 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 2001, 21(11):3911-3922
Widespread Expression of Netrin-1 by Neurons and Oligodendrocytes
in the Adult Mammalian Spinal Cord
Colleen
Manitt1,
Michael A.
Colicos1,
Katherine M.
Thompson1,
Etienne
Rousselle1,
Alan C.
Peterson2, and
Timothy E.
Kennedy1
1 Centre for Neuronal Survival, Montreal Neurological
Institute, and 2 Molecular Oncology Group, Royal Victoria
Hospital, McGill University, Montreal, Quebec, Canada, H3A 2B4
 |
ABSTRACT |
Netrins are a family of secreted proteins that function as
chemotropic axon guidance cues during neural development. Here we
demonstrate that netrin-1 continues to be expressed in the adult rat
spinal cord at a level similar to that in the embryonic CNS. In
contrast, netrin-3, which is also expressed in the embryonic spinal
cord, was not detected in the adult. In situ
hybridization analysis demonstrated that cells in the white matter and
the gray matter of the adult spinal cord express netrin-1.
Colocalization studies using the neuronal marker NeuN revealed that
netrin-1 is expressed by multiple classes of spinal interneurons and
motoneurons. Markers identifying glial cell types indicated that
netrin-1 is expressed by most, if not all, oligodendrocytes but not by
astrocytes. During neural development, netrin-1 has been proposed to
function as a diffusible long-range cue for growing axons. We show that in the adult spinal cord the majority of netrin-1 protein is not freely
soluble but is associated with membranes or the extracellular matrix.
Fractionation of adult spinal cord white matter demonstrated that
netrin-1 was absent from fractions enriched for compact myelin but was
enriched in fractions containing periaxonal myelin and axolemma,
indicating that netrin-1 protein may be localized to the periaxonal
space. These findings suggest that in addition to its role as a
long-range guidance cue for developing axons, netrin may have a
short-range function associated with the cell surface that contributes
to the maintenance of appropriate neuronal and axon-oligodendroglial
interactions in the mature nervous system.
Key words:
netrin-1; netrin-3; adult spinal cord; oligodendrocyte; regeneration; multiple sclerosis
 |
INTRODUCTION |
Netrin-1 is a secreted protein
produced by axonal targets during neural development. Appropriate
expression of netrin-1 in vivo is essential for certain
types of axons, such as those of embryonic spinal commissural neurons,
to grow toward a netrin-expressing target (Serafini et al., 1996 ).
Studies examining netrin function in vitro have demonstrated
that netrin-1 is diffusible and can orient axon growth at a distance
from the source of netrin protein. These findings suggest that netrin-1
acts as a long-range chemotropic axon guidance cue during development
(Kennedy et al., 1994 ; Colamarino and Tessier-Lavigne, 1995a ; Shirasaki
et al., 1996 ; Varela-Echavarria et al., 1997 ). Netrins are versatile
cues, attracting the growth cones of some axons and repelling others.
That netrin might be a bifunctional axon guidance cue was first
suggested by the phenotype of Caenorhabditis elegans mutants
lacking UNC-6, the C. elegans homolog of netrin. In
unc-6 mutants, the trajectories of axons growing toward or
away from cells expressing unc-6 were disrupted (Hedgecock
et al., 1990 ; Ishii et al., 1992 ). Two other mutations, unc-40 and unc-5, produce related axon guidance
phenotypes. Both encode transmembrane members of the Ig superfamily,
and both are expressed by neurons as they extend axons
(Leung-Hagesteijn et al., 1992 ; Chan et al., 1996 ). UNC-40 is
homologous to mammalian deleted in colorectal cancer (DCC) (Chan et
al., 1996 ; Keino-Masu et al., 1996 ), and three mammalian UNC-5 homologs
have now been identified (Ackerman et al., 1997 ; Leonardo et al.,
1997 ). Both genetic and biochemical evidence suggest that DCC and UNC-5
family members interact to form a netrin receptor complex mediating the response to netrin-1 (Hedgecock et al., 1990 ; McIntire et al., 1992 ;
Colavita and Culotti, 1998 ; Hong et al., 1999 ).
In addition to their function as long-range axon guidance cues,
evidence derived from genetic analysis in Drosophila
melanogaster supports a short-range role for netrin protein
expressed by muscle cells at some developing nerve muscle synapses
(Winberg et al., 1998 ). Like the long-range chemoattractant function of
netrin-1, this short-range action is also dependent on neuronal
expression of frazzled, the D. melanogaster
homolog of DCC. The mechanisms underlying the similarities and
differences between the short-range and long-range functions of netrins
are not clear; however, these results raised the intriguing possibility
that netrins mediate short-range cell-cell interactions (for review,
see Kennedy, 2000 ).
Here we address the expression and distribution of netrin-1 in the
adult mammalian CNS. We show that netrin-1 is constitutively expressed
by neurons and oligodendrocytes in the adult rat spinal cord and that
the majority of the netrin-1 protein present is not freely soluble but
associated with membranes or extracellular matrix (ECM). Furthermore,
fractionation of adult spinal cord white matter indicates that netrin-1
is enriched in periaxonal myelin, suggesting that netrin-1 protein is
concentrated at the interface between axons and oligodendrocytes. These
findings suggest that, like the role of netrin at nerve muscle
synapses in D. melanogaster, netrin-1 may have a short-range
function that mediates neuronal and axon-oligodendroglial interactions
in the adult CNS.
 |
MATERIALS AND METHODS |
Animals. Adult male Sprague Dawley rats (250-400 gm)
were obtained from Charles River Canada. A transgenic mouse line
in which a lacZ reporter gene replaces exon 1 of the
myelin basic protein (MBP) gene was used to mark the
oligodendrocyte lineage (Bachnou et al., 1997 ). All procedures with
animals were performed in accordance with the Canadian Council on
Animal Care guidelines for the use of animals in research.
Cloning rat netrin-1 and rat netrin-3. Total RNA was
isolated from adult rat spinal cord or embryonic day 18 (E18) rat brain using Trizol (Life Technologies, Gaithersburg, MD) and
poly(A+) RNA purified using the Oligotex
mRNA mini kit (Qiagen). Rat netrin-1 and rat netrin-3 cDNAs were
amplified from randomly primed cDNA and cloned using primers derived
from nucleotide sequences conserved between human and mouse netrins
(Serafini et al., 1996 ; van Raay et al., 1997 ; Meyerhardt et al., 1999 ;
Wang et al., 1999 ). Multiple cDNAs derived from at least three
independent amplifications of each clone were generated using the
Pfu high-fidelity thermostable polymerase (Stratagene, La
Jolla, CA) and were sequenced (Bio S&T) to identify potential
errors that might have been introduced during amplification. No
sequence discrepancies between independent clones were found. For rat
netrin-1 the primer sequences used were as follows:
GCGTGGTGAGCGAGCGTGGTGAAG and CTAGGCCTTCTTGCACTTGCCCTTCT; and for rat
netrin-3 the primer sequences used were the following: TCTGCCGACCCCTGCTATGATGA and GCGGCGGCCAGACAGTCGGTAGAG. Primers were
annealed at 68°C, and 30 cycles of amplification were performed. Sequence alignments were performed using Align analysis software (Dnastar). Additional sequence for rat netrin-1 was obtained from ESTs AW251519, AA859374, and AI502501, and for rat netrin-3 from
EST AI072413. EST cDNAs were obtained from Research Genetics.
Antibodies, immunohistochemistry, and Western blot analysis.
Netrin immunoreactivity was detected using rabbit polyclonal antibodies
PN2 and PN3. PN2 was raised against an 18 amino acid peptide (#11760,
RFNMELYKLSGRKSGGVC) present in rat netrin-1. This sequence is 100%
conserved in netrin-1 of human, mouse, chick, and frog (Serafini et
al., 1994 , 1996 ; de la Torre et al., 1997 ; Meyerhardt et al., 1999 ).
