 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 2001, 21(13):4712-4720
Hes1 and Hes5 Activities Are
Required for the Normal Development of the Hair Cells in the Mammalian
Inner Ear
Azel
Zine1,
Alexandre
Aubert1,
Jiping
Qiu1,
Stavros
Therianos1,
Francois
Guillemot2,
Ryoichiro
Kageyama3, and
Francois
de
Ribaupierre1
1 Institute of Physiology, University of Lausanne, 1005 Lausanne, Switzerland, 2 Institut de Genetique et de
Biologie Moleculaire et Cellulaire, 67404 Illkirch, Centre de
l'Université de Strasbourg, France, and
3 Institute for Virus Research, Kyoto University,
Kyoto 606-8507, Japan
 |
ABSTRACT |
The mammalian inner ear contains two sensory organs, the cochlea
and vestibule. Their sensory neuroepithelia are characterized by a
mosaic of hair cells and supporting cells. Cochlear hair cells
differentiate in four rows: a single row of inner hair cells (IHCs) and
three rows of outer hair cells (OHCs). Recent studies have shown that
Math1, a mammalian homolog of Drosophila atonal is a
positive regulator of hair cell differentiation. The basic helix-loop-helix (bHLH) genes Hes1 and
Hes5 (mammalian hairy and Enhancer-of-split homologs) can influence cell fate
determination by acting as negative regulators to inhibit the action of
bHLH-positive regulators. We show by using reverse transcription-PCR
analysis that Hes1, Hes5, and
Math1 are expressed in the developing mouse cochleae.
In situ hybridization revealed a widespread expression of Hes1 in the greater epithelial ridge (GER) and in
lesser epithelial ridge (LER) regions. Hes5 is
predominantly expressed in the LER, in supporting cells, and in a
narrow band of cells within the GER.
Examination of cochleae from
Hes1 / mice showed a significant
increase in the number of IHCs, whereas cochleae from
Hes5 / mice showed a significant
increase in the number of OHCs. In the vestibular system, targeted
deletion of Hes1 and to a lesser extent
Hes5 lead to formation of supernumerary hair cells in
the saccule and utricle.
The supernumerary hair cells in the mutant mice showed an upregulation
of Math1. These data indicate that Hes1 and
Hes5 participate together for the control of inner ear
hair cell production, likely through the negative regulation of Math1.
Key words:
Hes1; Hes5; Math1; basic
helix-loop-helix (bHLH) transcriptions factors; mouse mutant; cochlea; utricle; saccule; hair cell differentiation
 |
INTRODUCTION |
Regulatory cascades of positive and
negative basic helix-loop-helix (bHLH) transcription factors play
essential roles in the generation of numerous types of neurons from a
homogenous population of ectodermal progenitor cells in the mammalian
nervous system (Kageyama and Nakanishi, 1997 ; Lee, 1997 ). The inner ear
initially forms as a thickening of the ectoderm, termed the otic
placode in the hindbrain. The otic placode gives rise to neurons of the VIIIth cranial nerve and invaginates to become the otocyst, from which
the organ of Corti and vestibular organs will develop (Van de Water,
1983 ; Torres and Giraldez, 1998 ). The sensory epithelia of these organs
consist of mechanoreceptive hair cells, supporting cells, and nerve
endings. In the mouse cochlea, terminal mitoses occur between embryonic
day 13 (E13) and E14 (Ruben, 1967 ), and differentiating hair cells can
first be identified on E15 in the base (Anniko, 1983 ; Lim and Anniko,
1985 ). Histological studies suggest that, during cochlea morphogenesis,
inner hair cells (IHCs) derive from progenitor cells located in the
greater epithelial ridge (GER) that is medial to the future organ of
Corti, whereas outer hair cells (OHCs) derive from the distal
progenitor cells in the lesser epithelial ridge (LER) (Lim and Rueda,
1992 ). The time course of hair cell development includes cell fate
commitment-determination, initial differentiation, maturation, and
acquisition of stereociliary bundles (Kelley et al., 1993 ; Fekete,
1996 ; Torres and Giraldez, 1998 ). Recently, two evidences regarding
initial determination-differentiation of mammals cochlear hair cells
have been established. First, the involvement of the Notch1 signaling
pathway in regulating the number of progenitor cells that develop as
hair cells, contributing to the generation of the regular cochlear
mosaic (Lanford et al., 1999 ; Zine et al., 2000a ). Second, the
requirement of the bHLH transcription factor Math1 as a positive
regulator of the specification of hair cells in the mouse inner ear
(Bermingham et al., 1999 ; Zheng and Gao, 2000 ).
The negative bHLH transcription factors Hes1 and Hes5 homologs to the
products of Drosophila hairy and
Enhancer-of-split
[E(spl)] (Akazawa et al., 1992 ; Sasai et
al., 1992 ) have been demonstrated to affect cell fate determination by
inhibiting the action of bHLH-positive regulators during the
development of the CNS (Kageyama and Nakanishi, 1997 ).
In addition, previous studies reported that both Hes1 and
Hes5 expression is induced by Notch activation (Jarriault et
al., 1995 , 1998 ; Ohtsuka et al., 1999 ). Although a recent study
demonstrated that Hes1 acts as a negative regulator of IHC
differentiation (Zheng et al., 2000 ), none have been shown to be
required for the control of OHC differentiation. The accurate control
of both IHCs and OHCs is necessary for the generation of the regular
mosaic of hair cells and supporting cells within the mammalian cochlea. Here we examined by, using reverse transcription (RT)-PCR analysis, the
expression of Hes1, Hes5, and Math1
genes in the developing mouse cochlea. Using in situ
hybridization, Hes1 and Hes5 mRNA expression
patterns were examined in E18 and newborn cochleae.
