 |
 Previous Article | Next Article 
The Journal of Neuroscience, May 15, 2001, 21(10):3443-3456
Differential Expression of the Small-Conductance,
Calcium-Activated Potassium Channel SK3 Is Critical for Pacemaker
Control in Dopaminergic Midbrain Neurons
Jakob
Wolfart,
Henrike
Neuhoff,
Oliver
Franz, and
Jochen
Roeper
Medical Research Council, Anatomical Neuropharmacology Unit,
Department of Pharmacology, Oxford University, Oxford OX1 3TH, United
Kingdom
 |
ABSTRACT |
The physiological activity of dopaminergic midbrain (DA) neurons is
important for movement, cognition, and reward. Altered activity of DA
neurons is a key finding in schizophrenia, but the cellular mechanisms
have not been identified. Recently, KCNN3, a gene that encodes a member
(SK3) of the small-conductance, calcium-activated potassium (SK)
channels, has been proposed as a candidate gene for schizophrenia.
However, the functional role of SK3 channels in DA neurons is unclear.
We combined patch-clamp recordings with single-cell RT-PCR and confocal
immunohistochemistry in mouse midbrain slices to study the function of
molecularly defined SK channels in DA neurons. Biophysical and
pharmacological analysis, single-cell mRNA, and protein expression
profiling strongly suggest that SK3 channels mediate the
calcium-dependent afterhyperpolarization in DA neurons. Perforated
patch recordings of DA neurons in the substantia nigra (SN)
demonstrated that SK3 channels dynamically control the frequency of
spontaneous firing. In addition, SK3 channel activity was essential to
maintain the high precision of the intrinsic pacemaker of DA SN
neurons. In contrast, in the ventral tegmental area, DA neurons
displayed significantly smaller SK currents and lower SK3 protein
expression. In these DA neurons, SK3 channels were not involved in
pacemaker control. Accordingly, they discharged in a more irregular
manner compared with DA SN neurons. Thus, our study shows that
differential SK3 channel expression is a critical molecular mechanism
in DA neurons to control neuronal activity. This provides a cellular
framework to understand the functional consequences of altered SK3
expression, a candidate disease mechanism for schizophrenia.
Key words:
afterhyperpolarization; dopamine; substantia nigra; A9; ventral tegmental area (VTA); A10; schizophrenia; single-cell RT-PCR; confocal immunohistochemistry
| |
INTRODUCTION |
Different subpopulations of
dopaminergic (DA) midbrain neurons have been implicated in important
brain functions, such as voluntary movement, working memory, and reward
(Goldman-Rakic, 1999 ; Kitai et al., 1999; Spanagel and Weiss, 1999).
They are also closely involved in the etiology of neuropsychiatric
diseases, including schizophrenia (Verhoeff, 1999; Svensson, 2000) and
Parkinson's disease (Dunnett and Bjorklund, 1999). Thus, it is of
great interest to understand the molecular mechanisms that control
electrical activity and neurotransmitter release in DA midbrain neurons
and to define the coexpression of ion channel genes that orchestrate their excitability. Dopaminergic neurons, recorded in vivo,
discharge either in a single-spike pacemaker mode, in a burst-firing
pattern, or show irregular firing (Wilson et al., 1977; Sanghera et
al., 1984; Grace and Bunney, 1984a,b). However, in in vitro
brain slices, DA neurons display regular, low-frequency pacemaker
activity that is generated by intrinsic membrane properties (Sanghera
et al., 1984; Kita et al., 1986; Grace and Onn, 1989; Lacey et al.,
1989; Kang and Kitai, 1993). The pacemaker duty cycle is initiated by a
slow depolarization to threshold followed by a single, broad action
potential (AP). The calcium influx that occurs during the AP,
activates, among others, small-conductance, calcium-activated potassium
(SK) channels (Blatz and Magleby, 1986; Kohler et al., 1996; Vergara et
al., 1998; Bond et al., 1999), which in turn generate a large
afterhyperpolarization (AHP) (Shepard and Bunney, 1991; Nedergaard et
al., 1993; Sah, 1996). This AHP dominates the first part (50-200 msec)
of the interspike interval and is apamin-sensitive (Shepard and Bunney,
1991; Ping and Shepard, 1996). The rebound from the AHP initiates
another slow depolarization and completes the pacemaker duty cycle.
Voltage-gated calcium channels play an important role in the
AP-mediated activation of SK channels in DA neurons (Nedergaard et al.,
1993; Mercuri et al., 1994; Shepard and Stump, 1999). However, they can
also be activated by calcium-mobilizing, metabotropic neurotransmitter receptors (Fiorillo and Williams, 1998, 2000) or by release of calcium
from intracellular calcium stores (Seutin et al., 1998, 2000).
The molecular composition of SK channels in identified DA midbrain
neurons has not been defined. Recent in situ hybridization studies have demonstrated that mRNA encoding for SK3, one member of the
SK family of four related genes (SK1-SK4) (Bond et al., 1999), is
highly abundant in DA midbrain nuclei (Kohler et al., 1996; Stocker and
Pedarzani, 2000). However, it is unclear whether distinct DA midbrain
neuron subpopulations possess variable molecular repertoires and/or
densities of their SK channels. Indeed, quantitative autoradiography
has indicated significant differences in the density of apamin binding
sites between the substantia nigra (SN) (A9) and the ventral
tegmental area (VTA) (A10) (Mourre et al., 1984). Heterogenous
expression of SK channels in distinct DA midbrain neurons might
underlie, in part, the functional differences that have been observed
between VTA and SN neurons (Grenhoff et al., 1988). In addition,
differential SK expression could explain the variable spectrum of
effects that have been reported when pharmacologically targeting SK
channels in DA midbrain neurons (Shepard and Bunney, 1988, 1991; Gu et
al., 1992).
| |
MATERIALS AND METHODS |
Slice preparation. Procedures involving animals were
conducted in accordance with the Animals (Scientific Procedures) Act, 1986 (UK), and with the Society for Neuroscience policy on the use of
animals in research. C57BL/6J mice (10-14 postnatal days old; Charles
River, Margate, UK) were killed by cervical dislocation. Brains were
removed quickly, immersed in ice-cold solution, and then blocked for
slicing. Thin (250 µm) coronal midbrain slices were cut with a
Vibroslice (Campden Instruments, London, UK) while being bathed in an
ice-cold artificial CSF (ACSF) containing (in mM): 125 NaCl, 25 NaHCO3,
2.5 KCl, 1.25 NaH2PO4, 2 CaCl2, 2 MgCl2, and 25 glucose, bubbled with a mixture of 95% O2 and
5% CO2. After sectioning, midbrain slices were
maintained submerged in a holding chamber filled with gassed ACSF and
allowed to recover for >30 min at room temperature (22-24°C) before
the experiment. Midbrain slices containing a clearly defined substantia
nigra pars compacta at the level of the rostral interpeduncularis
nucleus and the caudal mammillary nucleus (corresponding to levels 2 and 3 in Nelson et al. (1996) were used for the experiments.
Electrophysiological recordings and data analysis. For
patch-clamp recordings, midbrain slices were transferred to a chamber and continuously perfused at 2-4 ml/min with ACSF bubbled with a
mixture of 95% O2 and 5%
CO2 at room temperature (22-24°C). Patch
pipettes were pulled from borosilicate glass (GC150TF/F; Clark,
Reading, UK) with tip resistances between 1.7 and 5 M . Patch
pipettes were filled with internal solution containing (in mM): 150 K-MeSO4 (KMe), 2 HEPES, and 0.1 EGTA, pH
7.3 (280-300 mOsm). A low level of the calcium buffer EGTA and
methylsulphate (KMe) instead of gluconate were used to preserve
Ca-dependent K currents during whole-cell recordings (Zhang et al.,
1994). For single-cell PCR experiments, a high potassium chloride
pipette solution (KCl) was used containing (in
mM): 140 KCl, 5 HEPES, 0.1 EGTA, and 3 MgCl2, pH 7.3. For gramicidin-perforated
patch-clamp recordings (Akaike, 1996), the patch pipette was tip-filled
with KCl solution, and back-filled with gramicidin-containing KCl
solution (20-50 µg/ml). For cell filling at the end of
perforated-patch experiments, we converted the configuration to
standard whole-cell by gentle suction monitored by changes in
capacitative transients in voltage-clamp mode, filled the cell
for 2 min, and removed the pipette via the outside configuration.
