 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 2001, 21(13):4657-4667
Taxol Induces Apoptosis in Cortical Neurons by a Mechanism
Independent of Bcl-2 Phosphorylation
Xavier A.
Figueroa-Masot,
Michal
Hetman,
Matthew J.
Higgins,
Niels
Kokot, and
Zhengui
Xia
Departments of Environmental Health and Pharmacology, Graduate
Program in Neurobiology and Behavior, University of Washington,
Seattle, Washington 98195-7234
 |
ABSTRACT |
Bcl-2, an antiapoptotic protein, protects cells against many but
not all forms of apoptosis. For example, Bcl-2 does not protect non-neuronal cells against taxol, a microtubule-stabilizing agent. The
underlying mechanism for the ineffectiveness of Bcl-2 against taxol has
been the subject of intense interest. Data from non-neuronal cells
indicate that taxol-induced apoptosis requires activation of N-terminal
c-Jun protein kinase (JNK) that phosphorylates and inactivates Bcl-2.
This suggests the interesting possibility that the apoptotic activity
of JNK may be caused by phosphorylation of Bcl-2 and inhibition of the
antiapoptotic activity of Bcl-2. Here we report that taxol induces
apoptosis in cortical neurons but by a mechanism significantly
different from that in non-neuronal cells. In contrast to human
embryonic kidney 293 cells, expression of wild-type Bcl-2 in cortical
neurons protected against taxol-induced apoptosis, and taxol did not
induce Bcl-2 phosphorylation. Furthermore, cortical neurons express
high basal JNK activity, and taxol did not stimulate total JNK
activity. However, taxol activated a subpool of JNK in the nucleus and
stimulated c-Jun phosphorylation. JNK inhibition or expression of a
dominant-negative c-Jun abrogated taxol-induced apoptosis in cortical
neurons, suggesting a role for JNK and JNK-mediated transcription in
taxol-stimulated apoptosis. Furthermore, taxol-induced apoptosis in
cortical neurons required inhibition of phosphatidylinositol
3-kinase signaling. These data suggest that taxol induces
apoptosis in neurons by a mechanism quite distinct from that of
non-neuronal cell lines and emphasize the importance of elucidating
apoptotic mechanisms specific for neurons in the CNS.
Key words:
cortical neurons; N-terminal c-Jun kinase; SAPK; JNK; CEP-1347; KT7515; taxol; paclitaxel; Bcl-2; PI 3-kinase; Akt; ERK1/2; apoptosis
 |
INTRODUCTION |
Bcl-2, the prototype of the
Bcl-2-related family of proteins, protects against many forms of
apoptosis (Davies, 1995 ; Adams and Cory, 1998 ; Vander Heiden and
Thompson, 1999 ). However, Bcl-2 does not inhibit apoptosis in
non-neuronal cells induced by microtubule-damaging agents including
taxol (paclitaxel) (Haldar et al., 1995 , 1996 , 1997 ). Taxol is a
microtubule-stabilizing agent and an effective anticancer drug for
ovarian, breast, lung, and prostate cancer (Wall and Wani, 1995 ;
Blagosklonny and Fojo, 1999 ). It induces apoptosis in cancer and
non-neuronal cell lines, presumably by causing cell cycle arrest at the
G2/M phase (Kung et al., 1990 ; Jordan et al.,
1996 ; Blagosklonny and Fojo, 1999 ). A hallmark of taxol treatment of
non-neuronal cells is activation of N-terminal c-Jun protein kinase
(JNK) and phosphorylation of Bcl-2 (Haldar et al., 1995 ; Blagosklonny
et al., 1996 ; Blagosklonny and Fojo, 1999 ; Srivastava et al., 1999 ;
Yamamoto et al., 1999 ). Phosphorylation occurs on selective serine
residues including S70 and S87 located around an unstructured loop in
Bcl-2 (amino acids 32-80) (Chang et al., 1997 ; Maundrell et al., 1997 ;
Basu and Haldar, 1998 ; Fang et al., 1998 ; Haldar et al., 1998 ;
Srivastava et al., 1999 ; Yamamoto et al., 1999 ). Several kinase
cascades have been implicated in Bcl-2 phosphorylation including JNK
(Maundrell et al., 1997 ; Amato et al., 1998 ; Lee et al., 1998 ; Wang et
al., 1998 , 1999 ; Srivastava et al., 1999 ; Yamamoto et al., 1999 ).
Although the functional significance of taxol-stimulated Bcl-2
phosphorylation has not been completely elucidated, it is hypothesized that Bcl-2 phosphorylation inactivates the antiapoptotic activity of
Bcl-2 and contributes to taxol-induced apoptosis (Haldar et al.,
1995 ; Srivastava et al., 1999 ). For example, deletion of the
unstructured loop region or mutations of amino acids S70 and S87 to
nonphosphorylatable alanines enhance the antiapoptotic activity of
Bcl-2 against taxol (Srivastava et al., 1999 ). Interestingly, JNK
activation and Bcl-2 phosphorylation also occur during normal cell
cycle progression in mitosis (Ling et al., 1998 ; Scatena et al., 1998 ;
Yamamoto et al., 1999 ). It has been postulated that taxol treatment
causes G2/M phase arrest, JNK activation, and Bcl-2 phosphorylation that lead to apoptosis (Lee et al., 1998 ; Ling et
al., 1998 ; Scatena et al., 1998 ; Srivastava et al., 1999 ; Wang et al.,
1999 ; Yamamoto et al., 1999 ). These studies suggest that the
antiapoptotic activity of Bcl-2 is negatively regulated by JNK.
Although Bcl-2 is expressed in CNS neurons and protects them against
some forms of apoptosis (Davies, 1995 ; Hetman et al., 1999 ; Namgung and
Xia, 2000 ), the role of Bcl-2 phosphorylation in neuronal apoptosis has
not been defined. Because JNK has been implicated in several forms of
CNS neuron apoptosis (Yang et al., 1997 ; Luo et al., 1998 ; Maroney et
al., 1998 ; Kuan et al., 1999 ; Le Niculescu et al., 1999 ; Namgung and
Xia, 2000 ), one might assume on the basis of work performed with
non-neuronal cells that JNK activation in neurons also contributes to
taxol-stimulated apoptosis via phosphorylation and inactivation of
Bcl-2. Surprisingly, we discovered that taxol stimulates apoptosis in
cortical neurons by a novel Bcl-2-independent mechanism that requires
JNK signaling to the nucleus and inhibition of the phosphatidylinositol
3 (PI 3)-kinase survival pathway.
 |
MATERIALS AND METHODS |
Materials. The following plasmids have been described
previously: pON260 that encodes -galactosidase (Cherrington and
Mocarski, 1989 ); pCDNA3-Flag-Bcl-2 (del Peso et al., 1997 ), the
dominant-negative mitogen-activated protein kinase (MAPK) kinase
(MKK)7 in which the activating phosphorylation sites S271, T275,
and T277 were replaced by alanines (Holland et al., 1997 ); and the
c-Jun dominant-negative mutant pCMV-TAM67 ( 3-122) that lacks the
JNK binding and transactivation domains (Rapp et al., 1994 ). The
pCDNA3-hemagglutinin(HA)-Bcl-2 loop deletion mutant (Bcl-2 loop,
deleting amino acids 32-80) was generated by subcloning the HA-Bcl-2
loop insert from the pSFFV-HA-Bcl-2 loop vector obtained from Dr.
S. Korsmeyer. The Bcl-2 single-point mutants pCDNA3-Flag-Bcl-2 S70A and
S87A were prepared by PCR-directed mutagenesis using Pfu DNA polymerase (QuickChange site-directed mutagenesis kit; Stratagene, La
Jolla, CA). The primers used were the following:
GGTCGCCCGGACCGCGCCACTGCAGACCC (S70A sense),
GGGTCTGCAGTGGCGCGGTCCGGGCGACC (S70A antisense), CGGGGCCTGCGCTAGCCCCGGTACCACCTGTG (S87A sense), and
CACAGGT- GGTACCGGGGCTAGCGCAGGCCCCGC (S87A antisense). Mutations were
screened by restriction enzyme digestion (KpnI or
NheI for the S87A mutation; RsrII or
PstI for the S70A mutation) and confirmed by direct sequence
analysis (ABI Prism Dye Termination Kit; PerkinElmer Life Sciences,
Emeryville, CA). The sequence fidelity of the Bcl-2 S70A and S87A
inserts was confirmed by DNA sequencing of the entire length of cDNA
inserts. The double mutant pCDNA3-Flag-Bcl-2 S70A and S87A (Bcl2 A/A,
hereafter) was generated by subcloning from single-point mutants using
SacII and XhoI restriction enzymes.
CEP-1347 (KT7515) was provided by Dr. Anna C. Maroney at Cephalon, Inc.
(West Chester, PA). PD98059 were purchased from Calbiochem (La
Jolla, CA). Taxol, bis-benzimide (Hoechst 33258), and
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were
purchased from Sigma (St. Louis, MO). Polyclonal antibody to
-galactosidase was purchased from 5 Prime 3 Prime, Inc. (Boulder,
CO). The anti-Bcl-2 (N-19 and C-2) antibodies were purchased from Santa
Cruz Biotechnology (Santa Cruz, CA). The anti-phospho-Erk antibody
(anti-ACTIVE MAPK pAb) was purchased from Promega (Madison, WI). The
anti-phospho-Ser 473 Akt antibody, the anti-phospho-JNK antibody
(Thr183 and Tyr185), and the anti-phospho-c-Jun (Ser73) antibody were
purchased from New England Biolabs (Beverly, MA).