PN3 was raised against domains V and VI of chick netrin-1 that have
>90% amino acid identity between the species listed above. To prevent
nonspecific binding, antibodies were affinity purified and preadsorbed
against acetone-extracted chicken liver protein. No netrin family
members have been detected in extracts of chicken liver (Kennedy et
al., 1994 ).
LacZ expression was visualized using a mouse monoclonal
antibody against -galactosidase ( -gal; dilution, 1:1000;
Promega, Madison, WI). A mouse monoclonal antibody against the
oligodendrocyte marker 2',3'-cyclic nucleotide 3'-phosphodiesterase
(CNP) was used at a dilution of 1:1000 (Sternberger Monoclonals), and a mouse monoclonal antibody against the astrocyte marker glial fibrillary acidic protein (GFAP) was used at a dilution of 1:500 (Sigma). A mouse
monoclonal antibody against the neuronal marker NeuN was used at a
dilution of 1:25 (gift from Dr. Richard Mullen).
For immunohistochemical analyses, adult rats and mice were anesthetized
with sodium pentobarbital (Somnotol; 65 mg/kg, i.p.; MTC
Pharmaceuticals) and perfused transcardially with PBS containing heparin (1 U/ml; Fisher Scientific), followed by 4% paraformaldehyde (Fisher Scientific) and 15% picric acid (Sigma) in PBS, pH 8.5, at
37°C. Spinal cords were dissected and post-fixed in the same fixative
at 4°C overnight and equilibrated in 30% sucrose, 4% paraformaldehyde, and 15% picric acid at pH 8.5. Spinal cords were
then embedded in optimal cutting temperature compound (Tissue Tek;
Sakura Finetek), and 25 µm sections were cut using a cryostat. Free-floating sections were rinsed in PBS for 5 min, and endogenous peroxidase activity was quenched by incubation in 70% methanol and 1%
H2O2 (Fisher Scientific).
Netrin antigenicity was enhanced by gradually heating the sections to
95°C in a 10-fold dilution of PBS in water. Sections were then
returned to PBS. Tissue sections were incubated for 1 hr at room
temperature in blocking solution: 2% bovine serum albumin (ICN
Biomedicals, Cleveland, OH), 2% heat-inactivated normal goat serum
(Life Technologies), and 0.2% Triton X-100 (Fisher Scientific) in PBS.
Sections were incubated with netrin primary antibodies in blocking
solution overnight at 4°C, followed by goat anti-rabbit
peroxidase-conjugated secondary antibody (1:400 dilution; Life
Technologies). Immunoreactivity was visualized using a diaminobenzidene
(DAB) detection kit with nickel chloride enhancement (Vector
Laboratories). For immunofluorescence analysis, primary antibodies were
visualized using secondary antibodies coupled to indocarbocyanine (Cy3)
or FITC (Jackson ImmunoResearch, West Grove, PA). Autofluorescence was
reduced using 0.1% sodium borohydride solution (Fisher Scientific) as
described previously (Clancy and Cauller, 1998 ). Slides were mounted
using Elvanol (DuPont NEN, Wilmington, DE) with 2.5%
1,4-diazabicyclo[2,2,2]octane (Sigma).
For Western blots, netrin antibodies PN2 and PN3 were used at
concentrations of 1.0 and 0.7 µg/ml, respectively. We used the following rabbit polyclonal antibodies raised against the endoplasmic reticulum (ER) integral membrane protein calnexin (gift of Dr. John M. Bergeron) at a dilution of 1:2000, the ER resident protein BiP (gift of
Dr. Linda Hendershot) at a dilution of 1:1000 (Hendershot et al.,
1995 ), the 160 kDa membrane sialoglycoprotein (MG-160) of the medial
cisternae of the Golgi apparatus (gift of Dr. N. K. Gonatas) at a
dilution of 1:1000 (Croul et al., 1990 ), and the plasma membrane
protein trk-B (gift of Dr. Louis Reichardt) at a dilution of 1:2000.
The following mouse monoclonal antibodies were used: anti-CNP at a
dilution of 1:100,000 (Sternberger Monoclonals), anti-MBP at a dilution
of 1:500 (Chemicon International, Temecula, CA), anti-neurofilament-145
(NFM) at a dilution of 1:50,000 (Chemicon International), and
anti-myelin-associated glycoprotein (MAG) at a dilution of 1:100,000
(gift of Dr. Peter E. Braun).
Protein homogenates were separated using 10% PAGE and transferred to
immobilon (Millipore, Bedford, MA) or nitrocellulose membrane (Amersham
Pharmacia Biotech). Membranes were incubated in 5% milk powder, 1%
glycine (Fisher Scientific), 0.1% Tween 20 (Fisher Scientific), 3%
heat-inactivated normal goat serum (Life Technologies), and 0.1% SDS
(Fisher Scientific) for 1 hr at room temperature, followed by
incubation with primary antibodies overnight in blocking solution at
4°C. Immunoreactivity was visualized using peroxidase-conjugated
donkey anti-rabbit or donkey anti-mouse secondary antibodies (1:4000;
Jackson ImmunoResearch) and the Chemiluminescence Reagent Plus protein
detection kit (NEN). Densitometry and quantification of the relative
level of netrin protein were performed on scanned images of immunoblots
(Epson ES 1200C) using NIH Image software (National Institutes of Health).
In situ hybridization. Sense and antisense cRNA probe
pairs corresponding to 933 bases of rat netrin-1, nucleotides
882-1815, were used. A shorter antisense transcript corresponding to
nucleotides 852-1046 in rat netrin-1 produced a pattern of
hybridization identical to that of the antisense probe described above
(data not shown). For probe synthesis, cDNA templates were isolated
from agarose gels, and cRNA transcription was performed using
polymerases T7 (New England Biolabs, Beverly, MA) or T3 (Promega) and
digoxigenin (DIG) RNA labeling mix (Roche Products).
After transcardial perfusion with 150 ml of PBS, pH 7.5, and heparin (1 U/ml) at 37°C, spinal cords were rapidly dissected and frozen by
immersion in 2-methylbutane (Fisher Scientific) chilled in liquid
nitrogen. Five micrometer cryostat sections were mounted onto slides
(Superfrost Plus; Fisher Scientific) and fixed by immersion in 4%
paraformaldehyde and 15% picric acid, pH 8.5, in PBS for 45 min at
room temperature. Sections were then rinsed in 2× SSC, equilibrated
for 5 min in 10 mM triethanolamine (Fisher Scientific), and
incubated in 0.25% acetic anhydride (Sigma) in 10 mM
triethanolamine for 10 min at room temperature. In situ hybridization was performed as described previously (Braissant and
Wahli, 1998 ) using DIG-labeled probes. Sections were transferred to
prehybridization solution (50% formamide, 5× SSC, 5× Denhardt's, 1% SDS, and 40 µg/ml single-stranded salmon sperm DNA) for 20 min at
room temperature. Hybridization was performed in 100 µl of solution
containing 200 ng of probe in 50% formamide, 5× SSC, and 40 µg/ml
single-stranded salmon sperm DNA, overnight at 57°C. Sections were
then washed in 2× SSC at room temperature followed by a wash in 2×
SSC for 1 hr at 65°C. Hybridization was detected using a
peroxidase-coupled antibody against DIG (Roche Products), amplified
using the TSA-Indirect (ISH) Tyramide Signal Amplification kit (NEN),
and visualized with peroxidase/DAB detection (Vector Laboratories).
Northern blot analysis.
Poly(A+) RNA was isolated from spinal
cord, the cervical through thoracic region.
[ -P32]dCTP was incorporated into a
462 base pair rat netrin-1 cDNA probe by PCR (5' primer,
GCGTGCGCGACCGAGACGACAGT; 3' primer, TGGGGGAGCGGCTCTGCTGGTAGC), and
the probe was purified using a NucTrap column (Stratagene). Two
micrograms of poly(A+) RNA were separated
on a 1% formaldehyde-agarose gel, capillary blotted to Hybond N
membrane (Amersham Pharmacia Biotech), and probed using standard
methods (Ausubel et al., 1990 ).