Recordings were made from neurons visualized by infrared differential
interference contrast video microscopy with a Newvicon camera (C2400;
Hamamatsu, Hamamatsu City, Japan) mounted to an upright microscope
(Axioskop FS; Zeiss, Oberkochen, Germany) (Stuart et al., 1993).
Recordings were performed in current-clamp and voltage-clamp mode using
an EPC-9 patch-clamp amplifier (Heka Elektronik, Lambrecht, Germany). Series resistance was continuously monitored: uncompensated values ranged between 5 and 10 M for single-cell PCR experiments and between 10 and 30 M for the other standard whole-cell experiments. The program package Pulse+pulsefit (Heka Elektronik) was used for data
acquisition and analysis. Records were digitized at 2-5 kHz and
filtered with low-pass filter (Bessel characteristic of 1 kHz cutoff
frequency). For extracellular local (<50 µm) application of drugs,
cells were perfused at a flow rate of 50-100 µl/min under visual
control using a quartz pipette (0.25 mm inner diameter) attached
to a second manipulator and a syringe pump system (World Precision
Instruments, Sarasota, FL). Switching between control and
drug-containing solutions was controlled by an automated application system (AutoMate Scientific, Oakland, CA). Drugs were diluted in a
solution containing (in mM): 10 HEPES, 145 NaCl,
2.5 KCl, 2 CaCl2, 2 MgCl2,
and 25 glucose, pH 7.4. Lipophilic substances [gramicidin,
tolbutamide, picrotoxin, kynurenic acid, and
1-ethyl-2-benzimidazolinone (1-EBIO)] were dissolved in DMSO and
diluted 1:1000 to final concentrations. Apart from 1-EBIO (Tocris,
Bristol, UK), all drugs were obtained from Sigma (Dorset, UK). A
possible shunt of applied and recorded currents caused by activation of
ATP-dependent K+ channels
(KATP) in standard whole-cell recordings (Liss et
al., 1999a) was prevented by tolbutamide (100 µM). When using high- KCl pipette solution, Cl
currents were blocked by 50 µM picrotoxin. Excitatory synaptic inputs were blocked by 50 µM kynurenic acid during long-term
perforated-patch recordings. The degree of rundown of AHP currents
(IAHPs) was estimated by fitting a
linear regression to the data points recorded under control conditions.
This fit predicted the change of control
IAHP throughout the time course of the
experiment. In D-tubocurarine
(DTC) experiments, the washout IAHP amplitudes were predicted by the
regression fit. The effect of pharmacological agents on
IAHPs was expressed relative to the predicted control amplitude at the time of analysis. Analysis and
plotting was done using IgorPro (WaveMetrics). Voltage-clamp records
were filtered off-line (0.2 kHz) and averaged 2-5 times. To evaluate
statistical significance (p < 0.05), data were
subjected to Student's t tests in Microsoft Excel. The
single-cell SK3 protein-current correlation was analyzed according to
Fisher in StatView. Numbers are presented as mean values ± SEM
(calculated in Excel if not stated otherwise). Coefficients of
variation (CVs) were obtained by dividing the SD of the Gaussian
fit by the mean interspike interval (ISI) and expressed as percentage.
Cytoplasm harvest and reverse
transcription. For single-cell reverse
transcription (RT)-PCR experiments, the patch pipettes were filled with
6 µl of autoclaved internal RT-PCR solution as described above (Liss
et al., 1999a). At the end of the recording (<15 min), the cell
contents (including the nucleus, in most cases) were aspirated into the
patch pipette under visual control (40× objective + 2-4× zoom) by
application of gentle negative pressure. Cells were only analyzed
further when the whole-cell configuration remained stable throughout
the harvesting procedure. Pipettes were then quickly removed from the
cell, washed two times through the solution interface, and the pipette
contents were immediately expelled into a 0.5 ml Eppendorf tube
containing the contents for reverse transcription. First strand cDNA
was synthesized for 1 hr at 37°C in a total reaction volume of 10 µl containing random hexamer primers (Boehringer Mannheim, Mannheim,
Germany; final concentration, 5 µM),
dithiothreitol (final concentration, 10 mM), the
four deoxyribonucleotide triphosphates (Amersham Pharmacia Biotech,
Little Chalfont, UK; final concentration, 0.5 mM each), 20 U of ribonuclease inhibitor
(Promega, Madison, WI), and 100 U of reverse transcriptase
(SuperscriptII; Life Technologies, Gaithersburg, MD). The
single-cell cDNA was kept at  70°C until PCR amplification.
Multiplex and nested PCR. After reverse
transcription, the cDNAs for tyrosine hydroxylase (TH), glutamate
decarboxylase (GAD67), and SK1-4 were simultaneously amplified
in a multiplex PCR using the following set of primers (from 5' to 3').
Primer pairs for TH, GAD67 were identical to those used in Liss et al.
(1999a): SK1-3 PCR products were generated with primers derived from
partial (SK1-3) and complete mouse cDNA clones (SK4); SK1 sense:
CAGCTGTTCTTGGTGGACAA; antisense: GTCTCCCTGAGAACGTTTGC (710 bp); SK2
sense: AGAAGAACCAGAACATCGGC; antisense: GGTACCTTTCACAAGCTCGG (672 bp);
SK3 sense: GGATTCCATGTTTTCGTTGG; antisense: CCAATGGAAAGGAACGTGAT (594 bp); SK4 (accession number AF072884) sense: TTTGATCACCCTGTCCACTG;
antisense: AGTCCTTCCTTCGAGTGTGC (806 bp). First multiplex PCR was
performed as hot start in a final volume of 100 µl containing the 10 µl RT reaction, 100 pmol of each primer, 0.2 mM
each dNTP (Pharmacia), 1.8 mM
MgCl2, 50 mM KCl, 20 mM Tris-HCl , pH 8.4, and 3.5 U of Gold
Taq-polymerase (PerkinElmer Life Sciences, Emeryville, CA)
in a PerkinElmer Thermal Cycler 9700 with the following cycling
protocol: after 10 min at 94°C for release of the antibody 35 cycles
(94°C, 30 sec; 58°C, 60 sec; 72°C 3 min) of PCR were performed
followed by a final elongation period of 7 min at 72°C. The nested
PCR amplifications were performed in individual reactions, in each case
with 2.5 µl of the first PCR reaction product under similar
conditions with the following modifications: 50 pmol of each primer,
2.5 U Taq polymerase (Life Technologies), 1.5 mM MgCl2, and a shorter extension time (60 sec) using the following primer pairs: SK1 sense:
CACTATCGCTTCACGTGGAC; antisense: GAAGGTGATGGAGATGAGCC; SK2 sense:
ACTATGCGCTTATCTTCGGC; antisense: GCCGTCCATGTGAACGTATA; SK3 sense:
GCCATGACCTACGAGCGTAT; antisense: GTCTTCATGACGAATCGGGT; SK4 sense
CTGTACATGAACACGCACCC; antisense: GTTGAACTCCAGCTTCCGAG. To investigate
the presence and size of the amplified fragments, 15 µl
aliquots of PCR products were separated and visualized in ethidium
bromide-stained agarose gels (2%) by electrophoresis. The predicted
sizes (in base pairs) of the PCR-generated fragments were 377 (TH), 702 (GAD67), 375 (SK1), 310 (SK2), 290 (SK3), and 285 (SK4). All individual
PCR products were verified several times (n > 3) by
direct sequencing or subcloning and sequencing. For semiquantitative
single-cell RT-PCR of SK1, SK2, and SK3 mRNA, we generated serial
dilutions (1/2, 1/4, 1/8, 1/16, 1/32/, 1/64) of single-cell cDNA pools.