The roles of Hes1 and Hes5 in hair cell
differentiation were investigated by analyzing the developing inner ear
from mice that lack both Hes1 and Hes5 genes.
 |
MATERIALS AND METHODS |
Animals. Compound Hes1 and Hes5
embryos and early neonatal [postnatal day 0 (P0)] mutants were
obtained from intercrosses of
Hes1+/ ;Hes5+/
or
Hes1+/ ;Hes5 /
mice. These mutant mouse lines have been described previously (Ishibashi et al., 1995 ; Ohtsuka et al., 1999 ; Cau et al., 2000 ). E0.5
was defined as noon of the day that vaginal plug was observed. Inner
ear tissues were collected from E16-E18 embryos or immediately after
birth, because Hes1 / mice die
during gestation or within 1 d after birth (Ishibashi et al.,
1995 ). Genotyping of the embryos and P0 mice was performed by PCR with
tail DNA.
RT-PCR. Sensory epithelia were dissected out from 10-14
cochleae of five developmental stages from E12.5 to newborn (P0). RT-PCR was performed and controlled as described previously (Zine et
al., 2000b ) with few modifications. Total RNA was isolated using TRIZOL
(Life Technologies, Gaithersburg, MD). Polyadenylated RNA was
purified from total RNA through oligo-dT cellulose separation (Amersham
Pharmacia Biotech, Uppsala, Sweden). mRNA was reverse transcribed using
Superscript II RNase free reverse transcriptase (Life Technologies).
For PCR amplification, the typical thermocycle profile was as follows:
5 min at 95°C, 45 sec at 58°C, and 1.5 min at 72°C for 40 cycles.
The PCR products were separated on a 1% agarose gel, stained with
ethidium bromide, purified, and sequenced. The primers for RT-PCR
analysis are as follows: for Hes1, upstream CAGCCAGTGTCAACACGACAC and downstream TCGTTCATGCACTCGCTGAG; for Hes5, upstream CGCATCAA CAGCAGCATAGAG and downstream
TGGAAGTGGT AAA GCAGCTTC; for Math1, upstream
AGTGACGGAGAGTTTTCCCC and downstream CTGCAGCCGTCCGAAGTCAA; and for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), upstream
GTCATCATCTCCGCCCCTTCTGC and downstream GATGCCTGCTTCACCACCTTCTTG.
In situ hybridization. Cochleae were dissected from E18 and
P0 inner ears and fixed in 4% paraformaldehyde for 3 hr in phosphate buffer, pH 7.4, overnight at 4°C.
For cryostat sections, cochleae were cryoprotected in 20% sucrose in
PBS, embedded in OCT compound (Tissue Tek; Miles, Elkhart, IN), and
mounted for sectioning. For whole-mount surface preparation, cochleae
were dissected from all of the surrounding tissue to expose the
developing sensory epithelia. RNA probes were synthesized from cDNA for
Hes1 (Tomita et al., 1996 ) and Hes5
(Akazawa et al., 1992 ). Hes1 was linearized by
XhoI and transcribed by T3, and Hes5 was
linearized by HindIII and transcribed by T3 RNA polymerase.
Both whole-mount surface preparations and cryostat sections (10 µm)
were processed with a digoxigenin (DIG)-labeled cRNA probes as
described previously (Schaeren-Wiemers and Gerfin-Moser, 1993 ). In
brief, after fixation, the samples were incubated in 1% Triton X-100
and digested with Proteinase K. They were incubated in a prehybridization solution for 2 hr at 50°C and then exposed to cRNA
probes overnight at 50°C. The probes were revealed by
alkaline-phosphatase-coupled anti-DIG antibodies (Boehringer Mannheim,
Mannheim, Germany), which were reacted with
nitroblue-tetrazolium-chloride and
5-bromo-4-chlor-indolyl-phosphate substrates for color reaction.
Some of the whole-mount cochlear preparations were cryosectioned after
the in situ hybridization procedures.
Histology and immunocytochemistry. Cochleae from embryos
(E16-E18) and P0 mice were fixed overnight in 4% paraformaldehyde in
PBS at 4°C. We performed immunofluorescence analysis on
whole-mount surface preparations and paraffin sections of the cochleae
as described previously (Zine et al., 2000a ). Both cochlea paraffin sections and surface preparations were preincubated in PBS containing 5% normal donkey serum for 2 hr and then incubated with polyclonal antibodies against myosin VIIa (Hasson et al., 1995 ) or against Math1 (Helms and Johnson, 1998 ). Antibody incubations were done overnight at 4°C, and binding was visualized with rhodamine or Cy3-conjugated donkey anti-rabbit secondary antibodies (Jackson ImmunoResearch, West Grove, PA). Other cochlear surface preparations were stained with rhodamine-conjugated phalloidin (5 µg/ml) for 45 min to visualize the pattern of hair cell differentiation in the organ
of Corti, in particular the actin-rich stereocilia.
Confocal and scanning electron microscopy. Digital images
were captured on a Leica (Nussloch, Germany) TCS-NT confocal laser scanning microscope. Images used for the figures were processed with
either NIH Image or Photoshop (Adobe Systems, Mountain View, CA)
software programs.
For scanning electron microscopy, cochleae were fixed in 2%
glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.2, for 2 hr and then post-fixed for 1 hr with 1% osmium tetroxide. After washing in cacodylate buffer, cochleae were dehydrated in ascending concentrations of ethanol, dried at the critical point, and sputter coated with gold. All material was examined in a Jeol (Peabody, MA)
630F scanning electron microscope operating at 5 kV.
Quantification of hair cells. We quantified the number of
cochlear hair cells in early neonatal (P0) mutant mice versus wild-type littermates. Count was made on cochlear surface preparations processed with rhodamine-conjugated phalloidin. We made analysis on a region that
covers a 1600 µm length of the organ of Corti, beginning near the
base of cochlea and extending toward the middle turn.
