 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 2001, 21(11):3771-3779
Metabotropic Glutamate Receptor Subtypes 1 and 5 Are Activators
of Extracellular Signal-Regulated Kinase Signaling Required for
Inflammatory Pain in Mice
Farzana
Karim,
Chia-Chuan
Wang, and
Robert W.
Gereau IV
Division of Neuroscience, Baylor College of Medicine, Houston,
Texas 77030
 |
ABSTRACT |
Metabotropic glutamate receptors are expressed abundantly in the
spinal cord and have been shown to play important roles in the
modulation of nociceptive transmission and plasticity. Most previous
studies have focused on the group I metabotropic glutamate receptors (mGluR1 and mGluR5) and activation of phospholipase C
signaling by these receptors in modulating nociception. Recently, it
was shown that the extracellular signal-regulated kinases
(ERKs)/mitogen-activated protein kinases are activated in spinal
cord dorsal horn neurons in response to stimulation of nociceptors and
that ERK signaling is involved in nociceptive plasticity. In the
present studies, we sought to test the hypothesis that group I mGluRs
modulate nociceptive transmission or plasticity via modulation of ERK
signaling in dorsal horn neurons. We show that activation of mGluR1 and mGluR5 leads to activation of ERK1 and ERK2 in the spinal cord. Furthermore, we find that inflammation-evoked ERK activation, which is
required for nociceptive plasticity, is downstream of mGluR1 and
mGluR5. Finally, we show colocalization of group I mGluRs with
activated ERK in dorsal horn neurons. These results show that mGluR1
and mGluR5 are activated in dorsal horn neurons in response to
peripheral inflammation and that activation of these group I mGluRs
leads to activation of ERK1 and ERK2, resulting in enhanced pain sensitivity.
Key words:
extracellular signal-regulated kinases (ERKs); mitogen-activated protein kinase (MAPK); nociception; formalin test; spinal cord; dorsal horn
 |
INTRODUCTION |
The mechanisms associated with
chronic inflammatory conditions, such as painful neuropathy, are not
clearly understood. It is, however, thought that continuous activation
of peripheral afferent fibers by noxious stimulation results in
sensitization of dorsal horn neurons, which can subsequently produce
aberrant activity in primary afferent fibers (Neugebauer et al., 1994 ; Rees et al., 1996 ). Together, the peripheral and central mechanisms contribute to a cycle of persistent nociception. Persistent activation of peripheral afferents may result in central changes in
neurotransmitter release or receptor states, resulting in chronic
nociceptive activation.
Subsequent to activation of sensory neurons, glutamate is released in
the spinal dorsal horn, in which it acts via activation of ionotropic
ligand-gated ion channels and G-protein-coupled metabotropic glutamate
receptors (mGluRs) (Conn and Pin, 1997 ). The eight cloned mGluRs
(mGluR1-mGluR8) are broadly classified into groups I (mGluR1 and
mGluR5), II (mGluR2 and mGluR3), and III (mGluR4, mGluR6, mGluR7, and
mGluR8) based on their sequence homology, pharmacology, and association
with intracellular effector systems (Conn and Pin, 1997 ). Several mGluR
subtypes are expressed in the spinal cord; in particular, there is
strong expression of mGluR5 and possibly mGluR1 in dorsal horn neurons
(Valerio et al., 1997a ,b ; Alvarez et al., 2000 ).
Behavioral studies show that intrathecal application of the mGluR1/5
agonist 3,5-dihydroxyphenylglycine (DHPG) induces spontaneous nociceptive behavior (Fisher and Coderre, 1996a ), as well as thermal hyperalgesia and allodynia in rats, and enhances pain in the second phase of the formalin test (Fisher and Coderre, 1998 ; Fisher et al.,
1998 ). DHPG also potentiates nociceptive responses of spinothalamic tract cells to cutaneous stimuli (Neugebauer et al., 1999 ).
Furthermore, mGluR antagonists reduce sustained nociceptive inputs
evoked by intraplantar formalin in rats and reduce capsaicin-induced
sensitization (Fisher and Coderre, 1996b ; Neugebauer et al., 1999 ).
Finally, antisense knockdown of group I mGluRs reduces responses of
dorsal horn neurons to repeated cutaneous mustard oil applications
(Young et al., 1998 ). Together, these reports suggest a role for group I mGluRs in spinal modulation of nociception.
The cellular mechanisms by which mGluRs modulate nociception are not
clear. Group I mGluRs activate phospholipase C, leading to release of
calcium from intracellular stores and activation of PKC. Although most
studies of group I mGluRs focus on this cascade, recent studies suggest
that they can activate other downstream kinases, such as the
extracellular signal-regulated kinase (ERK)/mitogen-activated protein
(MAP) kinase (Peavy and Conn, 1998 ; Ferraguti et al., 1999 ).
Both ERK1 and ERK2 are expressed in the spinal cord and are activated
in rat dorsal horn neurons after inflammation (Thomas and Hunt, 1993 ;
Ji et al., 1999 ). Inhibitors of ERK signaling reduce pain in the second
phase of the formalin test, suggesting a selective role for ERKs in
nociceptive sensitization (Ji et al., 1999 ).
The studies mentioned above suggest critical roles for ERK signaling
and mGluRs in inflammatory pain plasticity. In the present study, we
test the hypothesis that activation of mGluR1 and/or mGluR5 is
necessary for ERK activation after peripheral inflammation and,
furthermore, that this pathway is necessary for nociceptive sensitization.
 |
MATERIALS AND METHODS |
Animals. All experiments were done in accordance
within the guidelines of the National Institutes of Health and The
International Association for the Study of Pain and were approved by
the Animal Care and Use Committee of Baylor College of Medicine. Male
C57BL/6 mice weighing 20-25 gm were purchased from Baylor College of
Medicine, were housed in 12 hr light/dark cycles, and were given food
ad libitum.
Drug administration. The following compounds were purchased
from Tocris Cookson (Ballwin, MO): (RS)-DHPG, an mGluR1 and
mGluR5-selective agonist, was dissolved in 0.9% saline;
7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester
(CPCCOEt), a noncompetitive mGluR1-selective antagonist, was prepared
as a 50 mM stock solution in an equimolar
solution of NaOH and then diluted in HEPES (100 mM, pH 7.4); and
2-methyl-6-(phenylethynyl)-pyridine (MPEP), a noncompetitive
mGluR5-selective antagonist, was dissolved in HEPES (100 mM, pH 7.4).
2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059), an
MAP kinase kinase (MEK) inhibitor (Sigma, St. Louis, MO), was dissolved
in 10% DMSO. All drugs or their appropriate vehicles were injected
intrathecally in a volume of 3 µl by lumbar puncture using a
Hamilton syringe and 30 gauge needles (Hylden and Wilcox, 1980 ).
Nociceptive testing. The total time spent in spontaneous
pain behavior was recorded after intrathecal injection of
(RS)-DHPG in mice for 5 min. Spontaneous pain behavior was
defined as caudally oriented licking of the flanks, tail, and hindpaws
after intrathecal (RS)-DHPG. In separate experiments, mice
were pretreated intrathecally for 15 min with the mGluR1 or mGluR5
antagonists or vehicle before (RS)-DHPG injection. The
formalin test was done as described previously (Karim et al., 1993 ).
Mice were conditioned in a transparent Plexiglas test box (5 × 5 × 10 inches) before any drug injections for 1 hr. Mice were
pretreated intrathecally for 15 min with the antagonists or appropriate
vehicles. Formalin solution (2%) was injected subcutaneously into the right hindpaw, and the mouse was returned to the test box
immediately. The total time spent in nociceptive behavior (licking and
lifting of the injected paw) was recorded in blocks of 5 min for 1 hr.
Additional experiments were done in which a combination of MPEP and
CPCCOEt was administered intrathecally 15 min before hindpaw formalin injection.
