 |
 Previous Article | Next Article 
The Journal of Neuroscience, July 1, 2001, 21(13):4637-4648
The OMP-lacZ Transgene Mimics the Unusual
Expression Pattern of OR-Z6, a New Odorant Receptor Gene
on Mouse Chromosome 6: Implication for Locus-Dependent Gene
Expression
Martina
Pyrski1,
Zheng
Xu1,
Eric
Walters2,
Debra J.
Gilbert3,
Nancy A.
Jenkins3,
Neal G.
Copeland3, and
Frank L.
Margolis1
1 Department of Anatomy and Neurobiology, School of
Medicine, University of Maryland at Baltimore, Baltimore, Maryland
21201, 2 Department of Biochemistry and Molecular Biology,
Howard University Medical College, Washington, DC 20059, and
3 Mouse Cancer Genetics Program, National Cancer
Institute-Frederick, Frederick, Maryland 21702
 |
ABSTRACT |
Reporter gene expression in the olfactory epithelium of
H-lacZ6 transgenic mice mimics the cell-selective
expression pattern known for some odorant receptor genes. The transgene
construct in these mice consists of the lacZ coding
region, driven by the proximal olfactory marker protein
(OMP) gene promoter, and shows expression in a zonally
confined subpopulation of olfactory neurons. To address mechanisms
underlying the odorant receptor-like expression pattern of the
lacZ construct, we analyzed the transgene-flanking region and identified OR-Z6, the first cloned odorant
receptor gene that maps to mouse chromosome 6. OR-Z6
bears the highest sequence similarity (85%) to a human odorant
receptor gene at the syntenic location on human chromosome 7. We
analyzed the expression pattern of OR-Z6 in
olfactory tissues of H-lacZ6 mice and show that it
bears strong similarities to that mapped for  -galactosidase. Expression of both genes in olfactory neurons is primarily restricted to the same medial subregion of the olfactory epithelium. Axons from
both neuronal subpopulations project to the same ventromedial aspect of
the anterior olfactory bulbs. Furthermore, colocalization analyses in
H-lacZ6 mice demonstrate that
OR-Z6-reactive glomeruli receive axonal input from
lacZ-positive neurons as well. These results suggest
that the expression of both genes is coordinated and that transgene
expression in H-lacZ6 mice is regulated by locus-dependent mechanisms.
Key words:
transgene; receptors; OR-Z6; olfactory
neurons; olfactory epithelium; olfactory bulb; expression patterns; in situ hybridization; locus dependence; OMP promoter
| |
INTRODUCTION |
The vertebrate olfactory system is
remarkable in its ability to detect and discriminate among thousands of
different odorants. Tremendous progress has been made in understanding
odorant detection that is mediated by odorant receptor (OR) proteins
located in the ciliary membrane of the olfactory receptor neurons
(ORNs), a bipolar neuron population that resides in the olfactory
epithelium (OE) of the vertebrate nose. Vertebrate ORNs are unusual in
that they can be replaced throughout life via progenitor cell
proliferation and differentiation (Graziadei and Graziadei, 1979 ). Each
ORN seems to express a single OR gene from a family that is estimated to number as many as 1000 different genes in rodents (Buck and Axel,
1991). ORNs expressing a given OR gene exhibit a mosaic-like distribution within one of four suggested zones of the neuroepithelium (Ressler et al., 1993; Strotmann et al., 1994a,b; Vassar et al., 1994),
and their axons project onto defined glomeruli in the olfactory bulb
(OB) (Ressler et al., 1994; Vassar et al., 1994; Mombaerts et al.,
1996). The mechanisms underlying these expression patterns are still
elusive but likely depend on a complex interplay including allelic
exclusion, locus control elements, and zonally active transcription
factors during early development (Ressler et al., 1993; Chess et al.,
1994; Sullivan et al., 1996; Ebrahimi et al., 2000). Chromosomal
localization studies showed that OR genes are present on several
chromosomes where they often exist as clusters (Ben-Arie et al., 1994;
Asai et al., 1996; Sullivan et al., 1996; Trask et al., 1998). Recent
studies revealed that highly homologous genes from a cluster exhibit
expression in identical zones (Strotmann et al., 1999; Tsuboi et al.,
1999; Serizawa et al., 2000). However, the relation between locus and
zonal confinement is probably more complex because many receptors
expressed in the same zone reside at different loci and vice versa
(Sullivan et al., 1996).
To address the molecular and cellular bases of OR gene expression, we
analyzed the transgenic mouse line H-lacZ6 (Walters et al.,
1996a,b) in which transgene expression mimics the expression pattern
demonstrated for some OR genes (Ressler et al., 1993; Vassar et al.,
1993; Strotmann et al., 1994a,b). Transgene expression in
H-lacZ6 mice is restricted to a subpopulation of ORNs
primarily located on the tips of endoturbinate-II and -III and
ectoturbinate-3 (Treloar et al., 1996; Walters et al., 1996a), the
axons of which terminate in closely associated glomeruli in the
ventromedial aspects of the anterior OBs (Treloar et al., 1996;
Cummings et al., 2000). This pattern prompted us to hypothesize that
the lacZ transgene has inserted under the control of an OR
gene locus, and we analyzed the region flanking the insertion site for
the presence of OR genes. Our hypothesis was supported by the
subsequent identification of the new odorant receptor gene
OR-Z6 that not only resides in proximity to the transgene
locus on mouse chromosome 6 but also exhibits an expression pattern
similar to that of the transgene in H-lacZ6 mice. Our
results strongly suggest that the expression of both genes in
H-lacZ6 mice is subject to similar locus-dependent
regulatory mechanisms.
| |
MATERIALS AND METHODS |
H-lacZ6 mouse line. The generation of the
transgenic mouse line H-lacZ6 was reported previously
(Walters et al., 1996a). In brief, the transgene construct used
[H-olfactory marker protein (OMP)-lacZ]
consists of a truncated OMP promoter ( 239 to +55 bp of the
rat OMP gene that carry the proximal olf-1, O/E1 binding site) fused to the -galactosidase coding region and the Simian virus
40 (SV40) polyadenylation signal (Kudrycki et al., 1993). Experiments
were performed on homozygous mice of the transgenic H-lacZ6
line. Procedures involving the use of animals were approved by the
Institutional Animal Care and Use Committee of the University of
Maryland School of Medicine.
Cloning of transgene-flanking sequences. A genomic library
in  DashII (Stratagene, La Jolla, CA) was prepared from homozygous H-lacZ6 mice, and plaque lifts from ~1×
106 phages were screened with an
[ -32P]dCTP-labeled lacZ
probe (1.3 × 106 cpm/ml) according
to standard procedures (final washes in 2× SSC and 0.5% SDS at
60°C). Random primed labeling of a gel-purified 1891 bp
EcoRV-EcoRI restriction fragment of the
lacZ coding region [pMC1871 lacZ-plasmid
(Amersham Pharmacia Biotech, Piscataway, NJ)] was performed using
[-32P]dCTP (3000 Ci/mmol) and
the Ready-To-Go DNA-labeling kit (Amersham Pharmacia Biotech). DNA from
two different phages, obtained after three rounds of screening, was
purified (-Magic Minipreps; Promega, Madison, WI) and mapped by
restriction digestion, partial sequence analysis, and Southern blot
hybridization using 32P-labeled probes for
the OMP promoter (296 bp of the proximal region) and the
SV40 sequence that hybridize to the 5'-end and 3'-end of the transgene
construct, respectively. Probe labeling was as described. Phage 8
contained a nontruncated copy of the transgene construct in the correct
order of OMP-lacZ-SV40 plus 12 kb of genomic
downstream sequence and was further analyzed by restriction digestion
and Southern blot hybridization using the
-32P-labeled SV40 DNA probe. An 874 bp
XbaI hybridization product was excised from the gel,
purified (Qiagen, Valencia, CA), and subcloned into an
XbaI-linearized vector (pBluescript; Stratagene). Sequence
analysis using T3 and T7 vector primers showed that the fragment
contained the transition between the 3'-end of the transgene construct
(246 bp of SV40 sequence) and downstream flanking genomic DNA (629 bp).
The 629 bp flanking fragment was PCR-amplified using primers EW1 and
EW20; the amplicon was subjected to restriction digestion using
BamHI and XbaI enzymes (the BamHI site
had been introduced by primer EW1) and directionally subcloned into
pBluescript (clone pBSKS3'-flank).
Interspecific mouse backcross mapping. Interspecific
backcross progeny were generated by mating (C57BL/6J × Mus spretus) F1 females and C57BL/6J males
as described (Copeland and Jenkins, 1991). A total of 205 N2 mice were
used to map the Hlz6 locus. DNA isolation, restriction
enzyme digestion, agarose gel electrophoresis, Southern blot transfer
(Hybond-N+ nylon membrane; Amersham
Pharmacia Biotech), and hybridization were as described (Jenkins et
al., 1982). The probe, the 629 bp 3'-flanking fragment of mouse genomic
DNA, was labeled with [-32P]dCTP
using a nick translation labeling kit (Boehringer Mannheim, Indianapolis, IN); washing was done to a final stringency of 0.8× SSC-phosphate and 0.1% SDS, 65°C. A fragment of 6.1 kb was
detected in SphI-digested C57BL/6J DNA, and a fragment of
8.4 kb was detected in SphI-digested M. spretus DNA. The presence or absence of the 8.4 kb SphI
M. spretus-specific fragment was followed in backcross mice.
A description of the probes and restriction fragment length polymorphisms (RFLPs) for the loci linked to Hlz6 including
Ptn, Tcrb, and Hoxa5 has been reported
previously (Siracusa et al., 1991; Li et al., 1992). Recombination
distances were calculated using Map Manager, version 2.6.5. Gene order
was determined by minimizing the number of recombination events
required to explain the allele distribution patterns.
P1 clones. Two primers generated from the
3'-flanking fragment (clone pBSKS3'-flank) were used to screen a
wild-type mouse genomic library in P1 phagemids by PCR (Genome Systems,
St. Louis, MO). Primers ps2 and ps4 yielded a 160 bp amplicon. The four
P1 clones obtained (P1 clones 6386-6389) were confirmed to map to the
Hlz6 locus by PCR using the same primers. PCR standard
conditions were 10 mM Tris-HCl, pH 9, 50 mM KCl, 0.1% Triton X-100, 0.2 mM each dNTP, 2 mM
MgCl2, 2.5 U of Taq polymerase
(Promega), and 0.2 µM each primer. Cycling
parameters were 5 min at 95°C, followed by 35 cycles of 1 min at
60°C, 1.5 min at 72°C, and 1 min at 96°C and a final extension
for 20 min at 72°C.