In the vestibular sensory epithelia, we counted, using the 40×
objective lens, the number of hair cells of P0 utricle and saccule
maculae of mutants versus those of wild-type mice on transverse sections immunostained with myosin VIIa across the entire section length of the sensory epithelium. Only segments in which the section was perpendicular to the surface of the neuroepithelium were counted. Hair cell counts were made from three to five distant sections for each
macula, and two to five animals were counted for each genotype.
 |
RESULTS |
Hes1, Hes5, and Math1
are expressed in the developing cochlea
RT-PCR analyses (Fig. 1) were
performed with dissected sensory epithelia from the developing cochleae
that principally consist of the organ of Corti, a part of the basilar
membrane, GER, and LER, as described previously (Zine and de
Ribaupierre, 1999 ). Hes1 and Hes5 transcripts
became detected by E14, a stage just before the initiation of the
cytological differentiation of hair cells at E15 (Lim and Anniko,
1985 ). Math1 was expressed as early as E12.5, consistent
with a study reporting the initiation of Math1/LacZ expression in the
embryonic organ of Corti by E12.5 (Bermingham et al., 1999 ). The
expression of Hes1, Hes5, and Math1 between E14 and P0, a developmental period that is critical for initial
hair cell differentiation, suggests the possible functional relationship between these genes.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 1.
RT-PCR analysis of the temporal expression of
Hes1, Hes5, and Math1 in
the sensory epithelia dissected from the developing cochleae. All cDNA
was coamplified with GAPDH as shown. Math1 transcripts
were detected early at E12.5, whereas transcripts for
Hes1 and Hes5 were detected by E14. This
expression of Hes1, Hes5, and
Math1 was maintained in the developing sensory
epithelium until P0.
|
|
To determine the cellular expression patterns of Hes1 and
Hes5 genes, we used nonradioactive in situ
hybridization on cryosections and whole-mount surface preparations from
E18-P0 cochleae (Fig. 2). In
situ hybridization on E18 cochlea sections revealed
Hes1 expression principally in two areas, which include the
GER and LER. The organ of Corti, which contains the hair cells and
supporting cells, was devoid from Hes1 signal at this stage
of maturation (Fig. 2A), although a weak
hybridization signal for Hes1 was observed in the supporting
cells region in the basal cochlear turn of E15 mice, in addition to the
GER and LER (data not shown).

View larger version (157K):
[in this window]
[in a new window]
|
Figure 2.
Nonradioactive Hes1
(A-C) and Hes5
(D-F) RNA in situ hybridization
in the developing mouse cochlea at E18 and P0. A,
D, In situ hybridization on transverse
sections through the base of E18 cochlea. Hes1 mRNA
(A) is expressed in the LER cells and in a large
area of GER, except in the organ of Corti (OC).
Hes5 mRNA (D) is expressed in the
LER, pillar cells (P), and Deiter's cells at the
base of OHCs (area bracketed by arrows).
Hes5 is also found in the inner phalengeal cells
(arrowhead), which are adjacent to the inner hair cell
region. Hair cells (large arrow indicates IHC;
oblique arrows indicate the three rows of OHCs) are
lacking Hes5 hybridization signal. Note the
Hes5 expression in the marginal cells of the stria
vascularis (open arrowhead). Asterisk
indicates the spiral vessel, a landmark for the location of the organ
of Corti at this stage of maturation. B,
E, In situ hybridization on whole-mount
surface preparations from the middle turn of the cochlear duct at P0.
Expression of Hes1 (B) spans a
large area of the GER, as observed in a cochlea section
(A). Expression of Hes5
(E) is observed in a relatively narrow band of
cells of the GER. There is a faint but specific Hes5
expression in the cells within the LER (arrows). Note
the absence of both Hes1 and Hes5
hybridization signal from the hair cells (arrowheads
indicate the location of IHC row; bracket indicates the
OHC rows). C, F, Transverse sections
through the whole-mount cochlear surface preparations presented in
B and E, respectively. C,
This section confirms Hes1 expression in the GER
cells and its lack from the cells of the organ of Corti
(bracket). Hybridization label for Hes1
is also located in the LER (arrow). F,
Hes5 expression is restricted to the nonsensory
supporting cells (Deiter's cells; arrows) within the
organ of Corti. This section also confirms the specific expression of
Hes5 is the LER cells (arrowhead). A weak
label for Hes5 is observed in the GER region and in
cells located near the basilar membrane. Asterisk
indicates the spiral vessel. Scale bars, 20 µm.
|
|
Whole-mount cochlear surface preparations at P0 (Fig.
2B) also showed a widespread expression of
Hes1 in the GER area and its lack from the organ of Corti. A
section (Fig. 2C) through the whole-mount surface
preparation presented in Fig. 2B confirmed Hes1 expression in the GER and LER and the absence of
Hes1 hybridization signal from the organ of Corti.
Hes5 in situ hybridization (Fig. 2D-F) performed on E18-P0 cochleae indicated
both overlapping and distinct expression patterns compared with that of
Hes1. In the organ of Corti (Fig.
2D,F), Hes5 is
expressed in the pillar cells, Deiter's cells, and the inner
phalengeal cells. Like Hes1, the expression of
Hes5 was not detected in the hair cells. Hes5 was
also heavily expressed in the cells of the LER (Fig.
2D), although its expression in the GER was confined
to a narrow band of cells (Fig. 2E). Marginal cells
of the stria vascularis showed a specific Hes5 expression.
To define the roles of Hes1 and Hes5 genes in
hair cell development, we analyzed cochlear surface preparations and
inner ear sections of different genotypes that resulted from
Hes1+/ ;Hes5+/
or Hes1+/ ;
Hes5 / intercrosses. We obtained
eight possible genotypes (Cau et al., 200) and performed hair cells
counts on six of them in the case of cochlea (as summarized in Table
1) and four of them in the case of the
vestibule (see Fig. 6).
Deletion of Hes1 gene leads to a significant
increase in the number of IHCs
Whole-mount surface preparation of the cochleae from
Hes1 / mice stained with
rhodamine phalloidin revealed many regions (38% of the relative length
of the basilar membrane; Table 1) with a nearly complete row of
supernumerary IHCs (Fig.
3D-F) compared with
wild-types (<1% of basilar membrane; Table 1), which have only a
single row of IHCs (Fig. 3A-C). In addition, a few regions (5% of basilar membrane with a fourth row of OHCs; Table 1) of Hes1 / mutant cochleae presented
four instead of three rows of OHCs (Fig.
3D,F). The presence of the
supernumerary hair cells was confirmed by immunostaining cross-sections
of cochleae with anti-myosin VIIa, a hair cell-specific marker (Fig.