Subcellular fractionation. Subcellular fractionation of
protein derived from total adult rat spinal cords was performed
essentially as described for embryonic chick brain (Serafini et al.,
1994 ). Spinal cords were homogenized in a glass-glass Potter-Elvehjem homogenizer on ice using 5 ml of homogenization buffer [320
mM sucrose, 10 mM HEPES, pH 7.5, and protease
inhibitors (1 mM EDTA, 2 µg/ml leupeptin, 2 µg/ml
aprotinin, 1 µg/ml pepstatin, and 2 mM PMSF)].
Homogenization consisted of two sets of 15 strokes with a 5 min pause
between the sets. Crude homogenates were centrifuged at 1000 × g
at 4°C for 10 min (low-speed spin). The low-speed pellet (LSP) and an
aliquot of the low-speed supernatant (LSS) were stored at 80°C. The
remainder of the LSS was centrifuged at 10,000 × g at 4°C for
10 min (medium-speed spin). The medium-speed supernatant 1 (MSS1) was
stored on ice, and the first medium-speed pellet (MSP1) was resuspended
in resuspension buffer (RB; 10 mM HEPES, pH 7.5, and
protease inhibitors) and centrifuged again at 10,000 × g at 4°C
for 10 min. The final MSP was resuspended in RB and stored at 80°C;
the second medium-speed supernatant (MSS2) was pooled with the first
(MSS1), and an aliquot of the medium-speed supernatant (MSS) was stored
at 80°C. The remainder of the pooled MSS was centrifuged at
230,000 × g at 4°C for 35 min (high-speed spin). The high-speed
supernatant (HSS) containing soluble protein was stored at 80°C.
The high-speed pellet (HSP) was resuspended in high-salt extraction
buffer (HSEB; 1.5 M NaCl, 10 mM HEPES, pH 7.5, and protease
inhibitors); an aliquot was stored at 80°C, and the remainder was
incubated for 1 hr rotating at 4°C. High-salt extract was then
centrifuged at 100,000 × g for 2 hr yielding the high-salt
extract pellet (HSEP) and high-salt extract supernatant (HSES).
Myelin fractionation. Myelin fractionation was performed on
the basis of a protocol described by Detskey et al. (1988) as modified
by Sapirstein et al. (1992) . Spinal cords were dissected from 10 adult
rats (350-400 gm). All homogenizations were performed using a Dounce
homogenizer (Fisher Scientific). The initial homogenization consisted
of six strokes with a loose pestle, followed by four strokes with a
tight pestle, in ice-cold buffer containing 0.9 M sucrose,
150 mM NaCl, and 10 mM HEPES, pH 7.5. The
volume was brought to 210 ml, and protease inhibitors were added (5 mM EDTA, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 µg/ml pepstatin, and 2 mM PMSF). Homogenates (fraction 1)
were then centrifuged at 82,500 × g for 25 min at
4°C. The crude myelin fraction was isolated as a pellet floating at
the top of the sucrose solution (fraction 2). The crude gray matter
fraction pelleted at the bottom of the tube (fraction 3). Crude myelin
pellets were then rehomogenized with six strokes of a loose pestle,
followed by four strokes with a tight pestle, in 210 ml of ice-cold
0.85 M sucrose containing protease inhibitors.
The homogenate was then spun at 82,500 × g for 25 min
at 4°C. The resulting floating pellets were rehomogenized in osmotic
shock buffer containing 10 mM HEPES, pH 7.4, 5 mM EDTA, and protease inhibitors to separate
myelin from crude periaxolemma. Homogenates were gently rotated for 1.5 hr at 4°C, layered onto a discontinuous sucrose gradient composed of
15, 24, 28, 32, and 37% sucrose, and then centrifuged at 82,500 × g for 13 hr at 4°C. The myelin fraction (fraction 4)
was collected from the 15-24% interface, and the crude periaxolemmal
fraction (fraction 5) was from the 28-32% interface. To remove
residual nonmyelin microsomal contaminants, the myelin fraction was
osmotic shocked twice in ddH2O and sedimented at
12,000 × g. After the second sedimentation the pellet
was resuspended in ddH2O, layered over a 0.75 M sucrose solution, and centrifuged at
75,000 × g for 1.5 hr at 4°C. The purified myelin
fraction (fraction 6) was collected from the
ddH2O-0.75 M interface.
The crude periaxolemmal fraction was lysed for 30 min in 5 mM Tris-HCl, pH 8.3, 5 mM
EDTA, and protease inhibitors. After lysis, one-quarter of the volume
of 40% sucrose was added and then layered over a sucrose gradient
composed of 0.65, 0.8, and 1.0 M sucrose and
centrifuged at 75,000 × g for 1.5 hr. The periaxonal
myelin fraction (fraction 7) was collected from the 0.65-0.8
M interface, and the axolemma fraction (fraction
8) was collected from the 0.8-1.0 M interface.
Protein content was quantified using the BCA protein assay kit (Pierce,
Rockford, IL), and the fractions were assayed using PAGE and Western
blot analysis.
 |
RESULTS |
Netrin-1 is expressed in the adult mammalian spinal cord
Identical 1.6 kb rat netrin-1 cDNAs were amplified from adult rat
spinal cord and brain poly(A+) RNA.
Additional 5' sequence was obtained from ESTs AW251519 and AI502501
(Bonaldo et al., 1996 ). The sequence obtained encodes a full-length
open-reading frame 98% identical to the predicted amino acid sequence
of mouse netrin-1 (Serafini et al., 1996 ) but only 52% like that of
mouse netrin-3 (Wang et al., 1999 ). A previously identified rat cDNA
sequence [163 nucleotides (Livesey and Hunt, 1997 )] homologous to
netrin-1 was contained within this sequence. We were unable to amplify
a rat netrin-3 from adult rat spinal cord, but we were able to amplify
a rat netrin-3 cDNA from E18 rat brain
poly(A+) RNA. Additional 5' sequence of
rat netrin-3, including the translation start site, was obtained from
EST AI072413 (Bonaldo et al., 1996 ). The sequence of amino acids
encoded by the 1030 base pair cDNA is >96% identical to the predicted
amino acid sequence of mouse netrin-3 (Wang et al., 1999 ).
Northern blot analysis of poly(A+) RNA
derived from E14 rat brain and adult rat spinal cord revealed a single
~6 kb mRNA corresponding to netrin-1 (Fig.
1B). The amount of mRNA
detected indicates that netrin-1 is expressed at similar levels in the
adult and embryonic CNS. In agreement with our inability to amplify a
rat netrin-3 cDNA from adult spinal cord mRNA, Northern blot analysis
of rat netrin-3 expression in E14 brain and adult spinal cord mRNA
produced a detectable signal only in the E14 sample (Fig.
1B). We conclude that members of the netrin family
are differentially expressed in the embryonic and adult CNS with
netrin-1 expressed at readily detectable levels in the adult.

View larger version (103K):
[in this window]
[in a new window]
|
Figure 1.
Distribution of netrin-1-expressing cells in adult
rat spinal cord. A, Illustration of a hemisection of an
adult rat spinal cord [adapted from Paxinos (1995) ] is shown. The
boxes correspond to the regions displayed in the
micrographs of dorsal spinal cord (C, top
box in A) and ventral spinal cord
(D, bottom box in
A). B, Northern blot analysis of
E14 rat brain and adult rat spinal cord poly(A+) RNA
(2 µg of RNA) identified a single ~6 kb mRNA transcript encoding
netrin-1, and for netrin-3 identified a major transcript at ~9 kb and
several minor transcripts only in the E14 brain. Netrin-3 is not
expressed at detectable levels in the adult spinal cord. RNA size
standards correspond to 9.49, 7.46, 4.40, 2.37, 1.35, and 0.24 kb (Bio-Rad, Hercules, CA). Western blot analyses of protein
present in a high-salt extract of the membrane fraction of adult rat
spinal cord homogenate using antibodies PN2 or PN3 are shown. Both
antibodies reveal an ~75 kDa immunoreactive band, consistent with the
molecular weight of netrin-1. The additional minor lower-molecular
weight immunoreactive bands may be proteolytic fragments of full-length
netrin protein. Protein size standards correspond to 116, 97.4, 66.2, 45, and 31 kDa (Bio-Rad). C-G, In situ
hybridization analysis identified netrin-1-expressing cells in all
laminas and the white matter of dorsal (C) and
ventral (D) hemisections of C5 spinal cord.