Sample preparation. Mice were killed 5 min after
injection of different doses of (RS)-DHPG or at different
time points after hindpaw formalin injection. The spinal cords were
isolated, and lumbar sections from individual mice were stored at
80°C. Lumbar spinal cord enlargements (L4-S1) were homogenized
using a dounce homogenizer in ice-cold homogenization buffer (50 mM Tris HCl, pH 7.5, 50 mM
NaCl, 10 mM EGTA, 5 mM
EDTA, 2 mM sodium pyrophosphate, 1 mM sodium orthovanadate, 200 µM
paranitrophenylphosphate, 1 mM
phenylmethylsulfonyl fluoride, 20 µg/ml leupeptin, and 4 µg/ml aprotinin; Sigma). Protein concentrations were determined by the DC assay kit (Bio-Rad, Hercules, CA).
Immunoblotting for total and phospho-ERK. Proteins (10 µg)
were electrophoresed in 10% SDS polyacrylamide gels. Proteins were transferred onto protein-sensitive nitrocellulose membranes and blocked
in B-TTBS [3% bovine serum albumin (BSA), 50 mM
Tris-HCl, pH 7.5, 150 mM NaCl, 0.02 mM Na orthovanadate, 0.05% Tween 20, and 0.01%
thimerosal; Sigma] for 2 hr at room temperature. All antibody
applications were done in B-TTBS. An anti-phospho-p44/42 ERK primary
antibody that detects ERK phosphorylation at both Thr202 and Tyr204
(1:1000 dilution in B-TTBS; Cell Signaling Technology, Beverly, MA) was
used for immunoblotting overnight at 4°C. An anti-p44/42 ERK primary
antibody (1:1000 dilution in 3% BSA; Upstate Biotechnology, Lake
Placid, NY) that detects total p44/42 isoforms was used for
immunoblotting for 1 hr at room temperature. The blots were washed and
incubated in HRP-conjugated secondary antibody for 1 hr at room
temperature. Blots were developed with enhanced chemiluminescence (ECL;
Amersham Pharmacia Biotech, Arlington Heights, IL).
Densitometric quantification of immunopositive bands for total or
phospho-p44/42 ERK were done using NIH Image software (Scion Corp.,
Frederick, MD).
Immunocytochemistry for ERK and mGluR. Mice were
anesthetized intraperitoneally with sodium pentobarbital (30 mg/kg).
Eight minutes (determined from time course of ERK activation) after 2%
subcutaneous formalin injection into the hindpaw, mice were perfused
transcardially with warm saline (37°C, 0.9% NaCl), followed by 250 ml of ice-cold 4% paraformaldehyde solution. L4-S1 lumbar spinal cord
sections were dissected out and post-fixed at 4°C for 4 hr with
paraformaldehyde, followed by overnight cryoprotection at 4°C in 30%
sucrose. Tissue sections were embedded in OCT compound (Tissue-Tek,
Miles Inc., Elkhart, IN) and stored at 80°C. Coronal sections (30 µM) were cut using a freezing
sliding microtome, and sections were kept in PBS (pH 7.4) for
immunocytochemistry. Sections were rinsed in 10% methanol and 0.3%
H2O2 in 0.1 M PBS for 30 min and then blocked in 3% normal
goat serum (NGS) with 0.2% Triton X-100 (NGST) two times for 10 min
each. All antibodies were diluted in 1% NGST. Sections were
incubated at 4°C for 36-48 hr in anti-phospho-p44/42 ERK primary
antibody (1:1000 dilution in B-TTBS; Cell Signaling Technology) or an
anti-total p44/42 ERK primary antibody (1:1000 dilution in 3% BSA;
Upstate Biotechnology). Sections were rinsed with 1% NGST two times
for 10 min each, followed by incubation in a secondary biotinylated
anti-rabbit IgG antibody for 90 min (1:200; ABC kit; Vector
Laboratories, Burlingame, CA). Sections were rinsed with 1% NGST two
times for 10 min each and incubated in ExtraAvidin peroxidase (1:1000;
Sigma) for 1 hr at room temperature. Sections were rinsed in 0.1 M PBS two times for 10 min each and then in
phosphate buffer (two times for 10 min each) and stained with
3,3'-diaminobenzidine tetrahydrochloride (DAB) solution (0.025% DAB in
phosphate buffer containing 0.0025% H2O2; Sigma) for 5-10 min.
Sections were mounted onto gelatin-coated glass slides, air-dried,
dehydrated, cleared with xylene, coverslipped with DPX mounting
medium, and observed for total and phospho-ERK staining. For
detection of mGluR5, sections were incubated 36-48 hr at 4°C in
polyclonal anti-mGluR5 primary antibody (1:2000; Upstate
Biotechnology). For mGluR1a immunocytochemistry, sections were
incubated 36-48 hr at 4°C in polyclonal anti-mGluR1a primary antibody (1:2000; DiaSorin, Stillwater, MN). For double-staining of
phospho-ERK and mGluR5, sections were first incubated in rabbit polyclonal anti-mGluR5 antibody at 4°C overnight, rinsed, and then
incubated at 4°C in mouse monoclonal phospho-ERK antibody overnight.
Sections were rinsed and incubated in a mixture of anti-rabbit
IgG-rhodol green or anti-rabbit IgG-Oregon green-488 and anti-mouse
IgG-Cy3 (Molecular Probes, Eugene, OR) at room temperature for 1 hr.
Sections were dried, mounted on slides, and viewed with a confocal
microscope. In all cases in which cell counts were taken, the person
performing the counts was blind to the identity of the treatments.
Separate immunocytochemical experiments were done as described above 5 min (as determined from behavioral and immunoblot experiments) after
intrathecal injection of (RS)-DHPG (10 nmol).
Reverse transcription-PCR. Total RNA was isolated from
dorsal horn of mouse lumbar spinal cord. Tissue was homogenized with disposable plastic pestles in 300 µl of TRIZOL with 250 µg/ml glycogen (Life Technologies, Gaithersburg, MD). The homogenate was
incubated at room temperature for 5 min. Chloroform (160 µl) was
added to the homogenates, vortexed, and centrifuged at 14,000 × g
for 15 min at 4°C. The aqueous phase was carefully pipetted to a
clean tube, and 400 µl of isopropanol was added. The tubes were
incubated at room temperature for 10 min and then centrifuged at
14,000 × g for 10 min at 4°C. The supernatant was decanted, and
the pellet was washed with 1 ml of 75% DEPC ethanol. The pellet was
air dried and resuspended in 50 µl of DEPC water. Sample RNA was
quantified from a standard curve made from the RNA ladder. Reverse
transcription (RT)-PCR was performed according to the manufacturer-recommended protocol (Ready-to-go RT-PCR beads) using random hexamer primers. Annealing of the mGluR-specific primers during
the PCR was performed at 50°C, and extensions were 1 min each for 35 cycles.
RT-PCR was performed using primers based on rat mGluR sequences. The
following C-terminal upstream and downstream primers for mGluR5
(Minakami et al., 1993 ) and upstream and downstream primers for mGluR1
(Soloviev et al., 1999 ) used were as follows: 5aRTPCRU1, 5'
tgagttgcacgttctatgcg 3'; 5aRTPCRD1, 5'ggtactcttctcattctggg 3'; 1a
RTPCRU1, 5' gctccaacaccttcctcaac 3'; and 1aRTPCRD2, 5' acaggccgtctcattggtct 3'.
These primers will amplify all known C-terminal splice variants of
mGluR1 [with the exception of mGluR1c (Soloviev et al., 1999 )] and mGluR5.
Statistical analysis. Time course effects were analyzed
using repeated-measure ANOVA with the Prism statistical program
(Graphpad Software Inc., San Diego, CA). For comparisons of drug
effects from controls, factorial ANOVA was used followed by appropriate post hoc tests. Student's t test was used when
comparisons were restricted to two means.
 |
RESULTS |
As mentioned above, previous studies had indicated that activation
of spinal group I mGluRs leads to nocifensive behaviors in rats.
Furthermore, inflammatory pain plasticity in rats requires ERK
activation and also appears to involve activation of group I mGluRs. In
the present studies, we sought to test the hypothesis that the group I
mGluRs are activated after peripheral inflammation and that this mGluR
activation is necessary for nociceptive-specific activation of ERKs and
the resultant nociceptive plasticity. This hypothesis makes several
predictions: (1) nociceptive activation should elicit an increase in
ERK activation in the spinal cord; (2) activation of spinal mGluRs
should activate ERKs; (3) blockade of spinal group I mGluRs should
reduce the inflammation-evoked increase in ERK activation; and (4)
blockade of spinal group I mGluRs should reduce nociceptive plasticity.