3E) and by scanning electron microscopy (Fig.
3F). There was a significant increase in the total
number of hair cells in cochleae of
Hes1 / mice compared with wild
types. This was principally attributable to a significant
increase in the number of IHCs (**p < 0.005), because the number of OHCs in
Hes1 / cochleae was just slightly
higher than wild types (Table 1). The
Hes1 / mice of this study showed
a severe cochlea phenotype, with respect to the production of total
cochlear hair cells when compared with the results of a recent study
(Zheng et al., 2000 ). This could be attributable to differences in the
developmental stage at which hair cell counts were made or to the
length of cochlea covered by hair cell counts. In this study, we
quantified the number of hair cells in cochleae collected from newborn
(P0) mice for either mutant and wild types and along a 1.6 mm length of
the sensory epithelium, i.e., nearly 70% of the total length.

View larger version (126K):
[in this window]
[in a new window]
|
Figure 3.
A comparison of hair cell
development in P0 cochleae from wild-type control
(A-C),
Hes1 /
(D-F),
Hes5 /
(G-I), and
Hes1 / ;Hes5+/
(J) mutants and
Hes1+/ ;Hes5+/
heterozygous mice (K). Lack of
Hes1 and Hes5 causes the development
of supernumerary hair cells. A, D,
G, J, K, Confocal
images of surface preparations stained with rhodamine phalloidin
to visualize the actin-rich stereocilia of the hair cells.
B, E, H, Cross-sections
through the organ of Corti in the midmodiolar region immunostained with
antibody anti-myosin VIIa. C, F,
I, Scanning electron microscopy of the surface of the
organ of Corti in the midcochlear turn. In control cochlea, the normal
pattern is well defined, with a single row of IHCs and three rows of
OHCs. In contrast, in Hes1 /
cochleae, two rows of IHCs and three to four rows of OHCs are
present. In Hes5 /
cochleae, four rows of OHCs are often present, in
addition to dispersed regions along the sensory epithelium
that contain few IHC pairs. J,
Hes1 / ;Hes5+/
cochleae revealed the same phenotype as
Hes1 / , but the effect on the
number of supernumerary hair cells was more important in
Hes1 / ;Hes5+/
cochleae (see Table. 1). K, Cochlear surface preparation
from double heterozygous mouse cochlea indicating regions with
extra OHC rows and a few pairs of IHCs. Brackets mark
the OHCs rows, and arrowheads point to the IHC row.
Scale bars: A, B, D,
E, G, H, J,
K, 20 µm; C, F,
I, 10 µm.
|
|
Deletion of Hes5 gene leads to a significant
increase in the number of OHCs
Cochleae from Hes5 / mice
revealed many regions (45% of the relative length of the basilar
membrane with a fourth row of OHCs; Table 1) that principally contained
four rows of OHCs rather than three (Fig. 3G-I, Table 1),
although, in these mutants, doublets of IHCs (5% of basilar membrane;
Table 1) were interspersed within regions of a single row of IHCs (Fig.
3G,I). Moreover, sometimes cochleae of
Hes5 / mice exhibited a few
supernumerary hair cells scattered outside the sensory epithelium in
the GER (these extra hair cells at this location were not included in
hair cells counts), as defined by phalloidin (Fig.
4A) and myosin VIIa
(Fig. 4B-D) labeling. In contrast to
Hes1 / mice, the significant
increase in the total number of hair cells in the cochleae of
Hes5 / mice was attributable to
the significant increase in the number OHCs (*p < 0.05) compared with wild types (Fig. 3G-I, Table 1).

View larger version (97K):
[in this window]
[in a new window]
|
Figure 4.
Formation of supernumerary hair cells in both the
organ of Corti and the GER in P0 cochlea of
Hes5-deficient mice. A, Cochlear surface
preparation stained with phalloidin, revealing pairs of IHCs in the
organ of Corti (arrowheads), in addition to some extra
differentiating hair cells with immature stereocilia scattered in the
GER (arrows). B, Cross-section through
the midmodiolar region of the organ of Corti immunostained with
anti-myosin VIIa. Arrows indicate the two
differentiating extra hair cells outside the organ of Corti, in the GER
area. Note also the extra hair cells in the organ of Corti.
C, Cochlear surface preparation immunostained with
myosin VIIa, indicating the presence of differentiating extra hair
cells in the GER (arrows). D,
High-magnification of the extra hair cells seen in the GER in
C showing their characteristic shape and basal nuclei.
Scale bars, 20 µm.
|
|
We also examined the cochleae of
Hes5 / mice during the postnatal
development because, Hes5 single mutants were viable. We
observed that the supernumerary hair cells survived until P10 (the
latest stage we examined) and also developed morphological
characteristics of the normal hair cells (data not shown).
Enhanced increase of hair cell production in
Hes1 / ;Hes5+/
and
Hes1+/ ;Hes5 /
mutants
Cochleae from double mutant that were homozygous for
Hes1 and heterozygous for Hes5
(Hes1 / ;Hes5+/ )
and those heterozygous for Hes1 and homozygous for
Hes5
(Hes1+/ ;Hes5 / )
mice showed a more significant increase in the total number of hair
cells than Hes1 and Hes5 single mutants when
compared with the values of wild types (Table 1). This increase in
the number of hair cells was attributable to a significant increase in
the number of IHCs (**p < 0.005) in
Hes1 / ;Hes5+/
mice and in the number of OHCs (**p < 0.005) in
Hes1+/ ;Hes5 /
mice compared with wild types (for IHCs: wild type, 200 ± 10, mean ± SD; Hes1 / ,
276 ± 15;
Hes1 / ;Hes5+/ ,
326 ± 16) (for OHCs: wild type, 601 ± 19;
Hes5 / , 683 ± 26;
Hes1+/ ;Hes5 / ,
725 ± 25). In addition, the length of the basilar membrane (Table 1) with IHC pairs increased from 38% in
Hes1 / to 63% in
Hes1 / ;Hes5+/
mice and that with a fourth row of OHCs increased from 45% in Hes5 / to 62% in
Hes1+/ ;Hes5 / .