E illustrates the morphology of netrin-1-expressing
cells in lamina IV of the dorsal horn. Hybridization was detected in
the cytoplasm and the proximal portion of neurites. Large neurons in
the ventral horn with the morphological characteristics of motoneurons
express netrin-1 (D, F).
Netrin-1-positive cells were also detected throughout the white matter
(C, D). G illustrates the morphology of
netrin-1-positive cells located in ventral C5 white matter. Like the
neurons in E and F, positive
hybridization was detected in the cytoplasm and proximal processes of
these glial cells. The small inset in C
illustrates the absence of hybridization using the corresponding sense
cRNA probe. C-G, Differential interference contrast
(DIC) optics, digoxigenin-labeled probe visualized with a
POD-conjugated secondary antibody against digoxigenin and the
diaminobenzidine substrate, is shown. Objective magnification:
C, D, 10×; E, F, 40×; G,
100×. Scale bars: C, D, 150 µm; E, F,
50 µm; G, 25 µm. GAPDH,
Glyceraldehyde-3-phosphate dehydrogenase.
|
|
To characterize the expression of netrin protein we performed Western
blot analysis of adult spinal cord homogenates using affinity-purified
polyclonal antibodies raised against two different netrin-1 antigens.
Antibody PN2 was raised against a peptide epitope conserved in all
mammalian orthologs of netrin-1 identified to date (Serafini et al.,
1996 ; Meyerhardt et al., 1999 ). However, two conservative amino acid
substitutions are present in the corresponding 19 amino acid sequence
in human, rat, and mouse orthologs of netrin-3 (van Raay et al., 1997 ;
Wang et al., 1999 ). Antibody PN3 was raised against purified
recombinant protein corresponding to domains V and VI of chick
netrin-1, an ~430 amino acid sequence highly conserved in all
identified vertebrate netrin-1 orthologs. Western blot analysis
demonstrated that in addition to netrin-1, both PN2 and PN3 bind
recombinant mouse netrin-3 (data not shown). Analysis of adult rat
spinal cord homogenates using antibodies PN2 and PN3 revealed the
presence of an ~75 kDa band consistent with the molecular weight of
netrin-1 (Fig. 1B). In addition, preadsorption of PN2
or PN3 with a molar excess of recombinant netrin-1 protein abolished
all staining on Western blots or tissue sections (data not shown).
Because of the absence of detectable netrin-3 expression in the adult
spinal cord, the high level of netrin-1 expression, and the molecular
weight of the immunoreactive band, we conclude that immunoreactivity
detected by antibodies PN2 and PN3 in homogenates of adult spinal cord
corresponds to netrin-1.
Recently, two additional members of the netrin family have been
identified in mammals: netrin-4 (Koch et al., 2000 ; Yin et al.,
2000 ) and netrin-G1 (Nakashiba et al., 2000 ).
Netrin-4 is more closely related to the chain of laminin than it is
to netrin-1 and netrin-3, which are more closely related to the chain of laminin. In mouse netrin-4, 7 of 18 amino acids are conserved in the sequence used to generate antibody PN2. This sequence is absent
from mouse netrin-G1. The poor conservation of this epitope indicates
that it is unlikely that antibody PN2 recognizes these netrins.
Neurons and oligodendroglia express netrin-1 in adult
spinal cord
To identify the cell types that express netrin-1 in the adult rat
spinal cord, the distribution of netrin-1 mRNA was investigated using
in situ hybridization analysis. An antisense netrin-1
riboprobe (933 nucleotides) detected positively hybridizing cells in
all laminas of the gray matter and throughout the white matter (Fig. 1C-G). A second netrin-1 antisense riboprobe (196 nucleotides) detected an identical pattern of hybridization (data not
shown). Corresponding sense probes produced no signal (Fig.
1C, inset). The morphology and distribution of
many positive cells suggested that they were neurons (Fig.
1E,F); however, the presence of
netrin-1-expressing cells in the white matter indicated that certain
glia may also constitutively express netrin-1 (Fig. 1G).
The distribution of netrin protein in the adult spinal cord was
assessed using the affinity-purified antibody PN2.
Netrin-immunoreactive cells were present in the white matter and all
laminas of the spinal cord (Fig. 2).
These results are consistent with the distribution of
netrin-1-expressing cells detected using in situ
hybridization (Fig. 1). Particularly high levels of immunoreactivity
were found in the dorsal horn. Strongly labeled cells with the
morphological characteristics of spinal interneurons were present in
the most superficial laminas (Fig. 2A,C) and in the
neck of the dorsal horn (Fig. 2A,D). In addition to
cell body staining, significant immunoreactivity was also detected in
the neuropil. Much of this staining was fibrous, suggesting an
association between netrin protein and neurites (Fig.
2A,C,D). Although present throughout the gray matter
of the spinal cord, this pattern of staining was particularly clear in
the lateral spinal nucleus and lateral cervical nucleus. These nuclei
contained a web of netrin-immunoreactive processes with morphological
characteristics of dendrites and larger immunopositive neurites with a
beads-on-a-string appearance characteristic of synaptic varicosities
(Fig. 2F). Cell bodies and processes of motor neurons
in the ventral horn were also clearly netrin immunoreactive. This
staining included neurites within the gray matter with dendritic
morphology and immunopositive axons projecting out of the gray matter
(Fig. 2B,E).

View larger version (160K):
[in this window]
[in a new window]
|
Figure 2.
Distribution of netrin-1 protein in adult rat
spinal cord. A, B, Distribution of netrin-1
immunoreactivity in dorsal (A) and ventral
(B) C7 adult rat spinal cord is shown. Netrin-1
immunoreactivity was associated with a heterogeneous population of cell
bodies throughout the spinal gray matter and a uniform population in
the white matter. C, D, F, Fibrous and punctate
immunoreactivity was detected in the neuropil (C, D),
including immunoreactivity associated with fine processes and with
larger neurites that have a beads-on-a-string morphology characteristic
of synaptic varicosities (F; cervical nucleus and
lateral spinal nucleus at C7). E, In the ventral horn of
the gray matter, netrin-immunoreactive cell bodies and processes
characteristic of motoneurons were detected. A, B, In
the white matter, a uniform population of small cell bodies and their
processes were netrin-1 positive. Bright-field optics, visualized with
a POD-conjugated secondary antibody and diaminobenzidine substrate, is
shown. Objective magnification: A, B, 10×;
C-F, 40×. Scale bars: A, B, 100 µm;
C-E, 50 µm; F, 30 µm.
|
|
Sections of rat spinal cord were then double-labeled with antibodies
against netrin and immunohistochemical markers for neuronal or glial
cells. Double labeling using a monoclonal antibody against the
neuronal-specific antigen NeuN and the polyclonal netrin antibody PN2
confirmed that many of the immunopositive cells in the adult spinal
cord gray matter were neurons (Fig. 3).
However, a subset of small netrin-positive, NeuN-negative cells in the
gray matter were morphologically similar to the netrin-1-expressing
cells present in white matter.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3.
Netrin-1 expression by neurons.
Coimmunolabeling for netrin (PN2) and the neuronal marker NeuN
illustrates a close association of netrin protein with neurons in all
laminas of the adult spinal cord. Hemisections of C7 rat dorsal spinal
cord (A, B) and ventral spinal cord
(C, D) are double immunolabeled for netrin (A,
C) and the neuronal-specific marker NeuN (B, D).