We have tested each of these predictions using a combination of
behavioral, anatomical, and biochemical approaches, described below.
Activation of Group I mGluRs in the spinal cord activates
ERK signaling
Intrathecal injection of (RS)-DHPG in mice induced
spontaneous nocifensive behaviors that included caudally oriented
licking of the flanks, hindpaws, and tail. This increase in nocifensive behaviors was dose dependent and significantly different from vehicle-injected mice at the 1, 10, and 100 nmol doses of
(RS)-DHPG (Fig.
1A). Intrathecal
pretreatment with the mGluR1 antagonist CPCCOEt (50 nmol) or the mGluR5
antagonist MPEP (50 nmol) significantly attenuated
(RS)-DHPG-induced spontaneous nocifensive behaviors (Fig.
1B). In separate experiments, mice were killed 5 min
after injection of intrathecal (RS)-DHPG, and the spinal
cord lumbar sections were homogenized and run on a 10% SDS-PAGE.
Proteins were immunoblotted using a phospho-ERK-selective antibody,
which detects activated forms of both ERK1 and ERK2. A dose-dependent activation of ERK1 and ERK2 was observed (Fig. 1C) when
compared with the vehicle-injected controls. Although both ERK1 and
ERK2 were activated, ERK2 was relatively more strongly activated than ERK1.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
The group 1 mGluR agonist DHPG increases
nociceptive behavior and activates ERK1/2 in mouse spinal cord dorsal
horn. A, Total time (in seconds) spent in spontaneous
nocifensive behaviors after intrathecal injection of
(RS)-DHPG. Mice were given a single intrathecal
injection of various doses of (RS)-DHPG, and the time
spent in nocifensive behaviors was recorded for 5 min.
Points represent the mean ± SEM;
n = 4-5 animals per dose. B, Effect
of the mGluR5 antagonist MPEP and the mGluR1 antagonist CPCCOEt on
DHPG-induced spontaneous nocifensive behavior. Mice were pretreated
intrathecally with 50 nmol of either antagonist 15 min before
intrathecal (RS)-DHPG (1 nmol), and the time spent in
nocifensive behaviors was recorded for 5 min. Points
represent the mean ± SEM; n = 4 animals per
dose. *p < 0.05; **p < 0.01. C, Immunoblot analysis of phosphorylated ERK1 and ERK2
bands in mouse spinal cord homogenates from mice injected intrathecally
with (RS)-DHPG. Points represent the
mean ± SEM densities of phospho-ERK1 and phospho-ERK2 bands
normalized to total ERK for each sample from four separate experiments.
In C, all points are significant at
p < 0.05 compared with vehicle-injected controls,
with the exception of the p44 signal at the 0.1 nmol dose.
|
|
ERK activation is required for inflammatory pain plasticity
in mice
The formalin model is used frequently in the study of inflammatory
pain states in rodents (Tjolsen et al., 1992 ). Injection of 2%
formalin subcutaneously in the hindpaw of mice results in a typical
biphasic nociceptive response (Hunskaar and Hole, 1987 ). The first
phase, usually lasting <5 min, occurs a few seconds after formalin
injection and is characterized by intense licking or lifting of the
injected paw. This phase is attributable to acute stimulation of
nociceptors. The second phase is characterized by licking and lifting
of the injected paw beginning at ~20-25 min after formalin injection
and lasts until ~45-60 min after formalin injection, although the
duration and amplitude of the second phase depends on the concentration
of formalin used. This second phase of inflammatory nociception is
thought to involve central sensitization of dorsal horn neurons, as
well as peripheral sensitization associated with the inflammation
(Coderre and Melzack, 1992 ).
Injection of 2-5% formalin subcutaneously into the hindpaw induces
activation of phospho-ERK in the lumbar spinal cord, as shown
by immunoblotting using the phospho-ERK-selective primary antibody
(Fig.
2A,B).
The phospho-ERK bands were quantitated and normalized to total ERK
immunoblotted from the same samples using an anti-total ERK1/2
antibody. Compared with the contralateral cord, blots of tissue taken
from the side of the cord ipsilateral to the formalin injection showed
significant stimulation of both ERK1 and ERK2 at 3 min after formalin
injection but not when the animals were killed immediately after
formalin injection (Fig. 2B). Similarly, formalin
induced ipsilateral activation of ERK that was localized to cell bodies
and dendrites of dorsal horn neurons as seen in sections probed with
the primary antibody for phospho-ERK (Fig. 2C; see Fig.
6G). We observed no significant contralateral ERK activation
in the cord. Figure 2D shows the time course of the
number of dorsal horn neurons that have detectable levels of
phosphorylated ERK in response to subcutaneous injection of formalin
(2%). There is a time-dependent activation of ERK, which is optimal at
the 3 and 8 min time points. There was no significant change in total
ERK signal (Fig. 2A).

View larger version (62K):
[in this window]
[in a new window]
|
Figure 2.
Subcutaneous injection of formalin in the
hindpaw activates ERK1/2 ipsilaterally in the spinal cord.
A, Representative immunoblot of mouse spinal cord
homogenates using a phospho-ERK1/2 antibody (top) or
total ERK1/2 antibody (bottom). Ipsilateral and
contralateral lumbar spinal cord samples were taken at various time
points after injection of 2% formalin. The arrows show
the position of the 44 kDa (ERK1) and 42 kDa (ERK2) ERK isoforms.
B, Quantitation of ERK activation after injection of
formalin (2-5%). The phospho-ERK (pERK)
bands were densitized and normalized to total ERK immunoblotted from
the same samples using an anti-total ERK1/2 antibody and are expressed
as fold stimulation of phospho-ERK on the ipsilateral side compared
with the contralateral side. n = 7. *p < 0.05 compared with the contralateral side.
C, Immunocytochemistry showing ipsilateral activation of
ERKs 8 min after formalin injection. D, Time course of
the number of dorsal horn neurons positive for phosphorylated ERK after
formalin treatment. Data represent the mean ± SEM of 20 sections
taken from two animals. Vehicle-injected animals showed no
significant phospho-ERK staining (data not shown).
|
|
These results show that ERK1 and ERK2 are strongly activated in spinal
nociceptive pathways in response to inflammation in mice and suggest
that ERK activation may be involved in sensitization. To test this
hypothesis, we pretreated mice with the MEK inhibitor PD98059, which
inhibits ERK activation, and investigated whether this treatment
attenuates nociceptive behaviors in response to formalin-induced
inflammation. We found that intrathecal pretreatment with 25 nmol of
PD98059 for 20 min reduced the time spent in total pain behaviors
(licking and lifting of injected paw) in the second phase of the
formalin test when compared with the vehicle-pretreated mice with no
significant effect on the first phase response (Fig. 3A). Figure 3B
shows significant dose-dependent attenuation of the total time spent in
the second phase by intrathecal PD98059 when compared with
vehicle-pretreated mice.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3.
The MEK inhibitor PD98059 attenuates the second
phase of formalin-induced nociceptive behavior and decreases ERK
activation. A, Effect of a 20 min pretreatment with a
single intrathecal injection of PD98059 (25 nmol) in the mouse formalin
test. B, Effect of 5 and 25 nmol doses of PD98059 in the
second phase of the formalin test (15-30 min). Each bar
represents the mean ± SEM; n = 5-7.
*p < 0.05. C, Effect of PD98059 on
activation of spinal ERK after formalin injection determined by cell
counts of phospho-ERK-positive neurons. n = 3 each.
*p < 0.05.
|
|
Consistent with our hypothesis that the effects of PD98059 are mediated
by MEK inhibition, intrathecal pretreatment with 25 nmol of PD98059 for
20 min attenuated formalin-induced ERK activation as observed in
sections immunostained with phospho-ERK antibody. This attenuation of
ERK activation by PD98059 was statistically significant when compared
with the sections stained from vehicle-pretreated mice (Fig.
3C).