This pronounced defect in
Hes1 / ;Hes5+/
and
Hes1+/ ;Hes5 /
mutant cochleae suggests that the dosage of both Hes1 and
Hes5 gene products is important for the control of hair cell
production. There was a mild increase, statistically insignificant, in
the number of hair cells in the double heterozygote
(Hes1+/ ;Hes5+/ )
mice compared with wild types (Fig. 3K, Table1). Because
double homozygous embryos for Hes1 and Hes5 die
before E11.5 (Ohtsuka et al., 1999 ), well before the formation of the
cochlea, we were unable to assess hair cell differentiation in double
null mutant mice.
Analysis of Math1 expression in the cochleae of
Hes1- and Hes5-deficient mice
Because Math1 has been shown (Bermingham et al., 1999 ) to be
required for the genesis of hair cells, we examined by
immunohistochemistry whether the supernumerary hair cells in
Hes1 and Hes5 mutants mice also
expressed Math1 (Fig. 5). Antibody
anti-Math1 (Helms and Johnson, 1998 ) was used to detect Math1
expression in wild-type, Hes1, and Hes5 mutant
cochleae. In wild-types, Math1 expression was restricted to the
differentiating hair cells at E16 (Fig. 5C) and by P0 (Fig.
5A,E) was but absent in the
supporting cells and in cells outside the sensory epithelium.
Interestingly, in Hes1 / (Fig.
5B) and Hes5 / (Fig.
5D) mutant cochleae, Math1 expression also included the supernumerary hair cells that developed within the sensory epithelium. The presence of supernumerary hair cells in the sensory epithelium of
E16 Hes5 / (Fig. 5D)
and E16 Hes1 / mice (data not
shown) at the earliest developmental time points at which these cells
can be distinguished suggests that Hes1 and Hes5
genes may have roles in initial steps of hair cell
determination-differentiation. In addition, Math1 expression was seen
in a subset of extra hair cells that developed outside the organ of
Corti, in the GER of Hes5 /
cochlea (Fig. 5F). This upregulation of Math1 in
differentiating extra hair cells of
Hes1 / and
Hes5 / mutant cochleae is
consistent with a study demonstrating that Math1 is necessary for the
genesis of hair cells in the mice inner ear (Bermingham et al., 1999 ).
Moreover, it was demonstrated in a recent gain-of-function study that
overexpression of Math1 in postnatal cochlear cultures resulted in
extra hair cells observed in the GER (Zheng and Gao, 2000 ).

View larger version (115K):
[in this window]
[in a new window]
|
Figure 5.
Expression patterns of Math1 protein in the
developing cochleae of wild-type (control) (A,
C, E), Hes1-deficient
(B), and Hes5-deficient
(D, F) mice. A,
B, Cross-sections through the midturn of P0 cochlea from
control and Hes1 / mice. In
control, a single inner hair cell (arrowhead) and three
outer hair cells express Math1. In
Hes1 / , Math1 expression also
included the extra IHCs (arrowheads). C,
D, Cross-sections of the midturn E16 cochleae from
control and Hes5 / mice showing
the differentiating extra hair cells (arrowheads). Note
a diffuse expression of Math1 in the apical region of some cells in the
GER of Hes5 / mice
(arrow). E, F, Cochlear
surface preparations obtained from P0 control and
Hes5 / mice. In control, one row
of IHCs and three rows of OHCs express Math1. In
Hes5 / , Math1 expression
highlights the differentiating extra hair cells in both the organ of
Corti (open arrows) and the GER (arrows).
Scale bars, 20 µm.
|
|
Hes1 and Hes5 genes are also involved
in hair cell differentiation in the utricle and saccule sensory
epithelia
To analyze the effects of targeted deletion of Hes1 and
Hes5 on hair cell differentiation within the mouse
vestibular organs, we counted the number of cells within the lumenal
hair cell layer of P0 utricle and saccule on serial sections,
immunolabeled with anti-myosin VIIa (Fig.
6A-D). This
quantitation (Fig. 6E,F)
showed a significant increase in the mean number of hair cells per unit length of sensory epithelium in the utricle (Fig. 6F)
of Hes1 / mice (18.7 ± 4.4, mean ± SD; p < 0.0001) compared with the
wild-type control mice (12.8 ± 1.2). The number of hair cells in
the utricle of Hes5 / mice
(16.2 ± 3), although lower than that in the utricle of
Hes1 / mice, represents a
significant increase over the value of wild-type control mice. The
number of hair cells in the double heterozygote (Hes1+/ ;Hes5+/ )
utricles was below that of Hes1 and Hes5 single
mutants and slightly higher than that of the wild-type utricle mice. In
the saccule (Fig. 6E), hair cell differentiation is
similarly affected by Hes1 and Hes5 deletions as
in the utricle. We found a significant, although reduced relative to
the value in the utricle, increase in the number of hair cells in
Hes1 / (16.5 ± 1.7) and
Hes5 / (14.9 ± 1.9) mice
when compared with the wild-type (11.1 ± 1.3) saccule mice.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6.
Formation of supernumerary hair cells in the
utricle and saccule of Hes1- and
Hes5-deficient mice. Myosin VIIa immunolabeling of P0
saccular section from wild-type (WT) control
(A), Hes1 /
(B), Hes5 /
(C), and
Hes1+/ ;Hes5+/
heterozygous mice (D). E,
F, Hair cell counts from
Hes1 / ,
Hes5 / and
Hes1+/ ;Hes5+/
mouse saccules and utricles, respectively. Hair cell densities are
expressed as a mean number per 100 µm length of the sensory
epithelium cut perpendicular to the epithelial surface. Data are
expressed as mean ± SD, and significance was determined using a
Student's t test. *p < 0.0001 indicates significant values from wild type. Scale bar:
A-D, 50 µm.
|
|
Our quantitative data from the utricle of
Hes1 / mice are in the same range
as those reported by Zheng et al. (2000) . Their total hair cells counts
showed an increase of 36% in the
Hes1 / utricles compared with
those from the wild types. This value is very close to the increase in
hair cell density that we found for the utricle (38% increase for
Hes1 / ; 20% for
Hes5 / ). In the case of the
saccule, our counts indicate an increase of 34% for
Hes1 / and of 21% for
Hes5 / when compared with the
wild types.
 |
DISCUSSION |
Our experiments demonstrate that Hes1 and
Hes5 have separate and overlapping roles in regulating the
differentiation of hair cells in the mammalian inner ear. In the
cochlea, Hes1 has a significant influence on the production
of IHCs, whereas Hes5 has a significant influence on the
production of OHCs, although a few differentiating extra hair cells
were seen in the GER of some cochleae of
Hes5 / mice. In the vestibular
organs, targeted deletion of either Hes1 or Hes5
leads to the formation of supernumerary hair cells in both the utricle
and saccule sensory epithelia.