Quantitation of cell death and apoptosis. Cell viability was
determined by the MTT metabolism assay (Hansen et al., 1989 ; Hetman et
al., 1999 ). Cells were stained with the DNA dye Hoechst 33258 (bis-benzimide; 2.5 µg/ml) to visualize nuclear morphology (Hetman et
al., 1999 ). Apoptosis was quantitated by scoring the percentage of
apoptotic cells in the adherent cell population. Uniformly stained
nuclei were scored as healthy, viable neurons. Condensed or fragmented
nuclei were scored as apoptotic. Statistical analysis of the data was
performed using one-way ANOVA followed by post hoc tests.
Human embryonic kidney 293 cell culture and transfection.
Human embryonic kidney (HEK) 293 cells were maintained in DMEM
(Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (HyClone, Logan, UT), 2 mM L-glutamine
(Life Technologies), and penicillin (0.05 U/ml)-streptomycin (0.05 mg/ml). For DNA transfections, HEK 293 cells were plated at 3.0 × 106 cells/100 mm plate the day before
transfection. After growth overnight, cells were transfected by the
calcium phosphate coprecipitation method. For transient transfection
studies, cells were treated or harvested 2 d after transfection.
For stable transfections, cells were replated 2 d later and grown
in culture media containing G418 (Gemini Biolabs; 500 active units/ml)
to select for neomycin-resistant cells. One week later, cells were
switched to culture media containing 250 active units/ml G418 for
continued selection. The neomycin-resistant cell colonies were combined
to obtain pooled stable transfectants.
Culture, transfection of primary cortical neurons, and detection
of transfected neurons. Cortical neurons were prepared from newborn Sprague Dawley rats as described previously (Hetman et al.,
1999 ; Namgung and Xia, 2000 ). Neurons were transiently transfected at
day 3 or 4 in vitro (DIV 3 or 4) using a calcium phosphate coprecipitation protocol (Xia et al., 1996 ) with modifications (Hetman
et al., 1999 ; Namgung and Xia, 2000 ). To detect transfected cells,
neuron cultures were always cotransfected with an expression vector
encoding -galactosidase (pON260) as a marker for transfected cells
(Xia et al., 1995 ; Hetman et al., 1999 , 2000 ). Neuron cultures were
fixed for immunostaining 1-3 d after transfection. Transfected cells
were identified by immunostaining with a polyclonal antibody to
-galactosidase. Many of the expression vectors used in this study
were epitope-tagged, and expression of these epitope-tagged proteins
was confirmed directly by immunostaining using the corresponding anti-epitope-specific (anti-HA or anti-Flag) antibodies. Drug treatments of neurons were performed on DIV 5-6 or 2 d after transfection.
Assay of apoptosis in transfected neurons. Apoptosis in
transfected cells was assayed by nuclear fragmentation or condensation after Hoechst staining (Xia et al., 1995 ; Hetman et al., 1999 , 2000 ).
To visualize the nuclei of transfected cells, we included the DNA dye
Hoechst 33258 (2.5 µg/ml) in the wash after the secondary antibody
incubation. Transfected cells were scored blind for apoptosis under the
fluorescence microscope at the single-neuron level. The percentage of
apoptotic cells in the total transfected cell population was quantitated.
JNK kinase assays. Cell lysates were prepared as described
previously (Dérijard et al., 1994 ), and 100 µg of protein was used for each kinase assay. To assay for total JNK activity (JNK1-3), a JNK capture assay was performed (Faris et al., 1998 ; Namgung and Xia,
2000 ). Briefly, cell lysates were incubated with recombinant glutathione S-transferase (GST)-c-Jun (1-79) bound to
glutathione-coupled agarose beads (Sigma), and the complex was washed
extensively with lysis buffer. Kinase activity in the complex was
assayed by addition of [ -32P]ATP. The
combined JNK1 and JNK2 activity was quantitated by an immune complex
kinase assay using GST-c-Jun (1-79) as substrate and a polyclonal
antibody to JNK that recognizes both JNK1 and JNK2 to immune
precipitate JNK1/2 (Namgung and Xia, 2000 ). JNK3 activity was assayed
as described previously (Namgung and Xia, 2000 ). Briefly, cell lysates
were immunoprecipitated with a mixture of a polyclonal antibody that
recognizes both JNK1 and JNK2 and a monoclonal antibody that recognizes
JNK1 (PharMingen, San Diego, CA) to remove both JNK1 and JNK2 from the
lysates. The remaining JNK3 kinase activity in the supernatant was
assayed by the JNK capture assay.
Flow-automated cell-sorting analysis of HEK 293 cells. HEK 293 cells were resuspended from their culture dish by
trypsin and EDTA treatment for 1 min, stained with
4',6-diamidino-2-phenylindole, and analyzed by flow-automated cell
sorting (FACS). The MultiPlus (Phoenix Flow Systems, San Diego, CA)
software was used to analyze the cell distribution pattern. Cells were
divided into sub-G1, G1, S,
and G2/M populations.
Sub-G1 populations were considered apoptotic.
Immunohistochemistry for endogenous phospho-JNK, phospho-c-Jun,
and MAP-2 proteins in neurons. Cortical neurons were fixed with
4% paraformaldehyde and 4% sucrose in PBS for 10 min, permeabilized with 0.5% IGEPAL CA-630 (Sigma) in PBS for 30 min, and blocked in 5%
BSA for 1 hr at room temperature or overnight at 4°C. The endogenous
MAP-2 was detected by immunostaining with a monoclonal antibody to
MAP-2 (Sigma; 1:500 dilution). The MAP-2-positive cells were visualized
by Alexa Fluor 488-conjugated goat antibody to mouse IgG (Molecular
Probes, Eugene, OR; 1 µg/ml) and stained green. The endogenous
phospho-JNK (p-JNK) and phospho-c-Jun (p-c-Jun) were detected by
immunostaining with polyclonal antibodies to p-JNK (New England
Biolabs; 20 ng/ml) or p-c-Jun (New England Biolabs; 20 ng/ml). The
p-JNK- and p-c-Jun-positive cells were visualized by Alexa Fluor
594-conjugated goat antibody to rabbit IgG (Molecular Probes; 1 µg/ml) and stained red.
In all experiments, the data shown are representatives of or the
averages of at least three independent experiments.
 |
RESULTS |
Taxol induces apoptosis in cortical neurons and HEK 293 cells
To determine whether taxol induces apoptosis in postmitotic
neurons, we treated primary cultures of cortical neurons with varying
concentrations of taxol for 24 or 48 hr (Fig.
1). HEK 293 cells were also treated with
taxol for comparison. Taxol reduced cortical neuron viability (Fig.
1A) and induced nuclear fragmentation and
condensation, characteristic of apoptosis (Fig.
1B,C). Similarly, taxol reduced cell viability and
induced apoptosis in proliferating HEK 293 cells (Fig.
1D,E). Cortical neurons were approximately twice as
sensitive to taxol as were HEK 293 cells. These data demonstrate that
taxol potently induces apoptosis in cortical neurons as well as in
non-neuronal, transformed cell lines.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 1.
Taxol induces apoptosis in both cortical neurons
and HEK 293 cells. A, Dose-response for taxol-induced
loss of cell viability in cortical neurons. Cortical neurons were
treated with 0, 10, 50, 100, and 250 nM taxol for 24 or 48 hr. Cell viability was determined by MTT metabolism. Error bars
indicate ±SD. B, Dose-response and kinetics for
taxol-induced apoptosis in cortical neurons. Error bars indicate ±SEM.
C, Representative Hoechst-stained nuclear morphology of
cortical neurons treated with vehicle control (left) or
100 nM taxol (right) for 24 hr.
Arrowheads indicate healthy and uniformly stained
nuclei. Arrows identify apoptotic nuclei.
D, Dose-response for taxol-induced loss of cell
viability in HEK 293 cells. HEK 293 cells were treated with 0, 100, 250, 500, 750, and 1000 nM taxol, and cell viability was
determined by MTT metabolism 24 hr after treatment. Error bars indicate
±SD. E, Dose-response and kinetics of taxol-induced
apoptosis in HEK 293 cells. Error bars indicate ±SEM.
|
|
Taxol does not induce Bcl-2 phosphorylation in
cortical neurons
Bcl-2 phosphorylation is a hallmark of taxol treatment in all
cancer cells and other proliferating cells that have been investigated (Haldar et al., 1995 ; Blagosklonny et al., 1996 ; Blagosklonny and Fojo,
1999 ; Srivastava et al., 1999 ; Yamamoto et al., 1999 ). Consequently, we
monitored Bcl-2 phosphorylation in cortical neurons treated with taxol.
Cortical neurons were transfected with a wild-type Bcl-2, a mutant
Bcl-2 in which serine residues 70 and 87 were changed to
nonphosphorylatable alanines (Bcl-2 A/A), or the vector control pCDNA3.
The transient transfection was performed using a modified calcium
phosphate precipitation method (Hetman et al., 1999 ; Namgung and Xia,
2000 ). We also transiently transfected these plasmids into HEK 293 cells as a control. Furthermore, we generated HEK 293 cells stably
transfected with the wild-type Bcl-2, the Bcl-2 A/A mutant, or the
vector control. Phosphorylated Bcl-2 bands were identified by their
reduced electrophoretic mobility (phosphorylation shift) (Haldar et
al., 1995 ; Blagosklonny et al., 1996 ; Chang et al., 1997 ; Maundrell et
al., 1997 ; Srivastava et al., 1999 ; Yamamoto et al., 1999 ). As
expected, taxol induced wild-type Bcl-2 phosphorylation in both
transiently transfected or stable HEK 293 cells, and mutation of serine
residues 70 and 87 to alanines (Bcl-2 A/A) abolished this
phosphorylation (Fig. 2A). Surprisingly,
taxol did not stimulate phosphorylation of Bcl-2 in cortical neurons
(Fig. 2B). These data illustrate a fundamental difference in apoptotic mechanisms between cortical neurons and non-neuronal cells; cortical neurons are the first example of cells
that do not show increased Bcl-2 phosphorylation when treated with
taxol.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 2.