Cloning of OR-Z6. P1 clones 6386-6389
(cre -bacterial host strain NS3516;
Genome Systems) were grown in LB medium (Life Technologies, Rockville,
MD) supplemented with 20 µg/ml Kanamycin (Sigma, St. Louis, MO), and
P1 DNA from 5 hr cultures was purified according to the manufacturer's
recommendations. Each 50 ng of P1 DNA was subjected to PCR using the
degenerate primers p26 and p27 each at 2 µM.
Cycling parameters were 5 min at 95°C, followed by 45 cycles of 2 min
at 50°C, 3 min at 72°C, and 1 min at 96°C and a final extension
for 20 min at 72°C. Controls contained either 100 ng of mouse genomic
DNA or no template. PCR products were resolved on 1% agarose gels. The
390 bp amplicon deriving from P1 6386 DNA was gel-purified (Qiagen) and
labeled with dUTP-conjugated digoxigenin (Boehringer Mannheim) by PCR
according to the manufacturer's procedure and was used as a probe. For
Southern blot hybridization, each 800 ng of restriction-digested P1 DNA
was size-fractionated on 0.6% agarose gels, denatured (0.5 M NaOH and 1.5 M NaCl), and neutralized (3 M NaCl and 0.5 M Tris-HCl, pH 7.5) before passive overnight
transfer onto nylon membranes (Nytran; Bio-Rad, Hercules, CA). The
membranes were UV-cross-linked (120 mJ/cm2; UV Stratalinker 2400; Stratagene),
prehybridized for 2 hr at 62°C in 5× SSC, 0.1%
N-lauroylsarkosine, 0.02% SDS, and 1% blocking reagent
(Boehringer Mannheim), and hybridized for 16 hr at 62°C in the same
buffer containing 25 ng of digoxigenin-labeled DNA probe (see above).
Posthybridization washes were 10 min in 2× SSC at room temperature and
twice for 30 min each in 0.2× SSC containing 0.1% SDS at 65°C.
Detection of digoxigenin-labeled hybridization products was performed
using the manufacturer's protocol (DIG-Genius Users Guide; Boehringer
Mannheim). The 3 kb XbaI hybridization fragment was
subcloned into pGEM5zf (Promega) and subjected to double-strand
sequencing. The OR-Z6 sequence was deposited in GenBank
(accession number AF320347).
Genomic Southern blot hybridization. Genomic DNA was
extracted from liver tissue of H-lacZ6 and wild-type mice
(129S3), subjected to restriction digestion, and size-fractionated on
0.6% agarose gels. Southern blotting and hybridization conditions were
as described. The DNA probe, the digoxigenin-dUTP-labeled 899 bp
fragment of the OR-Z6 coding region, was generated by PCR
using primers N and C.
Bacterial artificial chromosome clones.
The sequence of the 629 bp flanking fragment (see above) was used to
screen The Institute for Genomic Research (TIGR) database that
contains the sequenced ends of EcoRI-digested mouse genomic
DNA [C57BL/6J female mouse bacterial artificial chromosome (BAC) end
sequence (BES)] generated by Osoegawa et al. (2000). BAC clones
RPCI-23-282I16 (AQ932615) and RPCI-23-323H21 (AQ988378) were obtained
as stab cultures (CHORI; BACPAC Resources, Oakland, CA) and amplified
in LB medium containing 20 µg/ml chloramphenicol (Sigma).
Purification of BAC DNA and subsequent conditions for PCR using the
degenerate primers NL61 and NL63 were as described for P1 DNA using
annealing temperatures of 50°C (high stringency) or 40°C (low
stringency). PCR products were size-fractionated on agarose gels,
gel-purified, and subcloned into the pGEM-T vector system (Promega).
Generated subclones were analyzed by restriction digestion and sequencing.
Primers used (5' to 3' orientations). The
following primers were used: EW1, TGTCTGGATCCAGATGGAGG; EW20,
CGATAAGCTCGATATCGA; ps2, CAGTCCTGCAGTAGTGAATTCTC; ps4,
CAGTGTTTTGTATTCCTTCTCAG; p26, GCITA(T/C)GA(T/C)CGITA(T/C)GTIGCIATITG; p27,
ACIACIGAIAG(A/G)TGIGAI(C/G)C(A/G)CAIGT; NL61,
CGGAATTCCC(G/A/T/C)ATGTA(C/T) (C/T)T(G/A/T/C)TT(C/T)CT; NL63,
ATAAGCTTAG(G/A)TG(G/A/T/C)(G/C)(T/A)(G/A/T/C)(G/C)
C(G/A)CA(G/A/T/C)GT; and OR-Z6 gene-specific primers (coding
region) N, CCTGGATCCCAAGAGCTACAC (48-69 bp, sense), and C,
CTGAGGAGCAGACAGCAACGC (918-938 bp, antisense).
Reverse transcription-PCR for
OR-Z6. Four-week-old 129S3/SvImJ mice (129S3; The Jackson
Laboratory, Bar Harbor, ME) were decapitated; their tissues (OE, OBs,
and liver) were dissected and snap-frozen in liquid nitrogen. Total RNA
was extracted with RNAzol-B (TEL-TEST, Friendswood, TX). Contaminating
genomic DNA was removed by DNase I digestion (2 U of DNase I/µg of
RNA; Boehringer Mannheim), followed by acidic phenol/chloroform
extraction (Ambion, Austin, TX). Total RNA was reverse transcribed
(Superscript RTII; random hexamer primers, 20 pmol/µg of RNA; Life
Technologies), and 500 ng of cDNA was subjected to PCR. To control for
PCR products deriving from amplification of residual genomic DNA, an
aliquot of RNA from each tissue was subjected to PCR without preceding
cDNA synthesis. OR-Z6 cDNA was selectively amplified using
the gene-specific primers N and C that generate an 899 bp fragment of
the OR-Z6 coding region. PCR products were resolved on 1%
agarose gels containing 0.5 µg/ml ethidium bromide, visualized under
UV light, and photographed (Polaroid, Cambridge, MA). PCR products were
gel-purified (Qiagen) and sequenced using primers N and C.
Tissue preparation for cryostat sections. Three- to
6-week-old 129S3 mice (The Jackson Laboratory) or H-lacZ6
mice were anesthetized using ketamine at 165 mg/kg of body weight
(Animal Health, Fort Dodge, IO) and xylazine at 11 mg/kg of body weight
(Bayer, Shawnee, KS). Mice were transcardially perfused with ice-cold
buffer-1 (0.1 M PIPES, 5 mM
MgCl2, and 5 mM EGTA, pH
6.9) (Emson et al., 1990) followed by fixative [4% (w/v)
paraformaldehyde in buffer-1]. OE and OBs were dissected,
cryoprotected in 30% sucrose overnight at 4°C, embedded in O.C.T.
(Tissue-Tek, Torrance, CA), and frozen in a dry ice/acetone bath.
Serial cryosections (10-18 µm) of the OE and of the OBs were
thaw-mounted onto slides (Superfrost-Plus; Fisher Scientific,
Pittsburgh, PA) and air-dried. All analyses were performed on coronal
sections (frontal and perpendicular to the anterior-to-posterior axis
of the OBs).
Detection of -galactosidase expression.
Staining of perfused hemiheads or cryosections using the chromogenic
substrate
5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal) and -galactosidase immunohistochemistry were as described in
Cummings et al. (2000).
In situ hybridization. Serial coronal cryosections of the OE
and OB were fixed for 10 min in 4% paraformaldehyde in PBS at 4°C,
rinsed twice in PBS, and incubated for 10 min at room temperature in
0.25% acetic anhydride and 0.1 M
triethanolamine, pH 8.0. Sections were rinsed in PBS and prehybridized
in standard hybridization solution (50% formamide, 5× SSC, 5×
Denhardt's, 0.2% SDS, 0.5 mg/ml salmon sperm DNA, and 0.25 mg/ml
yeast tRNA) for 4 hr at 60°C. OR-Z6 riboprobes were
generated from a BamHI subclone in pGEM5zf(+) (Promega)
containing a 573 bp fragment of the OR-Z6 coding region.
Digoxigenin-labeled OR-Z6 sense and antisense riboprobes were prepared from 1 µg of the linearized subclone (XbaI
and EcoRI, respectively) using the T7/Sp6 RNA transcription
system (DIG-Genius Users Guide; Boehringer Mannheim). OR37E
riboprobes were prepared similarly; the plasmid (generously provided by
J. Strotmann) was first linearized using PstI or
ApaI restriction enzymes. Blunt ends were obtained by
incubation with Klenow enzyme (Promega), and sense and antisense
riboprobes were generated using the kit indicated above. Riboprobes for
the OB were prepared accordingly, but CTP was replaced by 12 µM [-32P]CTP
(10 mCi/ml; >3000 Ci/mmol; Amersham Pharmacia Biotech). Hybridization
of OE sections was performed at 60°C for 16 hr in standard
hybridization solution containing 500 ng/ml digoxigenin-labeled sense
or antisense RNA probes. Hybridization of OB sections was performed
similarly using 1 × 108 cpm/ml
[-32P]CTP-labeled riboprobe
containing 10% dextran sulfate (molecular weight, 500,000). After
hybridization, sections were washed twice for 5 min each in 4× SSC at
room temperature and treated with RNase A (500 mM
NaCl, 10 mM Tris-HCl, 1 mM
EDTA, and 5 µg/ml RNase A, pH 7.5) for 30 min at 37°C. Sections
were washed twice for 10 min each in 2× SSC at room temperature, twice
for 30 min each in 0.2× SSC at 60°C, and once for 30 min in 0.1×
SSC at 60°C. Sections hybridized with the
[-32P]CTP-labeled riboprobe
were dehydrated in increasing percentages of ethanol, dipped into
NTB-3 photo emulsion (Kodak, New Haven, CT), and air-dried.