Our RT-PCR analysis with isolated cochlear sensory epithelia indicates
that Hes1, Hes5, and Math1 genes are
expressed during a developmental period that is critical for initial
hair cell differentiation. Our results using in situ
hybridization with E18-P0 mouse cochleae revealed Hes1
expression in the GER and LER regions, whereas undetectable to a low
level of Hes1 expression was seen in the supporting cells of
the basal turn of E15 cochlea. Hes5 expression predominated
in the LER and in supporting cells of the sensory epithelium of E18-P0
cochleae. In addition, in situ hybridization with
whole-mount preparations of the developing cochlea showed a narrow band
of Hes5-expressing cells in the GER area (Fig.
2E). These expression data are consistent to some
extent with the phenotypic characterization of Hes1 and
Hes5 mutant cochleae. Indeed, during embryonic development,
IHCs derive from progenitor cells located in the most distal domain of
the GER, whereas OHCs derive from progenitor cells located in the
proximal domain of LER (Lim and Rueda, 1992 ).
It is interesting that Hes5 was also expressed in a narrow
band of cells within the GER, as in some of the
Hes5 / cochleae in which a few
ectopic hair cells were observed in this region, in addition to
differentiation of the fourth row of OHCs that arose right next the
normal rows. Within the vestibular system, either Hes1 or
Hes5 deletions induced the formation of supernumerary hair
cells in both the utricle and saccule epithelia. This suggests an
overlapping role Hes1 and Hes5 genes in
preventing the formation of supernumerary utricular and saccular hair
cells during the normal development of the inner ear. Our quantitative
data of the vestibular system indicated that, in Hes5 mutant
mice, the formation of extra hair cells, although significant compared
with the wild-type mice, was less important than that of
Hes1 mutant mice. This could fit with the expression study
in the utricular epithelium of the rat (Zheng et al., 2000 )
demonstrating that, unlike Hes1, which is expressed in the
supporting cells throughout the sensory epithelium, Hes5
expression was confined to the supporting cells in the central area of
the utricle (striola). In contrast to the vestibular system,
Hes1 expression in E18-P0 mouse cochlea was undetectable in
the supporting cells. This suggest that Hes1 may act
differently to regulate hair cell differentiation in the inner ear neuroepithelia.
The upregulation of Math1 in the sensory epithelia of Hes1
and Hes5 mutant cochleae (Fig. 5) suggests that
Hes genes regulate hair cell differentiation, possibly by
antagonizing Math1. This may also occur within the
vestibular system because it has been shown that Hes1 and
Hes5 are expressed in the supporting cell layer of the
developing utricle (Zheng et al., 2000 ). In addition, Math1
is expressed in the vestibular hair cells and is also required for
their differentiation (Bermingham et al., 1999 ; Shailam et al.,
1999 ).
These results are consistent with previous studies demonstrating that
the transcription of Math1 is repressed by the
transcriptional activities of Hes genes (Takebayashi et al.,
1994 ; Akazawa et al., 1995 ), although the function of Hes5
as a repressor of Math1 transcription remains speculative. The increase
in cochlear hair cell production in
Hes1 / ;Hes5+/
and
Hes1+/ ;Hes5 /
mutant mice compared with Hes1 and Hes5 single
mutant mice suggests that Hes1 and Hes5 genes
operate in a common signaling pathway and may functionally compensate
for each other. Recent studies have demonstrated that activation of
Notch results in the subsequent activation of Hes1 and
Hes5 genes (Jarriault et al., 1995 , 1998 ; Ohtsuka et al.,
1999 ). Notch proteins are ligands-activated transmembrane receptors involved in cell fate selection throughout development of
both Drosophila and vertebrates (Artavanis-Tsakonas et al., 1999 ).
Studies from several laboratories have reported that the Notch pathway
is involved in the development of the vertebrate inner ear (Adam et
al., 1998 ; Haddon et al., 1998 ; Lanford et al., 1999 ; Morrison et al.,
1999 ; Eddison et al., 2000 ; Zhang et al., 2000 ; Zine et al., 2000a ). In
the mammalian cochlea, targeted deletion of Jagged2 gene,
which encodes one of the Notch ligands, resulted in supernumerary hair
cells (Lanford et al., 1999 ). Additionally, alteration of Notch
signaling by either Notch1 or Jagged1 antisense oligonucleotides resulted in an increase in the number of hair cells in
organotypic cultures of the developing cochlea (Zine et al., 2000a ).
These similarities in phenotypes when Notch1 and Hes1/Hes5 functions are altered suggest that
Notch1 and Hes-type factors act in the same pathway during cochlea development.