Taxol induces Bcl-2 phosphorylation in HEK 293 cells but not in cortical neurons. Cell lysates were analyzed by
Western blot analysis using an anti-Bcl-2 antibody (N-19 or C-2; Santa
Cruz Biotechnology). The Bcl-2-immunoreactive bands with reduced
mobility indicate phosphorylated Bcl-2 (p-Bcl-2).
A, Top, HEK 293 cells were transiently transfected with
0.5 µg of DNA/100 mm dish of a wild-type pCDNA3-Flag-Bcl-2
(Bcl-2 wt), the mutant Bcl-2 A/A, or a vector
control pCDNA3. Cell lysates (100 µg) were used for Western blot
analysis. Bottom, Alternatively, cell lysates obtained
from HEK293 cells stably transfected with Bcl-2 wt, Bcl-2 A/A, or
pCDNA3 were prepared from 32,000 cells and analyzed. Cells were treated
with 250 nM taxol (+) or vehicle control DMSO ( ) for 24 hr. B, Cortical neurons were transfected with 4 µg of
DNA/35 mm dish of Bcl-2 wt or the vector control pCDNA3. Two days
later, cells were treated with 600 nM taxol (+) or vehicle
control DMSO ( ) for 24 hr. An HEK 293 cell sample cotransfected with
Bcl-2, a constitutive active cdc42, together with a wild-type JNK3 was
used as a positive control [(+)HEK293] to demonstrate
separation of phosphorylated Bcl-2 forms on the gel.
|
|
Expression of wild-type Bcl-2 protects cortical neurons but not HEK
293 cells against taxol
To determine whether Bcl-2 is neuroprotective against taxol,
cortical neurons were transiently transfected with wild-type Bcl-2 or
the vector control pCDNA3 (Fig. 3).
Because deletion of the unstructured loop region or mutation of serine
residues 70 and 87 enhances the antiapoptotic activity of Bcl-2 against taxol in cancer cells (Srivastava et al., 1999 ), cortical neurons were
also transfected with a loop deletion mutant of Bcl-2 (Bcl-2 loop) or
the mutant Bcl-2 A/A. HEK 293 cells stably transfected with the
wild-type Bcl-2, the Bcl-2 A/A mutant, or the pCDNA3 vector were used
as controls. Wild-type Bcl-2 and the Bcl-2 A/A mutant proteins were
expressed at equivalent levels in stable HEK 293 cells (Fig.
3A). Expression of wild-type Bcl-2 did not protect HEK 293 cells from taxol-induced apoptosis (Fig. 3A). Similar
results were obtained when HEK 293 cells were transiently transfected
with various amounts of wild-type Bcl-2 DNA (0.1-4 µg; data not
shown). However, expression of the mutant Bcl-2 A/A partially protected
HEK 293 cells against taxol-induced apoptosis (Fig. 3A,
p < 0.002) and loss of MTT metabolism (data not
shown). In contrast, expression of wild-type Bcl-2 completely blocked taxol-stimulated apoptosis in cortical neurons (Fig. 3B).
Furthermore, wild-type Bcl-2 was as effective as the Bcl2 A/A mutant or
the Bcl-2 loop deletion mutant (Fig. 3B). These data
indicate that taxol induces apoptosis in cortical neurons by mechanisms
independent of Bcl-2 phosphorylation.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 3.
Expression of a wild-type Bcl-2 protects against
taxol-induced apoptosis in cortical neurons but not in HEK 293 cells.
A, Pooled HEK 293 cells stably transfected with Bcl-2
wt, Bcl-2 A/A, and the pCDNA3 vector control were generated.
Top, Cells were treated with 250 nM taxol
for 24, 48, and 72 hr, and apoptosis was quantitated by FACS analysis
scoring for the sub-G1 population. Error bars indicate
±SEM (*p < 0.002, ANOVA, for the group of Bcl-2
A/A compared with the group of Bcl-2 wt or pCDNA3).
Bottom, To ensure equal levels of protein expression for
Bcl-2 wt and Bcl-2 A/A, cell lysates collected from 3.0 × 104 cells of each stable-transfected cell line were
analyzed by anti-Bcl-2 Western blot. B, Cortical neurons
were transfected with 1 µg of expression vector for Bcl-2 wt, Bcl-2
A/A, a Bcl-2 loop deletion mutant (Bcl-2 loop), or the
vector control pCDNA3. All cells were also cotransfected with 1 µg of
plasmid DNA encoding -galactosidase as a marker for transfection.
Two days after transfection, neurons were treated with 100 nM taxol for 24 hr, and apoptosis in transfected cells
( -galactosidase-positive cells) was scored. Error bars indicate
±SEM (*p < 0.002, ANOVA).
|
|
Cortical neurons express high basal JNK activity and taxol
activates a subpool of JNK in the nucleus
Because JNK signaling has been suggested to be one of the primary
kinase pathways responsible for taxol-induced Bcl-2 phosphorylation (Maundrell et al., 1997 ; Amato et al., 1998 ; Lee et al., 1998 ; Wang et
al., 1998 , 1999 ; Srivastava et al., 1999 ; Yamamoto et al., 1999 ), the
different effects of taxol on Bcl-2 phosphorylation in cortical neurons
and non-neuronal cells might be caused by differential regulation of
JNK by taxol. To test this hypothesis, we assayed JNK activity after
taxol treatment (Fig. 4). In HEK 293 cells, there was a threefold increase in total JNK activity that was
sustained for at least 24 hr (see Fig. 4A,
6A). The activities of extracellular signal-regulated
kinases 1 and 2 (ERK1/2) and p38 MAP kinase in HEK 293 cells were
unaffected by taxol (data not shown). In contrast, treatment of
cortical neurons with taxol caused a slight decrease in total JNK
activity (data not shown). Western blot analysis using an antibody that
recognizes phosphorylated and activated JNK (anti-p-JNK) showed no
significant change in JNK phosphorylation after taxol treatment (Fig.
5A). Because there are three
isoforms for JNK (JNK1-3), it is possible that specific isoforms are
activated by taxol. We were particularly interested in the effect of
taxol on JNK3 activity because this isozyme contributes to
arsenite-stimulated apoptosis in cortical neurons (Namgung and Xia,
2000 ). Therefore, we measured JNK1/2 combined activities or JNK3
activity separately using immune complex kinase assays. Both JNK1/2 and
JNK3 activities in cortical neurons were partially reduced after taxol
treatment (Fig. 4B,C). However, we found that cortical neurons contain high basal JNK activity compared with that of
non-neuronal cells. When assayed for total JNK activity, basal JNK
activity in cortical neurons was at least 20-40-fold higher than that
in unstimulated HEK 293 cells (Fig. 4D). This observation is in agreement with reports of high basal JNK activity in
the mouse brain (Xu et al., 1997 ).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4.
Taxol activates total pooled JNK in HEK 293 cells
but not in cortical neurons. A, HEK 293 cells were
treated with 250 nM taxol for the indicated times, and 100 µg of cell lysates was used to measure total JNK activity by a
JNK capture assay. B, C, Cortical neurons at DIV 6 were
treated with 100 nM taxol for the indicated times (in
hours), and 100 µg of cell lysates was used to measure JNK1/2
activity (B) or JNK3 activity
(C) as described in Materials and Methods. Error
bars indicate ±SD. D, Cortical neurons have much higher
basal JNK activity in comparison with HEK 293 cells. Various amounts of
cell lysates prepared from untreated cortical neurons or HEK 293 cells
were used for anti-phospho-JNK Western blot analysis, indicative of JNK
activation. Phospho-JNK was readily visible using as low as 5 µg of
total lysates from unstimulated cortical neurons, whereas at least
100-200 µg of total lysates from unstimulated HEK 293 cells was
needed to see any JNK phosphorylation.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Figure 5.
Taxol stimulates phosphorylation of JNK and c-Jun
in the nuclei of cortical neurons. A, Taxol induces
c-Jun phosphorylation. At DIV 5, cortical neurons were pretreated with
CEP-1347 (5 µM; CEP) for 1 hr and then
treated with taxol (100 nM) or vehicle control DMSO
(C) for 3 or 12 hr as indicated. One hundred
micrograms of cell lysates were used for Western blot analysis using an
anti-phospho-JNK (p-JNK) or an
anti-phospho-c-Jun (p-c-Jun) antibody. -Actin
was used as the loading control. B, JNK and c-Jun
phosphorylation increases in the nucleus after taxol treatment.
Cortical neurons were treated with taxol or vehicle control DMSO
(C) for 12 hr and immunostained with antibodies
for anti-MAP-2 (a-d), p-JNK (e,
f), or p-c-Jun (g, h). MAP-2 was
used to identify cell bodies and neurites of neurons. Merged images
(i-l) demonstrate p-JNK and p-c-Jun in neurons
as well as increases in p-JNK and p-c-Jun immunoreactivity in the
nuclei after taxol treatment. All images were captured under the same
exposure conditions using a Leica confocal microscope. Scale bar, 20 µm.
|
|
A subpool of JNK in cortical neurons may be activated by taxol
and masked by the high basal JNK activity measured using the immune complex kinase assay. Therefore, we performed immunostaining analysis using the anti-p-JNK antibody (Fig. 5B). Basal
p-JNK was primarily present in the cell bodies and processes but absent in the nucleus. Although taxol did not alter the total amount of
phosphorylated JNK measured by Western blot analysis (Fig. 5A), it caused an increase in p-JNK in the nucleus of
neurons and a decrease in p-JNK in the processes (Fig. 5B).