Each dilution was used as template in a nested PCR (2 × 35 cycles) with SK1, SK2, and SK3 primers, respectively, as described
above, and detection thresholds were analyzed using agarose gel
electrophoresis (Franz et al., 2000).
RNA isolation and cDNA preparation for control reactions.
poly(A)+ RNA was prepared from ventral
midbrain and lung tissue of 14-d-old C57BL/6J mice using the
Micro-FastTrack Kit (Invitrogen, San Diego, CA). The reverse
transcription was performed with 500 ng of
poly(A)+ RNA as described above. For the
positive controls performed in parallel with each single-cell
amplification, the resulting brain and lung cDNA stock was diluted
10,000-fold, and 1 µl was used as template for the PCR reaction. All
PCR fragments were detected routinely in the positive control with the
PCR protocol described above. Negative controls were performed in
parallel to single-cell experiments excluding only the harvesting
procedure and resulted in no detectable bands. To probe for possible
amplification of genomic DNA from the harvested single nuclei,
single-cell mPCR amplifications were performed without previous reverse
transcription. For all analyzed neurons (n = 5), no PCR
products were detectable. When possible, primer pairs were designed to
be intron-spanning.
Immunocytochemistry and confocal microscopy. Neurons in 250 µm midbrain slices were recorded for 2-5 min in the whole-cell configuration with a pipette solution described above (KMe) containing 0.2% neurobiotin. Pipettes were removed via the outside-out
configuration. Control slices and those containing filled neurons were
fixed with 4% paraformaldehyde in PBS, pH 7.4, for 30 min at room
temperature. Subsequently, fixative was removed with four washes of PBS
solution. Slices were treated with 1% Na-borohydride (Sigma) dissolved
in PBS for 10 min to reduce unreacted aldehydes and again washed four
times in PBS for 5 min. To avoid unspecific bindings of immunoreagents, slices were treated for 20 min with a blocking solution containing 10%
horse serum, (Vector Laboratories, Burlingame, CA), 0.2% BSA, and
0.5% Triton X-100 (Sigma) for permeabilization of the cell membranes
in PBS. The blocking solution was removed with two washes of PBS.
Primary antibodies [sheep anti-TH; 1:1000; Chemicon, Temecula, CA;
rabbit anti-SK3 (1:1000), Alomone Labs, Jerusalem, Israel] were
applied overnight in a carrier solution consisting of 1% horse serum,
0.2% BSA, and 0.5% Triton X-100 in PBS. Afterward, slices were washed
four times in PBS for 5 min and then incubated with the following
secondary antibodies: Alexa 488 goat anti-sheep IgG (1:1000; Molecular
Probes); avidin-Cy3 (1:1000; Amersham Pharmacia Biotech), and goat
anti-rabbit Cy5 (1:1000; Amersham Pharmacia Biotech) for 90 min at room
temperature in 0.5% Triton X-100 in PBS. Subsequently, slices were
washed six times in PBS for 5 min and mounted in Vectashield mounting
medium (Vector Laboratories) to prevent rapid photo bleaching. Slices
were analyzed using a Zeiss LSM 510 confocal laser-scanning microscope.
Fluorochromes were excited with an Argon laser at 488 nm (Alexa; green)
using a BP505-530 emission filter, with a HeNe laser at 543 nm (Cy3; red) in combination with a BP560-615 emission filter and HeNe laser at
633 nm (Cy5; blue) and a long-pass 650 emission filter. To
eliminate any cross-talk of signals, the multitracking configuration of
the LSM 510 was used. For all images, the SK3 immunosignal was shown in
red color coding, neurobiotin-filled neurons were shown in blue color
coding, and TH staining was shown in green color coding. Images were
taken at a resolution of 1024 × 1024 pixels with either a
Plan-Neofluar 10×/0.3, Plan-Neofluar 20×/0.5, Plan-Apochromat
40×/1.3 Oil Phase 3, or a Plan-Apochromat 63×/1.4 Oil Phase 3 Zeiss objective, respectively, using the LSM 510 software 2.5. If not
specified otherwise, figures represent overlaid stacks of 12 scanned
images in 1 µm increments. The specificity of SK3 immunosignal in
fixed midbrain sections was ascertained by antigen peptide-blocking
experiments. For negative control, 1 µg of SK3 antibody and 1 µg of
peptide were preincubated for 1 hr at room temperature. This
coincubation resulted in no detectable immunoreactivity (data not
shown). In addition, incubation with the second antibodies only also
showed no detectable immunosignals.
Quantification of the SK3 immunostaining signal. Neurons
were scanned with a 40×/1.3 Oil Phase 3 lens using a 4× zoom. For quantification, confocal settings were chosen to ensure that both the
low SK3 signal intensity of VTA as well as the high SK3 signal intensity of SN neurons were fully resolved within the dynamic range of
detection (8 bit, 0-255), and no loss or saturation of signal did
occur. Subsequently, all neurons were scanned at the level of the
largest somatic transverse section using these defined confocal
settings consisting of identical detector gain, amplifier gain,
amplifier offset, pinhole diameter, excitation (laser power), scan mode
and speed (line scan), 4× averaging, frame size (1024 × 1024, 8 bit), 4× zoom. In these images, regions of interest (ROIs) were drawn
surrounding the somata of the scanned neurons. For each ROI that
corresponded to the total somatic area of the analyzed neuron, the
frequency distribution of SK3 signal intensity was analyzed using LSM
510 software. These frequency distributions of SK3 immunosignal
intensity were well described by Gaussian functions to determine their
mean intensity using Igor Pro software. In addition, SK3 background
noise levels were scanned in five cell-free regions of each slice. A
total of 76 slices from 50 mice at 10-14 postnatal days were
analyzed. The absolute background noise levels were similar in VTA
(16.2 ± 2.4; n = 23) and SN (17.9 ± 1.4;
n = 49). However, to account even for small variances
in the SK3 background noise between different slices, the SK3 signal intensities of individual neurons (determined by ROIs) were normalized to the averaged background signal in the same slice and compared with
the IAHP amplitudes determined in the
same cell.
| |
RESULTS |
Biophysical properties of AHP currents in DA SN neurons
The electrophysiological properties of identified DA midbrain
neurons in midbrain slices of C57BL/6J mice (10-14 d) were analyzed using patch-clamp techniques. Current-clamp recordings of DA neurons in
the SN revealed spontaneous, low-frequency, pacemaker activity (Fig.
1A). A large "sag"
component, which is mediated by the activation of
Ih channels, was observed after
injection of hyperpolarizing currents (Fig. 1B).
These two phenomena constitute the well described biophysical
fingerprint of DA SN neurons (Sanghera et al., 1984; Grace and Onn,
1989; Lacey et al., 1989; Yung et al., 1991; Richards et al., 1997). In
previous studies (Liss et al., 1999a,b; Franz et al., 2000), we have
demonstrated using single-cell RT-PCR that neurons with these
properties express tyrosine hydroxylase mRNA and therefore, possess a
dopaminergic phenotype. In accordance with previous studies in mice
(Sanghera et al., 1984) and other species (Grace and Onn, 1989; Lacey
et al., 1989; Grace, 1991; Yung et al., 1991; Richards et al., 1997),
mouse DA SN neurons displayed large and prolonged AHPs that dominated
the first part of the interspike interval during pacemaker discharge.