In comparison, the expression of Hes5 and to a lesser extend
that of Hes1 in the developing cochlea is quite similar to
that of Notch1 and Jagged1 in terms of their
spatial distribution. Previous studies have shown that both
Notch1 and its ligand Jagged1 were expressed
throughout the prospective cochlear sensory epithelium before hair cell
differentiation (Morrison et al., 1999 ; Zine et al., 2000a ). Their
expression was downregulated in the differentiating hair cells and
persisted in supporting cells and in undifferentiated cells within the
GER and LER of the developing cochlea. Altogether, these results may
support the role of Hes1 and Hes5 as downstream mediators of Notch1 signaling pathway in the cochlea and a model in
which Notch1-mediated lateral inhibition participates in the regulation
of hair cell differentiation. However, phenotypic characterization of
both Hes1 and Hes5 null mutant cochleae suggests
that the function of these Hes genes is not restricted to a lateral
inhibitory mechanism between neighboring cells. We did not observe
regions of the organ of Corti displaying only hair cells without
interposed supporting cells in
Hes1 / and
Hes5 / mice, as would be expected
if the Hes1 and Hes5 genes operate only in a
lateral inhibitory manner. According to the early expression of
Hes1 in the embryonic mouse cochlea at E14 (Fig. 1), in
combination to its broad expression throughout cells of the GER and LER
(Fig. 2), Hes1 might also serve as a prepatterning gene,
acting to demarcate sensory epithelium versus nonsensory epithelium
progenitor cell domains against which determination-differentiation
cues are directed. In contrast to Hes1, Hes5 expression was
observed, in addition to GER and LER, in the supporting cells, which
includes Deiter's cells and pillar cells within the sensory epithelium
of E18 cochlea (Fig. 2D). This spatial distribution
of Hes5 in the cell types that are closely apposed to the
differentiating OHCs may support a role of Hes5 in
Notch-mediated lateral inhibition because Deiter's cells and pillar
cells also express Notch1 receptor at this stage of maturation (Zine et
al., 2000a ).
Such a system parallels to some extent a role of their
Drosophila homolog genes, the hairy and
[E(spl)] complex in the generation of
mechanosensory bristles that resemble the basic feature of vertebrate
mechanosensory hair cells (Chan and Yan, 1999 ). In Drosophila, the hairy gene participates in
proneural cluster positioning as a prepatterning gene and the
[E(spl)] genes act at a later stage in the
repression of local neuronal fates within the proneural cluster. This
later function is dependent on Notch activation of the genes of the
[E(spl)] complex. In both cases, the
effect of hairy and [E(spl)]
complex genes is the negative regulation of neurogenesis through
repression of bHLH genes, such as atonal (a
Drosophila homolog of Math1) and the
achaete-scute complex (Jennings et al., 1994 ; Fisher and
Caudy, 1998 ). Therefore, Hes1 and Hes5 may have
Notch-dependent and/or Notch-independent activities in the developing
mammalian inner ear, as is possible with their Drosophila
homologs, and raise the hypothesis that the function of
Notch-Hes-Math1 pathway has been evolutionarily conserved.
Our findings demonstrate that Hes1 and Hes5
activities are important for repressing the commitment of progenitor
cells to IHCs and OHCs fates, respectively, likely by antagonizing
Math1. This negative regulation is critical for the correct number of hair cells to be produced and for the establishment of the normal cochlear mosaic of a single row of IHCs and three rows of OHCs. In the
vestibular system, Hes1 and Hes5 also act as
negative regulators of hair cell differentiation within the utricle and
saccule epithelia.
A complete understanding of the role of the Notch-Hes-Math1 pathway
directing hair cell fate in the mammalian inner ear may help to develop
strategies to solve the problem of auditory hair cells loss. It is
possible that simultaneous downregulation of both of Hes1
and Hes5 in the cochlea might be used to stimulate the
replacement of lost auditory hair cells. Such studies may have a
significant therapeutic value, because loss of auditory hair cells
through disease, trauma, and aging is a common cause of hearing loss
and/or deafness.
 |
FOOTNOTES |
Received Nov. 27, 2000; revised April 2, 2001; accepted April 4, 2001.
This research was supported by Swiss National Science Foundation
Grant 31-56897.99. We thank Drs. Mark Mooseker for his gift of
anti-myosinVIIa, Jane Johnson for anti-Math1 antibody, Thomas Van de
Water for comments and suggestions, and Luc Pellerin for laboratory facilities.
Correspondence should be addressed to Dr. Azel Zine, Institut de
Physiologie, 7 Rue du Bugnon, CH-1005 Lausanne, Switzerland. E-mail:
azel.zine{at}iphysiol.unil.ch.
S. Therianos's present address: Center on Aging and Developmental
Biology, University of Rochester Medical Center, Rochester, NY 14642.
 |
REFERENCES |
-
Adam J,
Myat A,
Le Roux I,
Eddison M,
Henrique D,
Ish-Horowicz D,
Lewis J
(1998)
Cell fate choices and the expression of Notch, Delta and Serrate homologues in the chick inner ear: parallels with Drosophila sense-organ development.
Development
125:4645-4654[Abstract].
-
Akazawa C,
Sasai Y,
Nakanishi S,
Kageyama R
(1992)
Molecular characterization of a rat negative regulator with a basic helix-loop-helix structure predominantly expressed in the developing nervous system.
J Biol Chem
267:21879-21885[Abstract/Free Full Text].
-
Akazawa C,
Ishibashi M,
Shimizu C,
Nakanishi S,
Kageyama R
(1995)
A mammalian helix-loop-helix factor structurally related to the products of Drosophila proneural gene atonal is a positive transcriptional regulator expressed in the developing nervous system.
J Biol Chem
270:8730-8738[Abstract/Free Full Text].
-
Anniko M
(1983)
Cytodifferentiation of cochlear hair cells.
Am J Otolaryngol
4:375-388[ISI][Medline].
-
Artavanis-Tsakonas S,
Rand MD,
Lake RJ
(1999)
Notch signaling: cell fate control and signal integration in development.
Science
284:770-776[Abstract/Free Full Text].
-
Bermingham NA,
Hassan BA,
Price SD,
Vollrath MA,
Ben-Arie N,
Eatock RA,
Bellen HJ,
Lysakowski A,
Zoghbi HY
(1999)
Math1: an essential gene for the generation of inner ear hair cells.
Science
284:1837-1841[Abstract/Free Full Text].
-
Cau E,
Gradwhol G,
Casarosa S,
Kageyama R,
Guillemot F
(2000)
Hes genes regulate stages of neurogenesis in the olfactory epithelium.
Development
127:2323-2332[Abstract].