After a 4 week exposure in the dark at 4°C, sections were developed
in Kodak-D19 (2 min at 16°C), rinsed in water, fixed in Kodak fixer,
counterstained with hematoxylin (Sigma), dehydrated in ethanol, and
cleared in xylene, and coverslips were mounted with DPX
(Aldrich, Milwaukee, WI,). Sections hybridized with a
digoxigenin-labeled riboprobe were blocked in TBS (0.1 M Tris-HCl and 0.15 M NaCl,
pH 7.5) containing 4% goat serum, and hybridization products were
detected using alkaline phosphatase-conjugated sheep anti-digoxigenin
antibody (Boehringer Mannheim; 1:5000 in TBS; overnight at 4°C) and
washed twice for 15 min each in TBS. Bound antibody was visualized
using 5-bromo-4-chloro-3-indolylphosphate/nitroblue tetrazolium
(Boehringer Mannheim) as substrate, yielding a cytosolic purple
precipitate. Endogenous alkaline phosphatase activity was blocked with
0.24 mg/ml Levamisol (Sigma). Color development was stopped in TE
buffer (20 mM Tris-HCl and 5 mM EDTA, pH 8.0), and the sections were
coverslipped in Dako mounting medium (Dako, Carpinteria, CA).
Zonal tracing. Adjacent coronal cryosections from P19
wild-type mice (129S3; The Jackson Laboratory) were collected on
separate sets of slides, and each set was subjected to in
situ hybridization using sense and antisense riboprobes either for
OR-Z6 or for one of the OR genes shown previously to
represent a single rostrocaudal zone of the OE. Clones for generating
riboprobes for K21 (zone 1), K20 (zone 2), and
L45 (zone 3) were kindly provided by L. Buck (Ressler et
al., 1993, 1994). Digoxigenin-labeled riboprobes were prepared as
described above. In situ hybridization signals for each OR
mRNA were subsequently traced using a camera lucida attached to a Leitz
Orthoplan microscope (Leitz, Wetzlar, Germany). The individual maps
obtained for OR-Z6, K20, K21, and
L45 were color-coded and scanned, and the images were
stacked to facilitate comparison.
Preparation of photographs. Photographs of olfactory
turbinates and OB whole mounts stained with X-gal were taken on a Leica WILD M3Z dissecting photomicroscope (Leica, Deerfield, IL) using Ektachrome 160T slide film (Kodak). Images were digitized using a Nikon
LS-1000 slide scanner (Nikon, Melville, NY). Light photomicrographs were scanned on a Leica DMRX microscope attached to a Phase One Power
Phase digital camera (Phase One, Copenhagen, Denmark). Photomicrographs of radioactive in situ hybridization were taken with a
dark-field condenser using a Nikon Optiphot-2 microscope (Nikon) fitted
onto a Polaroid DMC1 digital camera (Polaroid). Digitized images were minimally processed (adjustments included only small changes in contrast and brightness) using Adobe Photoshop 5.0 (Adobe Systems, Mountain View, CA), and photomicrographs were printed on a Fujix Pictrography 3000 (Fuji, Carlstadt, NJ).
| |
RESULTS |
The transgene expression pattern in the OE of H-lacZ6
mice (Walters et al., 1996a) was analyzed by staining whole-mount nose preparations using the chromogenic substrate X-gal. As seen for the
in situ hybridization patterns reported for some OR genes (Ressler et al., 1993; Vassar et al., 1993; Strotmann et al., 1994a,b),
transgene expression in H-lacZ6 mice was limited to a subset
of ORNs (Fig. 1A). In
agreement with our previous studies (Treloar et al., 1996; Walters et
al., 1996a), -galactosidase-positive (-gal+) neurons appear in a zonal
pattern along the anterior-to-posterior axis of the OE and exhibit a
high density on endoturbinate-II. On the basis of this expression
pattern, we hypothesized that the lacZ transgene had
integrated at a locus that directs the expression of nearby OR genes.
To address this and to obtain information about genomic sequences
flanking the transgene locus, we screened an H-lacZ6 mouse
genomic library in DashII using a
32P-labeled lacZ DNA probe.
Analyses of the positive phages enabled us to identify and subclone a
genomic flanking fragment of 629 bp (clone pBSKS3'-flank) that resides
immediately downstream of the transgene construct. This 3'-flanking
fragment was subsequently used to determine the chromosomal
localization of the transgene as well as to isolate the corresponding
genomic region from a wild-type mouse genomic library in P1
phagemids.
View larger version (80K):
[in this window]
[in a new window]
|
Figure 1.
Expression pattern and chromosomal location of the
OMP-lacZ transgene in
H-lacZ6 mice. A, X-gal staining in the
right heminose of a 3-week-old H-lacZ6 mouse is shown.
The punctate pattern shown corresponds to the ORN subpopulation
expressing the lacZ transgene (black
dots). The majority of -gal+ neurons is
concentrated on endoturbinate-IIv
(star); fewer neurons are scattered along the
rostrocaudal axis of the OE (arrows).
Endoturbinate-IId and
-IIv, Dorsal and ventral aspects of endoturbinate-II.
Scale bar, 1 mm. B, The transgene insertion site in
H-lacZ6 mice (Hlz6 locus) maps to the
proximal region of mouse chromosome 6, as determined by interspecific
backcross analysis. Left, The segregation patterns of
Hlz6 and the flanking genes (Ptn,
Tcrb, and Hoxa5) were typed in 174 backcross animals. For individual pairs of loci, >174 animals were
typed (see text). Each column represents the chromosome
identified in the backcross progeny that was inherited from the
C57BL/6J × M. spretus F1 parent. The
black and white boxes refer to the
presence of a C57BL/6J allele and an M. spretus allele,
respectively. The number of offspring inheriting each type of
chromosome is listed at the bottom of each
column. Right, A partial chromosome 6 linkage map shows the location of Hlz6 in relation to
its linked genes. Recombination distances between loci in centimorgans
are shown to the left of the chromosome, and the
positions of loci in human chromosomes, where known, are shown to the
right. References for the human map positions of loci
cited in this study can be obtained from the Genome Data Base, a
computerized database of human linkage information maintained by The
William H. Welch Medical Library of The Johns Hopkins University
(Baltimore, MD).
|
|
The lacZ transgene maps to mouse chromosome 6
As a first step toward understanding the transgene locus
(Hlz6), we mapped the chromosomal location of the
insertion site by interspecific backcross analysis using a panel that
has been typed for over 2900 loci that are well distributed among all
autosomes and the X chromosome (Copeland and Jenkins, 1991). DNA from
C57BL/6J and M. spretus was analyzed for informative
RFLPs using the 629 bp genomic 3'-flanking fragment as a probe. The
mapping results indicated that the Hlz6 locus is located in
the proximal region of mouse chromosome 6 and linked to the chromosomal
markers Ptn, Tcrb, and Hoxa5. We
analyzed 174 mice for every marker (Fig. 1B) and up
to 193 mice for some pairs of markers. Each locus was analyzed in
pair-wise combinations for recombination frequencies using the
additional data. The ratios of the total number of mice exhibiting recombinant chromosomes to the total number of mice analyzed for each
pair of loci showed that the most likely gene order is the following:
centromere-Ptn-7/181-Hlz6-0/186-Tcrb-9/193-Hoxa5.
The recombination frequencies [expressed as genetic distances in
centimorgans (cM) ± the SE] are the following:
Ptn-3.9 ± 1.4 cM-Hlz6,
Tcrb-4.7 ± 1.5 cM-Hoxa5. No recombinants
were detected between Hlz6 and Tcrb in 186 animals typed in common, suggesting that the two loci are within 1.6 cM
of each other. We compared our interspecific map of chromosome 6 with a
composite mouse linkage map that reports the location of many uncloned
mouse mutations (Mouse Genome Database; The Jackson Laboratory).
Hlz6 mapped in a region that lacks mouse mutations with a
phenotype that might be expected for an alteration in this locus (data
not shown). The proximal region of mouse chromosome 6 shares regions of
homology with both the long and short arms of human chromosome 7 (Fig.
1B). In particular, Tcrb has been mapped
to 7q35. The close linkage between Hlz6 and Tcrb
in mouse suggests that the human homolog of the Hlz6 locus
will map to 7q as well.
Cloning of the new mouse OR gene OR-Z6
To search the vicinity of the Hlz6 locus for the
presence of OR genes, we first isolated the genomic region surrounding
the Hlz6 locus from a wild-type mouse genomic library in P1
phagemids by PCR, using primers ps2 and ps4 that derived from the
sequence of the 3'-flanking fragment. Four genomic P1 clones (P1 clones 6386-6389; Genome Systems) with an average insert size of 80 kb were
obtained and confirmed to correspond to the transgene integration site
by PCR using the same primers (Fig.
2A). The existence of OR genes at the Hlz6 locus was assessed by subjecting the
four P1 clones to PCR using the degenerate oligonucleotides p26 and p27, shown previously to amplify the region between transmembrane domains 3 and 6 of human and mouse OR genes (nucleotide sequences for
p26 and p27 were provided by L. Buck) (Ngai et al., 1993). One of the
clones, P1 6386, gave rise to a PCR product of the expected size of 390 bp (Fig. 2A). Assuming that this amplicon represents
a mixture of different OR sequences, the PCR product was labeled with
digoxigenin and used as a probe in Southern blot hybridization of
restriction-digested P1 6386 DNA (Fig. 2B). The number of detected hybridization products per digestion indicated that
one potential OR gene was obtained by PCR. Subcloning and sequence
analysis of a 3 kb hybridizing XbaI fragment (Fig.
2B) led indeed to the identification of a new mouse
OR gene that we named OR-Z6, recalling its identification in
the genomic context of the mouse line H-lacZ6. The
intronless open-reading frame of OR-Z6 encodes a typical
G-protein-coupled, seven transmembrane domain protein and contains many
conserved amino acid motifs and single residues in specific positions
characteristic of the large family of OR genes (Fig.
3A). This analysis
demonstrated that the transgene construct in H-lacZ6 mice
had indeed inserted close to an OR gene. OR-Z6 is the first
cloned OR gene that maps to mouse chromosome 6.
View larger version (56K):
[in this window]
[in a new window]
|
Figure 2.
Identification of the new odorant receptor gene
OR-Z6 at the Hlz6 locus.