These results are consistent with previous studies in rat and further
show that ERK1 and ERK2 are activated in response to inflammation or
stimulation of group I mGluRs in mouse spinal cord dorsal horn. Because
we have shown that activation of mGluR1 and/or mGluR5 induces pain and
increases activation of ERKs, we wanted to test the hypothesis that
mGluR1 and mGluR5 are necessary upstream activators of ERK by testing
whether antagonists of mGluR1 and mGluR5 attenuate formalin-induced
nociceptive behavior and ERK activation.
Blockade of spinal group I mGluRs reduces inflammation-induced ERK
activation and inflammatory pain plasticity in mice
We tested whether blocking mGluR1 and mGluR5 would reduce
inflammatory pain behaviors in the formalin test. We found that both
the mGluR1 antagonist CPCCOEt and the mGluR5 antagonist MPEP significantly reduced pain behaviors in the second phase of the formalin test in a dose-dependent manner (Fig.
4). Interestingly, we found that, at
higher doses, MPEP (50 nmol) and CPCCOEt (100 nmol) also significantly
attenuated the first phase, suggesting a role for mGluRs in mediation
of both the acute and chronic phases of this model. Intrathecal
coinjection of both CPCCOEt (50 nmol) and MPEP (50 nmol) significantly
attenuated the second phase pain behaviors after subcutaneous formalin
in the hindpaw. Coinjection of the antagonists reduced the second phase
pain behaviors by 47% (p < 0.05) when compared
with the intrathecal vehicle-treated mice. This effect was not
additive, because no significant differences were observed between the
effects of coinjection of MPEP and CPCCOEt versus the effects of either
antagonist injected alone.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 4.
Intrathecal MPEP and CPCCOEt attenuate
formalin-induced nociceptive behavior. A,
C, Time course graphs of 15 min pretreatment with 50 nmol of CPCCOEt and 50 nmol of MPEP. B,
D, Dose-response curves of CPCCOEt
(B) and MPEP (D) on the
first phase (the 5 min time point; filled squares) and
the second phase (sum of 15-30 min points; open
squares). Points represent the mean ± SEM;
n = 5 - 11 per dose.
+p < 0.05 for phase 2 only;
*p < 0.05 for phase 1 and phase 2.
|
|
These results show that mGluR1 and mGluR5 are involved in nociceptive
plasticity after peripheral inflammation. We therefore tested the
hypothesis that this modulation of plasticity was attributable to
decreased ERK activation by the mGluR1/5 antagonists. The effects of
MPEP and CPCCOEt on formalin-induced activation of ERK were investigated. A 15 min pretreatment with either MPEP (50 nmol) or
CPCCOEt (50 nmol) significantly attenuated formalin-induced ERK
phosphorylation detected with immunocytochemistry (Fig.
5).

View larger version (148K):
[in this window]
[in a new window]
|
Figure 5.
Intrathecal MPEP and CPCCOEt attenuate
formalin-induced ERK activation in the spinal cord dorsal horn.
Representative spinal cord lumbar sections immunostained with
phospho-ERK antibody after a unilateral injection of formalin
subcutaneously into the right hindpaw. Mice were pretreated with either
vehicle (A) (100 mM HEPES, pH 7.4) or
MPEP (B) (50 nmol). D and
E show staining of spinal cords from vehicle- and
CPCCOEt-pretreated mice. Quantitation of the total number of
phospho-ERK-positive neurons in the dorsal horn of the lumbar spinal
cord after pretreatment with either vehicle or MPEP
(C) or vehicle or CPCCOEt
(F) before subcutaneous formalin injection.
Bars represent the mean ± SEM;
n = 3-6 for each treatment. *p < 0.05; **p < 0.01.
|
|
Colocalization of inflammation-evoked ERK activation and group
I mGluRs
Given that mGluR antagonists reduce ERK activation after
inflammation, it is reasonable to hypothesize that mGluRs couple to ERK
activation in these dorsal horn neurons. However, it is formally
possible that mGluRs do not couple to ERKs but rather regulate synaptic
transmission in the complex dorsal horn circuitry, leading to increased
ERK activation by other receptors. If mGluRs couple directly to
intracellular ERK activation rather than indirectly through modulation
network activity, then a necessary condition is that the receptors
should be expressed in the cells in which ERK activation occurs. We
therefore investigated the localization of mGluR1 and mGluR5 in
relation to the phosphorylated ERK by costaining spinal cord lumbar
sections with the mGluR5 and phospho-ERK antibody after intrathecal
(RS)-DHPG or subcutaneous formalin injection in the hindpaw.
The pattern of phospho-ERK immunostaining in the dorsal horn neurons
after intrathecal injection of (RS)-DHPG (10 nmol) (Fig.
6A) was very similar to
that seen after subcutaneous injection of formalin in the hindpaw (Fig.
6E). Consistent with previous reports in rat, we
found that mGluR5 staining is localized in the dorsal horn of the mouse
spinal cord (Fig. 6A,E).
Phospho-ERK immunoreactivity is seen as dense staining within cell
somata and dendrites (Fig. 6B-D,
F-H) of mostly the superficial dorsal horn
laminas. Using confocal microscopy, we found that, in many instances, the mGluR5 staining was present as a distinct annulus surrounding phospho-ERK-positive somata, and colocalization could also
be seen in processes.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 6.
Colocalization of phospho-ERK and mGluR5 in mouse
dorsal horn after intrathecal DHPG (10 nmol)
(A-D) or intraplantar formalin injection
(E-H). A, E,
Fluorescence images showing the distribution of mGluR5
(green) and phospho-ERK (red)
immunoreactivity in the lumbar spinal cord dorsal horn 5 min after DHPG
(A) or 8 min after 2% subcutaneous injection of
formalin in the right hindpaw (E).
B and F show higher-power examples
of confocal images showing the distribution of mGluR5
(green) in relation to phospho-ERK
(red) in the dorsal horn. Note that some phospho-ERK
cells also have apparent membrane labeling for mGluR5
(arrows), whereas other phospho-ERK-positive cells
contain no detectable mGluR5 (arrowheads).
C and G show higher magnifications of
phospho-ERK staining of dorsal horn neurons. Note the labeling of
dendritic processes (arrowheads), which are typically
seen when cells are observed using a confocal microscope.
D and H show higher magnification of
additional example neurons with apparent membrane labeling for mGluR5
and somatic phospho-ERK. These images are representative of similar
results obtained from three separate animals.
|
|
Many cells positive for phosphorylated ERK showed no detectable signal
for mGluR5 in the membrane or cytoplasm. It is possible that some of
these mGluR5-negative cells may express mGluR1. However, spinal cord
sections stained with an mGluR1a-selective antibody resulted in no
detectable amounts of mGluR1a in the superficial dorsal horn of the
spinal cord (data not shown). This suggests that mGluR1a may not be
expressed in the superficial dorsal horn neurons, and perhaps different
splice variants of mGluR1 are responsible for the mGluR1-dependent ERK
activation in these dorsal horn neurons. Unfortunately, there are no
commercially available antibodies at present for the other splice
variants of mGluR1.
To examine the expression of other known splice variants of mGluR1, we
performed RT-PCR on total RNA extracted from mouse spinal cord dorsal
horn using primers that amplify mGluR1a, mGluR1b, mGluR1d, and mGluR1f
(Minakami et al., 1993 ; Soloviev et al., 1999 ). Our results from the
RT-PCR show that there are three RNA splice variants of mGluR1 present
in the spinal cord dorsal horn: mGluR1a, mGluR1b, and mGluR1d (Fig.
7A). The relative abundance of
the mGluR1 splice variants in the dorsal horn rank in the order mGluR1a > mGluR1d mGluR1b. These results, combined with the results
showing that CPCCOEt reduces formalin-induced nociceptive plasticity
and formalin-induced activation of ERKs, suggest that mGluR1d or
mGluR1b may be expressed in dorsal horn neurons and responsible for the
behavioral and molecular changes observed. We also confirmed the
presence of the two known splice variants of mGluR5 (mGluR5a and
mGluR5b) in the mouse spinal cord dorsal horn (Fig. 7B),
with mGluR5b being more abundant than the mGluR5a splice variant.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 7.