This was accompanied by an increase in c-Jun phosphorylation in the
nucleus and an increase in total c-Jun phosphorylation at serine 73, indicative of c-Jun activation (Fig. 5). These data suggest that either
a subpool of the JNK is activated in the nucleus or a subpool of the
active JNK is translocated to the nucleus in response to taxol. Regardless, the net result is increased JNK activity in the nucleus, c-Jun phosphorylation, and presumably activator protein-1
(AP-1)-mediated transcription.
JNK activity and its downstream transcription are required for
taxol-induced apoptosis in cortical neurons
We next performed a series of experiments to determine whether JNK
activity is obligatory for taxol-induced apoptosis in neurons. We
performed similar experiments in HEK 293 cells as a control. To assess
the importance of JNK activation for taxol-induced apoptosis, HEK 293 cells were treated with CEP-1347, a pharmacological inhibitor that
prevents activation of JNK but not p38 or ERK (Maroney et al., 1998 ).
Treatment of 293 cells with CEP-1347 completely prevented taxol-induced
JNK activation (Fig.
6A,B) and Bcl-2
phosphorylation (Fig. 6B). It also prevented
taxol-induced loss of cell viability and apoptosis in a dose-dependent
manner (Fig. 6C,D). Similarly, treatment of cortical neurons
with 5 µM CEP-1347 greatly suppressed basal JNK
activity both in the presence or absence of taxol (Fig. 5A,
7A). CEP-1347 also inhibited
taxol-induced c-Jun phosphorylation (Fig. 5A), apoptosis,
and loss of cell viability in cortical neurons (Fig.
7B,C).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6.
Activation of JNK is critical for taxol-induced
Bcl-2 phosphorylation and apoptosis in HEK 293 cell. A,
CEP-1347, a JNK pathway inhibitor, inhibited taxol-induced JNK
activation. HEK 293 cells were pretreated with CEP-1347 (5 µM) or vehicle control DMSO for 1 hr and then stimulated
with taxol (250 nM) for 0, 3, 6, or 17 hr. One hundred
micrograms of cell lysates were used to measure total JNK activity by a
JNK capture assay. Results are from two independent experiments with
duplicate determinations. Error bars indicate ±SEM
(*p < 0.002, ANOVA). B,
Taxol-induced phosphorylation of JNK and Bcl-2 is inhibited by
CEP-1347. Stable HEK 293 cells expressing the wild-type Bcl-2 were
either left untreated (NT) or pretreated with
CEP-1347 (5 µM) for 1 hr and then stimulated with taxol
(250 nM) for 12 or 18 hr as indicated. One hundred
micrograms of cell lysates were used for Western blot analysis using an
anti-Bcl-2 (top) or an anti-p-JNK
(bottom) antibody. C, D, CEP-1347
protects against taxol-induced apoptosis (C) and
loss of cell viability (D). HEK 293 cells were
pretreated with varying concentrations of CEP-1347 for 1 hr and then
exposed to 250 nM taxol for 24 hr. Error bars indicate
±SEM (C) or ±SD (D).
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Figure 7.
JNK activity contributes to taxol-induced
apoptosis in cortical neurons. A, CEP-1347 inhibits
basal JNK activity. Cortical neurons were either left untreated
(NT) or pretreated with CEP-1347
(CEP; 5 µM) for 1 hr and then treated with
100 nM taxol or vehicle control DMSO. Total JNK activity
was determined 3 or 12 hr later. B, CEP-1347 protects
against taxol-induced apoptosis. Cortical neurons were pretreated with
0, 0.5, 1, 2.5, or 5 µM CEP-1347 for 1 hr and then
treated with 100 nM taxol for 24 hr. C,
CEP-1347 protects against taxol-induced loss of cell viability.
Cortical neurons were pretreated with CEP-1347 (5 µM) or
vehicle control DMSO for 1 hr and then treated with varying
concentrations of taxol for 24 hr (top) or 48 hr
(bottom). Cell viability was measured by MTT metabolism.
D, Blocking JNK signaling with dominant-negative
con- structs protects neurons from taxol-induced apoptosis.
Cortical neurons were transfected with 4 µg of expression vectors for
a dominant-negative MKK7 (DN MKK7), a
dominant-negative c-Jun (DN c-Jun), or the vector
control pCDNA3. All cells were also cotransfected with 1 µg of
plasmid DNA encoding -galactosidase as a marker for transfection.
Two days after transfection, neurons were treated with 100 nM taxol for 24 hr, and apoptosis in transfected cells
( -galactosidase-positive cells) was quantitated. Error bars indicate
±SD for all panels (*p 0.002, ANOVA, for groups
compared with taxol-treated cortical neurons transfected with control
pCDNA3 vector).
|
|
We also transiently transfected cortical neurons with a
dominant-negative MKK7 to block specifically JNK signaling. MKK7 is a
JNK kinase. Expression of the dominant-negative MKK7 inhibited taxol-induced cortical neuron apoptosis (Fig. 7D). Because
c-Jun is phosphorylated after taxol treatment, we also transfected
cortical neurons with a dominant-negative c-Jun to examine the
contribution of c-Jun- or AP-1-mediated transcription in taxol-induced
apoptosis. Expression of the dominant-negative c-Jun inhibited
taxol-induced cortical neuron apoptosis (Fig. 7D).
Furthermore, coexpression of the dominant-negative MKK7 together with
the dominant-negative c-Jun did not provide more protection than either
construct alone (data not shown). Together, these data suggest a
critical role for JNK and its downstream transcriptional events in
taxol-induced apoptosis in cortical neurons.
Not all forms of neuronal apoptosis are dependent on
JNK activity
Because the total JNK activity is not stimulated by taxol in
neurons, one might argue that the effect of both CEP-1347 and dominant-negative constructs of the JNK signaling pathway on
taxol-induced apoptosis in cortical neurons was caused by nonspecific
inhibitory effects, independent of the JNK pathway. To exclude this
possibility further, we examined the effect of CEP-1347 and expression
of a dominant-negative c-Jun on two other forms of cortical neuron apoptosis: apoptosis induced by trophic withdrawal (Hetman et al.,
2000 ) or treatment with camptothecin that causes DNA damage (Morris and
Geller, 1996 ; D. S. Park et al., 1997 , 1998 ; Hetman et al.,
1999 ) (Fig. 8). Although camptothecin
activated JNK1/2 twofold in cortical neurons (data not shown),
expression of a dominant-negative c-Jun had no effect on cortical
neuron apoptosis induced by either camptothecin or serum withdrawal
(Fig. 8A,B). Similarly, treatment of cortical neurons
with 5 µM CEP-1347 had no effect on apoptosis
induced by camptothecin, serum deprivation, or serum deprivation
combined with exposure to MK801, an NMDA receptor antagonist (Fig.
8C,D). These data suggest that CEP-1347 or expression of the
dominant-negative c-Jun does not inhibit all forms of cortical neuron
apoptosis but protects cortical neurons against taxol specifically.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 8.
JNK activity is not required for all forms of
apoptosis in cortical neurons. A, B, Expression of a
dominant-negative c-Jun has no effect on cortical neuron apoptosis
induced by the DNA-damaging agent camptothecin
(A) or by serum deprivation
(B). Cortical neurons were transfected with a
dominant-negative c-Jun (DN c-JUN) or the vector
control (4 µg of DN c-Jun in A; 2 and 4 µg of DN
c-Jun in B). All cells were also cotransfected with 1 µg of plasmid DNA encoding -galactosidase as a marker for
transfection. Control vector was used to supplement total DNA to 5 µg
in all cases in B. Two days after transfection, cultures
were treated with 5 µM camptothecin for 12 hr
(A) or deprived of serum for 24 hr
(B) as described previously (Hetman et al.,
2000 ). Apoptosis in transfected cells ( -galactosidase positive) was
scored. C, D, CEP-1347 has no effect on cortical neuron
apoptosis induced by camptothecin (C) or by
trophic deprivation (D). Cortical neurons were
pretreated with 0 or 5 µM CEP-1347 for 1 hr. Cells were
then treated with 10 µM camptothecin for 24 hr
(C) or deprived of trophic support for 24 hr
(D) as described previously (Hetman et al.,
2000 ). Trophic deprivation included serum deprivation ( S) and
serum deprivation together with exposure to the NMDA receptor
antagonist MK-801 ( S+MK801). Cells that were washed
similarly but subsequently incubated in serum-containing media were
used as the control (+S). Error bars indicate ±SEM.
|
|
Inhibition of PI 3-kinase signaling also contributes to
taxol-induced cortical neuron apoptosis
Activation of the ERK1/2 MAP kinase or PI 3-kinase signaling
pathways promotes neuronal survival, and inhibition of these pathways
contributes to some forms of neuronal apoptosis (Xia et al., 1995 ; Yao
and Cooper, 1995 ; Dudek et al., 1997 ; Crowder and Freeman, 1998 ; Hetman
et al., 1999 , 2000 ). Therefore, we examined the effect of taxol
treatment on the activities of these kinases (Fig.
9). Because stimulation of PI 3-kinase
leads to the activation and phosphorylation of protein kinase Akt
(Franke et al., 1997 ), we indirectly assayed PI 3-kinase activity by
Western blot analysis using a phospho-Akt antibody that specifically
recognizes activated Akt. Similarly, the ERK1/2 activities were
measured by Western blot analysis using a phospho-ERK1/2 antibody that
specifically recognizes activated ERK1/2. Taxol treatment had little
effect on ERK1/2 but inhibited Akt phosphorylation, presumably by
inhibition of PI 3-kinase signaling (Fig. 9A).
Alternatively, the decreased Akt phosphorylation could result from an
increase in phosphatase activity.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 9.