A, Gel electrophoresis is shown of the products obtained
after PCR of the four P1 clones 6386-6389 (lanes 5-8)
using the two different primer sets primers p26 and p27 and primers ps2
and ps4. All P1 clones carry the 3'-flanking fragment as demonstrated
by the 160 bp amplicon derived from primers ps2 and ps4 (lanes
5-8). The 390 bp PCR product (star) derived
from the degenerate OR primers p26 and p27 is only evident for P1 clone
6386 (lane 5) and the positive control
(+C, lane 4) using mouse genomic
DNA. The thickness of the band in the positive control
(lane 4) reflects the amplification of numerous
genomic OR genes. The positive control for primers ps2 and ps4
(+C, lane 2; mouse genomic DNA) shows a
160 bp amplicon, whereas negative control reactions, omitting template
DNA, yielded no products for primers ps2 and ps4 (C,
lane 1) or primers p26 and p27 (C,
lane 3). HaeIII-digested  X174 phage
DNA (M) is the length standard (lane 9).
Fragment sizes in base pairs are indicated by the
numbers at the right.
B, Restriction digestion (left) followed
by Southern blot hybridization (right) shows that the P1
clone 6386 carries a single OR gene. Eight hundred nanograms of
each P1 6386 DNA digest (E, EcoRI;
S, SacI; X,
XbaI) were resolved on a 0.6% agarose gel, transferred
onto a nylon membrane, and subjected to Southern blot hybridization.
The probe was prepared by labeling the 390 bp PCR fragment obtained in
A with digoxigenin-conjugated dUTP via PCR using primers
p26 and p27. Hybridizing fragment sizes were 4 kb
(EcoRI), 11 kb (SacI), and 3 kb
(XbaI). The 3 kb hybridizing XbaI
fragment (arrowhead) was subcloned and sequenced.
HindIII-digested DNA
(M) is the length standard in kilobase
pairs indicated by the numbers at the
left.
|
|
View larger version (51K):
[in this window]
[in a new window]
|
Figure 3.
The new mouse OR-Z6 gene
encodes a typical OR protein. A, Top, Partial
restriction map of the 3 kb XbaI fragment carrying the
complete OR-Z6 coding region (black box)
and sequences 1.2 kb upstream and 1 kb downstream. Location of the
gene-specific primers N and C used in RT-PCR analyses
(C) is indicated by arrows.
Restriction enzymes are the following: B,
BamHI; E, EcoRI;
S, SphI; X,
XbaI. Bottom, Comparison of the deduced
amino acid sequences of the coding regions of mouse
OR-Z6 (mOR-Z6) and a human
OR-Z6 ortholog (hOR-Z6) in
one-letter code. For hOR-Z6, only
differences from the mOR-Z6 sequence are shown.
Gray shading depicts the predicted seven transmembrane
domains TM-1 to TM-7. The amino acid
sequence domains of the two OR-Z6 proteins that match
closely to the motifs conserved (indicated by a horizontal
line) among OR proteins are PMYFFL (TM-2),
MAVDRYVAVC (TM-3), SY (TM-5),
K(A/S)FSTCASH (TM-6), and PFLNPF
(TM-7). Both OR-Z6 proteins share
85% similarity over a total of 314 amino acids and exhibit cysteine
residues in conserved positions (97, 179, stars) and a
putative N-terminal receptor glycosylation site
(arrowhead), as well as several serine and threonine
phosphorylation sites in the third intracellular loop
(IL-3). B, Genomic Southern blot
hybridization for OR-Z6. Restriction digestion of mouse
liver DNA (10 µg/lane) from wild-type (wt) and
H-lacZ6 mice was as indicated (H,
HindIII; S, SphI;
X, XbaI). The Southern blot was
hybridized with the digoxigenin-labeled OR-Z6 coding
region. The DNA probe hybridized to a single fragment per
lane, and the sizes of the hybridizing fragments for
both wild-type and H-lacZ6 genomic DNA were identical
(H, 23 kb; S, 1.72 kb; X,
3 kb). HindIII-digested DNA
(M) is the length standard in kilobase
pairs indicated by the numbers on the
left. C, RT-PCR performed with RNA from
three different tissues demonstrating that OR-Z6 mRNA is
expressed in olfactory tissues (OE, OB). The photograph
shows a gel electrophoresis of the products derived from RT-PCR using
the OR-Z6 specific primers N and C. The 899 bp amplicon
was only evident in samples with preceding reverse transcription
(+RT). No products were obtained from RT-PCR
using liver mRNA (L) or from reactions omitting
reverse transcriptase (RT). The lower intensity
of the fragment obtained from OB mRNA versus that from OE mRNA
coincides with reports demonstrating that OR mRNA is much less abundant
in axon terminals compared with their cell bodies (Ressler et al.,
1994).
|
|
OR-Z6 orthologs on human chromosome 7
Subsequent homology searches in the European Molecular Biology
Laboratory database using the deduced OR-Z6 protein
showed sequence similarities up to 66% with other OR genes but did not reveal any OR-Z6 homologs. Interestingly, when searching the
High Throughput Genomic Sequences human genome database, we
identified OR genes on human chromosome 7 that have a higher homology
to OR-Z6 than to any other OR sequence yet reported and most
likely represent human OR-Z6 orthologs. Human clone
RP11-707F14 (AC073647) carries three OR-Z6 orthologs, the
coding regions of which show 81-94% nucleotide sequence identity
among themselves and 78-81% identity with the mouse OR-Z6
gene. One of the human ORs shares 85% amino acid similarity with
OR-Z6 (Fig. 3A), whereas the deduced protein
sequences of the other two OR-Z6 orthologs are interrupted by frame shifts and stop codons that may reflect pseudogenes or the
draft quality of the sequence released. Consistent with previous reports (Ben-Arie et al., 1994; Asai et al., 1996; Sullivan et al.,
1996; Trask et al., 1998; Strotmann et al., 1999; Tsuboi et al., 1999),
the human OR-Z6 orthologs exist in a tandem array and are
separated by 31 and 24 kb spacers.
OR-Z6 is a single OR gene at the
Hlz6 locus
To identify mouse OR-Z6 homologs, we performed
high-stringency genomic Southern blot hybridization using a
digoxigenin-labeled DNA probe of the OR-Z6 coding region and
genomic DNA from both wild-type mice (129S3) and H-lacZ6
mice. It has been reported that members of a subfamily share at least
80% identity and cross-hybridize with one another (Lancet and
Ben-Arie, 1993). The identical hybridization patterns obtained from
both DNA types (Fig. 3B) implied that the integration of the
lacZ transgene did not delete or grossly modify the
OR-Z6 locus in H-lacZ6 mice. Furthermore, the
number of the hybridizing fragments obtained per digestion showed that
OR-Z6 in mouse is most likely a single gene in its subfamily
but does not exclude the possibility that OR genes from a different
subfamily reside proximal to the OR-Z6 gene. To address this
question, we analyzed two BAC clones that extend ~190 kb each
upstream and downstream of the Hlz6 locus. The terms
"upstream" and "downstream" refer to the 3'-flanking fragment
that maps downstream of the transgene construct in H-lacZ6
mice and were only defined for the purpose of orientation. A
computerized search in an end-sequenced mouse genomic BAC library (TIGR
database) using the 3'-flanking fragment as a query yielded two BAC
clones. Clones RPCI-23-282I16 (AQ932615) and RPCI-23-323H21 (AQ988378)
showed 96% identity with the first 348 bp and the last 250 bp of the
3'-flanking fragment, respectively. Thus, the sequence of our transgene
3'-flanking fragment overlaps the two BAC clones and links them into a
single contig. PCR analyses of both BAC clones, using the
degenerate primers NL61 and NL63 that amplify the region between
transmembrane domains 2 and 6 of OR genes (primer sequences were
obtained from R. Reed, The Johns Hopkins University), yielded no other
OR genes in addition to OR-Z6. Low-stringency PCR yielded
PCR products from both BAC clones that were subcloned. A total
of 55 subclones derived from both BAC clones were examined by
restriction digestion, and 20 of these clones were subjected to
sequence analysis (data not shown). No OR genes were identified on BAC
PCI-23-323H21 that extends downstream of the Hlz6
locus. All sequenced subclones deriving from BAC RPCI-23-282I16 that
extends upstream of the Hlz6 locus were identical to the
OR-Z6 sequence. Thus, OR-Z6 in mouse may be a
single OR gene at the Hlz6 locus or the last member of a
cluster that resides even farther upstream in a region not covered by
BAC RPCI-23-282I16.
OR-Z6 expression in the OE
The tissue-specific expression of OR-Z6 was addressed
by reverse transcription (RT)-PCR in three different tissues using the gene-specific primers N and C (Fig. 3A) that span 899 bp of
the OR-Z6 coding region. Amplicons of the expected size were
only obtained after RT-PCR using RNA from OE and OB (Fig.
3C), demonstrating that OR-Z6 is an expressed OR
gene and that its mRNA is present in olfactory tissue. No products were
obtained from liver RNA or control reactions that omit reverse
transcriptase during cDNA synthesis. Sequencing of the RT-PCR products
showed that they were identical to the OR-Z6 sequence,
initially derived from the genomic XbaI subclone.
To analyze the distribution of OR-Z6 mRNA in the OE, we
performed in situ hybridization of serial coronal
cryosections along the anterior-to-posterior axis using
digoxigenin-labeled antisense and sense riboprobes. Riboprobes were
generated from a subcloned BamHI fragment that spans the
region between transmembrane domains 1 and 5 of the OR-Z6
coding region (Fig. 3A, top,
restriction map). Hybridizing ORNs were predominantly
located in the mid-to-caudal aspects of the OE. Interestingly,
OR-Z6+ ORNs were strongly restricted
to the medial epithelial recess, consisting of the tips of
endoturbinate-II and -III and ectoturbinate-3, all of which are exposed
at the central lumen of the nasal cavity (Fig.
4, left column). Within this
zone, OR-Z6+ neurons were randomly
distributed as indicated by hybridization of single neurons and small
clusters of approximately two to three neurons.