To study the currents involved in the AHP in a more controlled and
quantitative manner, we used a variant of the hybrid clamp method
introduced by Lancaster and Adams (1986). The membrane was
depolarized from a holding potential of 80 to 60 mV for 100 msec, to
induce unclamped spikes. Subsequently, the membrane potential was
stepped back to 80 mV to record the AHP currents
(IAHPs) under voltage-clamp conditions. This method has been used successfully to delineate conductances that contribute to the AHP complex in other neurons (Storm, 1989; Pedarzani and Storm, 1993; Sah, 1996). Because
calcium-activated channels are known to play a dominant role in the
AHP, we used intracellular pipette solutions with a low
calcium-buffering capacity (0.1 mM EGTA) to
minimize nonphysiological calcium buffering. Indeed, conventional
pipette solutions containing 10 mM EGTA reduced the AHP currents elicited by the hybrid clamp protocol (data not shown). In DA SN neurons, the hybrid protocol evoked AHP outward currents that peaked ~40-200 msec after the depolarizing voltage step and then slowly decayed (Fig. 1C). The
IAHP peak amplitudes were normally
distributed around a mean of 100 pA (105 ± 6 pA at 80 mV;
n = 108) using a KMe-based pipette solution (Fig.
1D) and had a slightly larger mean (122 ± 10 pA
at 80 mV; n = 89; p < 0.01) using a
KCl-based pipette solution (Fig. 1E). The single Gaussian distributions of IAHP peak
amplitudes obtained with both pipette solutions in standard whole-cell
recordings in DA SN neurons might indicate that these neurons express a
stereotypical set of ion channels mediating the
IAHPs.
View larger version (26K):
[in this window]
[in a new window]
|
Figure 1.
Electrophysiological profile and
IAHPs in SN DA neurons. A,
Whole-cell, current-clamp recording of spontaneous pacemaker activity
(1.5 Hz). Note pronounced AHP after single action potentials.
B, Overlay of voltage responses to hyperpolarizing
current injections of increasing intensity. Note prominent "sag"
component mediated by Ih activation.
C, Whole-cell, voltage-clamp recording of an
IAHP, activated by a hybrid clamp
protocol (inset). D, E, Frequency
distributions of IAHP peak amplitudes,
recorded with KMe (D) or high KCl
(E) pipette solutions, were well described by
single Gaussian functions with mean IAHP
amplitudes of 105 ± 6 pA (n = 108) and
122 ± 10 pA (n = 89), respectively.
|
|
The decay of the IAHPs was dominated
by one component with time constants in the range of 100-200 msec
(Fig. 2A,B) that
corresponds to the "medium" IAHP
(Sah, 1996). This medium IAHP
(mIAHP) decayed with a mean time
constant of 135 ± 7 msec (n = 105) (Fig.
2A) in KMe solution and had a slower time constant in
KCl solutions of 174 ± 11 msec (n = 88;
p < 0.001) (Fig. 2B). In addition, a minor slow component (14.1 ± 0.5% of the total
IAHP amplitude; n = 181) with time constants in the range of 0.5-2.5 sec was present (KMe,
1.1 ± 0.1 sec; n = 93; KCl, 1.1 ± 0.1 sec;
n = 56). Removal of extracellular calcium almost
completely abolished the mIAHP (12 ± 5% residual fitted mIAHP;
n = 7) (Fig. 2C), but did not affect the
slow IAHP
(sIAHP) (103 ± 12%
residual fitted sIAHP; n = 7) (Fig. 2C). The calcium sensitivity of
the mIAHP and its reversal potential
(100 ± 5 mV; n = 5; data not shown) indicates that this current is mediated by calcium-dependent potassium channels. To gain more insight into the calcium sensitivity of the
mIAHP and the contribution of SK
channels, we used 1-EBIO, a compound that stabilizes the interaction of
the SK channel and its gating modifier calmodulin and thereby increases
the open probability of SK channels (Xia et al., 1998; Oliver et al.,
2000; Pedarzani et al., 2000; Syme et al., 2000). Application of 2 mM 1-EBIO potentiated the
IAHP amplitudes by a factor of
1.7 ± 0.1 (control, 114 ± 20 pA; 1-EBIO, 186 ± 29 pA;
n = 5; p = 0.001) and increased the
decay time constant approximately threefold (control, 14 ± 29 msec; 1-EBIO, 412 ± 59 msec; n = 5;
p < 0.001), consistent with the role of 1-EBIO in
stabilizing the open state of SK channels (Fig. 2D).
These results demonstrate that calcium-activated
K+ channels, most probably of the
small-conductance (SK) type, mediate the dominant, medium
IAHP in DA SN neurons. SK channels
possess no intrinsic voltage dependence, and their open probability is coupled to the changes in intracellular calcium concentrations (Hirschberg et al., 1998, 1999; Xia et al., 1998), which in turn, are
orchestrated by the interaction of voltage-dependent calcium channels,
intracellular calcium pools, calcium pumps, and buffers (Berridge,
1998). Because this delicate interplay of calcium handling mechanisms
is likely to be distorted in the standard whole-cell configuration, the
gramicidin-perforated patch method (Akaike, 1996) was also used to
study IAHPs in DA SN neurons. The
hybrid clamp protocol elicited mIAHPs
with significantly smaller amplitudes (46 ± 4 pA;
n = 8; p < 0.0001) but similar decay
kinetics (108 ± 9 msec; n = 8) (Fig.
2E) in gramicidin-perforated patch recordings compared with those elicited with 0.1 mM EGTA KMe
solutions in the standard whole-cell mode (p > 0.01). In summary, these results indicate that calcium- and
1-EBIO-sensitive K+ channels mediate the
dominant, medium IAHP under conditions
of intact calcium handling in DA SN neurons.
View larger version (23K):
[in this window]
[in a new window]
|
Figure 2.
mIAHPs in SN DA neurons
are calcium- and 1-EBIO-sensitive. A, B, Whole-cell
voltage-clamp IAHP recordings.
IAHP decay was best described with
biexponential functions with a medium (~150 msec) and a slow (~1
sec) time constant ( m and s). The medium component accounted for
80% of the IAHP amplitude (79 ± 10%;
n = 181). Frequency distributions of m values
could be fitted with single Gaussian functions (insets)
with a mean m of 135 ± 7 msec (A, KMe;
n = 105) and 174 ± 11 msec (B,
KCl; n = 88), respectively. Mean s values (data
not shown) were 1.1 ± 0.1 sec for both solutions (KMe,
n = 93; KCl, n = 56).
C, mIAHPs were dependent on
extracellular calcium. Removal of extracellular calcium (0 Ca2+) reversibly blocked 88 ± 5% of the
fitted mIAHP amplitude
(n = 7), but had no effect on the slow
IAHP. D, 1-EBIO, an SK
channel activator, reversibly increased IAHP
amplitudes and slowed the IAHP decay.
E, IAHPs recorded with
gramicidin-perforated recordings (gram) had
smaller amplitudes (46 ± 4 pA; n = 8)
compared with those recorded in the whole-cell mode (Fig. 1), but
similar m values (108 ± 9 msec; n = 8).
|
|
Pharmacology of SK channels in DA midbrain neurons
To gain more insight into the type of
K+ channel activity that underlies the
calcium- and 1-EBIO-sensitive mIAHP,
quantitative pharmacological experiments on DA SN neurons were
performed. Apamin, a bee venom that selectively blocks SK channels
(Romey et al., 1984; Ishii et al., 1997a), inhibited the
mIAHP in low nanomolar concentrations
but did not affect the calcium-insensitive
sIAHP (Fig.
3A). This demonstrated that
the mIAHP is indeed mediated by SK
channels. The onset of inhibition by apamin occurred within seconds but
was not reversible within washout periods of ~10 min. The apamin
concentration-response curve of the mean
mIAHPs was well described with a
single Hill function that had an IC50 of 8.5 nM and a Hill coefficient of 0.9. (n = 53; mean IC50 of apamin = 9.2 ± 0.7 nM; n = 24)
(Fig. 3B). The IC50 in the low
nanomolar range is similar to that described for recombinant SK3
channels (Ishii et al., 1997a). In contrast, recombinant SK2 channels
display a higher apamin sensitivity with an IC50
in the picomolar range (Kohler et al., 1996; Ishii et al., 1997a).
