AMPA receptor desensitization in short-term synaptic depression at the calyx of Held in developing rats
J. Physiol.,
May 1, 2008;
586(9):
2263 - 2275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Rodriguez-Contreras, J. S. S. van Hoeve, R. L. P. Habets, H. Locher, and J. G. G. Borst
Dynamic development of the calyx of Held synapse
PNAS,
April 8, 2008;
105(14):
5603 - 5608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Joshi, Y.-M. Yang, and L.-Y. Wang
Coincident Activation of Metabotropic Glutamate Receptors and NMDA Receptors (NMDARs) Downregulates Perisynaptic/Extrasynaptic NMDARs and Enhances High-Fidelity Neurotransmission at the Developing Calyx of Held Synapse
J. Neurosci.,
September 12, 2007;
27(37):
9989 - 9999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Hermann, M. Pecka, H. von Gersdorff, B. Grothe, and A. Klug
Synaptic Transmission at the Calyx of Held Under In Vivo-Like Activity Levels
J Neurophysiol,
August 1, 2007;
98(2):
807 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nakamura and T. Takahashi
Developmental changes in potassium currents at the rat calyx of Held presynaptic terminal
J. Physiol.,
June 15, 2007;
581(3):
1101 - 1112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Erazo-Fischer, J. Striessnig, and H. Taschenberger
The Role of Physiological Afferent Nerve Activity during In Vivo Maturation of the Calyx of Held Synapse
J. Neurosci.,
February 14, 2007;
27(7):
1725 - 1737.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-M. Yang and L.-Y. Wang
Amplitude and Kinetics of Action Potential-Evoked Ca2+ Current and Its Efficacy in Triggering Transmitter Release at the Developing Calyx of Held Synapse
J. Neurosci.,
May 24, 2006;
26(21):
5698 - 5708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Hoffpauir, J. L. Grimes, P. H. Mathers, and G. A. Spirou
Synaptogenesis of the calyx of Held: rapid onset of function and one-to-one morphological innervation.
J. Neurosci.,
May 17, 2006;
26(20):
5511 - 5523.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. I. Daw, N. V. Bannister, and J. T. R. Isaac
Rapid, activity-dependent plasticity in timing precision in neonatal barrel cortex.
J. Neurosci.,
April 19, 2006;
26(16):
4178 - 4187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Youssoufian, S. Oleskevich, and B. Walmsley
Development of a Robust Central Auditory Synapse in Congenital Deafness
J Neurophysiol,
November 1, 2005;
94(5):
3168 - 3180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koike-Tani, N. Saitoh, and T. Takahashi
Mechanisms Underlying Developmental Speeding in AMPA-EPSC Decay Time at the Calyx of Held
J. Neurosci.,
January 5, 2005;
25(1):
199 - 207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Bergsman, P. De Camilli, and D. A. McCormick
Multiple Large Inputs to Principal Cells in the Mouse Medial Nucleus of the Trapezoid Body
J Neurophysiol,
July 1, 2004;
92(1):
545 - 552.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Joshi, S. Shokralla, P. Titis, and L.-Y. Wang
The Role of AMPA Receptor Gating in the Development of High-Fidelity Neurotransmission at the Calyx of Held Synapse
J. Neurosci.,
January 7, 2004;
24(1):
183 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Cathala, S. Brickley, S. Cull-Candy, and M. Farrant
Maturation of EPSCs and Intrinsic Membrane Properties Enhances Precision at a Cerebellar Synapse
J. Neurosci.,
July 9, 2003;
23(14):
6074 - 6085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yamashita, T. Ishikawa, and T. Takahashi
Developmental Increase in Vesicular Glutamate Content Does Not Cause Saturation of AMPA Receptors at the Calyx of Held Synapse
J. Neurosci.,
May 1, 2003;
23(9):
3633 - 3638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Leao and H. Von Gersdorff
Noradrenaline Increases High-Frequency Firing at the Calyx of Held Synapse During Development by Inhibiting Glutamate Release
J Neurophysiol,
May 1, 2002;
87(5):
2297 - 2306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Joshi and L.-Y. Wang
Developmental profiles of glutamate receptors and synaptic transmission at a single synapse in the mouse auditory brainstem
J. Physiol.,
May 1, 2002;
540(3):
861 - 873.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Brenowitz and L. O. Trussell
Maturation of Synaptic Transmission at End-Bulb Synapses of the Cochlear Nucleus
J. Neurosci.,
December 1, 2001;
21(23):
9487 - 9498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Iwasaki and T. Takahashi
Developmental regulation of transmitter release at the calyx of Held in rat auditory brainstem
J. Physiol.,
August 1, 2001;
534(3):
861 - 871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Joshi and L.-Y. Wang
Developmental profiles of glutamate receptors and synaptic transmission at a single synapse in the mouse auditory brainstem
J. Physiol.,
May 1, 2002;
540(3):
861 - 873.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|