OR-Z6+ neurons were evident
throughout the depth of the OE and seemed only occasionally to
segregate in the more apical OE. Few labeled neurons were found in
other turbinates, the septum, or the vomeronasal organ (VNO) (data not
shown). The VNO, an accessory olfactory system, mediates the detection
of pheromones via specialized classes of pheromone receptors (Dulac and
Axel, 1995; Herrada and Dulac, 1997; Matsunami and Buck, 1997; Ryba and
Tirindelli, 1997; Leinders-Zufall et al., 2000). Although these
receptors differ from the main ORs, occasional cross-hybridization of
VNO neurons with OR sequences has been reported (Dulac and Axel, 1995;
Ebrahimi et al., 2000). We never detected hybridization signals in
sustentacular cells, in olfactory stem cells, or in control
hybridizations using the OR-Z6 sense probe. The
OR-Z6 hybridization pattern was essentially bilaterally
symmetrical between the left and right nose and reproducible among the
mice investigated (n = 10 129S3 mice). Comparison of the OR-Z6 mRNA pattern with that of three ORs, each known to
represent a single rostrocaudal zone, further illustrated the divergent OR-Z6 expression pattern (clones K21,
K20, and L45 corresponding to zones 1, 2, and 3 were provided by L. Buck). In situ hybridization for each of
the four probes in adjacent cryosections, followed by manual tracing of
the individual mRNA patterns (data not shown), demonstrated that
OR-Z6 was not only confined to the medial aspect of zone 2 (according to the Buck nomenclature) (Ressler et al., 1993, 1994) but
also overlapped with the ventral region of zone 1 and the dorsal aspect
of zone 3. A similar restricted type of expression was reported for
members of the OR37 subfamily in rat and mouse (Strotmann et
al., 1992, 1999).
View larger version (53K):
[in this window]
[in a new window]
|
Figure 4.
OR-Z6 mRNA and -galactosidase
exhibit similar expression patterns in mouse OE. The hemisections (left
nostril) shown in both columns represent a survey from
anterior (top) to posterior (bottom) in
the mid-to-caudal region of the OE. Left column,
In situ hybridization for OR-Z6
(digoxigenin-labeled riboprobe) performed in an array of 15 µm
coronal cryosections of the OE from a wild-type mouse (129S3; postnatal
day 24) is shown. OR-Z6+ neurons are
restricted to endoturbinate-II and -III and ectoturbinate-3 as
indicated. Similar to lacZ+ neurons
(right column), OR-Z6+
neurons are located at different depths of the OE; the most intensely
labeled neurons are located in the apical OE. Right
column, The overall distribution of OR-Z6 mRNA
is almost identical to the -galactosidase expression pattern
observed in an age-matched H-lacZ6 mouse. As seen for
OR-Z6 (boxed area, left column),
X-gal-stained ORNs (right column) are concentrated on
the tips of the central turbinates. To facilitate the comparison of the
expression patterns for OR-Z6 mRNA and
-galactosidase, sections were chosen to match similar regions of the
OE. Scale bar, 500 µm.
|
|
Expression of OR-Z6 and -galactosidase in
H-lacZ6 mice
The OR-Z6 expression pattern was strikingly similar to
that of -galactosidase in H-lacZ6 mice. This became
apparent when we compared the X-gal staining pattern in
H-lacZ6 mice with the OR-Z6 mRNA pattern in an
age-matched wild-type mouse. Although -gal+ ORNs in H-lacZ6 mice
were more numerous than OR-Z6+ ORNs
in wild-type mice, both patterns exhibited a high density of labeled
neurons at the tips of the central turbinates (Fig. 4).
LacZ+ neurons were evident
throughout the depth of the OE and did not exhibit obvious laminar
segregation. As seen for OR-Z6, a few -gal+ neurons were present in other
turbinates, the septum, and the VNO (data not shown). Analyses of the
rostrocaudal distribution in H-lacZ6 mice further
demonstrated the related expression patterns of -galactosidase and
OR-Z6 (Fig. 5). Adjacent
coronal cryosections from H-lacZ6 mice were collected as
separate sets of every 10th section and subjected to either X-gal
staining or OR-Z6 in situ hybridization before the labeled
cells were counted. On the basis of the similar expression pattern, we
included in situ hybridization for OR37E on one
set of sections (the OR37E subclone was kindly provided by
J. Strotmann). The distribution of
OR-Z6+ neurons in H-lacZ6
mice was the same as that determined in wild-type mice, implying that
the insertion of the reporter gene, close to the OR-Z6
locus, apparently does not affect the OR-Z6 expression pattern. Furthermore, despite the different total numbers of labeled neurons per reaction, the highest numbers of ORNs labeled for -galactosidase, OR-Z6, or mOR37E were found at
~2.40-2.75 mm posterior to the organ of Masera (a small patch of
OMP-positive ORNs separate from the main OE on both sides of
the nasal septum) (Giannetti et al., 1995). This result confirmed and
extended our previous findings that OR-Z6,
-galactosidase, and OR37 share a similar unusual spatial
distribution pattern in the OE.
View larger version (20K):
[in this window]
[in a new window]
|
Figure 5.
Anterior-to-posterior distribution of
-galactosidase (X-gal staining, top),
OR-Z6 (in situ hybridization,
middle), and OR37E (in
situ hybridization, bottom) in separate but
adjacent nose sections of the same P21 H-lacZ6 mouse.
Starting at the organ of Masera (0 mm), 15 µm coronal cryosections
were collected, and the labeled cells of every 10th section were
counted and plotted along the anterior-to-posterior axis. The three
expression profiles shown are nearly bilaterally symmetrical, and each
of the three neuron phenotypes shows the highest density of reactive
ORNs in the mid-to-caudal aspect of the OE at ~2.6 mm posterior to
the organ of Masera. ORNs expressing the lacZ transgene
were approximately twice as numerous as were
OR-Z6+ neurons. Whereas a small
number of -gal+ ORNs was evident in the region up
to 1.2 mm posterior to the organ of Masera, almost no
OR-Z6+ or
mOR37E+ neurons were found in this
anterior aspect. The unusually large number of
mOR37E+ neurons is caused by
cross-hybridization. The riboprobe used derives from the
mOR37E coding region that is highly homologous among the
four members of this subfamily, all of which are expressed in the same
zone (Strotmann et al., 2000). The total numbers of labeled
ORNs in the left or right nose of the H-lacZ6 mouse
analyzed were as follows: X-gal+, 5680 or 5780;
OR-Z6+, 3400 or 3240; and
mOR37E+, 10,230 or 10,410, respectively.
|
|
Neuronal colocalization of OR-Z6
and lacZ
Because of the close chromosomal localization of OR-Z6
and the lacZ transgene, together with their related
expression patterns, we determined whether both genes are expressed in
the same neurons. Double-labeling experiments in the OE of
H-lacZ6 mice were performed by subjecting coronal
cryosections to OR-Z6 in situ hybridization before
anti--galactosidase immunohistochemistry (IHC). In agreement with
the result obtained from single-labeling analyses,
OR-Z6+ and
-gal+ neurons cosegregated at the tips
of the central turbinates in all H-lacZ6 mice analyzed
(n = 5). Surprisingly, only a small fraction of ORNs
exhibited coexpression (OR-Z6+ and
-gal+) (Fig.
6), whereas the majority of neurons was
either OR-Z6-positive or -galactosidase-positive. Among
2038 -gal+ and 1070 OR-Z6+ neurons counted in a P19
H-lacZ6 mouse, 15 neurons showed double-labeling (0.74% of
the -gal+ population). Similar results
were obtained from a P12 H-lacZ6 mouse in which out of 1035 -gal+ and 618 OR-Z6+ neurons, 6 ORNs showed
double-labeling (0.58% of the -gal+
population). The numbers presented derive from conservative counts, discarding any ambiguously double-labeled neurons. Furthermore, we
noted that in situ hybridization before
anti--galactosidase IHC decreases the number of immunolabeled
neurons by 10-20%. Thus, the actual number of double-labeled cells
detected could be slightly higher. Reasoning that the population of
lacZ+ neurons in H-lacZ6
mice coexpresses other OR genes in addition to OR-Z6, we
performed double-labeling for -galactosidase and OR37E
that exhibits a similar zonal restriction. Interestingly, among 6605 OR37E+ neurons and 2226 -gal+ neurons counted in a P35
H-lacZ6 mouse, 36 neurons exhibited coexpression (1.6% of
the -gal+ population). Despite the
small number of H-lacZ6 mice investigated (n = 3), this analysis demonstrates that the expression of
-galactosidase does not exclude the coexpression of either
OR-Z6 or OR37E in the same neuron.
View larger version (147K):
[in this window]
[in a new window]
|
Figure 6.
The three bright-field images illustrate the
criteria by which olfactory neurons coexpressing the
lacZ transgene and OR-Z6 were identified.
OR-Z6 in situ hybridization was performed using a
digoxigenin-labeled OR-Z6 riboprobe, and hybridization
signals were detected and visualized using an alkaline
phosphatase-conjugated anti-digoxigenin antibody and a substrate that
developed a purple precipitate. Left, Hybridization
signals were most prominent in the apical cytoplasmic portion and
appeared triangular (arrows). In addition
we observed a thin line surrounding the nucleus; the
nucleus itself was usually white. Right,
In contrast, ORNs that solely express the lacZ transgene
(arrow) were gray, including the
cytoplasm covering the nucleus. Expression of -galactosidase was
detected using a primary anti--galactosidase antibody and visualized
using a substrate yielding a gray precipitate.
Middle, The double-labeled neuron shows a combination of
both features described. The gray cytoplasm covering the
nucleus indicates -galactosidase expression (arrow),
whereas the peak-shaped purple precipitate in the apical cytoplasm
corresponds to OR-Z6 in situ hybridization
(arrowhead). The three differently labeled neurons shown
derive from the same coronal cryosection of a 35-d-old
H-lacZ6 mouse and were closely associated on
endoturbinate-II. Scale bar, 20 µm.
|
|
OR-Z6+ ORNs project to a single
glomerulus in each OB
The bulb projections of OR-Z6+
neurons were assessed by in situ hybridization of serial
coronal sections of the entire OBs using
32P-labeled antisense and sense
riboprobes. To compare the position of hybridization signals among
different mice, we defined the sections as percentages along the
anterior-to-posterior axes of OBs. The first anterior section and the
last posterior section containing glomeruli were set as 0 and 100%,
respectively. Analyses of four 2-week-old wild-type mice (129S3) and
four 4-week-old H-lacZ6 mice showed that axonal projections
of OR-Z6+ neurons preferentially
converge onto a single glomerulus in each OB (Fig.
7).