In the gray matter, many NeuN-positive neurons are netrin positive;
however NeuN-negative, netrin-positive cells are also present
throughout the gray and the white matter. Confocal microscopy, with
Cy3- and FITC-coupled secondary antibodies, is shown. Objective
magnification, 10×. Scale bars, 250 µm.
|
|
Immunohistochemical markers that differentiate between glial cell types
were used to identify the netrin-1-expressing cells in the spinal white
matter. No colabeling was found between netrin-1-positive cells and
GFAP-positive astrocytes (Fig. 4). In
contrast, an antibody against the oligodendroglial marker CNP (Vogel
and Thompson, 1988 ) labeled all of the netrin-immunoreactive cells
observed in the white matter of the adult rat spinal cord (Fig.
5F-H).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4.
Netrin-1 is not expressed by astrocytes.
Double immunolabeling for netrin and the astrocytic marker GFAP
indicates that netrin is not expressed by astrocytes. A,
The distribution of netrin protein (red) in the ventral
spinal cord of an adult rat. The dashed line delineates
the border between the gray matter of the ventral horn
(above) and the spinal white matter. B,
The distribution of astrocytes indicated by GFAP immunoreactivity
(green). C, The absence of
colabeling between netrin-immunoreactive cells in spinal white matter
and GFAP-positive astrocytes. D, A magnification of the
central portion of C, illustrating that although the
GFAP-positive and netrin-1-positive processes are often intertwined,
they are distinctly separate. Confocal microscopy, with Cy3- and
FITC-coupled secondary antibodies, is shown. Objective magnification,
20×. Scale bar, 100 µm.
|
|

View larger version (100K):
[in this window]
[in a new window]
|
Figure 5.
Oligodendroctyes express
netrin-1 in the adult spinal cord. A, In
situ hybridization showing the distribution of
netrin-1-expressing cells in white matter at the ventral edge of the
adult rat cervical spinal cord. B, Distribution of
netrin immunoreactivity in a similar section of cervical spinal cord.
A and B are visualized with POD and DAB.
C-E, A transgenic mouse line that marks the
oligodendroglial lineage by expression of lacZ used to
determine the relationship between netrin-1 expression and
oligodendrocytes. D, Confocal analysis of netrin-1
immunoreactivity (red, Cy3-conjugated secondary
antibody). E, -Gal immunoreactivity marking
oligodendrocytes (green, FITC-conjugated
secondary antibody). C, Superimposition of
D and E showing netrin-1-immunoreactive
oligodendrocytes. F-H, Confocal image analysis of
double-labeled immunoreactivity in the adult rat spinal cord of netrin
and the oligodendrocyte marker CNP. G, Netrin-1
immunoreactivity (red, Cy3-conjugated secondary
antibody). H, Distribution of CNP immunoreactivity
(green, FITC-conjugated secondary antibody).
A, DIC optics. B, Bright-field optics,
POD-conjugated secondary antibody and DAB. C-H,
Confocal microscopy. Objective magnification: A, B,
40×; C-H, 100×. Scale bars: A, B, 50 µm; C-H, 25 µm.
|
|
To confirm the identity of these cells, we used a line of mice carrying
a transgene that marks the oligodendrocyte lineage. These mice contain
a lacZ reporter gene that has been "knocked in" and
replaces the first exon of the MBP gene (Bachnou et al., 1997 ). LacZ expression is driven by the endogenous MBP
promoter, and -gal accumulation serves as a sensitive marker to
identify oligodendrocytes. Although the interrupted locus is null for
MBP and mice lacking MBP have the shiverer phenotype because
of myelin deficiency (Roach et al., 1985 ), heterozygous knock-in
mice are normal and were used for our analysis. Netrin-1
immunoreactivity colocalized with -gal immunoreactivity in both the
white (Fig. 5C-E) and the gray matter (data not shown) of
the spinal cord. In both adult rats and the MBP-lacZ transgenic mice,
extensive analysis of colabeling along the full rostrocaudal extent of
the spinal cord showed no discordance between the coexpression of oligodendrocyte markers and netrin, indicating that most, if not all,
oligodendrocytes in the adult spinal cord constitutively express
netrin-1.
Time course of postnatal netrin expression
We performed a developmental time course of postnatal netrin-1
protein expression in the rat spinal cord using Western blot analysis
(Fig. 6A). Similar
amounts of full-length netrin-1 protein were detected in the newborn
[postnatal day 0 (P0)] through to adulthood. A small but distinct
shift (~80 to ~75 kDa) in the mobility of netrin-1 protein occurs
at approximately P14. We have found no evidence that netrin-1 mRNA is
alternatively spliced in either the developing or adult CNS, raising
the possibility that netrin-1 may undergo different post-translational
processing in the embryo compared with the adult, possibly by limited
proteolysis or differential glycosylation. Several potential N-linked
glycosylation sites are conserved in mammalian netrin-1 sequences.
Although the ~75 kDa band is the predominant species found in the
adult, the enrichment produced by subcellular fractionation (described below) revealed the presence of both immunoreactive bands in the adult
nervous system (Fig. 6B, lane 8). It may
be the case that both variants are produced in the adult CNS or
alternatively that the higher molecular weight protein corresponds to
protein produced earlier in development that persists in the adult.
Currently, little is known about the half-life of netrin-1 protein in
any context.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 6.
Postnatal expression and subcellular
enrichment of netrin protein. A, Western blot analysis
of total spinal cord homogenates illustrates a developmental time
course of netrin protein expression in postnatal and adult rat spinal
cord. Lane 1 is derived from newborn rat spinal cord;
lanes 2-4 are from P7, P14, and adult spinal cord,
respectively. A small but distinct shift in the mobility of netrin
occurs at approximately P14 (~80 to ~75 kDa). PAGE (10%) was used
to separate ~30 µg of total protein loaded per lane.
B, After homogenization of adult rat spinal cords, the
low-speed spin yields an LSP (lane 1) and an LSS
(lane 2). The medium-speed spin of the LSS yields an MSP
(lane 3) and an MSS (lane 4). The
high-speed spin of MSS yields the HSP (lane
5) containing microsomes and an HSS (lane
6) containing soluble proteins. High-salt extraction of
the HSP and high-speed centrifugation yields the HSEP containing
stripped microsomes, transmembrane proteins, and the microsomal
contents (lane 7) and the HSES containing
solubilized membrane-associated proteins (lane 8). PAGE
(10%) was used to separate ~20 µg of total protein loaded per
lane. The same nitrocellulose membrane was reprobed
multiple times to visualize the different markers shown. Below the
immunoreactivity for netrin and each of the markers, the same blot is
shown stained with Ponceau S, illustrating that comparable amounts of
protein are present in each lane. The
arrow indicates the approximate molecular weight of
netrin-1. Molecular weight markers correspond to 116, 97.4, 66.2, 45, and 31 kDa.
|
|
Netrin-1 protein is membrane-associated in the adult
spinal cord
The subcellular distribution of netrin-1 protein was identified
using fractionation by differential centrifugation of adult rat spinal
cord homogenates (Fig. 6B). We followed the initial steps of a netrin purification protocol that was developed to isolate
membranes derived from embryonic day 10 chick brains (Serafini et al.,
1994 ). Although a secreted protein, netrin-1 was isolated from the
membrane-associated fraction of the embryonic CNS (Serafini et al.,
1994 ). To what extent netrin-1 protein is soluble or
membrane-associated in the embryo has not yet been determined. The
fractionation of adult rat spinal cord homogenates reported here
indicates that the majority of netrin-1 in the adult CNS is not freely
soluble. The results are consistent with much of the netrin-1 protein
being membrane-associated or incorporated into an insoluble component of the extracellular matrix. After homogenization, full-length netrin-1
was detected in the LSP (Fig. 6B, lane 1)
that contains a heterogeneous mixture of nuclei, intact cells, large
cellular debris, and extracellular matrix. After the high-speed spin
that separates membranous microsomes from soluble proteins, an
immunoreactive band corresponding to the molecular weight of
full-length netrin-1 (~75 kDa) was enriched in the HSP (Fig.
6B, lane 5) relative to the HSS (Fig.