Thus, these data do not support a contribution of SK2 channels in the
IAHP of DA SN neurons. Based on the
conflicting results on the apamin sensitivity of SK1 channels (Kohler
et al., 1996; Ishii et al., 1997a; Shah and Haylett, 2000; Strobaek et
al., 2000), it is difficult to assess its possible contribution to the
native SK channel in DA neurons. The toxin DTC
has been shown to bind SK channels in a similar way as apamin (Ishii et
al., 1997a), but, in contrast to apamin the inhibition of SK channels
by DTC is readily reversible. Indeed, the
mIAHP component was reversibly blocked
by DTC (Fig. 3C, insert). Mean
inhibition by DTC had a concentration-response curve that was well described with a single Hill function and had an
IC50 of 52 µM and a Hill
coefficient of 1.5 (n = 30; mean IC50 of DTC = 52.8 ± 3.1 µM; n = 16)
(Fig. 3D), again consistent with the presence of a single
type of SK channel. This IC50 is similar to that
reported for SK3 channels in recombinant systems, which had an
IC50 of 63 µM (Ishii et
al., 1997a). The biophysical and pharmacological analysis strongly
suggested the presence of a single SK channel subtype, most likely SK3,
in DA SN neurons.
View larger version (33K):
[in this window]
[in a new window]
|
Figure 3.
mIAHPs in SN DA neurons
are apamin- and D-tubocurarine-sensitive. Whole-cell
voltage-clamp recordings of SN DA neurons. A, The medium
IAHP was completely blocked by 300 nM apamin (apa), whereas the slow
IAHP component was not affected.
Inset shows time course of normalized
IAHP amplitudes during the experiment.
B, The mean dose-response for apamin inhibition was
well described by a single Hill function with an IC50 of
8.5 nM and a Hill coefficient of 0.9 (n = 53). C, The medium IAHP was
also selectively blocked by 1 mM DTC. In
contrast to apamin, the inhibition by DTC was readily
reversible (inset). Mean dose-response for
DTC inhibition was well described by a single Hill function
with an IC50 of 52 µM and a Hill coefficient
of 1.5 (n = 30).
|
|
SK channels act as dynamic low-pass filters of pacemaker frequency
in DA SN neurons
The quantitative pharmacological results enabled us to study the
physiological effects of defined inhibition and activation of SK
channels in DA SN neurons. These experiments were performed under
conditions of intact intracellular calcium handling with gramicidin-perforated patch recordings. Fast synaptic transmission was
pharmacologically inhibited to ensure the functional isolation of the
intrinsic pacemaker. DA SN neurons displayed spontaneous low-frequency
pacemaker discharge in the range from 0.6-4.3 Hz (Fig.
4). The application of 80 µM DTC, which inhibited ~2/3 (66%) of SK
channels in DA SN neurons, was sufficient to induce an increase in the
spontaneous pacemaker frequency (Fig. 4A). The fact
that a partial inhibition of SK channels had functional consequences argues for a tight control of the pool of active SK channels in DA
neurons. Higher DTC concentrations (1 mM) that completely blocked SK channels further
accelerated the discharge frequency and depressed the AHPs (Fig.
4B,C). Furthermore, the activation of SK channels by
200 µM 1-EBIO decelerated the spontaneous
discharge frequency and increased the AHP amplitude and duration (Fig.
4D). These data are consistent with previous results
that indicated a role for SK channels in the control of the firing
frequency of DA midbrain neurons (Shepard and Bunney, 1991; Ping and
Shepard, 1996). However, heterogeneous responses to SK inhibition have
been described for dopaminergic neurons, i.e., the application of
apamin increased the frequency of firing in some DA neurons but had no
effect on others. Also, some neurons became more irregular, whereas
others switched to a burst mode in response to apamin (Shepard and
Bunney, 1988, 1991; Gu et al., 1992; Shepard and Stump, 1999).
Interestingly, the DTC-mediated increase and the
1-EBIO-mediated decrease of the spiking frequencies were itself
depended on the pacemaker frequency in DA SN neurons (Fig.
4E). To also study frequencies above the observed
range of spontaneous discharge, we injected different amplitudes of
positive currents (5-50 pA). At the low-frequency end of the spectrum
of spontaneous discharge rates (<2 Hz), partial SK inhibition had a
small but significant effect on discharge rates (relative change,
1.1 ± 0.02; n = 31; p < 0.0001).
With increasing discharge rates, the relative effect of partial SK inhibition increased and saturated at frequencies >6 Hz where partial
SK inhibition induced an maximal increase in discharge rates of 50%
(1.5 ± 0.1 at 6-8 Hz; n = 7). As expected,
complete SK inhibition by 1 mM
DTC also increased firing in a
frequency-dependent manner (1.7 ± 0.1 at 2-4 Hz;
n = 10; 2.3 ± 0.2 at 4-6 Hz; n = 5; data not shown). The effects of partial and complete SK inhibition were not significantly different in the lower frequency group of 0-2
Hz (1.2 ± 0.1; n = 8; p = 0.08).
Similar results were obtained by partial (20 nM)
or complete (300 nM) inhibition of SK channels by
apamin (20 nM apamin: 1.2 ± 0.1 at 2-4 Hz,
n = 32; 1.4 ± 0.1 at 4-6 Hz, n = 3; 300 nM apamin: 1.5 ± 0.1 at 2-4 Hz,
n = 34; 1.7 ± 0.3 at 4-6 Hz, n = 3; data not shown). In accordance with the frequency dependence of SK
inhibition, partial activation of SK channels with 200 µM 1-EBIO also showed a similar frequency dependence. The effect of 200 µM 1-EBIO
increased at higher discharge frequencies and was saturated at
frequencies >4 Hz, reducing the discharge rate to 50% (0.50 ± 0.03 at 6-8 Hz; n = 8). Higher 1-EBIO concentrations
(0.5-2 mM) led to tonic membrane
hyperpolarizations that prevented pacemaker activity (data not shown).
These results show that with increasing discharge frequencies the
functional role of SK channels becomes more dominant in the control of
excitability. It is reasonable to assume that this frequency dependence
of SK channel recruitment is related to rising calcium concentrations during enhanced activity (Wilson and Callaway, 2000). As a consequence, the relative importance of SK channels in shaping firing increases with
faster spiking frequencies. Thus, SK channels might act as low-pass
filters that stabilize the frequency of the discharge and ensure lower
firing rates. Sudden increases of spike rates are likely to recruit
more SK channels to the active pool and counteract the initial
acceleration by negative feedback.
View larger version (21K):
[in this window]
[in a new window]
|
Figure 4.
SK channels dynamically control pacemaker
frequencies in DA SN neurons. A-D, Current-clamp
recordings of SN DA neurons in the gramicidin-perforated patch
configuration. A, Partial (2/3) inhibition of SK
channels by 80 µM DTC resulted in a
reversible increase of spontaneous discharge (3.8-4.8 Hz).
B, Control pacemaker frequency (2.3 Hz). Note that
single spike AHPs peak at 60 mV. C, A 1 mM
concentration of DTC reduced AHP peak amplitudes and
increased the spiking frequency to 3.3 Hz (relative change, 1.4).
D, A 200 µM concentration of 1-EBIO
increased AHP peak amplitudes and duration and decreased the spiking
frequency to 1.3 Hz (relative change, 0.5). Action potentials were
truncated for clarity. E, Summary of experiments as in
A-D. Control frequencies were combined in 2 sec bins
(n = 3-31) to compare the effect of 200 µM 1-EBIO, 80 µM DTC. A broader
frequency range (>6 Hz) was achieved by injecting positive current.
Partial inhibition and activation of SK channels by 80 µM
DTC and 200 µM 1-EBIO, respectively, altered
the discharge rate in a frequency-dependent manner with increased
efficiency at higher discharge rates.
|
|
SK channels control pacemaker precision in DA SN neurons
An additional function of SK channels in pacemaker control could
be to enhance the precision of the intrinsic pacemaker mechanism, because SK channel activation might counteract the variability of
individual interspike intervals. To quantify the role of SK channels in
pacemaker precision, the distribution and variance of ISIs during
continuous recording were analyzed (Figs.