Expression of various splice variants of
mGluR1 and mGluR5 in mouse spinal cord dorsal horn. RT-PCR
amplification of the alternatively spliced forms of mGluR1
(A) and mGluR5 (B) from
total RNA prepared from dorsal horn of the mouse spinal cord and mouse
cortex. The position of predicted band sizes for mGluR1a, mGluR1b,
mGluR1d, mGluR1f, mGluR5a, and mGluR5b are indicated. Molecular markers
are shown in base pairs.
|
|
 |
DISCUSSION |
The present study reports several important findings. Intrathecal
administration of DHPG, a group I mGluR agonist, stimulated spontaneous
nociceptive behavior that included licking of the flanks, hindpaws, and
the tail. Intrathecal administration of the selective mGluR1 and mGluR5
antagonists CPCCOEt and MPEP, respectively, attenuated DHPG-induced
nociceptive behavior. This suggests that activation of spinal group I
mGluRs generates nociceptive responses. Although a previous study
showed a similar behavioral effect in rats (Fisher and Coderre, 1996b ),
we have extended these findings and have shown that nociceptive
activation by group I mGluRs is correlated with activation of ERK1 and
ERK2 in the spinal cord, identifying this cascade as a potential
mediator of mGluR-induced enhancement of nociception.
Immunoblot analysis of spinal cord homogenates after intrathecal DHPG
revealed a dose-dependent increase in phosphorylation of ERK1 and ERK2,
with stronger activation of ERK2. Stimulation of nociceptive behavior
and activation of ERKs by intrathecal DHPG occurred at similar doses,
suggesting that mGluR1/5 activation in the dorsal horn may induce
nociception through activation of ERKs. Furthermore,
immunocytochemistry using a phospho-ERK-selective antibody localized
the activation of ERKs by DHPG primarily to the superficial dorsal horn
neurons. Spinal ERK activity has been shown to be induced by peripheral
noxious stimuli in rats (Ji et al., 1999 ); however, our data are the
first to report activation of spinal ERKs by selective stimulation of
mGluR1/5.
We found that injection of the inflammatory agent formalin
subcutaneously into the hindpaw of mice stimulates ERK activation in
the ipsilateral dorsal horn. In addition, we found that intrathecal pretreatment with the MEK inhibitor PD98059 decreases the second phase
of formalin-induced nociceptive behavior and decreases dorsal horn ERK
activation. Similar results have been obtained in rats (Ji et al.,
1999 ), but we have extended these findings in mice to show that
inflammatory nociceptive activation correlates with quantitative
increases in activation of both ERK1 and ERK2. We found a more
pronounced and longer-lasting activation of ERKs in response to
formalin than was observed in the previous study. This may relate to
differences in formalin doses, which are difficult to compare because
of differences in species, formalin concentration, and injection volume.
The mGluR5-selective antagonist MPEP and the mGluR1-selective
antagonist CPCCOEt reduced the second phase of the formalin test in a
dose-dependent manner, suggesting that each of these receptor subtypes
contributes to the second phase nociceptive behavior. We also found
that these antagonists attenuated the first phase of the formalin test
at higher doses, suggesting that mGluR1 and mGluR5 are also involved in
acute nociceptive transmission. This is consistent with previous
studies showing a reduction of acute nociceptive transmission by
intravenous MPEP and by group I mGluR antisense knockdown (Young et
al., 1998 ; Bordi and Ugolini, 2000 ). It is interesting to note that,
whereas the mGluR antagonists reduced the first phase, the MEK
inhibitor PD98059 did not. This suggests that, although modulation of
the second phase by group I mGluRs involves ERK activation, the role of
group I mGluRs in acute nociception likely involves a different
signaling pathway. Intrathecal coinjection of both the mGluR1 and
mGluR5 antagonists decreased second phase nociceptive behavior to the
same magnitude as when each antagonist was given alone. The reason for
the lack of an additive effect is not clear. One possibility is that
mGluR1 and mGluR5 are both required for the mGluR-mediated component of
ERK activation induced by nociceptive stimulation. Indeed, we found the
behavioral response to intrathecal DHPG was inhibited by >50% by each
individual antagonist, suggesting functional overlap between these two receptors.
In addition to attenuating inflammatory nociceptive behavior, the group
1 mGluR antagonists also reduced formalin-induced spinal ERK
activation. Attenuation of ERK induction by each antagonist was
partial; this is not surprising because spinal nociceptive processing
is very complex and involves interplay between several neurotransmitters or peptides that originate from descending inputs from the brain, primary inputs from the periphery, and transmission within the dorsal horn itself. Although our data show activation of
ERKs by selective stimulation of spinal mGluR1/5, other glutamate receptors participate in ERK activation; for example, an NMDA receptor
antagonist also decreased formalin-induced spinal ERK activation (Ji et
al., 1999 ). There is evidence that points to interaction between mGluRs
and NMDA receptors, suggesting that NMDA receptor-mediated nociceptive
processing may be regulated by mGluRs (Jones and Headley, 1995 ). It is
possible that part of the mechanism involved in mGluR
antagonist-mediated reduction in ERK activation and nociceptive
plasticity reflects decreased modulation of NMDA receptors. Future
studies will address this possibility.
Attenuation of the inflammatory nociceptive responses by MPEP likely
occurs postsynaptically in neurons of the superficial dorsal horn.
Previous reports have demonstrated the expression of mGluR1 and mGluR5
in the soma and dendrites of rat superficial dorsal horn neurons, as
well as in vesicle-containing profiles (Jia et al., 1999 ; Tao et al.,
2000 ), suggesting that these neurons are apposed closely to nociceptive
primary afferents. In addition, the mGluR5 containing neurons receive
inputs from GABAergic terminals from interneurons in the spinal cord,
perhaps modulating the incoming nociceptive stimuli (Tao et al. 2000 ).
mGluR5 in these neurons may thus have a major role in spinal
nociceptive processing. Our RT-PCR analysis from dorsal horn RNA,
together with the immunolocalization of mGluR5, confirms the expression
of mGluR5a and mGluR5b in laminas I and II of the mouse dorsal horn. We
further investigated the relationship of the ERK-positive dorsal horn
neurons to the distribution of the mGluR1/5 receptors in the spinal
cord dorsal horn and showed that some of the lamina I neurons that show
activated ERK do indeed express mGluR5.
The effects of CPCCOEt are also likely mediated in the dorsal horn
neurons. However, because of lack of commercially available antibodies
that detect all of the different splice variants of mGluR1, we cannot
yet confirm which splice variants of mGluR1 mediate the effects of
CPCCOEt. We and others have found that several commercially available
antibodies for mGluR1a show cross-reactivity with mGluR5 (B. Nadin and
R. W. Gereau, unpublished findings; Jia et al., 1999 ).
There are six known splice variants of mGluR1: mGluR1a, mGluR1b,
mGluR1c, mGluR1d, mGluR1e, and mGluR1f (Soloviev et al., 1999 ). Using
RT-PCR of mouse spinal dorsal horn RNA, we confirm the presence of
three splice variants in the dorsal horn of the mouse spinal cord:
mGluR1a, mGluR1b, and mGluR1d. It seems likely that the superficial
dorsal horn contains mGluR1b and/or mGluR1d because immunocytochemistry
using an antibody selective for mGluR1a shows staining in only the
deeper laminas of the dorsal horn. Thus, attenuation of the
inflammatory nociceptive responses to formalin by CPCCOEt is most
likely mediated via mGluR1b or mGluR1d. A recent study has reported the
expression of low levels of mGluR1b in lamina II neurons (Alvarez et
al., 2000 ). There are no reports to date of mGluR1d expression in the
mouse spinal cord, and our findings are the first that show the
presence of this splice variant in the spinal cord dorsal horn.
The role of ERK pathway in inflammation-induced sensitization is not
clear. Activation of ERKs may regulate transcription of a variety of
gene products, for example, through phosphorylation of the cAMP
response element-binding protein, which has been shown to be activated
in the spinal cord dorsal horn by noxious peripheral stimulation (Ji
and Rupp, 1997 ; Impey et al., 1999 ). Peripheral inflammation by
formalin also causes unilateral increased expression of dynorphin,
enkephalin, neuropeptide Y (NPY), NPY receptor, and galanin mRNAs
(Dubner and Ruda, 1992 ; Ji et al., 1994 , 1995a ,b ; Donaldson et al.,
1995 ; Woolf and Costigan, 1999 ; Ruda et al., 2000 ). Some of these could
result from transcriptional activation by ERKs, because they are all
expressed in the superficial dorsal horn.