OR-Z6+ glomeruli were reproducibly
located in the ventromedial portion of the anterior OBs, at
approximately the rostral tip of the subventricular zone. Hybridization
signals in the left and right bulbs of individual mice were nearly
bilaterally symmetrical (Fig. 7). The positions of
OR-Z6-labeled glomeruli across all mice investigated varied between 19 and 26% of the bulb length, equaling a mouse-to-mouse variation of 250 µm along the anterior-to-posterior axis (two to
three glomerulus widths). Furthermore, in each one of the two mouse
strains investigated, we detected an additional
OR-Z6+ glomerulus in one of the
bulbs that was either directly adjacent to and in the same coronal
plane as the primary one (129S3 line) or 300 µm (three to four
glomerulus widths) posterior to the primary one (H-lacZ6
line). The fact that these additional glomeruli were closely associated
with the primary OR-Z6+ glomerulus
in the ventromedial OB is consistent with the general idea that OR gene
expression plays a role in guiding axons to specific target sites in
the OB (Mombaerts et al., 1996; Wang et al., 1998). In contrast to
other reports (Mombaerts et al., 1996), we have never observed
OR-Z6+ glomeruli in the lateral OB
in any mice investigated.
View larger version (198K):
[in this window]
[in a new window]
|
Figure 7.
OR-Z6 neurons preferentially
project to a single glomerulus in the main OB. In situ
hybridization was performed on serial coronal cryosections of the
entire OBs using a [32P]CTP-labeled
antisense RNA probe of the OR-Z6 coding region.
Subsequent counterstaining of periglomerular nuclei facilitated the
identification of individual glomeruli in the glomerular layer
(GL). Top panels, The dark-field
photomicrographs illustrate that axonal projections of
OR-Z6-reactive neurons preferentially terminate onto a
single ventromedial glomerulus in each OB, as depicted by the
arrowheads. Bottom panels 1-3,
The hybridization signals (white grains) shown for this
specimen were evident in three consecutive 18 µm sections per bulb
(boxed areas in top panels magnified).
EPL, External plexiform layer; ONL,
olfactory nerve layer. Scale bar: bottom panels 1-3, 50 µm.
|
|
OR-Z6+ glomeruli in
H-lacZ6 mice receive input from
lacZ+ axons
Previous reports showed that -gal+
ORNs in H-lacZ6 mice project to many ventromedially located
glomeruli of the anterior OBs (Treloar et al., 1996; Walters et al.,
1996a; Cummings et al., 2000). These glomeruli exhibit different
degrees of lacZ expression because of the different number
of lacZ+ axons converging to each
glomerulus. Of these, two to three glomeruli are heavily innervated by
axons expressing the lacZ transgene, but it remains to be
shown whether all axons entering these glomeruli express
lacZ. Because the positions we determined for
OR-Z6+ glomeruli (between 19 and
26% of the bulb length) coincide closely with those of the
lacZ+ glomeruli mapped recently in
H-lacZ6 mice (Cummings et al., 2000), we next asked whether
axons of both ORN phenotypes also project to the same glomeruli.
Alternate coronal cryosections (15 µm) of the entire OBs from
young adult H-lacZ6 mice were collected as two sets and
separately subjected either to in situ hybridization using a
32P-labeled OR-Z6 antisense
riboprobe or to anti--galactosidase IHC. Analysis of two
H-lacZ6 mice showed that the single
OR-Z6+ glomerulus was always
strongly labeled for -galactosidase (Fig. 8), coinciding with one of the two to
three heavily labeled lacZ+
glomeruli. Consistently, the OR-Z6 extra glomerulus detected in one of the H-lacZ6 bulbs (data not shown) exhibited
lacZ labeling as well. The
-gal+ fibers projecting to the
OR-Z6+ glomerulus most likely
represent axonal projections of the double-labeled neurons detected in
the OE. Thus, this analysis demonstrates that OR-Z6+ glomeruli receive axonal
input from at least two phenotypically distinct ORN populations
(OR-Z6+ and
-gal+;
OR-Z6+ and
-gal).
View larger version (116K):
[in this window]
[in a new window]
|
Figure 8.
OR-Z6-positive glomeruli in
H-lacZ6 mice receive input from two phenotypically
different ORN populations. IHC for -galactosidase and in
situ hybridization for OR-Z6 were performed on
separate but adjacent sets of coronal cryosections (15 µm) cut from
the OB of a P26 H-lacZ6 mouse. The panels
show a series of higher magnifications of the ventromedial portion of
the left OB. The order in which sections were taken along the
anterior-to-posterior axis is indicated by the numbers
1-6. Hybridization signals for OR-Z6 appear as
dense white grains (dark-field, left),
whereas -gal+ axons are visible as
brown fibers entering their target glomeruli
(bright-field, right). Corresponding glomeruli in
adjacent sections were aligned after identifying glomerular borders by
counterstaining periglomerular nuclei. Comparison of labeled glomeruli
in the two columns demonstrates that the
OR-Z6+ glomerulus receives input from
-gal+ axons as well (white boxed
areas). The changing signal intensity for both
OR-Z6 and -gal as the sections progress through the
different depths of the glomerulus can be traced along the
anterior-to-posterior axes of the three sections shown. Note the small
number of -gal+ axons projecting to the
OR-Z6-labeled glomerulus. Scale bar, 100 µm.
|
|
| |
DISCUSSION |
We demonstrate that locus-dependent mechanisms probably contribute
to the zonal confinement of the OMP-lacZ
reporter in H-lacZ6 mice (Walters et al., 1996a,b) that
mimics the cell-selective expression pattern known for some OR genes.
Analysis of the transgene insertion site in H-lacZ6 mice
enabled us to identify and characterize the new OR gene
OR-Z6, the expression pattern of which resembles that of the
lacZ reporter in H-lacZ6 mice.
OR-Z6 is a typical OR gene the deduced protein sequence of
which shares many features with the large multigene OR family. Sequence
similarities to other ORs were as high as 66% but without selectivity
to any known OR, indicating that OR-Z6 defines a new subfamily. We mapped OR-Z6 and the lacZ transgene
to the proximal region of mouse chromosome 6, close to Tcrb.
Because this region shows synteny to human chromosome 7, where
Tcrb maps to 7q35, we predicted that human OR-Z6
orthologs map to 7q as well. Analyzing a recent release of the human
genome database, we identified three OR-Z6 orthologs on
human chromosome 7 that share ~80% nucleotide sequence identity with
mouse OR-Z6. In contrast, mouse OR-Z6 is likely a
single OR gene in its subfamily, because we did not detect homologs by
Southern blot analysis. The strong mouse-to-human homology suggests
that OR-Z6 is the first member of a distinct class of ORs
that have been conserved during mammalian evolution. Interestingly, a
recent hybridization study indicated that a mouse ortholog of the
canine OR subfamily CfOLF3 (Issel-Tarver and Rine, 1997) resides proximal to the marker Tbxas1 on mouse
chromosome 6 (Carver et al., 1998). No ORs were assigned to this
region, and the canine receptor is only poorly homologous to
OR-Z6. Thus, OR-Z6 is the first cloned OR gene
identified on mouse chromosome 6.
OR-Z6 expression is restricted to the medial OE
Any given OR gene is expressed by an ORN subpopulation confined to
one of four rostrocaudal zones of the mouse OE (for review, see
Mombaerts, 1999). By contrast, our in situ data
demonstrate that OR-Z6 neuron distribution differs from this
zonal rule. Although primarily confined to zone 2, OR-Z6
expression overlaps with neighboring zones and exhibits an unusual
medial restriction by occupying the tips of the central turbinates
only. Within this small subzone, OR-Z6 neurons are randomly
distributed, as implied by the coexistence of single-labeled neurons
and small labeled ORN clusters. The overall pattern is bilaterally
symmetrical between left and right nostrils and is present in both
wild-type and H-lacZ6 mice. A similar distribution was
reported for the mOR37 genes (Strotmann et al., 1999), the
only other exception to the canonical OR expression patterns. In
contrast to OR-Z6, mOR37 members share a six
amino acid extension in the third extracellular domain (Strotmann et al., 1999; Hoppe et al., 2000) and map to mouse chromosome 4, near to
two other OR genes that exhibit related expression patterns, but lack
the loop extension. OR-Z6, on mouse chromosome 6, has no
significant sequence identity with the mOR37 genes, despite the related expression pattern. Our results demonstrate that the zonal
confinement of OR expression is more complex than suggested by the
arbitrary division into four rostrocaudal zones. We provide evidence of
a medially restricted compartment having OR-Z6 and the genes
of the mOR37 locus as the first members. This location exposes OR-Z6 and mOR37 to the main nasal
airflow, implying a specific biological significance for these
receptors. Thus, it would be of interest to explore the ligand
chemistry of OR-Z6 and mOR37.
OR-Z6+ neurons project
exclusively to the medial OB
The unusual epithelial distribution is also reflected in OBs where
axonal projections of OR-Z6+ neurons
converge preferentially onto a single ventromedial glomerulus, as
demonstrated by in situ hybridization. We occasionally
identified secondary OR-Z6+
glomeruli (see also Royal and Key, 1999; Gogos et al., 2000; Strotmann et al., 2000). Mapping analyses of the entire bulbs showed that OR-Z6+ glomeruli always
reside ventromedial and within 19-26% of the rostrocaudal axis of the
OBs. The close association of primary and secondary glomeruli reflects
the topographic organization of the epithelium-to-bulb projections of
OR-Z6+ neurons, supporting the idea
that OR proteins contribute to selecting specific target sites in the
OBs (Mombaerts et al., 1996; Wang et al., 1998). Although their
physiological significance is unknown, the presence or absence of extra
glomeruli clearly demonstrates interindividual variation in olfactory
coding. In contrast to reports indicating that axonal projections of
ORNs expressing the same receptor each converge onto one lateral and
one medial glomerulus per OB (Ressler et al., 1994; Vassar et al.,
1994; Mombaerts et al., 1996), we have never observed lateral
OR-Z6+ glomeruli in the OBs of any
mice. As for OR-Z6, ORNs expressing members of the
mOR37 family (Strotmann et al., 2000) also project to single ventromedial glomeruli. In analogy to tracing studies investigating the patterns of epithelium-to-bulb projections (Astic and
Saucier, 1986; Schoenfeld et al., 1994), we conclude that the
ventromedial position for OR-Z6+ and
mOR37+ glomeruli is consistent with
the medial restriction of the corresponding neurons in the OE.