5, 6). These recordings were performed in the perforated-patch configuration under pharmacological inhibition of fast synaptic transmission. In
accordance with previous studies (Grenhoff et al., 1988; Shepard and
German, 1988) the DA SN pacemaker showed a high degree of precision,
and the distribution of ISIs could be described with single Gaussian
functions (Figs. 5A, 6A). The CV, measured
by the SD of fitted Gaussian function normalized to the mean ISI, was
only ~10% of the mean ISI of SN DA neurons (12.4 ± 1.6%;
n = 12). Partial inhibition of SK channels by 80 µM DTC enhanced the
variability of ISIs by ~40% (CV, 17.5 ± 1.8%;
n = 12; p < 0.001) (Fig.
5B,D). This effect was more pronounced by
complete inhibition of SK channels by 1 mM
DTC, which subsequently increased the ISI
variability by 140% compared with control conditions (CV, 30.0 ± 2.9%; n = 10; p < 0.0001) (Fig.
5C,D). The DTC
effect on precision was partially reversible after washout of the drug
(CV, 15.6 ± 2.4%; n = 3) (Fig. 5D).
Similar results were obtained by application of apamin (Fig. 6).
Already partial SK inhibition by 20 nM apamin
reduced the precision of firing (CV control: 12.1 ± 1.2%,
n = 11; CV 20 nM apamin:
16.5 ± 2.3%, n = 9, p = 0.02), which was further decreased by complete SK inhibition in 300 nM apamin (CV 300 nM
apamin: 32.8 ± 5.6%, n = 11, p < 0.005). These results demonstrate that the pool of active SK
channels is intimately involved in the control of the precision and
timing of the endogenous pacemaker in DA SN neurons.
View larger version (32K):
[in this window]
[in a new window]
|
Figure 5.
D-Tubocurarine-sensitive SK channels
maintain high precision of the pacemaker in DA SN neurons.
A-C, Current-clamp recordings of SN DA neurons in the
gramicidin-perforated patch configuration during control and
DTC application. Representative traces (10 sec) are shown
for each condition. Action potentials were truncated at 30 mV, and
mean peak AP amplitudes were 29.1 ± 0.1 mV
(n = 50) for control, 27.7 ± 0.1 mV
(n = 50) for 80 µM DTC,
and 21.0 ± 0.6 mV (n = 50) for 1 mM DTC. ISI histograms for each condition are
depicted in the right panels, respectively. ISI frequency
distributions were described by single Gaussian functions, and
the resulting coefficient of variation was calculated as a measure of
pacemaker precision. A, Control (CV, 6%).
B, Partial (2/3) inhibition of SK channels by 80 µM DTC increased the spiking frequency and
decreased spiking precision (CV, 9%). C, Complete block
of SK channels (1 mM DTC) resulted in a further
reduction of spiking precision (CV, 16%). D, Summary of
experiments as in A-C. The mean CVs in control, 80 µM DTC, 1 mM DTC, and
washout were 12.4 ± 1.6% (n = 12), 17.5 ± 1.8% (n = 12; p = 0.001),
30.0 ± 2.9% (n = 10; p < 0.0005), and 15.6 ± 2.4% (n = 3),
respectively.
|
|
View larger version (27K):
[in this window]
[in a new window]
|
Figure 6.
Selective inhibition of SK channels by apamin
dramatically reduces pacemaker precision in DA SN neurons.
A-C, Current-clamp recordings of SN DA neurons in the
gramicidin-perforated patch configuration during control and apamin
application. Representative traces (10 sec) are shown for each
condition. Action potentials were truncated at 15 mV, and mean peak
AP amplitudes were 7.8 ± 0.1 mV (n = 50)
for control, 6.7 ± 0.2 mV (n = 50) for 20 nM apamin, and 5.8 ± 0.2 mV (n = 50) for 300 nM apamin. ISI histograms for each condition
are depicted in the right panels, respectively. ISI
frequency distributions were described by single Gaussian functions,
and the resulting coefficient of variation was calculated as a measure
of pacemaker precision. A, Control (CV, 18%).
B, Partial inhibition of SK channels by 20 nM apamin decreased spiking precision (CV, 26%).
C, Complete block of SK channels (300 nM
apamin) resulted in a strong reduction of spiking precision (CV, 48%).
D, Summary of experiments as in A-C. The
mean CVs in control, 20 nM, and 300 nM apamin
were 12.1 ± 1.2% (n = 11), 16.5 ± 2.3% (n = 9; p = 0.02), and
32.8 ± 5.6% (n = 11; p < 0.005), respectively.
|
|
DA SN neurons express SK3 channels
To assess the molecular composition of the SK channels that may
exert this control over the pacemaker in identified DA SN neurons, we
combined patch-clamp recordings with both qualitative single-cell
RT-multiplex (m) PCR, as developed by Lambolez et al. (1992) and
semiquantitative single-cell RT-PCR, as established by Tkatch et al.
(1998, 2000). A single-cell RT-mPCR protocol was designed to
simultaneously detect levels of the mRNAs of the SK channel subunits
SK1, SK2, SK3, and SK4. In addition, the protocol probed for the
expression of the marker genes TH for dopaminergic neurons and GAD67
for GABAergic neurons (Liss et al., 1999a). The sizes of each of the
PCR amplicons were predicted by their respective mRNA sequences. Figure
7A shows that the six specific PCR products were detected from lung cDNA diluted to the picogram range. Consistent with previous findings (Kohler et al., 1996; Ishii et
al., 1997b; Stocker and Pedarzani, 2000), mRNAs for SK1-SK3, but not
SK4 channel subunits are expressed in brain, as well as TH and GAD67
(Fig. 7B). The single-cell RT-mPCR protocol was then used to
analyze SK channel subunit expression in individual DA SN neurons.
Because the genomic structures of the mouse SK1-SK4 genes were unknown
at the time of primer design, single-cell mPCR amplifications were
performed without previous reverse transcription to probe for possible
amplification of genomic DNA from the harvested single nuclei. No PCR
products were detectable from the cells tested in this way
(n = 5; data not shown). Thus, our protocol was suited
to study the genuine SK1-4 mRNA expression profiles of single neurons.
Consistent with previous in situ hybridization studies that
showed high SK3 mRNA expression in dopaminergic midbrain nuclei (Kohler
et al., 1996; Stocker and Pedarzani, 2000), SK3 mRNA was detected in
all TH-positive neurons displaying medium IAHPs (n = 19) (Fig.
7C,D). In contrast to SK3 mRNA, the
expression of SK1 and/or SK2 mRNA was only detected in a minority of DA
cells (Fig. 7D). Figure 7, E and F,
plots single-cell genotype-phenotype correlations for DA neurons
comparing the expression of SK1-3 in a given neuron with the amplitude
and decay time constant of the SK-mediated
mIAHP, determined in the same cell.
Differential mRNA coexpression of SK1 and/or SK2 with the prominent SK3
mRNA was not correlated with a significantly different phenotype of the
mIAHP. In addition to these
qualitative single-cell mPCR results, we used serial dilutions of
single-cell cDNA pools to quantify the PCR detection limits of SK1,
SK2, and SK3 mRNA in single DA neurons (Fig.
8). The frequency distribution of
single-cell SK3 detection thresholds was well described with a single
Gaussian function, indicating a mean SK3 detection threshold of 13 ± 4% (2 2.9) of
the single-cell cDNA pools (Fig. 8A,B). Whereas SK3
was again detected in all cells with detection thresholds up to
a 1:16 dilution, SK1 or SK2 mRNAs were in most cases not detected (SK1
6/9, SK2 4/6 cells) or only detected up to a 1:4 dilution in similar
serial dilution single-cell RT-PCR experiments (Fig.