Activation of spinal mGluR1 and mGluR5 may increase the excitability of
spinal cord nociceptive neurons, a phenomenon referred to as central
sensitization. Central sensitization may also contribute to mechanisms
that cause secondary hyperalgesia. A recent electrophysiological study
by Neugebauer et al. (1999) has shown that the mGluR1-selective antagonist CPCCOEt reverses capsaicin-induced central sensitization and
blocks modulation by DHPG. Central sensitization may be related to
windup, which is a frequency-dependent increase in excitability of
spinal neurons evoked by electrical stimulation of afferents (Herrero
et al., 2000 ). mGluRs have also been implicated in generation of windup
processes in the spinal cord (Boxall et al., 1996 ; Budai and Larson,
1998 ). Although the relationship between mechanisms of windup and
central sensitization are not understood, our results suggest that the
mGluRs may mediate these effects partly by activation of ERK signaling.
In summary, our data suggest that mGluR1 and mGluR5 in the spinal cord
are involved in functional plasticity during inflammation and that
their modulatory effects involve activation of downstream ERKs. These
mGluRs and the ERKs may therefore be potential targets for novel
treatments for different types of inflammatory pain. Our ongoing
studies include an analysis of downstream targets of ERKs in the dorsal
horn, as well as electrophysiological characterization of the
functional consequences of ERK activation.
 |
FOOTNOTES |
Received Nov. 6, 2000; revised March 12, 2001; accepted March 13, 2001.
This work was supported by National Institutes of Mental Health Grant
MH60230 and The Spinal Cord Research Foundation (to R.W.G.). We thank
Gautam Bhave for his assistance in this project, Brian Nadin for
assistance with the confocal microscopy, and Dr. D. Sweatt for
critically reading this manuscript.
Correspondence should be addressed to Robert W. Gereau IV, Baylor
College of Medicine, Division of Neuroscience, One Baylor Plaza, Room
S636, Houston, TX 77030. E-mail: rgereau{at}bcm.tmc.edu.
C.-C. Wang's present address: Fujen Catholic University, 510 Chung
Cheng Road, Hsinchuang, Taipei Hsien 24205, Taiwan, Republic of China.
 |
REFERENCES |
-
Alvarez FJ,
Villalba RM,
Carr PA,
Grandes P,
Somohano PM
(2000)
Differential distribution of metabotropic glutamate receptors 1a, 1b, and 5 in the rat spinal cord.
J Comp Neurol
422:464-487[Web of Science][Medline].
-
Bordi F,
Ugolini A
(2000)
Involvement of mGluR(5) on acute nociceptive transmission.
Brain Res
871:223-233[Medline].
-
Boxall SJ,
Thompson SW,
Dray A,
Dickenson AH,
Urban L
(1996)
Metabotropic glutamate receptor activation contributes to nociceptive reflex activity in the rat spinal cord in vitro.
Neuroscience
74:13-20[Web of Science][Medline].
-
Budai D,
Larson AA
(1998)
The involvement of metabotropic glutamate receptors in sensory transmission in dorsal horn of the rat spinal cord.
Neuroscience
83:571-580[Medline].
-
Coderre TJ,
Melzack R
(1992)
The contribution of excitatory amino acids to central sensitization and persistent nociception after formalin-induced tissue injury.
J Neurosci
12:3665-3670[Abstract].
-
Conn PJ,
Pin J-P
(1997)
Pharmacology and functions of metabotropic glutamate receptors.
Annu Rev Pharmacol Toxicol
37:205-237[Web of Science][Medline].
-
Donaldson LF,
McQueen DS,
Seckl JR
(1995)
Induction of transcription factor AP2 mRNA expression in rat primary afferent neurons during acute inflammation.
Neurosci Lett
196:181-184[Web of Science][Medline].
-
Dubner R,
Ruda MA
(1992)
Activity-dependent neuronal plasticity following tissue injury and inflammation.
Trends Neurosci
15:96-103[Web of Science][Medline].
-
Ferraguti F,
Baldani-Guerra B,
Corsi M,
Nakanishi S,
Corti C
(1999)
Activation of the extracellular signal-regulated kinase 2 by metabotropic glutamate receptors.
Eur J Neurosci
11:2073-2082[Web of Science][Medline].
-
Fisher K,
Coderre TJ
(1996a)
Comparison of nociceptive effects produced by intrathecal administration of mGluR agonists.
NeuroReport
7:2743-2747[Web of Science][Medline].
-
Fisher K,
Coderre TJ
(1996b)
The contribution of metabotropic glutamate receptors (mGluRs) to formalin-induced nociception.
Pain
68:255-263[Web of Science][Medline].
-
Fisher K,
Coderre TJ
(1998)
Hyperalgesia and allodynia induced by intrathecal (RS)-dihydroxyphenylglycine in rats.
NeuroReport
9:1169-1172[Medline].
-
Fisher K,
Fundytus ME,
Cahill CM,
Coderre TJ
(1998)
Intrathecal administration of the mGluR compound, (S)-4CPG, attenuates hyperalgesia and allodynia associated with sciatic nerve constriction injury in rats.
Pain
77:59-66[Medline].
-
Herrero JF,
Laird JM,
Lopez-Garcia JA
(2000)
Wind-up of spinal cord neurones and pain sensation: much ado about something?
Prog Neurobiol
61:169-203[Web of Science][Medline].
-
Hunskaar S,
Hole K
(1987)
The formalin test in mice: dissociation between inflammatory and non-inflammatory pain.
Pain
30:103-114[Web of Science][Medline].
-
Hylden JL,
Wilcox GL
(1980)
Intrathecal morphine in mice: a new technique.
Eur J Pharmacol
67:313-316[Web of Science][Medline].
-
Impey S,
Obrietan K,
Storm DR
(1999)
Making new connections: role of ERK/MAP kinase signaling in neuronal plasticity.
Neuron
23:11-14[Web of Science][Medline].
-
Ji RR,
Rupp F
(1997)
Phosphorylation of transcription factor CREB in rat spinal cord after formalin-induced hyperalgesia: relationship to c-fos induction.
J Neurosci
17:1776-1785[Abstract/Free Full Text].
-
Ji RR,
Zhang X,
Wiesenfeld-Hallin Z,
Hokfelt T
(1994)
Expression of neuropeptide Y and neuropeptide Y (Y1) receptor mRNA in rat spinal cord and dorsal root ganglia following peripheral tissue inflammation.
J Neurosci
14:6423-6434[Abstract].
-
Ji RR,
Zhang Q,
Law PY,
Low HH,
Elde R,
Hokfelt T
(1995a)
Expression of µ-,
-, and -opioid receptor-like immunoreactivities in rat dorsal root ganglia after carrageenan-induced inflammation.
J Neurosci
15:8156-8166[Abstract]. -
Ji RR,
Zhang X,
Zhang Q,
Dagerlind A,
Nilsson S,
Wiesenfeld-Hallin Z,
Hokfelt T
(1995b)
Central and peripheral expression of galanin in response to inflammation.
Neuroscience
68:563-576[Web of Science][Medline].
-
Ji RR,
Baba H,
Brenner GJ,
Woolf CJ
(1999)
Nociceptive-specific activation of ERK in spinal neurons contributes to pain hypersensitivity.
Nat Neurosci
2:1114-1119[Web of Science][Medline].
-
Jia H,
Rustioni A,
Valtschanoff JG
(1999)
Metabotropic glutamate receptors in superficial laminae of the rat dorsal horn.
J Comp Neurol
410:627-642[Web of Science][Medline].
-
Jones MW,
Headley PM
(1995)
Interactions between metabotropic and ionotropic glutamate receptor agonists in the rat spinal cord in vivo.
Neuropharmacology
34:1025-1031[Web of Science][Medline].
-
Karim F,
Kanui TI,
Mbugua S
(1993)
Effects of codeine, naproxen and dexamethasone on formalin-induced pain in the naked mole-rat.
NeuroReport
4:25-28[Medline].