Taxol-induced apoptosis in cortical neurons may
also require inhibition of PI 3-kinase signaling. A,
Taxol inhibits PI 3-kinase signaling. Cortical neurons were treated
with 100 nM taxol alone or in the presence of 10 ng/ml BDNF
for the indicated times. Protein lysates (100 µg) were analyzed by
Western blotting using antibodies against Akt (Akt),
phosphorylated and activated Akt (p-Akt), or
phosphorylated and activated ERK1/2 (p-Erk1/2).
B, BDNF provides partial protection for cortical neurons
against taxol-induced apoptosis via a PI 3-kinase-dependent mechanism.
Cortical neurons were treated with vehicle control DMSO ( ) or 100 nM taxol (+) in the presence of 10 ng/ml BDNF, 30 µM LY294002, or 40 µM PD98059 where
indicated. Apoptosis was scored 24 hr later (*p < 0.002, ANOVA, compared with neurons treated with taxol alone). Error
bars indicate ±SD. C, Selective activation of the PI
3-kinase pathway partially protects cortical neurons against taxol.
Cortical neurons were transiently transfected with 2 µg each of
expression vectors for a constitutive active PI 3-kinase
(p110*) and a wild-type Akt or their control
vectors. All cells were also cotransfected with 1 µg of plasmid DNA
encoding -galactosidase as a marker for transfection. Two days after
transfection, cells were treated with 100 nM taxol for 24 hr, and apoptosis in transfected cells ( -galactosidase positive) was
quantitated. Error bars indicate ±SEM.
|
|
To determine whether inhibition of the PI 3-kinase-Akt signaling also
contributes to taxol-induced apoptosis, cortical neurons were incubated
with brain-derived neurotrophic factor (BDNF) that activates both the
ERK1/2 and PI 3-kinase pathways in cortical neurons (Hetman et al.,
1999 ). BDNF increased Akt phosphorylation for up to 9 hr even in the
presence of taxol (Fig. 9A). Furthermore, BDNF provided
partial protection against taxol-induced apoptosis; this protection was
abolished by cotreatment with the PI 3-kinase inhibitor LY294002 but
not PD98059, an inhibitor of the ERK1/2 kinase MAPK/ERK kinase 1 (Fig. 9B). Furthermore, transient expression of a
constitutive active PI 3-kinase (Hu et al., 1995 ) and a wild-type Akt
reduced cortical neuron apoptosis after taxol treatment (Fig. 9C). These data suggest that activation of the PI
3-kinase-Akt signaling pathway is neuroprotective, and inhibition of
this pathway contributes to taxol-induced apoptosis in cortical neurons.
 |
DISCUSSION |
The objectives of this study were to determine whether
phosphorylation regulates the antiapoptotic activity of Bcl-2 in
cortical neurons and to evaluate the role of JNK in taxol-stimulated
apoptosis. We compared apoptotic mechanisms in postmitotic cortical
neurons with those in proliferating non-neurons (HEK 293 cells). In HEK 293 cells, JNK activation and Bcl-2 phosphorylation seemed to play a
major role in the apoptosis caused by taxol, and expression of
wild-type Bcl-2 was not protective. In contrast, taxol did not induce
Bcl-2 phosphorylation in cortical neurons, and Bcl-2 expression
completely protected from taxol. Furthermore, cortical neurons express
high basal JNK activity, and taxol did not stimulate total JNK
activity. However, taxol increased phosphorylation of JNK and c-Jun in
the nucleus of cortical neurons. Blocking JNK signaling by CEP-1347 or
transient expression of a dominant-negative MKK7 inhibited
taxol-induced apoptosis. Moreover, expression of a dominant-negative
c-Jun that interferes with the function of endogenous c-Jun or other
AP-1 transcription factors reduced taxol-induced cortical neuron
apoptosis. These data suggest a critical role for JNK and JNK-mediated
transcription in taxol-induced apoptosis in neurons. In addition,
taxol-stimulated cortical neuron apoptosis required inhibition of the
PI 3-kinase pathway.
Taxol is used as an anticancer drug, and its administration causes
peripheral neuropathy in humans and in animal models. It has been
suggested that taxol may be useful for the treatment of Alzheimer's
disease (AD) and multiple sclerosis (MS) because it stabilizes
microtubules (Mattson, 1992 ; Michaelis et al., 1998 ). However, the
toxicity of taxol for CNS neurons has not been determined. Here we
report that taxol is a potent inducer of apoptosis in postnatal
cortical neurons. Apoptosis induced by taxol in proliferating cells is
thought to result from G2/M cell cycle arrest
(Kung et al., 1990 ; Jordan et al., 1996 ). However, our results suggest that taxol-induced microtubule damage is sufficient to induce apoptosis
independent of its cell cycle effects because postnatal cortical
neurons are postmitotic. Moreover, taxol-induced apoptosis may be a
useful model for neurodegeneration that is characterized by
cytoskeleton damage and failure of axonal transport, e.g., AD, MS, and
brain trauma (Raine and Cross, 1989 ; Povlishock and Christman, 1995 ;
Trapp et al., 1998 ; Vickers et al., 2000 ). Elucidation of mechanisms of
taxol-induced CNS neuron apoptosis may provide insights concerning the
treatment of these neurodegenerative conditions.
JNK is activated when various non-neuronal cells are treated with taxol
and is strongly implicated in taxol-stimulated apoptosis (Lee et al.,
1998 ; Wang et al., 1998 , 1999 ; Srivastava et al., 1999 ; Yamamoto et
al., 1999 ). Our data illustrate that taxol activates JNK in HEK 293 cells, and inhibition of JNK activation by CEP-1347 protected against
taxol-induced apoptosis and Bcl-2 phosphorylation. Surprisingly, taxol
did not activate total JNK activity in cortical neurons. However, basal
JNK activity was very high in neurons, and taxol caused an accumulation
of phospho-JNK in the nucleus. Our data do not distinguish between
increased phospho-JNK in the nucleus because of activation of a subpool
of JNK in the nucleus or translocation of a subpool of the active JNK
to the nucleus in response to taxol. However, these data indicate that
taxol causes increased nuclear JNK activity. Moreover, taxol stimulated c-Jun phosphorylation in the nucleus, providing additional evidence of
nuclear JNK activation. These data suggest that the activated JNK and
c-Jun in the nucleus are key players in taxol-induced cortical neuron apoptosis.
The presence of a distinct pool of activated JNK in the nucleus
suggests that specific pools of JNK serve different functions in
neurons. The basal JNK activity associated with the cell bodies and
neurites may be important for the maintenance of normal physiological functions in neurons, whereas activation of JNK in the nuclei in
response to stress signals may mediate cell death. Interestingly, JNK3,
but not JNK1 or JNK2, is activated in response to arsenite-induced cortical neuron apoptosis (Namgung and Xia, 2000 ), providing another example of selective activation of distinct pools of JNK in response to
stress signals.
The discovery that a distinct pool of JNK is activated in the nucleus
is also consistent with a recent report that specific pools of JNK are
differentially regulated in cerebellar granule cells (Coffey et al.,
2000 ). Consequently, experiments based on pooled, total JNK activity
should be interpreted cautiously. For example, it was reported that
trophic withdrawal-induced apoptosis of cerebellar granule cells
requires c-Jun phosphorylation and c-Jun-mediated transcription (Watson
et al., 1998 ). Because total JNK activity was not stimulated, it was
concluded that c-Jun phosphorylation may be regulated by a novel
mechanism (Watson et al., 1998 ). This conclusion may need to be
reexamined because of our findings and those of Coffey et al. (2000)
showing that a subpool of JNK may be activated in the absence of total
JNK activation.
It is interesting that JNK activity is not required for cortical neuron
apoptosis induced by trophic withdrawal or by the DNA-damaging agent
camptothecin. This contrasts with data obtained with non-CNS neurons.
For example, in pheochromocytoma 12 cells, JNK is activated after
trophic withdrawal and is required for trophic withdrawal-induced
apoptosis (Xia et al., 1995 ; Troy et al., 1997 ; Maroney et al., 1999 ).
Similarly, DNA-damaging agents or irradiation induce apoptosis via a
JNK-dependent mechanism in non-neuronal cells (Saleem et al., 1995 ;
Chen et al., 1996a ,b ; Zanke et al., 1996 ; Butterfield et al.,
1997 ; J. Park et al., 1997 ; Seimiya et al., 1997 ). ERK1/2 also
seem to play a different role in taxol-induced apoptosis in cortical
neurons than in non-neuronal cell lines. Although ERK1/2 do not
contribute to taxol-induced apoptosis in cortical neurons, blocking
ERK1/2 signaling enhanced taxol-induced apoptosis in tumor cells
(MacKeigan et al., 2000 ).
We find it even more interesting that the contribution of JNK to
apoptosis in cortical neurons depends on the apoptotic signal. For
example, cortical neuron apoptosis induced by sodium arsenite is
mediated by selective activation of JNK3, a neural-specific JNK isoform
(Namgung and Xia, 2000 ). Here we found that taxol reduces basal
activity of all three isoforms of JNK, but activation of a subpool of
JNK in the nucleus is required for taxol-induced cortical neuron
apoptosis. Furthermore, inhibition of JNK signaling had no effect on
cortical neuron apoptosis induced by camptothecin or trophic
withdrawal. These data illustrate the importance of elucidating
apoptotic mechanisms specific for each type of cellular stress.