8C,D). These results indicate that SK3
mRNA is expressed with at least a fourfold higher abundance compared
with SK1 or SK2 in single DA neurons. On the level of mRNA, SK3 is
clearly the ubiquitous and dominant species in identified single DA SN
neurons.
View larger version (37K):
[in this window]
[in a new window]
|
Figure 7.
SK3 mRNA is the dominant SK mRNA species in
single, identified SN DA neurons. A, B, PCR products of
nested PCR reactions were resolved in separate lanes by gel
electrophoresis gels in parallel with a 100 bp ladder as molecular
weight marker. All SK channel subunit mRNAs as well GAD and TH mRNAs
are expressed in mouse lung tissue (positive controls), and with the
exception of SK4, all transcripts were also present in brain. The
predicted sizes (in base pairs) of the PCR amplicons were 702 (GAD67),
377 (TH), 375 (SK1), 310 (SK2), 290 (SK3), and 285 (SK4).
C, Single-cell RT-multiplex PCR experiment of a DA SN
neuron: after eliciting the IAHP current
(left panel) (compare Fig. 1C),
the cytoplasm was harvested for RT-mPCR analysis. The respective
single-cell mRNA expression profile (TH+,
SK3+) was displayed by gel electrophoresis
(right panel). D, Distribution of
single-cell RT-mPCR expression profiles from SN DA
(TH+) neurons with medium
IAHPs. E, F, Single-cell
phenotype-genotype correlation between amplitude
(E) and kinetics (F) of
IAHP and SK1-SK3 expression profiles in DA
SN neurons. Codetection of SK1 and/or SK2 with the prominent SK3 was
not correlated with a significantly different
IAHP phenotype.
|
|
View larger version (27K):
[in this window]
[in a new window]
|
Figure 8.
Semiquantitative single-cell RT-PCR demonstrates
that SK3 mRNA is most abundant in SN DA neurons. A,
Semiquantitative single-cell RT-PCR experiment of a DA SN neuron: after
eliciting the IAHP current (left
panel) (compare Fig. 1C), the cytoplasm
was harvested for RT. Serial dilutions of the single-cell cDNA pool
were analyzed by nested PCR. Gel electrophoresis analysis (right
panel) demonstrated SK3 detection in up to one-eighth of
the respective single-cell cDNA pool. B-D, Frequency
distribution of SK3 (A), SK2
(B), and SK1 (C) detection
thresholds in SN DA (TH+) neurons. Whereas SK1 and
SK2 were not detected in most cases (white bars), the
distribution of SK3 detection thresholds was well described with single
Gaussian function, indicating a mean detection from 13 ± 4%
(22.9; n = 13; B) of the single-cell cDNA pools.
|
|
Differential expression of SK3 protein is correlated with different
IAHP amplitudes in DA midbrain neurons
To study the expression of SK3 on the protein level in DA midbrain
neurons, confocal immunohistochemistry was performed on mouse midbrain
sections. Double labeling with SK3 antibodies was done in combination
with TH antibodies to identify DA neurons. The low-power overview of a
coronal midbrain section, shown in Figure
9, demonstrates that SK3 protein is
prominently expressed in TH-positive, i.e., DA SN neurons, which is
consistent with our previous single-cell RT-PCR results. There is
little SK3 immunoreactivity in TH-negative i.e., nondopaminergic
midbrain neurons. However, the intensity of SK3 immunolabeling was not
uniformly distributed in different DA subpopulations in the midbrain:
whereas it was strong in the substantia nigra pars compacta in
particular the ventral tierthe SK3 immunosignal was weaker by
comparison in the dorsal tier of the SN and the VTA (A10). To compare
DA neurons in the SN and the VTA, high-resolution intensity maps of SK3
immunolabeling were generated and scanned with identical confocal
settings (Fig. 10) (similar results in
10 independent experiments). This comparison not only revealed
prominent SK3 signals decorating the somatodendritic membranes of DA
neurons, but also showed that a stronger SK3 immunosignal was present
in DA neurons in the substantia nigra pars compacta (Fig. 10, compare
B, F). To assess directly the functional relevance of
the observed differences in SK3 protein expression, we combined electrophysiological recordings of
IAHPs in neurobiotin-filled DA neurons
with triple-labeling immunohistochemistry and semiquantitative analysis
of the SK3 immunosignal in the recorded and reconstructed neurons (Fig.
11A-F). The
absolute background levels were similar in VTA (16.2 ± 2.4;
n = 23) and SN (17.9 ± 1.4; n = 49). To account for small background variances between different
slices, absolute SK3 immunosignals (34.8 ± 3.2; n = 44) from individual neurons were normalized to an averaged SK3
background signal in the respective images (Fig. 11F,
insert). Analysis of forty-four DA SN neurons revealed a
significant correlation between IAHP
amplitudes and SK3 immunosignal intensities (r = 0.42;
p < 0.005). These results demonstrate that the
expression of SK3 subunits is an important molecular determinant for
the number of functional SK channels in DA neurons. As shown in Figures
9 and 10, DA VTA neurons express less SK3 protein. To assess the
functional significance of this finding, we also combined the recording
of IAHPs in DA VTA neurons with
triple-labeling immunohistochemistry (Fig.
12A-F).
Consistent with lower SK3 expression, DA VTA neurons displayed smaller
IAHPs. The
IAHPs in DA VTA neurons consisted of
only one component that decayed with a mean time constants of 619 ± 30 msec (n = 12; data not shown). However, the
pharmacological properties of the
IAHPs in DA VTA neuronsi.e.,
activation by 2 mM 1-EBIO (1.9 ± 0.1-fold; n = 16) (Fig. 12G) and partial inhibition of
the 1-EBIO-enhanced IAHP, by 80 µM DTC (40 ± 4%;
n = 9) (Fig. 12H)were similar
compared with those of the mIAHP in DA
SN neurons. In addition, the IAHPs in
DA VTA neurons were completely inhibited by 1 mM
DTC (n = 3), and the removal of
extracellular calcium reduced the IAHP
to 14 ± 9% (n = 5). Quantitative analysis of 12 recorded, filled, and immunocytochemically analyzed DA VTA neurons
clearly demonstrated that SK3 immunoreactivity was significantly
smaller in VTA (20.1 ± 2.9) compared with DA SN neurons
(3.7-fold; VTA, 1.23 ± 0.04, n = 12; SN,
1.85 ± 0.05, n = 44, p < 0.0001)
(Fig. 12I). Interestingly, a similar difference has
been reported between SN and VTA using quantitative apamin
autoradiography (Mourre et al., 1984). In accordance with the
quantified differences in SK3 protein expression, DA VTA neurons
possessed fourfold smaller AHP currents (VTA, 25 ± 1 pA,
n = 12; SN, 111 ± 7 pA, n = 44, p < 0.0001) (Fig. 12J). These
results give clear evidence that differential SK3 expression in
different DA subpopulations is closely linked to functionally relevant
differences in calcium-sensitive IAHP
currents.
View larger version (45K):
[in this window]
[in a new window]
|
Figure 9.
Double immunolabeling indicates prominent SK3
protein expression in dopaminergic midbrain neurons. A
shows a low-power overview of the distribution of SK3 immunoreactivity
(red) in a coronal mouse midbrain section. Note
prominent SK3 signals in the ventral tier of substantia nigra pars
compacta (SNpc, A9), and weaker staining in the dorsal SNpc and the VTA
(A10). B shows the TH immunolabeling in the same section
revealing the well described distribution of TH-positive, i.e.,
dopaminergic, midbrain neurons in the A9 and A10 nuclei. The
superimposed image shown in C indicates cellular
colocalization of SK3 and TH protein within the SNpc and to a lesser
degree in the VTA at higher power. Scale bars, 200 µm.
|
|
View larger version (56K):
[in this window]
[in a new window]
|
Figure 10.