6B, lane 6). The microsomes in the
HSP fraction are derived from a mixture of cellular membranes that
include the plasma membrane, endoplasmic reticulum, and Golgi
apparatus. Calnexin and MG-160 are integral membrane proteins of the ER
and Golgi apparatus, respectively (Gonatas et al., 1989 ; Wada et al., 1991 ), and were appropriately enriched in the HSP (Fig.
6B, lane 5). TrkB, a tyrosine kinase that
functions as a neurotrophin receptor at the plasma membrane (Klein et
al., 1991 ) was similarly enriched in the HSP fraction. After high-salt
extraction of the HSP to solubilize membrane-associated proteins, these
transmembrane proteins all partitioned into the HSEP fraction (Fig.
6B, lane 7), appropriately remaining with the membranes. BiP, a soluble ER resident protein (Munro
and Pelham, 1986 ), was also enriched in the HSP and HSEP fractions,
indicating that proteins contained within the lumen of the ER largely
remain associated with the membrane fraction. This suggests that most
ER microsomes reform to retain their contents and are not lysed by
either homogenization or high-salt extraction. After high-salt
extraction of the HSP, the majority of netrin-1 protein was stripped
from the membranes and partitioned into the HSES (Fig.
6B, lane 8). Densitometric analysis
indicated that netrin-1 is enriched ~25-fold in the HSES fraction
compared with the HSP and ~140-fold in the HSES compared with the
homogenate (Table 1). A small amount of
netrin-1 protein remained associated with the microsomal membranes in
the HSEP. This may correspond to netrin-1 in vesicles that had not yet
been secreted from the cell, to netrin-1 inside an endosomal
compartment of the cell, or to netrin-1 within vesicles derived from
plasma membrane that resealed in an outside-in configuration after
homogenization. The presence of some netrin-1 protein within an
intracellular membrane-bound compartment is consistent with the results
shown in Figure 2, illustrating the presence of netrin-1
immunoreactivity in the cytoplasm of many cells. In summary, the
fractionation results obtained are consistent with the majority of
netrin-1 protein in the adult spinal cord being associated with
the exterior surface of cellular plasma membranes or the ECM.
Netrin-1 protein is associated with periaxonal myelin
To characterize the distribution of netrin-1 in the white matter,
we performed myelin fractionation experiments. Following a series of
steps described schematically in Figure
7A, we produced final
fractions enriched for compact myelin, periaxonal myelin, and axolemma
following a protocol described by Sapirstein et al. (1992) . Fractions
enriched for crude gray matter and crude myelin were generated first
(Fig. 7B, lanes 2,3). From the crude myelin, fractions enriched for myelin and crude periaxolemma were produced (Fig. 7B, lanes 4,5). The myelin fraction was
further processed to yield the purified myelin fraction (Fig.
7B, lane 6) that is highly enriched for
compact myelin. The crude periaxolemmal fraction (Fig. 7B,
lane 5) is the precursor to fractions enriched for
periaxonal myelin and axolemma (Fig. 7B, lanes
7,8). The periaxonal myelin fraction is enriched for
oligodendrocyte membranes apposed to the periaxonal space, whereas the
axolemmal fraction is enriched for axonal membranes derived from
myelinated axons. MBP was used as a marker for fractions containing
compact myelin (Yin et al., 1997 ). MBP was appropriately
enriched in the purified myelin fraction (Fig.
7B, lane 6). MAG, a transmembrane protein,
and CNP, a cytoplasmic plasma membrane-associated enzyme, were
used as markers enriched in periaxonal myelin (Trapp et al., 1988 ;
Bartsch et al., 1989 ), and NFM was used as a marker for axons (Lee and
Cleveland, 1996 ). Here, CNP and MAG were appropriately enriched
in the periaxonal myelin fraction and NFM in the axolemmal fraction
(Fig. 7B, lanes 7,8), confirming that components
of these fractions partitioned as expected. After fractionation of
crude myelin into the myelin and crude periaxolemmal fractions,
netrin-1 was enriched in the latter fraction (Fig. 7B,
lane 5) with barely detectable levels present in the myelin
fraction (Fig. 7B, lane 4). After further purification, netrin-1 was not detected in the purified myelin fraction
(Fig. 7B, lane 6). Consistent with this
result, we did not detect netrin-1 protein in preparations of purified
compact myelin prepared using an alternative method described by Norton and Poduslo (1973) (data not shown). Netrin-1 protein could be detected
in both the axolemmal and periaxonal myelin membrane fractions (Fig.
7B, lanes 7,8) after further fractionation of crude periaxolemma. The distribution found after fractionation is
consistent with the netrin-1 staining detected in the white matter
immunohistochemically (Fig. 5B). In agreement with the results of fractionation, compact myelin did not stain. However, many
small immunoreactive dots and, more rarely, thin linear positive profiles were detected throughout the white matter, consistent with the
presence of netrin-1 within the proximal processes of oligodendrocyte
arms and the periaxonal space (Fig. 5B). Although ultrastructural analysis using immunoelectron microscopy will have to
be performed to determine the precise subcellular localization of
netrin-1 protein, the findings presented here demonstrate that full-length netrin-1 protein is excluded from compact myelin and suggest that netrin-1 is present in the periaxonal space associated with the membrane surfaces of oligodendrocytes and axons.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 7.
Netrin-1 is enriched in periaxonal
myelin. A, The flow chart illustrates the origin of the
fractions containing purified myelin, periaxonal myelin, and axolemma.
Each step is labeled with the number corresponding to
the lane on the gel in B containing that
fraction. B, The proteins MBP (~14 kDa),
CNP (~46 kDa), MAG (~100 kDa), and NFM (~145 kDa) were used as
markers for the enrichment of purified myelin (compact myelin),
periaxonal myelin, and axolemmal membranes, respectively.
Full-length netrin-1 protein partitioned between the crude myelin
(lane 2) and crude gray matter (lane 3)
fractions. After separation of the crude white matter fraction into
myelin (lane 4) and crude periaxolemma
(lane 5), netrin-1 (~75 kDa) was enriched in the crude
periaxolemmal fraction. No netrin immunoreactivity was detected in the
purified myelin fraction containing compact myelin (lane
6). After further fractionation of the crude
periaxolemmal myelin, full-length netrin-1 partitioned between the
fractions enriched for periaxonal myelin (lane
7) and axolemma (lane 8). A 10% and a
12% acrylamide gel were used to separate ~20 µg of total protein
loaded per lane to visualize the different markers
shown. Below the immunoblots, a 12% gel containing these fractions is
shown stained with Coomassie blue, illustrating the distribution of
proteins in each fraction and that comparable amounts of protein are
present in each lane. Molecular weight markers
correspond to 116, 97.4, 66.2, 45, 31, and 21 kDa.
|
|
 |
DISCUSSION |
Netrins: secreted proteins with long-range and
short-range actions
Netrins are bifunctional cues, attracting the growth of some axons
and repelling that of others. Netrin-1 protein secreted by the floor
plate has been proposed to form a gradient that orients the growth of
circumferentially extending axons in the developing neural tube
(Kennedy et al., 1994 ; Colamarino and Tessier-Lavigne, 1995a ). In
support of this, netrin-1 secreted by cells in vitro acts as
a long-range cue to attract or repel the axons of different types of
neurons (Kennedy et al., 1994 ; Colamarino and Tessier-Lavigne, 1995a ;
Shirasaki et al., 1996 ; Deiner et al., 1997 ; Metin et al., 1997 ;
Varela-Echavarria et al., 1997 ; Wang et al., 1999 ). These assays
suggest that netrin-1 protein can diffuse at least 250 µm from the
source of netrin-1 synthesis (Placzek et al., 1990 ; Kennedy et al.,
1994 ). Consistent with this, loss of netrin-1 or DCC function in
vivo disrupts the normal establishment of long-distance axonal
projections, including those that grow to the floor plate and pioneer
the ventral commissure of the spinal cord (Serafini et al., 1996 ;
Fazeli et al., 1997 ).
Here we describe widespread constitutive expression of netrin-1 by
neurons and oligodendrocytes in the adult mammalian spinal cord.