Until our study, there were no reports concerning the importance of
Bcl-2 phosphorylation for apoptosis in CNS neurons. Apoptosis in
proliferating cells induced by microtubule damaging agents, including
taxol, is characterized by increased Bcl-2 phosphorylation that
inactivates Bcl-2 (Haldar et al., 1995 ; Blagosklonny et al., 1996 ;
Blagosklonny and Fojo, 1999 ; Srivastava et al., 1999 ; Yamamoto et al.,
1999 ; Fan et al., 2000 ). It has been hypothesized that JNK is a Bcl-2
kinase (Maundrell et al., 1997 ; Amato et al., 1998 ; Lee et al., 1998 ;
Wang et al., 1998 , 1999 ; Srivastava et al., 1999 ; Yamamoto et al.,
1999 ; Fan et al., 2000 ) and that the apoptotic activity of JNK may be
caused by phosphorylation of Bcl-2 and inhibition of the antiapoptotic
activity of Bcl-2. We confirmed that in proliferating HEK 293 cells,
Bcl-2 is phosphorylated after taxol treatment and overexpression of
Bcl-2 does not protect against taxol. However, Bcl-2 phosphorylation
was not induced by taxol treatment in cortical neurons, suggesting that
taxol does not always cause Bcl-2 phosphorylation. We also demonstrated
that expression of the wild-type Bcl-2 completely protected cortical neurons against taxol as did Bcl-2 mutants lacking putative
phosphorylation sites. Collectively, our data indicate that
taxol-induced apoptosis in cortical neurons does not involve
JNK-mediated Bcl-2 phosphorylation and inactivation.
Although activation of the PI 3-kinase-Akt signaling pathway has been
implicated in promoting survival of several cell types including
neurons (Yao and Cooper, 1995 ; D'Mello et al., 1997 ; Dudek et al.,
1997 ; Miller et al., 1997 ; Crowder and Freeman, 1998 , 1999 ; Hetman et
al., 1999 ), its ability to protect against taxol-induced apoptosis had
not been examined. We discovered that PI 3-kinase-Akt signaling in
cortical neurons is inhibited by taxol and that BDNF partially protects
against taxol by potentiation of the PI 3-kinase-Akt pathway.
Furthermore, selective and direct activation of PI 3-kinase-Akt
signaling was sufficient to provide partial protection against taxol.
In summary, our data illustrate that there are significant differences
in the mechanisms for taxol-stimulated apoptosis in proliferating,
non-neuronal cell lines compared with postmitotic CNS neurons. In
cortical neurons, stimulation of apoptosis by taxol depends on nuclear
JNK activity, JNK-stimulated transcription, and inactivation of the PI
3-kinase pathway. This study illustrates that there are a variety of
mechanisms for regulation of apoptosis in neurons that depend on
different combinations of survival and proapoptotic kinase pathways.
 |
FOOTNOTES |
Received Oct. 19, 2000; revised April 9, 2001; accepted April 11, 2001.
This work was supported by the National Institute of Neurological
Disorders and Stroke Grant NS 37359 and by Grant APP 3010 from the
Burroughs Wellcome Fund for a New Investigator Award in Toxicology
(Z.X.). X.A.F.-M. is supported by a National Institutes of Health
predoctoral training grant (Environmental Pathology/Toxicology training
program; National Institute of Environmental Health Sciences Grant
ES07032). We thank Kevin Kanning for assistance in preparing the Bcl-2
A/A mutant. We thank Drs. L. del Peso and G. Nunez for providing the
Bcl-2 construct, Dr. C. Thompson for the Bcl-2 loop deletion construct,
Dr. R. Davis for providing the anti-JNK1/2 polyclonal antibody, and Dr.
Anna C. Maroney at Cephalon Incorporated for CEP-1347.
Correspondence should be addressed to Dr. Zhengui Xia, Department of
Environmental Health, Box 357234, University of Washington, Health
Sciences Building, Room F561C, Seattle, WA 98195. E-mail: zxia{at}u.washington.edu.
 |
REFERENCES |
-
Adams JM,
Cory S
(1998)
The bcl-2 protein family: arbiters of cell survival.
Science
281:1322-1326[Abstract/Free Full Text].
-
Amato SF,
Swart JM,
Berg M,
Wanebo HJ,
Mehta SR,
Chiles TC
(1998)
Transient stimulation of the c-Jun-NH2-terminal kinase/activator protein 1 pathway and inhibition of extracellular signal-regulated kinase are early effects in paclitaxel-mediated apoptosis in human B lymphoblasts.
Cancer Res
58:241-247[Abstract/Free Full Text].
-
Basu A,
Haldar S
(1998)
Microtubule-damaging drugs triggered bcl2 phosphorylation-requirement of phosphorylation on both serine-70 and serine-87 residues of bcl2 protein.
Int J Oncol
13:659-664[Web of Science][Medline].
-
Blagosklonny MV,
Fojo T
(1999)
Molecular effects of paclitaxel: myths and reality (a critical review).
Int J Cancer
83:151-156[Web of Science][Medline].
-
Blagosklonny MV,
Schulte T,
Nguyen P,
Trepel J,
Neckers LM
(1996)
Taxol-induced apoptosis and phosphorylation of Bcl-2 protein involves c-Raf-1 and represents a novel c-Raf-1 signal transduction pathway.
Cancer Res
56:1851-1854[Abstract/Free Full Text].
-
Butterfield L,
Storey B,
Maas L,
Heasley LE
(1997)
c-Jun NH2-terminal kinase regulation of the apoptotic response of small cell lung cancer cells to ultraviolet radiation.
J Biol Chem
272:10110-10116[Abstract/Free Full Text].
-
Chang BS,
Minn AJ,
Muchmore SW,
Fesik SW,
Thompson CB
(1997)
Identification of a novel regulatory domain in Bcl-X(L) and Bcl-2.
EMBO J
16:968-977[Web of Science][Medline].
-
Chen YR,
Meyer CF,
Tan TH
(1996a)
Persistent activation of c-Jun N-terminal kinase 1 (JNK1) in gamma radiation-induced apoptosis.
J Biol Chem
271:631-634[Abstract/Free Full Text].
-
Chen YR,
Wang XP,
Templeton D,
Davis RJ,
Tan TH
(1996b)
The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation: duration of JNK activation may determine cell death and proliferation.
J Biol Chem
271:31929-31936[Abstract/Free Full Text].
-
Cherrington JM,
Mocarski ES
(1989)
Human cytomegalovirus iel transactivates the
promoter-enhancer via an 18-base-pair repeat element.
J Virol
63:1435-1440[Abstract/Free Full Text]. -
Coffey ET,
Hongisto V,
Dickens M,
Davis RJ,
Courtney MJ
(2000)
Dual roles for c-Jun N-terminal kinase in developmental and stress responses in cerebellar granule neurons.
J Neurosci
20:7602-7613[Abstract/Free Full Text].
-
Crowder RJ,
Freeman RS
(1998)
Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons.
J Neurosci
18:2933-2943[Abstract/Free Full Text].
-
Crowder RJ,
Freeman RS
(1999)
The survival of sympathetic neurons promoted by potassium depolarization, but not by cyclic AMP, requires phosphatidylinositol 3-kinase and Akt.
J Neurochem
73:466-475[Web of Science][Medline].
-
Davies AM
(1995)
The Bcl-2 family of proteins, and the regulation of neuronal survival.
Trends Neurosci
18:355-358[Web of Science][Medline].
-
del Peso L,
GonzalezGarcia M,
Page C,
Herrera R,
Nunez G
(1997)
Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.
Science
278:687-689[Abstract/Free Full Text].
-
Dérijard B,
Hibi M,
Wu IH,
Barrett T,
Su B,
Deng T,
Karin M,
Davis RJ
(1994)
JNK1: a protein kinase stimulated by UV light and HA-ras binds to and activates the c-jun activation domain.
Cell
76:1025-1037[Web of Science][Medline].
-
D'Mello SR,
Borodezt K,
Soltoff SP
(1997)
Insulin-like growth factor and potassium depolarization maintain neuronal survival by distinct pathways: possible involvement of PI 3-kinase in IGF-1 signaling.
J Neurosci
17:1548-1560[Abstract/Free Full Text].
-
Dudek H,
Datta SR,
Franke TF,
Birnbaum MJ,
Yao RJ,
Cooper GM,
Segal RA,
Kaplan DR,
Greenberg ME
(1997)
Regulation of neuronal survival by the serine-threonine protein kinase Akt.
Science
275:661-665[Abstract/Free Full Text].
-
Fan M,
Goodwin M,
Vu T,
Brantley-Finley C,
Gaarde WA,
Chambers TC
(2000)
Vinblastine-induced phosphorylation of Bcl-2 and Bcl-XL is mediated by JNK and occurs in parallel with inactivation of the Raf-1/MEK/ERK cascade.
J Biol Chem
275:29980-29985[Abstract/Free Full Text].
-
Fang G,
Chang BS,
Kim CN,
Perkins C,
Thompson CB,
Bhalla KN
(1998)
"Loop" domain is necessary for taxol-induced mobility shift and phosphorylation of Bcl-2 as well as for inhibiting taxol-induced cytosolic accumulation of cytochrome c and apoptosis.
Cancer Res
58:3202-3208[Abstract/Free Full Text].
-
Faris M,
Kokot N,
Latinis K,
Kasibhatla S,
Green DR,
Koretzky GA,
Nel A
(1998)
The c-Jun N-terminal kinase cascade plays a role in stress-induced apoptosis in Jurkat cells by up-regulating Fas ligand expression.
J Immunol
160:134-144[Abstract/Free Full Text].
-
Franke TF,
Kaplan DR,
Cantley LC
(1997)
PI3K: downstream AKTion blocks apoptosis.
Cell
88:435-437[Web of Science][Medline].
-
Haldar S,
Jena N,
Croce CM
(1995)
Inactivation of Bcl-2 by phosphorylation.
Proc Natl Acad Sci USA
92:4507-4511[Abstract/Free Full Text].
-
Haldar S,
Chintapalli J,
Croce CM
(1996)
Taxol induces bcl-2 phosphorylation and death of prostate cancer cells.
Cancer Res
56:1253-1255[Abstract/Free Full Text].
-
Haldar S,
Basu A,
Croce CM
(1997)
Bcl2 is the guardian of microtubule integrity.