-
Minakami R,
Katsuki F,
Yamamoto T,
Nakamura K,
Sugiyama H
(1993)
Molecular cloning and the functional expression of two isoforms of human metabotropic glutamate receptor subtype 5.
Biochem Biophys Res Commun
199:1136-1143.
-
Neugebauer V,
Lucke T,
Schaible HG
(1994)
Requirement of metabotropic glutamate receptors for the generation of inflammation-evoked hyperexcitability in rat spinal cord neurons.
Eur J Neurosci
6:1179-1186[Web of Science][Medline].
-
Neugebauer V,
Chen PS,
Willis WD
(1999)
Role of metabotropic glutamate receptor subtype mGluR1 in brief nociception and central sensitization of primate STT cells.
J Neurophysiol
82:272-282[Abstract/Free Full Text].
-
Peavy RD,
Conn PJ
(1998)
Phosphorylation of mitogen-activated protein kinase in cultured rat cortical glia by stimulation of metabotropic glutamate receptors.
J Neurochem
71:603-612[Web of Science][Medline].
-
Rees H,
Sluka KA,
Lu Y,
Westlund KN,
Willis WD
(1996)
Dorsal root reflexes in articular afferents occur bilaterally in a chronic model of arthritis in rats.
J Neurophysiol
76:4190-4193[Abstract/Free Full Text].
-
Ruda MA,
Ling QD,
Hohmann AG,
Peng YB,
Tachibana T
(2000)
Altered nociceptive neuronal circuits after neonatal peripheral inflammation.
Science
289:628-631[Abstract/Free Full Text].
-
Soloviev MM,
Ciruela F,
Chan WY,
McIlhinney RA
(1999)
Identification, cloning and analysis of expression of a new alternatively spliced form of the metabotropic glutamate receptor mGluR1 mRNA1.
Biochim Biophys Acta
1446:161-166[Medline].
-
Tao Y,
Li Y,
Zhao Z,
Johns RA
(2000)
Synaptic relationship of the neurons containing a metabotropic glutamate receptor, MGluR5, with nociceptive primary afferent and GABAergic terminals in rat spinal superficial laminae.
Brain Res
875:138-143[Web of Science][Medline].
-
Thomas K,
Hunt S
(1993)
The regional distribution of extracellularly regulated kinase-1 and -2.
Neuroscience
56:741-757[Web of Science][Medline].
-
Tjolsen A,
Berge OG,
Hunskaar S,
Rosland JH,
Hole K
(1992)
The formalin test: an evaluation of the method.
Pain
51:5-17[Web of Science][Medline].
-
Valerio A,
Paterlini M,
Boifava M,
Memo M,
Spano P
(1997a)
Metabotropic glutamate receptor mRNA expression in rat spinal cord.
NeuroReport
8:2695-2699[Web of Science][Medline].
-
Valerio A,
Rizzonelli P,
Paterlini M,
Moretto G,
Knopfel T,
Kuhn R,
Memo M,
Spano P
(1997b)
mGluR5 metabotropic glutamate receptor distribution in rat and human spinal cord: a developmental study.
Neurosci Res
28:49-57[Medline].
-
Woolf CJ,
Costigan M
(1999)
Transcriptional and posttranslational plasticity and the generation of inflammatory pain.
Proc Natl Acad Sci USA
96:7723-7730[Abstract/Free Full Text].
-
Young MR,
Blackburn-Munro G,
Dickinson T,
Johnson MJ,
Anderson H,
Nakalembe I,
Fleetwood-Walker SM
(1998)
Antisense ablation of type I metabotropic glutamate receptor mGluR1 inhibits spinal nociceptive transmission.
J Neurosci
18:10180-10188[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21113771-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
G. Peng, M. Han, Y. Du, A. Lin, L. Yu, Y. Zhang, and N. Jing
SIP30 Is Regulated by ERK in Peripheral Nerve Injury-induced Neuropathic Pain
J. Biol. Chem.,
October 30, 2009;
284(44):
30138 - 30147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fukuda, S. Hisano, and M. Tanaka
Licking Decreases Phosphorylation of Extracellular Signal-Regulated Kinase in the Dorsal Horn of the Spinal Cord After a Formalin Test
Anesth. Analg.,
October 1, 2009;
109(4):
1318 - 1322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Montana, L. F. Cavallone, K. K. Stubbert, A. D. Stefanescu, E. D. Kharasch, and R. W. Gereau IV
The Metabotropic Glutamate Receptor Subtype 5 Antagonist Fenobam Is Analgesic and Has Improved in Vivo Selectivity Compared with the Prototypical Antagonist 2-Methyl-6-(phenylethynyl)-pyridine
J. Pharmacol. Exp. Ther.,
September 1, 2009;
330(3):
834 - 843.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Kim, C.-K. Park, S. K. Back, C. J. Lee, S. J. Hwang, Y. C. Bae, H. S. Na, J. S. Kim, S. J. Jung, and S. B. Oh
Membrane-Delimited Coupling of TRPV1 and mGluR5 on Presynaptic Terminals of Nociceptive Neurons
J. Neurosci.,
August 12, 2009;
29(32):
10000 - 10009.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-J. Gao, L. Zhang, O. A. Samad, M. R. Suter, K. Yasuhiko, Z.-Z. Xu, J.-Y. Park, A.-L. Lind, Q. Ma, and R.-R. Ji
JNK-Induced MCP-1 Production in Spinal Cord Astrocytes Contributes to Central Sensitization and Neuropathic Pain
J. Neurosci.,
April 1, 2009;
29(13):
4096 - 4108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Cao, Y.-J. Gao, W.-H. Ren, T.-T. Li, K.-Z. Duan, Y.-H. Cui, X.-H. Cao, Z.-Q. Zhao, R.-R. Ji, and Y.-Q. Zhang
Activation of Extracellular Signal-Regulated Kinase in the Anterior Cingulate Cortex Contributes to the Induction and Expression of Affective Pain
J. Neurosci.,
March 11, 2009;
29(10):
3307 - 3321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Ferraguti, L. Crepaldi, and F. Nicoletti
Metabotropic Glutamate 1 Receptor: Current Concepts and Perspectives
Pharmacol. Rev.,
December 1, 2008;
60(4):
536 - 581.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Ferguson, K. A. Bolding, J. R. Huie, M. A. Hook, D. R. Santillano, R. C. Miranda, and J. W. Grau
Group I Metabotropic Glutamate Receptors Control Metaplasticity of Spinal Cord Learning through a Protein Kinase C-Dependent Mechanism
J. Neurosci.,
November 12, 2008;
28(46):
11939 - 11949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-D. Chen, M.-L. Peng, P.-Y. Wang, S.-D. Lee, H.-M. Chang, S.-F. Pan, M.-J. Chen, K.-C. Tung, C.-Y. Lai, and T.-B. Lin
Calcium/calmodulin-dependent kinase II mediates NO-elicited PKG activation to participate in spinal reflex potentiation in anesthetized rats
Am J Physiol Regulatory Integrative Comp Physiol,
February 1, 2008;
294(2):
R487 - R493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Price, M. H. Rashid, M. Millecamps, R. Sanoja, J. M. Entrena, and F. Cervero
Decreased Nociceptive Sensitization in Mice Lacking the Fragile X Mental Retardation Protein: Role of mGluR1/5 and mTOR
J. Neurosci.,
December 19, 2007;
27(51):
13958 - 13967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Hu, B. J. Alter, Y. Carrasquillo, C.-S. Qiu, and R. W. Gereau IV
Metabotropic Glutamate Receptor 5 Modulates Nociceptive Plasticity via Extracellular Signal-Regulated Kinase Kv4.2 Signaling in Spinal Cord Dorsal Horn Neurons
J. Neurosci.,
November 28, 2007;
27(48):
13181 - 13191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. H. Gabra, F. K. Kessler, J. K. Ritter, W. L. Dewey, and F. L. Smith
Decrease in N-Methyl-D-aspartic Acid Receptor-NR2B Subunit Levels by Intrathecal Short-Hairpin RNA Blocks Group I Metabotropic Glutamate Receptor-Mediated Hyperalgesia
J. Pharmacol. Exp. Ther.,
July 1, 2007;
322(1):
186 - 194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mizushima, K. Obata, H. Katsura, J. Sakurai, K. Kobayashi, H. Yamanaka, Y. Dai, T. Fukuoka, T. Mashimo, and K. Noguchi
Intensity-Dependent Activation of Extracellular Signal-Regulated Protein Kinase 5 in Sensory Neurons Contributes to Pain Hypersensitivity
J. Pharmacol. Exp. Ther.,
April 1, 2007;
321(1):
28 - 34.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-Y. Qiao and M. A. Gulick
Region-specific changes in the phosphorylation of ERK1/2 and ERK5 in rat micturition pathways following cyclophosphamide-induced cystitis
Am J Physiol Regulatory Integrative Comp Physiol,
March 1, 2007;
292(3):
R1368 - R1375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Carrasquillo and R. W. Gereau IV
Activation of the Extracellular Signal-Regulated Kinase in the Amygdala Modulates Pain Perception
J. Neurosci.,
February 14, 2007;
27(7):
1543 - 1551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bonnefont, L. Daulhac, M. Etienne, E. Chapuy, C. Mallet, L. Ouchchane, C. Deval, J.-P. Courade, M. Ferrara, A. Eschalier, et al.