Furthermore, the level of netrin-1 mRNA detected was similar to that
found in the embryonic CNS. However, subcellular fractionation indicated that the majority of netrin-1 protein present in the adult
CNS is not freely soluble. In the adult, newly synthesized netrin-1
protein may be externalized already bound to a component of the cell
surface, or alternatively, it may be diffusible immediately after
secretion but then captured by a component of the ECM or the cell
surface. In either case, these results suggest that much of the
netrin-1 protein present is bound to either the surface of the cell
secreting the protein or the surface of a nearby cell. By definition,
this distribution suggests a short-range function for netrin-1 in the
adult CNS. As such, this may have more in common with the short-range
role of netrin regulating the development of neuromuscular synapses in
D. melanogaster (Winberg et al., 1998 ) than with the
function of netrin as a long-range axon guidance cue in the embryonic
spinal cord (Kennedy et al., 1994 ; Serafini et al., 1996 ). In the study
by Winberg et al. (1998) , netrin was found to act as a
short-range target-derived cue regulating the formation of
nerve muscle synapses in a concentration-dependent manner. The
distribution described here suggests that a major function of netrin-1
in the adult mammalian CNS may be to similarly regulate cell-cell
interactions, including synaptic connections and axon-glial interactions.
For netrin-1 to function as a short-range cue, netrin receptors must be
expressed by nearby cells. DCC expression has been reported in the
adult human spinal cord, although the specific cell types involved were
not identified (Hedrick et al., 1994 ). Consistent with this
observation, we have found that Dcc and the netrin receptors
neogenin, unc5h1, and unc5h2 are all
constitutively expressed in the adult rat spinal cord (our
unpublished data).
Neurons in the adult spinal cord express netrin-1
Our findings indicate that many neurons in the adult spinal cord,
including motoneurons and multiple classes of interneurons, express
readily detectable levels of netrin-1. Embryonic commissural neurons
express DCC and require netrin-1 to extend their axons to the floor
plate (Serafini et al., 1996 ). In the adult rat, these commissural
neurons are thought to become spinothalamic, spinoreticular, and
spinocerebellar neurons (Altman and Bayer, 1984 ; for review, see
Colamarino and Tessier-Lavigne, 1995b ). Although embryonic commissural
neurons do not express netrin-1 as their axons extend to the floor
plate, our results suggest that these and many other classes of spinal
interneurons express netrin-1 in the adult. During development in
C. elegans, some pioneer neurons that extend an axon in
response to a distant source of netrin/UNC-6 later express
unc-6 themselves, and it has been suggested that this
neuronal source of UNC-6 may influence the growth of other axons
(Wadsworth et al., 1996 ). Furthermore, analysis of the distribution of
netrin protein found in the developing CNS of D. melanogaster indicates that frazzled, the fly homolog of DCC, can
capture netrin and present it locally along the surface of an axon.
This results in a restricted distribution of netrin that functions to
guide later-extending axons (Hiramoto et al., 2000 ). These results
indicate that netrin on the surface of a neuron can affect the behavior
of an adjacent cell. They also raise the possibility that in the
mammalian CNS, the distribution of netrin protein may be influenced by
the distribution of receptors, such as DCC and neogenin, that may
function to localize and present netrin to nearby cells.
Netrin-1 is expressed by oligodendrocytes and enriched in
periaxonal myelin
In addition to being expressed by neurons, we report that most, if
not all, oligodendrocytes in the adult spinal cord express netrin-1.
Furthermore, fractionation of adult spinal cord white matter indicated
that full-length netrin-1 protein is excluded from compact myelin but
may be localized to the periaxonal space, the interface between axons
and oligodendroglia. The intimate apposition between oligodendrocytes
and axons constitutes one of the most extensive intercellular
specializations in the CNS. The membranes associated with myelinated
axons can be divided into at least three types: compact myelin,
periaxonal myelin, and axolemma. Compact myelin is a specialized, but
enzymatically inactive, structure. In contrast, the oligodendrocyte
membrane facing the periaxonal space is specifically enriched with
proteins such as CNP and MAG, proteins that appear to be
required for the maintenance of interactions between axonal and
oligodendroglial membranes (Yin et al., 1997 ; Schachner and Bartsch,
2000 ). Immediately before myelination begins, the interaction between
the axon and its ensheathing oligodendrocyte must involve both surface
recognition and adhesive affinity. The expression of netrin-1 by adult
oligodendrocytes suggests that it may regulate oligodendrocyte motility
during development or influence myelination. Understanding this role of
netrin-1 may provide insight into the development of strategies that
promote remyelination in diseases such as multiple sclerosis.
The presence of netrin-1 in the CNS may also influence the ability of
axons to regenerate after injury. Although many CNS neurons have the
capacity to regenerate a severed axon (David and Aguayo, 1981 ), the
onset of myelination in the mammalian CNS coincides with a dramatic
drop in the ability of injured axons to regenerate. Substantial
evidence indicates that CNS white matter contains factors that inhibit
axon outgrowth (for review, see Schwab et al., 1993 ), and multiple
inhibitory components of myelin have been identified (McKerracher et
al., 1994 ; Mukhopadhyay et al., 1994 ; Chen et al., 2000 ;
GrandPre et al., 2000 ; Prinjha et al., 2000 ). Interestingly, two
of these inhibitors, MAG and Nogo, are constitutively expressed by
oligodendrocytes in the adult CNS and enriched in periaxonal myelin
(Bartsch et al., 1989 ; Chen et al., 2000 ). The expression of netrin-1
by mature oligodendrocytes and its presence in periaxonal myelin
suggest that myelin-associated netrin-1 may restrict axonal sprouting
in the adult CNS, perhaps via a mechanism analogous to axonal
chemorepulsion during development. Such a function in the normal CNS
may translate into inhibition of regeneration after injury.
Netrin: a role at the cell surface mediating
cell-cell interactions?
Here we have identified the cell types that express netrin-1 in
the adult spinal cord; however, both netrin-1 and DCC are also
expressed outside the nervous system (Hedrick et al., 1994 ; Kennedy et
al., 1994 ; Reale et al., 1994 ; Meyerhardt et al., 1999 ; Wang et al.,
1999 ). DCC was first identified as a candidate tumor suppressor deleted
in some forms of colorectal cancer (Fearon et al., 1990 ; Hedrick et
al., 1994 ). Loss of DCC expression occurs with the progression of
multiple types of cancer, including glial carcinomas (Scheck and Coons,
1993 ; Ekstrand et al., 1995 ; for review, see Cho and Fearon, 1995 ;
Reyes-Mugica et al., 1997 ). Furthermore, mutation or strongly reduced
expression of netrin-1 has been found in some human glioblastomas and
neuroblastomas (Meyerhardt et al., 1999 ), and although controversial,
recent findings continue to support a role for DCC as a tumor
suppressor (Hilgers et al., 2000 ). As such, the short-range function
for netrin-1 emphasized here, mediating neuron-neuron and
neuron-glial interactions in the adult CNS, may be representative of a
wider role for netrin-DCC interactions regulating cell-cell contact in multiple tissue types.
 |
FOOTNOTES |
Received April 28, 2000; revised Feb. 21, 2001; accepted March 6, 2001.
This work was supported by the Paralyzed Veterans of America Spinal
Cord Research Foundation, the Multiple Sclerosis Society of Canada, and
the Medical Research Council (MRC) of Canada. T.E.K. is a scholar of
the MRC. We thank Adriana Di Polo, Dena Howland, Stephen Morris,
Laurence Simard-Emond, Simon Moore, Jean-Francois Bouchard, and Andrew
Jarjour for critically reading this manuscript and Elena Malitskaya for
technical assistance.
GenBank Accession Numbers: rat netrin-1, AY028417; rat netrin-3,
AY028418.
Correspondence should be addressed to Dr. Timothy E. Kennedy, Centre
for Neuronal Survival, Montreal Neurological Institute, McGill
University, 3801 University Street, Montreal, Quebec, Canada, H3A 2B4.