Cancer Res
57:229-233[Abstract/Free Full Text].
-
Haldar S,
Basu A,
Croce CM
(1998)
Serine-70 is one of the critical sites for drug-induced Bcl2 phosphorylation in cancer cells.
Cancer Res
58:1609-1615[Abstract/Free Full Text].
-
Hansen MB,
Nielsen SE,
Berg K
(1989)
Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill.
J Immunol Methods
119:203-210[Web of Science][Medline].
-
Hetman M,
Kanning K,
Cavanaugh JE,
Xia Z
(1999)
Neuroprotection by brain-derived neurotrophic factor is mediated by extracellular-signal-regulated kinase and phosphatidylinositol-3 kinase.
J Biol Chem
274:22569-22580[Abstract/Free Full Text].
-
Hetman M,
Cavanaugh JE,
Kimelman D,
Xia Z
(2000)
Role of glycogen synthase kinase-3
in neuronal apoptosis induced by trophic withdrawal.
J Neurosci
20:2567-2574[Abstract/Free Full Text]. -
Holland PM,
Suzanne M,
Campbell JS,
Noselli S,
Cooper JA
(1997)
MKK7 is a stress-activated mitogen-activated protein kinase kinase functionally related to hemipterous.
J Biol Chem
272:24994-24998[Abstract/Free Full Text].
-
Hu Q,
Klippel A,
Muslin AJ,
Fantl WJ,
Williams LT
(1995)
Ras-dependent induction of cellular responses by constitutively active phosphatidylinositol-3 kinase.
Science
268:100-102[Abstract/Free Full Text].
-
Jordan MA,
Wendell K,
Gardiner S,
Derry WB,
Copp H,
Wilson L
(1996)
Mitotic block induced in HeLa cells by low concentrations of paclitaxel (taxol) results in abnormal mitotic exit and apoptotic cell death.
Cancer Res
56:816-825[Abstract/Free Full Text].
-
Kuan CY,
Yang DD,
Roy DRS,
Davis RJ,
Rakic P,
Flavell RA
(1999)
The Jnk1 and Jnk2 protein kinases are required for regional specific apoptosis during early brain development.
Neuron
22:667-676[Web of Science][Medline].
-
Kung AL,
Zetterberg A,
Sherwood SW,
Schimke RT
(1990)
Cytotoxic effects of cell cycle phase specific agents: result of cell cycle perturbation.
Cancer Res
50:7307-7317[Abstract/Free Full Text].
-
Lee LF,
Li G,
Templeton DJ,
Ting JP
(1998)
Paclitaxel (taxol)-induced gene expression and cell death are both mediated by the activation of c-Jun NH2-terminal kinase (JNK/SAPK).
J Biol Chem
273:28253-28260[Abstract/Free Full Text].
-
Le Niculescu H,
Bonfoco E,
Kasuya Y,
Claret FX,
Green DR,
Karin M
(1999)
Withdrawal of survival factors results in activation of the JNK pathway in neuronal cells leading to Fas ligand induction and cell death.
Mol Cell Biol
19:751-763[Abstract/Free Full Text].
-
Ling YH,
Tornos C,
Perez Soler R
(1998)
Phosphorylation of Bcl-2 is a marker of M phase events and not a determinant of apoptosis.
J Biol Chem
273:18984-18991[Abstract/Free Full Text].
-
Luo YQ,
Umegaki H,
Wang XT,
Abe R,
Roth GS
(1998)
Dopamine induces apoptosis through an oxidation-involved SAPK/JNK activation pathway.
J Biol Chem
273:3756-3764[Abstract/Free Full Text].
-
MacKeigan JP,
Collins TS,
Ting JP
(2000)
MEK inhibition enhances paclitaxel-induced tumor apoptosis.
J Biol Chem
275:38953-38956[Abstract/Free Full Text].
-
Maroney AC,
Glicksman MA,
Basma AN,
Walton KM,
Knight E,
Murphy CA,
Bartlett BA,
Finn JP,
Angeles T,
Matsuda Y,
Neff NT,
Dionne CA
(1998)
Motoneuron apoptosis is blocked by CEP-1347 (KT 7515), a novel inhibitor of the JNK signaling pathway.
J Neurosci
18:104-111[Abstract/Free Full Text].
-
Maroney AC,
Finn JP,
Bozyczko-Coyne D,
O'Kane TM,
Neff NT,
Tolkovsky AM,
Park DS,
Yan CY,
Troy CM,
Greene LA
(1999)
CEP-1347 (KT7515), an inhibitor of JNK activation, rescues sympathetic neurons and neuronally differentiated PC12 cells from death evoked by three distinct insults.
J Neurochem
73:1901-1912[Web of Science][Medline].
-
Mattson MP
(1992)
Effects of microtubule stabilization and destabilization on tau immunoreactivity in cultured hippocampal neurons.
Brain Res
582:107-118[Web of Science][Medline].
-
Maundrell K,
Antonsson B,
Magnenat E,
Camps M,
Muda M,
Chabert C,
Gillieron C,
Boschert U,
Vial-Knecht E,
Martinou J-C,
Arkinstall S
(1997)
Bcl-2 undergoes phosphorylation by c-Jun N-terminal kinase/stress-activated protein kinases in the presence of the constitutively active GTP-binding protein Rac1.
J Biol Chem
272:25238-25242[Abstract/Free Full Text].
-
Michaelis ML,
Ranciat N,
Chen Y,
Bechtel M,
Ragan R,
Hepperle M,
Liu Y,
Georg G
(1998)
Protection against beta-amyloid toxicity in primary neurons by paclitaxel (taxol).
J Neurochem
70:1623-1627[Medline].
-
Miller TM,
Tansey MG,
Johnson EM,
Creedon DJ
(1997)
Inhibition of phosphatidylinositol 3-kinase activity blocks depolarization- and insulin-like growth factor I-mediated survival of cerebellar granule cells.
J Biol Chem
272:9847-9853[Abstract/Free Full Text].
-
Morris EJ,
Geller HM
(1996)
Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity.
J Cell Biol
134:757-770[Abstract/Free Full Text].
-
Namgung U,
Xia Z
(2000)
Arsenite-induced apoptosis in cortical neurons is mediated by c-Jun N-terminal protein kinase 3 and p38 mitogen-activated protein kinase.
J Neurosci
20:6442-6451[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Greene LA,
Geller HM
(1997)
G1/S cell cycle blockers and inhibitors of cyclin-dependent kinases suppress camptothecin-induced neuronal apoptosis.
J Neurosci
17:1256-1270[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Padmanabhan J,
Shelanski ML,
Geller HM,
Greene LA
(1998)
Cyclin-dependent kinases participate in death of neurons evoked by DNA-damaging agents.
J Cell Biol
143:457-467[Abstract/Free Full Text].
-
Park J,
Kim I,
Oh YJ,
Lee KW,
Han PL,
Choi EJ
(1997)
Activation of c-Jun N-terminal kinase antagonizes an anti-apoptotic action of Bcl-2.
J Biol Chem
272:16725-16728[Abstract/Free Full Text].
-
Povlishock JT,
Christman CW
(1995)
The pathobiology of traumatically induced axonal injury in animals and humans: a review of current thoughts.
J Neurotrauma
12:555-564[Web of Science][Medline].
-
Raine CS,
Cross AH
(1989)
Axonal dystrophy as a consequence of long-term demyelination.
Lab Invest
60:714-725[Web of Science][Medline].
-
Rapp UR,
Troppmair J,
Beck T,
Birrer MJ
(1994)
Transformation by raf and other oncogenes renders cells differentially sensitive to growth inhibition by a dominant negative c-jun mutant.
Oncogene
9:3493-3498[Web of Science][Medline].
-
Saleem A,
Datta R,
Yuan ZM,
Kharbanda S,
Kufe D
(1995)
Involvement of stress-activated protein kinase in the cellular response to 1-beta-D-arabinofuranosylcytosine and other DNA-damaging agents.
Cell Growth Differ
6:1651-1658[Abstract].
-
Scatena CD,
Stewart ZA,
Mays D,
Tang LJ,
Keefer CJ,
Leach SD,
Pietenpol JA
(1998)
Mitotic phosphorylation of Bcl-2 during normal cell cycle progression and taxol-induced growth arrest.
J Biol Chem
273:30777-30784[Abstract/Free Full Text].
-
Seimiya H,
Mashima T,
Toho M,
Tsuruo T
(1997)
c-Jun NH2-terminal kinase-mediated activation of interleukin-1 beta converting enzyme/CED-3-like protease during anticancer drug-induced apoptosis.
J Biol Chem
272:4631-4636[Abstract/Free Full Text].
-
Srivastava RK,
Mi QS,
Hardwick JM,
Longo DL
(1999)
Deletion of the loop region of Bcl-2 completely blocks paclitaxel-induced apoptosis.
Proc Natl Acad Sci USA
96:3775-3780[Abstract/Free Full Text].
-
Trapp BD,
Peterson J,
Ransohoff RM,
Rudick R,
Mork S,
Bo L
(1998)
Axonal transection in the lesions of multiple sclerosis [see comments].
N Engl J Med
338:278-285[Abstract/Free Full Text].
-
Troy CM,
Stefanis L,
Greene LA,
Shelanski ML
(1997)
Nedd2 is required for apoptosis after trophic factor withdrawal, but not superoxide dismutase (SOD1) downregulation, in sympathetic neurons and PC12 cells.
J Neurosci
17:1911-1918[Abstract/Free Full Text].
-
Vander Heiden MG,
Thompson CB
(1999)
Bcl-2 proteins: regulators of apoptosis or of mitochondrial homeostasis?
Nat Cell Biol
1:E209-E216[Web of Science][Medline].