Acetaminophen Recruits Spinal p42/p44 MAPKs and GH/IGF-1 Receptors to Produce Analgesia via the Serotonergic System
Mol. Pharmacol.,
February 1, 2007;
71(2):
407 - 415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Zhang, J. C. Fehrenbacher, M. R. Vasko, and G. D. Nicol
Sphingosine-1-Phosphate Via Activation of a G-Protein-Coupled Receptor(s) Enhances the Excitability of Rat Sensory Neurons
J Neurophysiol,
September 1, 2006;
96(3):
1042 - 1052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Volk, C. A. Daly, and K. M. Huber
Differential Roles for Group 1 mGluR Subtypes in Induction and Expression of Chemically Induced Hippocampal Long-Term Depression
J Neurophysiol,
April 1, 2006;
95(4):
2427 - 2438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kawasaki, T. Kohno, and R.-R. Ji
Different Effects of Opioid and Cannabinoid Receptor Agonists on C-Fiber-Induced Extracellular Signal-Regulated Kinase Activation in Dorsal Horn Neurons in Normal and Spinal Nerve-Ligated Rats
J. Pharmacol. Exp. Ther.,
February 1, 2006;
316(2):
601 - 607.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Wei, K. I. Vadakkan, H. Toyoda, L.-J. Wu, M.-G. Zhao, H. Xu, F. W.F. Shum, Y. H. Jia, and M. Zhuo
Calcium Calmodulin-Stimulated Adenylyl Cyclases Contribute to Activation of Extracellular Signal-Regulated Kinase in Spinal Dorsal Horn Neurons in Adult Rats and Mice
J. Neurosci.,
January 18, 2006;
26(3):
851 - 861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, A. L. Rodriguez, and P. J. Conn
Allosteric Potentiators of Metabotropic Glutamate Receptor Subtype 5 Have Differential Effects on Different Signaling Pathways in Cortical Astrocytes
J. Pharmacol. Exp. Ther.,
December 1, 2005;
315(3):
1212 - 1219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Guo, F. Wei, S. Zou, M. T. Robbins, S. Sugiyo, T. Ikeda, J.-C. Tu, P. F. Worley, R. Dubner, and K. Ren
Group I Metabotropic Glutamate Receptor NMDA Receptor Coupling and Signaling Cascade Mediate Spinal Dorsal Horn NMDA Receptor 2B Tyrosine Phosphorylation Associated with Inflammatory Hyperalgesia
J. Neurosci.,
October 13, 2004;
24(41):
9161 - 9173.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.-R. Ji and G. Strichartz
Cell Signaling and the Genesis of Neuropathic Pain
Sci. Signal.,
September 28, 2004;
2004(252):
re14 - re14.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kawasaki, T. Kohno, Z.-Y. Zhuang, G. J. Brenner, H. Wang, C. Van Der Meer, K. Befort, C. J. Woolf, and R.-R. Ji
Ionotropic and Metabotropic Receptors, Protein Kinase A, Protein Kinase C, and Src Contribute to C-Fiber-Induced ERK Activation and cAMP Response Element-Binding Protein Phosphorylation in Dorsal Horn Neurons, Leading to Central Sensitization
J. Neurosci.,
September 22, 2004;
24(38):
8310 - 8321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Gallagher, C. A. Daly, M. F. Bear, and K. M. Huber
Extracellular Signal-Regulated Protein Kinase Activation Is Required for Metabotropic Glutamate Receptor-Dependent Long-Term Depression in Hippocampal Area CA1
J. Neurosci.,
May 19, 2004;
24(20):
4859 - 4864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Li and V. Neugebauer
Differential Roles of mGluR1 and mGluR5 in Brief and Prolonged Nociceptive Processing in Central Amygdala Neurons
J Neurophysiol,
January 1, 2004;
91(1):
13 - 24.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Miyata, H. Kashiwadani, M. Fukaya, T. Hayashi, D. Wu, T. Suzuki, M. Watanabe, and Y. Kawakami
Role of Thalamic Phospholipase C{beta}4 Mediated by Metabotropic Glutamate Receptor Type 1 in Inflammatory Pain
J. Neurosci.,
September 3, 2003;
23(22):
8098 - 8108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Hu, K. S. Glauner, and R. W. Gereau IV
ERK Integrates PKA and PKC Signaling in Superficial Dorsal Horn Neurons. I. Modulation of A-Type K+ Currents
J Neurophysiol,
September 1, 2003;
90(3):
1671 - 1679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Hu and R. W. Gereau IV
ERK Integrates PKA and PKC Signaling in Superficial Dorsal Horn Neurons. II. Modulation of Neuronal Excitability
J Neurophysiol,
September 1, 2003;
90(3):
1680 - 1688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-X. Jin, Z.-Y. Zhuang, C. J. Woolf, and R.-R. Ji
p38 Mitogen-Activated Protein Kinase Is Activated after a Spinal Nerve Ligation in Spinal Cord Microglia and Dorsal Root Ganglion Neurons and Contributes to the Generation of Neuropathic Pain
J. Neurosci.,
May 15, 2003;
23(10):
4017 - 4022.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. F. De Jongh, K. C. Vissers, T. F. Meert, L. H. D. J. Booij, C. S. De Deyne, and R. J. Heylen
The Role of Interleukin-6 in Nociception and Pain
Anesth. Analg.,
April 1, 2003;
96(4):
1096 - 1103.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Berkeley and A. I. Levey
Cell-Specific Extracellular Signal-Regulated Kinase Activation by Multiple G Protein-Coupled Receptor Families in Hippocampus
Mol. Pharmacol.,
January 1, 2003;
63(1):
128 - 135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Anderson, S. P. Rao, B. Rowe, D. R. Giracello, G. Holtz, D. F. Chapman, L. Tehrani, M. J. Bradbury, N. D. P. Cosford, and M. A. Varney
[3H]Methoxymethyl-3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine Binding to Metabotropic Glutamate Receptor Subtype 5 in Rodent Brain: In Vitro and in Vivo Characterization
J. Pharmacol. Exp. Ther.,
December 1, 2002;
303(3):
1044 - 1051.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Hu, G. Bhave, and R. W. Gereau IV
Prostaglandin and Protein Kinase A-Dependent Modulation of Vanilloid Receptor Function by Metabotropic Glutamate Receptor 5: Potential Mechanism for Thermal Hyperalgesia
J. Neurosci.,
September 1, 2002;
22(17):
7444 - 7452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Dai, K. Iwata, T. Fukuoka, E. Kondo, A. Tokunaga, H. Yamanaka, T. Tachibana, Y. Liu, and K. Noguchi
Phosphorylation of Extracellular Signal-Regulated Kinase in Primary Afferent Neurons by Noxious Stimuli and Its Involvement in Peripheral Sensitization
J. Neurosci.,
September 1, 2002;
22(17):
7737 - 7745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Fagni, P. F. Worley, and F. Ango
Homer as Both a Scaffold and Transduction Molecule
Sci. Signal.,
June 18, 2002;
2002(137):
re8 - re8.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|