E-mail: tkenne5{at}po-box.mcgill.ca.
 |
REFERENCES |
-
Ackerman SL,
Kozak LP,
Przyborski SA,
Rund LA,
Boyer BB,
Knowles BB
(1997)
The mouse rostral cerebellar malformation gene encodes an UNC-5-like protein.
Nature
386:838-842[Medline].
-
Altman J,
Bayer SA
(1984)
The development of the rat spinal cord.
Adv Anat Embryol Cell Biol
85:1-164[Medline].
-
Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
Smith JA,
Struhl K
(1990)
In: Current protocols in molecular biology. New York: Wiley.
-
Bachnou N,
Schwartz Z,
Farhdi H,
Peterson A
(1997)
Developmental programming of a myelin gene revealed at high resolution in MBP "knock-in" mice.
In: Mystic Connecticut: ISN satellite and U Conn-Kroc, Symposium abstracts, p 79.
-
Bartsch U,
Kirchoff F,
Schachner M
(1989)
Immunohistological localization of the adhesion molecules L1, N-CAM, and MAG in the developing and adult optic nerve of mice.
J Comp Neurol
284:451-462[ISI][Medline].
-
Bonaldo MF,
Lennon G,
Soares MB
(1996)
Normalization and subtraction: two approaches to facilitate gene discovery.
Genome Res
6:791-806[Abstract/Free Full Text].
-
Braissant O,
Wahli W
(1998)
A simplified in situ hybridization protocol using non-radioactively labeled probes to detect abundant and rare mRNAs on tissue sections.
Biochemica
1:10-16.
-
Chan SSY,
Zheng H,
Su MW,
Wilk R,
Kileen MT,
Hegdecock EM,
Culotti JG
(1996)
UNC-40, a C. elegans homolog of DCC (deleted in colorectal cancer), is required in motile cells responding to UNC-6 netrin cues.
Cell
87:187-195[ISI][Medline].
-
Chen MS,
Huber AB,
van der Haar ME,
Frank M,
Schnell L,
Spillman AA,
Christ F,
Schwab ME
(2000)
Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1.
Nature
403:434-439[Medline].
-
Cho KR,
Fearon ER
(1995)
DCC: linking tumor suppressor genes and altered cell surface interactions in cancer?
Curr Opin Genet Dev
5:72-78[Medline].
-
Clancy B,
Cauller LJ
(1998)
Reduction of background autofluorescence in brain sections following immersion in sodium borohydride.
J Neurosci Methods
83:97-102[ISI][Medline].
-
Colamarino SA,
Tessier-Lavigne M
(1995a)
The axonal chemoattractant netrin-1 is also a chemorepellent for trochlear motor axons.
Cell
81:621-629[ISI][Medline].
-
Colamarino SA,
Tessier-Lavigne M
(1995b)
The role of the floor plate in axon guidance.
Annu Rev Neurosci
18:497-529[ISI][Medline].
-
Colavita A,
Culotti JG
(1998)
Suppressors of ectopic UNC-5 growth cone steering identify eight genes involved in axon guidance in Caenorhabditis elegans.
Dev Biol
194:72-85[ISI][Medline].
-
Croul S,
Mezitis SGE,
Stieber A,
Chen Y,
Gonatas JO,
Goud B,
Gonatas NK
(1990)
Immunocytochemical visualization of the Golgi apparatus in several species, including human, and tissues with antiserum against MG-160, a sialoglycoprotein of rat Golgi apparatus.
J Histochem Cytochem
38:957-963[Abstract].
-
David S,
Aguayo AJ
(1981)
Axonal elongation into peripheral nervous system "bridges" after central nervous system injury in adult rats.
Science
214:931-933[Abstract/Free Full Text].
-
Deiner MS,
Kennedy TE,
Fazeli A,
Serafini T,
Skarnes WC,
Tessier-Lavigne M,
Sretevan DW
(1997)
Netrin-1 and DCC mediate axon guidance at the optic disc: loss of function leads to optic nerve hypoplasia.
Neuron
19:575-589[ISI][Medline].
-
de la Torre J,
Hopker V,
Ming G,
Poo M,
Tessier-Lavigne M,
Hemmati-Brivanlou A,
Holt C
(1997)
Turning of retinal growth cones in a netrin-1 gradient mediated by the netrin receptor DCC.
Neuron
19:1211-1224[ISI][Medline].
-
Detskey PZ,
Bigbee JW,
DeVries GH
(1988)
Isolation and characterization of axolemma-enriched fractions from discrete areas of bovine CNS.
Neurochem Res
13:449-454[Medline].
-
Ekstrand BC,
Mansfield TA,
Bigner SH,
Fearon ER
(1995)
DCC expression is altered by multiple mechanisms in brain tumours.
Oncogene
11:2393-2402[Medline].
-
Fazeli A,
Dickinson SL,
Hermiston ML,
Tighe RV,
Steen RG,
Small CG,
Stoeckli ET,
Keino-Masu K,
Masu M,
Rayburn H,
Simons J,
Bronson RT,
Gordon JI,
Tessier-Lavigne M,
Weinberg RA
(1997)
Phenotype of mice lacking functional Deleted in colorectal cancer (Dcc) gene.
Nature
386:796-804[Medline].
-
Fearon ER,
Cho KR,
Nigro JM,
Kern SE,
Simons JW,
Ruppert JM,
Hamilton SR,
Preisinger AC,
Thomas G,
Kinzler KW,
Vogelstein B
(1990)
Identification of a chromosome 18q gene that is altered in colorectal cancers.
Science
247:49-56[Abstract/Free Full Text].
-
Gonatas JO,
Mezitis SG,
Stieber A,
Fleischer B,
Gonatas NK
(1989)
MG-160. A novel sialoglycoprotein of the medial cisternae of the Golgi apparatus.
J Biol Chem
264:646-653[Abstract/Free Full Text].
-
GrandPre T,
Nakamura F,
Vartanian T,
Strittmatter SM
(2000)
Identification of the Nogo inhibitor of axon regeneration as a Reticulon protein.
Nature
403:439-444[Medline].
-
Hedgecock EM,
Culotti JG,
Hall DH
(1990)
The unc-5, unc-6, and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans.
Neuron
4:61-85[ISI][Medline].
-
Hedrick L,
Cho KR,
Fearon ER,
Wu TC,
Kinzler KW,
Vogelstein B
(1994)
The DCC gene product in cellular differentiation and colorectal tumorigenesis.
Genes Dev
8:1174-1183[Abstract/Free Full Text].
-
Hendershot LM,
Wei J-Y,
Gaut JR,
Lawson B,
Freiden PJ,
Murti KG
(1995)
In vivo expression of mammalian BiP ATPase mutants causes disruption of the endoplasmic reticulum.
Mol Biol Cell
6:283-296[Abstract].
-
Hilgers W,
Song JJ,
Haye M,
Hruban RR,
Kern SE,
Fearon ER
(2000)
Homozygous deletions inactivate DCC, but not MADH4/DPC4/SMAD4, in a subset of pancreatic and biliary cancers.
Genes Chromosomes Cancer
27:353-357[Medline].
-
Hiramoto M,
Hiromi Y,
Giniger E,
Hotta Y
(2000)
The Drosophila netrin receptor frazzled guides axons by controlling netrin distribution.
Nature
406:886-889[Medline].
-
Hong K,
Hinck L,
Nishiyama M,
Poo M,
Tessier-Lavigne M,
Stein E
(1999)
A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion.
Cell
97:927-941[ISI][Medline].
-
Ishii N,
Wadsworth WG,
Stern BD,
Culotti JG,
Hedgecock EM
(1992)
UNC-6, a laminin-related protein, guides cell and pioneer axons and mesodermal cells on the epidermis in C. elegans.
Neuron
4:61-85.
-
Keino-Masu K,
Masu M,
Hinck L,
Leonardo ED,
Chan SSY,
Culotti JG,
Tessier-Lavinge M
(1996)
Deleted in colorectal cancer (DCC) encodes a netrin receptor.
Cell
87:175-185[ISI]
|