-
Vickers JC,
Dickson TC,
Adlard PA,
Saunders HL,
King CE,
McCormack G
(2000)
The cause of neuronal degeneration in Alzheimer's disease.
Prog Neurobiol
60:139-165[Web of Science][Medline].
-
Wall ME,
Wani MC
(1995)
Camptothecin and taxol: discovery to clinic
Thirteenth Bruce F. Cain Memorial Award Lecture.
Cancer Res
55:753-760[Abstract/Free Full Text]. -
Wang TH,
Wang HS,
Ichijo H,
Giannakakou P,
Foster JS,
Fojo T,
Wimalasena J
(1998)
Microtubule-interfering agents activate c-Jun N-terminal kinase/stress-activated protein kinase through both Ras and apoptosis signal-regulating kinase pathways.
J Biol Chem
273:4928-4936[Abstract/Free Full Text].
-
Wang TH,
Popp DM,
Wang HS,
Saitoh M,
Mural JG,
Henley DC,
Ichijo H,
Wimalasena J
(1999)
Microtubule dysfunction induced by paclitaxel initiates apoptosis through both c-Jun N-terminal kinase (JNK)-dependent and -independent pathways in ovarian cancer cells.
J Biol Chem
274:8208-8216[Abstract/Free Full Text].
-
Watson A,
Eilers A,
Lallemand D,
Kyriakis J,
Rubin LL,
Ham J
(1998)
Phosphorylation of c-Jun is necessary for apoptosis induced by survival signal withdrawal in cerebellar granule neurons.
J Neurosci
18:751-762[Abstract/Free Full Text].
-
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME
(1995)
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
-
Xia Z,
Dudek H,
Miranti CK,
Greenberg ME
(1996)
Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism.
J Neurosci
16:5425-5436[Abstract/Free Full Text].
-
Xu X,
Raber J,
Yang DS,
Su B,
Mucke L
(1997)
Dynamic regulation of c-Jun N-terminal kinase activity in mouse brain by environmental stimuli.
Proc Natl Acad Sci USA
94:12655-12660[Abstract/Free Full Text].
-
Yamamoto K,
Ichijo H,
Korsmeyer SJ
(1999)
BCL-2 is phosphorylated and inactivated by an ASK1/Jun N-terminal protein kinase pathway normally activated at G(2)/M.
Mol Cell Biol
19:8469-8478[Abstract/Free Full Text].
-
Yang DD,
Kuan CY,
Whitmarsh AJ,
Rincon M,
Zheng TS,
Davis RJ,
Rakic P,
Flavell RA
(1997)
Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the Jnk3 gene.
Nature
389:865-870[Medline].
-
Yao R,
Cooper GM
(1995)
Requirement for phosphatidylinositol-3 kinase in the prevention of apoptosis by nerve growth factor.
Science
267:2003-2006[Abstract/Free Full Text].
-
Zanke BW,
Boudreau K,
Rubie E,
Winnett E,
Tibbles LA,
Zon L,
Kyriakis J,
Liu FF,
Woodgett JR
(1996)
The stress-activated protein kinase pathway mediates cell death following injury induced by cis-platinum, UV irradiation or heat.
Curr Biol
6:606-613[Web of Science][Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21134657-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
L. J. Martin, Z. Liu, J. Pipino, B. Chestnut, and M. A. Landek
Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex
Cereb Cortex,
September 26, 2008;
(2008)
bhn167v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kabuta, R. Setsuie, T. Mitsui, A. Kinugawa, M. Sakurai, S. Aoki, K. Uchida, and K. Wada
Aberrant molecular properties shared by familial Parkinson's disease-associated mutant UCH-L1 and carbonyl-modified UCH-L1
Hum. Mol. Genet.,
May 15, 2008;
17(10):
1482 - 1496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Klintworth, K. Newhouse, T. Li, W.-S. Choi, R. Faigle, and Z. Xia
Activation of c-Jun N-Terminal Protein Kinase Is a Common Mechanism Underlying Paraquat- and Rotenone-Induced Dopaminergic Cell Apoptosis
Toxicol. Sci.,
May 1, 2007;
97(1):
149 - 162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Cai, S. H. Chang, E. B. E. Becker, A. Bonni, and Z. Xia
p38 MAP Kinase Mediates Apoptosis through Phosphorylation of BimEL at Ser-65
J. Biol. Chem.,
September 1, 2006;
281(35):
25215 - 25222.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B.-J. Kim, S.-W. Ryu, and B.-J. Song
JNK- and p38 Kinase-mediated Phosphorylation of Bax Leads to Its Activation and Mitochondrial Translocation and to Apoptosis of Human Hepatoma HepG2 Cells
J. Biol. Chem.,
July 28, 2006;
281(30):
21256 - 21265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Jaworski, S. Spangler, D. P. Seeburg, C. C. Hoogenraad, and M. Sheng
Control of Dendritic Arborization by the Phosphoinositide-3'-Kinase-Akt-Mammalian Target of Rapamycin Pathway
J. Neurosci.,
December 7, 2005;
25(49):
11300 - 11312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. M. Muller, V. M. Dirsch, A. Rudy, N. Lopez-Anton, G. R. Pettit, and A. M. Vollmar
Cephalostatin 1 Inactivates Bcl-2 by Hyperphosphorylation Independent of M-Phase Arrest and DNA Damage
Mol. Pharmacol.,
May 1, 2005;
67(5):
1684 - 1689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hu, C. Jiang, C. Ip, Y. M. Rustum, and J. Lu
Methylseleninic Acid Potentiates Apoptosis Induced by Chemotherapeutic Drugs in Androgen-Independent Prostate Cancer Cells
Clin. Cancer Res.,
March 15, 2005;
11(6):
2379 - 2388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Michaelis, S. Ansar, Y. Chen, E. R. Reiff, K. I. Seyb, R. H. Himes, K. L. Audus, and G. I. Georg
{beta}-Amyloid-Induced Neurodegeneration and Protection by Structurally Diverse Microtubule-Stabilizing Agents
J. Pharmacol. Exp. Ther.,
February 1, 2005;
312(2):
659 - 668.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Newhouse, S.-L. Hsuan, S. H. Chang, B. Cai, Y. Wang, and Z. Xia
Rotenone-Induced Apoptosis Is Mediated By p38 And JNK MAP Kinases In Human Dopaminergic SH-SY5Y Cells
Toxicol. Sci.,
May 1, 2004;
79(1):
137 - 146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Chang, S. Poser, and Z. Xia
A Novel Role For Serum Response Factor in Neuronal Survival
J. Neurosci.,
March 3, 2004;
24(9):
2277 - 2285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Caughlan, K. Newhouse, U. Namgung, and Z. Xia
Chlorpyrifos Induces Apoptosis in Rat Cortical Neurons that is Regulated by a Balance Between p38 and ERK/JNK MAP Kinases
Toxicol. Sci.,
March 1, 2004;
78(1):
125 - 134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Liu, J. E. Cavanaugh, Y. Wang, H. Sakagami, Z. Mao, and Z. Xia
ERK5 activation of MEF2-mediated gene expression plays a critical role in BDNF-promoted survival of developing but not mature cortical neurons
PNAS,
July 8, 2003;
100(14):
8532 - 8537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Chuckowree and J. C. Vickers
Cytoskeletal and Morphological Alterations Underlying Axonal Sprouting after Localized Transection of Cortical Neuron Axons In Vitro
J. Neurosci.,
May 1, 2003;
23(9):
3715 - 3725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Brown and J. L. Boyle
Mesenchymal Chondrosarcoma: Molecular Characterization by a Proteomic Approach, with Morphogenic and Therapeutic Implications
Ann. Clin. Lab. Sci.,
April 1, 2003;
33(2):
131 - 141.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Waetzig and T. Herdegen
A Single c-Jun N-terminal Kinase Isoform (JNK3-p54) Is an Effector in Both Neuronal Differentiation and Cell Death
J. Biol. Chem.,
January 3, 2003;
278(1):
567 - 572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hetman, S.-L. Hsuan, A. Habas, M. J. Higgins, and Z. Xia
ERK1/2 Antagonizes Glycogen Synthase Kinase-3beta -induced Apoptosis in Cortical Neurons
J. Biol. Chem.,
December 13, 2002;
277(51):
49577 - 49584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhou, K. Gupta, J. Yao, K. Ye, D. Panda, P. Giannakakou, and H. C. Joshi
Paclitaxel-resistant Human Ovarian Cancer Cells Undergo c-Jun NH2-terminal Kinase-mediated Apoptosis in Response to Noscapine
J. Biol. Chem.,
October 11, 2002;
277(42):
39777 - 39785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Ghahremani, E. Keramaris, T. Shree, Z. Xia, R. J. Davis, R. Flavell, R. S. Slack, and D. S. Park
Interaction of the c-Jun/JNK Pathway and Cyclin-dependent Kinases in Death of Embryonic Cortical Neurons Evoked by DNA Damage
J. Biol. Chem.,
September 13, 2002;
277(38):
35586 - 35596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rapoport, H. N. Dawson, L. I. Binder, M. P. Vitek, and A. Ferreira
Tau is essential to beta -amyloid-induced neurotoxicity
PNAS,
April 30, 2002;
99(9):
6364 - 6369.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kruidering, T. Schouten, G. I. Evan, and E. Vreugdenhil
Caspase-mediated Cleavage of the Ca2+/Calmodulin-dependent Protein Kinase-like Kinase Facilitates Neuronal Apoptosis
J. Biol. Chem.,
October 12, 2001;
276(42):
38417 - 38425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rapoport, H. N. Dawson, L. I. Binder, M. P. Vitek, and A. Ferreira
Tau is essential to beta -amyloid-induced neurotoxicity
PNAS,
April 30, 2002;
99(9):
6364 - 6369.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|