The OMP-lacZ-transgene mimics the
OR-Z6 expression pattern
The expression patterns of OR-Z6 and the transgene in
H-lacZ6 mice exhibit strong similarities, are confined to
the tips of the central turbinates, and exist as separate, but
overlapping, ORN populations. Whereas
OR-Z6+ neurons project primarily to
a single glomerulus per OB, lacZ+
neurons, which are twice as numerous, converge to a variety of ventromedial glomeruli, exhibiting different degrees of lacZ
labeling. The overall distribution of
OR-Z6+ neurons and their bulbar
projections are indistinguishable in H-lacZ6 and wild-type
mice, demonstrating that insertion of the OMP-lacZ construct close to the OR-Z6
locus has little effect on the OR-Z6 expression pattern.
Despite their similar zonal confinement, the small number of
double-labeled ORNs detected in H-lacZ6 mice (1-2%) shows
that coexpression of lacZ and either OR-Z6 or
mOR37E is independent and that transgene expression does not
interfere with OR gene expression.
OR-Z6+ glomeruli in the OBs of
H-lacZ6 mice are always positive for -galactosidase.
Because the number of lacZ+ fibers
in OR-Z6+ glomeruli approximates the
number of double-labeled ORN cell bodies in the OE, we conclude that
these glomeruli receive input from two different
OR-Z6+ ORN phenotypes
(OR-Z6+ and
lacZ;
OR-Z6+ and
lacZ+), suggesting that singly
lacZ-labeled neurons
(OR-Z6 and
lacZ+) that converge onto
neighboring glomeruli express other ORs. This idea is consistent with
reports demonstrating the importance of OR expression for precise
axonal convergence (Mombaerts et al., 1996; Wang et al., 1998).
LacZ+ neurons in H-lacZ6
mice target a large number of glomeruli the overall topography of which
is reestablished with remarkable accuracy after chemical
deafferentation (Cummings et al., 2000). Thus, we propose that
glomerular targeting of lacZ+
neurons in H-lacZ6 mice relies on coexpression of OR genes,
preferentially directed to the small medial subzone, of which
OR-Z6 and mOR37E are the only two known examples.
Furthermore, we speculate that the number of
lacZ+ glomeruli corresponds to the
number of different OR genes expressed by the
lacZ+ neuron population. The
different levels of lacZ labeling in H-lacZ6 glomeruli may reflect the different degrees to which
lacZ+ neurons coexpress other OR genes.
Locus-dependent transgene expression in
H-lacZ6 mice
The similar spatial distribution of
lacZ+ and
OR-Z6+ neurons implies that the
expression of both genes is linked. Because the transgene construct
bears no OR gene identity, the question arises as to what molecular
mechanisms lead to this pattern. The H-OMP-lacZ construct consists of a truncated OMP promoter containing
the proximal olf-1 (O/E-1) binding site (Kudrycki et al., 1993; Wang and Reed, 1993), the lacZ coding region, and an SV40
polyadenylation sequence. Transgene expression in H-lacZ3
mice, another mouse line generated with this construct, showed that the
truncated OMP promoter serves as a minimal promoter,
providing temporally and spatially correct expression in all mature
ORNs (Walters et al., 1996a,b). In contrast, the expression pattern
observed in H-lacZ6 mice implies the involvement of
hierarchical mechanisms, capable of overriding the properties of the
OMP promoter in the lacZ transgene and
restricting lacZ expression not only to a specific zone but
also to an ORN subpopulation within this zone, as opposed to the global
ORN expression observed in H-lacZ3 mice. Zonally active
transcription factors, environmental cues, or lineage predetermination possibly contribute to this patterning. However, the
OR-Z6-like transgene expression in H-lacZ6 mice
is likely caused by the site of transgene integration that occurred
close to OR-Z6. So-called position effects are well known in
transgenic mice (Festenstein et al., 1996; Milot et al., 1996). This
idea is consistent with studies showing that OR genes closely linked at
specific loci exhibit similar expression patterns (Strotmann et al.,
1999; Tsuboi et al., 1999; Serizawa et al., 2000). A transgenic
approach demonstrated that the zonal affiliation of an OR
promoter-driven reporter construct was dependent on the chromosomal
insertion site (Qasba and Reed, 1998). Thus, we propose that the
transgene pattern in H-lacZ6 mice is locus-predetermined and
that the OMP-lacZ construct that randomly
inserted near OR-Z6 reports on its genomic environment. Similar locus-dependent mechanisms may apply to the mOR37
genes on mouse chromosome 4. In conclusion, our study strongly suggests that the expression of OR-Z6 and the
OMP-lacZ transgene is regulated via common,
locus-dependent mechanisms that exemplify the locus-dependent regulation of OR gene expression.
| |
FOOTNOTES |
Received Dec. 20, 2000; revised April 3, 2001; accepted April 5, 2001.
This research was supported in part by National Institutes of Health
Grants DCD03112 (F.L.M.) and U54NS39407 (E.W.) and by the National
Cancer Institute, Department of Health and Human Services (N.G.C.,
N.A.J., and D.J.G.). We thank Drs. A. Puche and O. Buiakova for helpful
discussions and S. Moussavi and Deborah B. Householder for excellent
technical assistance.
Correspondence should be addressed to Dr. F. L. Margolis,
University of Maryland at Baltimore, School of Medicine, Department of
Anatomy and Neurobiology, 685 West Baltimore Street, Health Science
Facility 273, Baltimore, MD 21201. E-mail:
fmargoli{at}umaryland.edu.
| |
REFERENCES |
-
Asai H,
Kasai H,
Matsuda Y,
Yamazaki N,
Nagawa F,
Sakano H,
Tsuboi A
(1996)
Genomic structure and transcription of a murine odorant receptor gene: differential initiation of transcription in the olfactory and testicular cells.
Biochem Biophys Res Commun
221:240-247[Web of Science][Medline].
-
Astic L,
Saucier D
(1986)
Anatomical mapping of the neuroepithelial projection to the olfactory bulb in the rat.
Brain Res Bull
16:445-454[Web of Science][Medline].
-
Ben-Arie N,
Lancet D,
Taylor C,
Khen M,
Walker N,
Ledbetter DH,
Carrozzo R,
Patel K,
Sheer D,
Lehrach H
(1994)
Olfactory receptor gene cluster on human chromosome 17: possible duplication of an ancestral receptor repertoire.
Hum Mol Genet
3:229-235[Abstract/Free Full Text].
-
Buck L,
Axel R
(1991)
A novel multigene family may encode odorant receptors: a basis for odorant recognition.
Cell
65:175-187[Web of Science][Medline].
-
Carver EA,
Issel-Tarver L,
Rine J,
Olsen AS,
Stubbs L
(1998)
Location of mouse and human genes corresponding to conserved canine olfactory receptor gene family.
Mamm Genome
9:349-354[Web of Science][Medline].
-
Chess A,
Simon I,
Cedar H,
Axel R
(1994)
Allelic inactivation regulates olfactory receptor gene expression.
Cell
78:823-834[Web of Science][Medline].
-
Copeland NG,
Jenkins NA
(1991)
Development and applications of a molecular genetic linkage map of the mouse genome.
Trends Genet
7:113-118[Web of Science][Medline].
-
Cummings DM,
Darren KE,
Steven LS,
Margolis FL
(2000)
Pattern of olfactory bulb innervation returns after recovery from reversible peripheral deafferentiation.
J Comp Neurol
421:362-373[Web of Science][Medline].
-
Dulac C,
Axel R
(1995)
A novel family of genes encoding putative pheromone receptors in mammals.
Cell
83:195-206[Web of Science][Medline].
-
Ebrahimi FAW,
Edmondson J,
Rothstein R,
Chess A
(2000)
YAC transgene-mediated olfactory receptor gene choice.
Dev Dyn
217:225-231[Medline].
-
Emson PC,
Shoham S,
Feler C,
Buss T,
Price J,
Wilson CJ
(1990)
The use of a retroviral vector to identify foetal striatal neurons transplanted into the adult striatum.
Exp Brain Res
79:427-430[Web of Science][Medline].
-
Festenstein R,
Tolaini M,
Corbella P,
Mamalaki C,
Parrington J,
Fox M,
Miliou A,
Jones M,
Kioussis D
(1996)
Locus control region function and heterochromatin-induced position effect variegation.
Science
271:1123-1125[Abstract].
-
Giannetti N,
Pellier V,
Oestreicher AB,
Astic L
(1995)
Immunocytochemical study of the differentiation process of the septal organ of Masera in developing rats.
Brain Res Dev Brain Res
84:287-293[Medline].
-
Gogos JA,
Osborne J,
Nemes A,
Mendelsohn M,
Axel R
(2000)
Genetic ablation and restoration of the olfactory topographic map.
Cell
103:609-620[Web of Science][Medline].
-
Graziadei PP,
Graziadei GA
(1979)
Neurogenesis and neuron regeneration in the olfactory system of mammals. I. Morphological aspects of differentiation and structural organization of the olfactory sensory neurons.
J Neurocytol
8:1-18[Web of Science][Medline].
-
Herrada G,
Dulac C
(1997)
A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution.
Cell
90:763-773[Web of Science][Medline].
-
Hoppe R,
Weimer M,
Beck A,
Breer H,
Strotmann J
(2000)
Sequence analyses of the olfactory gene cluster mOR37 on mouse chromosome 4.
Genomics
68:284-295.
-
Issel-Tarver L,
Rine J
(1997)
The evolution of mammalian olfactory receptors.
Genetics
145:185-195[Abstract].
-
Jenkins NA,
Copeland NG,
Taylor BA,
Lee BK
(1982)
Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus.
J Virol
43:26-36[Abstract/Free Full Text].
-
Kudrycki K,
Stein-Izsak C,
Behn C,
Grillo M,
Akeson R,
Margolis FL
(1993)
Olf-1-binding site: characterization of an olfactory neuron-specific promoter motif.
Mol Cell Biol
13:3002-3014[Abstract/Free Full Text].
-
Lancet D,
Ben-Arie N
(1993)
Olfactory receptors.
Curr Biol
3:668-674.
-
Leinders-Zufall T,
Lane AP,
Puche AC,
Ma W,
Novotny MV,
Shipley MT,
Zufall F
(2000)
Ultrasensitive pheromone detection by mammalian vomeronasal neurons.