Differential SK3 protein expression in
dopaminergic SN and VTA neurons. A-D, Double
immunolabeling of SK3 (red, A;
pseudocolor-coded SK3 intensity map, B) and TH
(green, C; SK3 + TH
overlay, D) of an SN neuron (arrow). Note
that SK3 immunolabeling is most intense along the somatodendritic
membrane of the DA SN neuron. SK3 protein is also present on
TH-positive neuropil. E-H, Double immunolabeling of SK3
(red, E; pseudocolor-coded SK3 intensity
map, F) and TH (green,
G; SK3 + TH overlay, H) of VTA
neurons. Scanned with identical confocal settings for direct comparison
of SK3 immunosignals in SN and VTA neurons, note that SK3
immunolabeling also labels somatodendritic membranes of VTA DA neurons
but is considerably weaker compared with that in SN DA neurons. Scale
bars, 20 µm.
|
|
View larger version (24K):
[in this window]
[in a new window]
|
Figure 11.
IAHP amplitudes
correlate with the intensity of SK3 immunolabeling in single DA SN
neurons. A, IAHP current was
elicited in whole-cell recording of an SN DA neuron that was filled
with 0.2% neurobiotin for identification during subsequent
quantitative confocal microscopy (B-F). Triple
immunolabeling of recorded SN DA neuron of neurobiotin
(blue, B), TH
(green, C), and SK3
(red, D; neurobiotin + TH + SK3 overlay,
E). F, Semiquantitative analysis of the
SK3 immunolabeling intensity distribution of the recorded SN DA neuron
(arrow). A Gaussian function was fitted to the intensity
distribution to determine the mean SK3 intensity level of the
respective neuron (arrow; 26 ± 0.02). The SK3
background signal intensity was also well described by a Gaussian
function (mean, 14 ± 0.004; inset). Scale bars, 20 µm. G, Single-cell correlations between
IAHP current amplitudes and SK3
immunolabeling intensities (normalized to fitted SK3 noise levels) as
shown in A-F. The line indicates linear regression with
a correlation coefficient of r = 0.42 (n = 44; p < 0.005).
|
|
View larger version (22K):
[in this window]
[in a new window]
|
Figure 12.
VTA DA neurons express smaller
IAHP currents and lower SK3 immunolabeling
compared with SN DA cells. A, Small
IAHP was elicited in whole-cell recording of
a VTA DA neuron that was filled with 0.2% neurobiotin for
identification during subsequent quantitative confocal microscopy
(B-F). Triple immunolabeling of recorded VTA DA
neuron of neurobiotin (blue, B), TH
(green, C), and SK3 (red,
D; neurobiotin + TH + SK3 overlay, E).
Scale bars, 20 µm. F, Semiquantitative analysis of the
SK3 immunolabeling intensity distribution of the recorded SN DA neuron
(arrow). A Gaussian function was fitted to the intensity
distribution to determine the mean SK3 intensity level of the
respective neuron (mean, 11 ± 0.01). The SK3 background signal
intensity was also well described by a Gaussian function (mean, 9 ± 0.08; inset). G, H, Small
IAHP currents in VTA DA neurons show similar
sensitivity to 1-EBIO (1.9 ± 0.1-fold potentiation;
n = 16) and DTC sensitivity (inhibition
by 40 ± 4%; n = 9) but slower kinetics
compared with those in DA SN neurons. I, Normalized SK3
immunolabeling intensities of recorded and reconstructed SN DA neurons
(1.85 ± 0.05; n = 44) were 3.7-fold higher
compared with those of VTA DA neurons (1.23 ± 0.04;
n = 12; p < 0.0005).
J, Similar to SK3 immunolabeling intensities,
IAHP amplitudes of recorded and
reconstructed SN DA neurons (111 ± 7 pA; 91 ± 7%
mIAHPs; n = 44) were
4.0-fold larger compared with those of VTA DA neurons (25 ± 1 pA;
n = 12; p < 0.0005).
|
|
SK3 channels do not control the discharge activity of DA
VTA neurons
To address the functional significance of the considerably smaller
pool of SK3 channels in identified DA neurons of the VTA, we combined
apamin application during perforated patch experiments with subsequent
cell filling to confirm the dopaminergic identity of the recorded VTA
neurons by double neurobiotin and TH immunohistochemistry (Fig.
13A-C). DA VTA neurons were
spontaneously active with a higher mean rate of 2.9 ± 0.4 Hz
(n = 9) compared with SN DA neurons. Already under
control conditions, DA VTA neurons discharged highly irregular compared
with SN DA neurons, as evident from the large CV (Fig. 13A).
Complete inhibition of SK3 channels by 300 nM
apamin had little effect on this irregular pattern of discharge (Fig. 13B). As shown in Figure 13D, complete and
specific SK inhibition had no significant effect on pacemaker activity
in identified DA VTA neurons (CV control: 93.8 ± 17.4%; CV 300 nM apamin: 105.6 ± 16.0%,
n = 8). Furthermore, neither complete inhibition of SK channels by 1 mM
D-tubocurarine (n = 4; data not
shown) nor activation of SK channels by 200 µM
1-EBIO (n = 3; data not shown) had significant effects
on the spontaneous discharge rates of DA VTA neurons. Thus, in contrast
to DA SN neurons, SK channels in DA VTA neurons were not involved in
the control of the pacemaker frequency and precision.
View larger version (30K):
[in this window]
[in a new window]
|
Figure 13.
Identified VTA DA neurons display
apamin-insensitive, low-precision firing compared with SN DA neurons.
Current-clamp recordings of an immunohistochemically identified VTA DA
neuron in the gramicidin-perforated patch configuration during control
(A) and application of 300 nM apamin
(B). Representative traces (10 sec) are shown in
the left panels. Action potentials were truncated at
15 mV, and mean peak AP amplitudes were 12.3 ± 0.1 mV
(n = 50) for control and 6.3 ± 0.3 mV
(n = 50) for 300 nM apamin. ISI
histograms for each condition are depicted in the right
panels, respectively. ISI frequency distributions were
described by single Gaussian functions, and the resulting coefficient
of variation was calculated as a measure of pacemaker precision.
A, VTA DA neurons showed low pacemaker precision during
control condition (CV, 93%) compared with SN DA neurons (Figs. 5, 6).
B, Pacemaker precision and AHPs were not significantly
affected by complete inhibition of SK channels (300 nM
apamin; CV, 106%). C, Identification and immunolabeling
of the same neuron shown in A and B.
After the perforated-patch recording, the recording was converted to
standard whole-cell, and the cell was filled with 0.2% neurobiotin.
Subsequent double immunolabeling identified (neurobiotin,
blue) and confirmed the recorded cell as a dopaminergic
VTA neuron (TH, green; overlay in right
panel). Scale bars, 20 µm. D, Summary
of experiments as in A-C. The mean CVs in control and
300 nM apamin were 93.8 ± 17.4%
(n = 8) and 105.6 ± 16.0%
(n = 8; p = 0.3).
|
|
The combination of electrophysiological recordings with cell filling
and immunohistochemistry enabled us to provide a topography of
differential expression and function of SK3 channels in dopaminergic midbrain neurons (Fig. 14). The
positions of recorded and reconstructed DA neurons were mapped
according to their ventrodorsal and mediolateral coordinates. Each
symbol represents a single neuron, and the symbol size corresponds to
the functional parameter determined for this particular cell. Figure
14A plots the spatial distribution of SK-mediated IAHP amplitudes. It is evident that DA
VTA neurons display significantly smaller
IAHPs compared with the majority of SN
DA neurons, which show a considerable variability of recorded
IAHP currents. As we have shown, SK3
expression is clearly related to the degree of pacemaker precision
illustrated in Figure 14B by the topography of
pacemaker variances (CV), which are significantly larger (7.6-fold) in
DA VTA compared with DA SN neurons (CV SN: 12.3 ± 0.1%,
n = 17; CV VTA: 93.8 ± 17.4, n = 8) (Fig. 14B,D). Finally, the functional impact of
complete inhibition (300 nM apamin) of SK3
channels |
TOP
ABSTRACT
INTRODUCTION