Nature
405:792-796[Medline].
-
Li YS,
Hoffman RM,
Le Beau MM,
Espinosa III R,
Jenkins NA,
Gilbert DJ,
Copeland NG,
Deuel TF
(1992)
Characterization of the human pleiotrophin gene.
J Biol Chem
267:26011-26016[Abstract/Free Full Text].
-
Matsunami H,
Buck L
(1997)
A multigene family encoding a diverse array of putative pheromone receptors in mammals.
Cell
90:775-784[Web of Science][Medline].
-
Milot E,
Strouboulis J,
Trimborn T,
Wijgerde M,
de Boer E,
Langeveld A,
Tan-Un K,
Vergeer W,
Yannoutsos N,
Grosveld F,
Fraser P
(1996)
Heterochromatin effects on the frequency and duration of LCR-mediated gene transcription.
Cell
87:105-114[Web of Science][Medline].
-
Mombaerts P
(1999)
Molecular biology of odorant receptors in vertebrates.
Annu Rev Neurosci
22:487-509[Web of Science][Medline].
-
Mombaerts P,
Wang F,
Dulac C,
Chao SK,
Nemes A,
Mendelsohn M,
Edmondson J,
Axel R
(1996)
Visualizing an olfactory sensory map.
Cell
87:675-686[Web of Science][Medline].
-
Ngai J,
Dowling MM,
Buck L,
Axel R,
Chess A
(1993)
The family of genes encoding odorant receptors in the channel catfish.
Cell
72:657-666[Web of Science][Medline].
-
Osoegawa K,
Tateno M,
Woon PY,
Frengen E,
Mammoser AG,
Catanese JJ,
Hayashizaki Y,
de Jong PJ
(2000)
Bacterial artificial chromosome libraries for mouse sequencing and functional analysis.
Genome Res
10:116-128[Abstract/Free Full Text].
-
Qasba P,
Reed RR
(1998)
Tissues and zonal specific expression of an olfactory receptor transgene.
J Neurosci
18:227-236[Abstract/Free Full Text].
-
Ressler KJ,
Sullivan SL,
Buck LB
(1993)
A zonal organization of odorant receptor gene expression in the olfactory epithelium.
Cell
73:597-609[Web of Science][Medline].
-
Ressler KJ,
Sullivan SL,
Buck LB
(1994)
Information coding in the olfactory system: evidence for a stereotyped and highly organized epitope map in the olfactory bulb.
Cell
79:1245-1255[Web of Science][Medline].
-
Royal S,
Key B
(1999)
Development of P2 olfactory glomeruli in P2-internal ribosome entry site-tau-lacZ transgenic mice.
J Neurosci
19:9856-9864[Abstract/Free Full Text].
-
Ryba NJ,
Tirindelli R
(1997)
A new multigene family of putative pheromone receptors.
Neuron
19:371-379[Web of Science][Medline].
-
Schoenfeld TA,
Clancy AN,
Forbes WB,
Macides F
(1994)
The spatial organization of the peripheral olfactory system of the hamster. Pt I, Receptor neuron projections to the main olfactory bulb.
Brain Res Bull
34:183-210[Web of Science][Medline].
-
Serizawa S,
Ishii T,
Nakatani H,
Tsuboi A,
Nagawa F,
Asano M,
Sudo K,
Sakagami J,
Sakano H,
Ijiri T,
Matsuda Y,
Suzuki M,
Yamamori T,
Iwakura Y,
Sakano H
(2000)
Mutually exclusive expression of odorant receptor transgenes.
Nat Neurosci
3:687-693[Web of Science][Medline].
-
Siracusa LD,
Rosner MH,
Vigano MA,
Gilbert DJ,
Staudt LM,
Copeland NG,
Jenkins NA
(1991)
Chromosomal location of the octamer transcription factors, Otf-1, Otf-2, and Otf-3, defines multiple Otf-3-related sequences dispersed in the mouse genome.
Genomics
10:313-326[Web of Science][Medline].
-
Strotmann J,
Wanner I,
Krieger J,
Raming K,
Breer H
(1992)
Expression of odorant receptors in spatially restricted subsets of chemosensory neurons.
NeuroReport
3:270-280.
-
Strotmann J,
Wanner I,
Helfrich T,
Beck A,
Meinken C,
Kubick S,
Breer H
(1994a)
Olfactory neurons expressing distinct odorant receptor subtypes are spatially segregated in the nasal neuroepithelium.
Cell Tissue Res
276:429-438[Web of Science][Medline].
-
Strotmann J,
Wanner I,
Helfrich T,
Breer H
(1994b)
Rostro-caudal patterning of receptor-expressing olfactory neurons in the rat nasal cavity.
Cell Tissue Res
278:11-20[Web of Science][Medline].
-
Strotmann J,
Hoppe R,
Conzelmann S,
Feinstein P,
Mombaerts P,
Breer H
(1999)
Small subfamily of olfactory receptor genes: structural features, expression pattern and genomic organization.
Gene
236:281-291[Web of Science][Medline].
-
Strotmann J,
Conzelmann S,
Beck A,
Feinstein P,
Breer H,
Mombaerts P
(2000)
Local permutations in the glomerular array of the mouse olfactory bulb.
J Neurosci
20:6927-6938[Abstract/Free Full Text].
-
Sullivan SL,
Adamson MC,
Ressler KJ,
Kozak CA,
Buck LB
(1996)
The chromosomal distribution of mouse odorant receptor genes.
Proc Natl Acad Sci USA
93:884-888[Abstract/Free Full Text].
-
Trask BJ,
Friedman C,
Martin-Gallardo A,
Rowen L,
Akinbami C,
Blankenship J,
Collins C,
Giorgi D,
Iadonato S,
Johnson F,
Kuo WL,
Massa H,
Morrish T,
Naylor S,
Nguyen OT,
Rouquier S,
Smith T,
Wong DJ,
Youngblom J,
van den Engh G
(1998)
Members of the olfactory receptor gene family are contained in large blocks of DNA duplicated polymorphically near the ends of human chromosomes.
Hum Mol Genet
7:13-26[Abstract/Free Full Text].
-
Treloar H,
Walters E,
Margolis F,
Key B
(1996)
Olfactory glomeruli are innervated by more than one distinct subset of primary sensory olfactory neurons in mice.
J Comp Neurol
367:550-562[Web of Science][Medline].
-
Tsuboi A,
Yoshihara S,
Yamazaki N,
Kasai H,
Asai-Tsuboi H,
Komatsu M,
Serizawa S,
Ishii T,
Matsuda Y,
Nagawa F,
Sakano H
(1999)
Olfactory neurons expressing closely linked and homologous odorant receptor genes tend to project their axons to neighboring glomeruli on the olfactory bulb.
J Neurosci
19:8409-8418[Abstract/Free Full Text].
-
Vassar R,
Ngai J,
Axel R
(1993)
Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium.
Cell
74:309-318[Web of Science][Medline].
-
Vassar R,
Chao SK,
Sitcheran R,
Nunez JM,
Vosshall LB,
Axel R
(1994)
Topographic organization of sensory projections to the olfactory bulb.
Cell
79:981-991[Web of Science][Medline].
-
Walters E,
Grillo M,
Tarozzo G,
Stein-Izsak C,
Corbin J,
Bocchiaro C,
Margolis FL
(1996a)
Proximal regions of the olfactory marker protein gene promoter direct olfactory neuron-specific expression in transgenic mice.
J Neurosci Res
43:146-160[Web of Science][Medline].
-
Walters E,
Grillo M,
Oestreicher B,
Margolis FL
(1996b)
LacZ and OMP are co-expressed during ontogeny and regeneration in olfactory receptor neurons of OMP promoter-lacZ transgenic mice.
Int J Dev Neurosci
14:813-822[Medline].
-
Wang F,
Nemes A,
Mendelsohn M,
Axel R
(1998)
Odorant receptors govern the formation of a precise topographic map.
Cell
93:47-60[Web of Science][Medline].
-
Wang MM,
Reed RR
(1993)
Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast.
Nature
364:121-126[Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21134637-12$05.00/0
This article has been cited by other articles:
|
|
|
|
 
T. A. Schoenfeld and T. A. Cleland
Anatomical Contributions to Odorant Sampling and Representation in Rodents: Zoning in on Sniffing Behavior
Chem Senses,
February 1, 2006;
31(2):
131 - 144.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Zhang, M. Rogers, H. Tian, X. Zhang, D.-J. Zou, J. Liu, M. Ma, G. M. Shepherd, and S. J. Firestein
High-throughput microarray detection of olfactory receptor gene expression in the mouse
PNAS,
September 28, 2004;
101(39):
14168 - 14173.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. L. Iwema, H. Fang, D. B. Kurtz, S. L. Youngentob, and J. E. Schwob
Odorant Receptor Expression Patterns Are Restored in Lesion-Recovered Rat Olfactory Epithelium
J. Neurosci.,
January 14, 2004;
24(2):
356 - 369.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Serizawa, K. Miyamichi, H. Nakatani, M. Suzuki, M. Saito, Y. Yoshihara, and H. Sakano
Negative Feedback Regulation Ensures the One Receptor-One Olfactory Neuron Rule in Mouse
Science,
December 19, 2003;
302(5653):
2088 - 2094.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. L. Youngentob, P. F. Kent, and F. L. Margolis
OMP Gene Deletion Results in an Alteration in Odorant-Induced Mucosal Activity Patterns
J Neurophysiol,
December 1, 2003;
90(6):
3864 - 3873.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Goetze, H. Breer, and J. Strotmann
A Long-term Culture System for Olfactory Explants with Intrinsically Fluorescent Cell Populations
Chem Senses,
November 1, 2002;
27(9):
817 - 824.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Young and B. J. Trask
The sense of smell: genomics of vertebrate odorant receptors
Hum. Mol. Genet.,
May 15, 2002;
11(10):
1153 - 1160.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. B. Treloar, P. Feinstein, P. Mombaerts, and C. A. Greer
Specificity of Glomerular Targeting by Olfactory Sensory Axons
J. Neurosci.,
April 1, 2002;
22(7):
2469 - 2477.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Key and J. St John
Axon Navigation in the Mammalian Primary Olfactory Pathway: Where to Next?
Chem Senses,
March 1, 2002;
27(3):
245 - 260.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