-
Chan Y-M,
Yan YN
(1999)
Conservation of neurogenic genes and mechanisms.
Curr Opin Neurobiol
9:582-588[ISI][Medline].
-
Eddison M,
Le Roux I,
Lewis J
(2000)
Notch signaling in the development of the inner ear: lessons from Drosophila.
Proc Natl Acad Sci USA
97:11692-11699[Abstract/Free Full Text].
-
Fekete DM
(1996)
Cell fate specification in the inner ear.
Curr Opin Neurobiol
6:533-541[ISI][Medline].
-
Fisher A,
Caudy M
(1998)
The function of hairy-related bHLH repressor proteins in cell fate decisions.
BioEssays
20:298-306[ISI][Medline].
-
Haddon C,
Jiang YL,
Smithers L,
Lewis J
(1998)
Delta-Notch signalling and the patterning of sensory cell differentiation in the zebrafish ear: evidence from the mind bomb mutant.
Development
125:4637-4644[Abstract].
-
Hasson T,
Heintzelman MB,
Santos-Sacchi J,
Corey DP,
Mooseker MS
(1995)
Expression in cochlea and retina of myosin VIIa, the gene product defective in Usher syndrome type 1B.
Proc Natl Acad Sci USA
92:9815-9819[Abstract/Free Full Text].
-
Helms AW,
Johnson JE
(1998)
Progenitors of dorsal commissural interneurons are defined by MATH1 expression.
Development
125:919-928[Abstract].
-
Ishibashi M,
Ang SL,
Shiota K,
Nakanishi S,
Kageyama R,
Guillemot F
(1995)
Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (Hes-1) leads to upregulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects.
Genes Dev
9:3136-3148[Abstract/Free Full Text].
-
Jarriault S,
Brou C,
Logeat F,
Schroeter E,
Kopan R,
Israel A
(1995)
Signalling downstream of activated mammalian Notch.
Nature
377:355-358[Medline].
-
Jarriault S,
Le Bail O,
Hirsinger E,
Pourquie O,
Logeat F,
Strong C,
Brou C,
Seidah N,
Israel A
(1998)
Delta-1 activation of Notch-1 signaling results in Hes-1 transactivation.
Mol Cell Biol
18:7423-7431[Abstract/Free Full Text].
-
Jennings B,
Preiss A,
Delidakis C,
Bray S
(1994)
The Notch signaling pathway is required for Enhancer of Split bHLH protein expression during neurogenesis in the Drosophila embryo.
Development
120:3537-3548[Abstract].
-
Kageyama R,
Nakanishi S
(1997)
Helix-loop-helix factors in growth and cell differentiation of the vertebrate nervous system.
Curr Opin Genet Dev
7:659-665[ISI][Medline].
-
Kelley MW,
Xu XM,
Wagner MA,
Warchol ME,
Corwin JT
(1993)
The developing organ of Corti contains retinoic acid and forms supernumerary hair cells in response to exogenous retinoic acid in culture.
Development
119:1041-1053[Abstract].
-
Lanford PJ,
Lan Y,
Jiang R,
Lindsell C,
Weinmaster G,
Gridley T,
Kelley MW
(1999)
Notch signaling pathway mediates hair cell development in mammalian cochlea.
Nat Genet
21:289-292[ISI][Medline].
-
Lee JE
(1997)
Basic helix-loop-helix genes in neural development.
Curr Opin Neurobiol
7:13-20[ISI][Medline].
-
Lim DJ,
Anniko M
(1985)
Developmental morphology of the mouse inner ear. A scanning electron microscopy observation.
Acta Otolaryngol
422:1-69.
-
Lim D,
Rueda J
(1992)
Structural development of the cochlea.
In: Development of auditory and vestibular systems 2 (Romand R,
ed), pp 33-58. New York: Elsevier.
-
Morrison A,
Hodgetts C,
Gossler A,
Hrabé de Angelis M,
Lewis J
(1999)
Expression of Delta1 and Serrate1 (Jagged1) in the mouse inner ear.
Mech Dev
84:169-172[ISI][Medline].
-
Ohtsuka T,
Ishibashi M,
Gradwohl G,
Nakanishi S,
Guillemot F,
Kageyama R
(1999)
Hes1 and Hes5 as Notch effectors in mammalian neuronal differentiation.
EMBO J
18:2196-2207[ISI][Medline].
-
Ruben RJ
(1967)
Development of the inner ear of the mouse: a radioautographic study of terminal mitosis.
Acta Otolaryngol
220:1-44.
-
Sasai Y,
Kageyama R,
Tagawa Y,
Shigemoto R,
Nakanishi S
(1992)
Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and Enhancer of split.
Genes Dev
6:2620-2634[Abstract/Free Full Text].
-
Schaeren-Wiemers N,
Gerfin-Moser A
(1993)
A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes.
Histochemistry
100:431-440[ISI][Medline].
-
Shailam R,
Lanford PJ,
Dolinsky CM,
Norton C,
Gridley T,
Kelley MW
(1999)
Expression of proneural and neurogenic genes in the embryonic mammalian vestibular system.
J Neurocytol
28:809-819[ISI][Medline].
-
Takebayashi K,
Sasai Y,
Sasai K,
Watanabe T,
Nakanishi S,
Kageyama R
(1994)
Structure, chromosomal locus, and promoter analysis of the gene encoding the mouse helix-loop-helix factor HES1: negative autoregulation through the multiple N box elements.
J Biol Chem
269:5150-5156[Abstract/Free Full Text].
-
Tomita K,
Ishibashi M,
Nakahara K,
Ang SL,
Guillemot F,
Kageyama R
(1996)
Mammalian hairy and Enhancer of split homolog 1 regulates differentiation of retinal neurons and is essential for eye morphogenesis.
Neuron
16:723-734[ISI][Medline].
-
Torres M,
Giraldez F
(1998)
The development of the vertebrate inner ear.
Mech Dev
71:5-21[ISI][Medline].
-
Van de Water TR
(1983)
Embryogenesis of the inner ear: in vitro studies.
In: Development of auditory and vestibular systems (Romand R,
ed), pp 337-374. New York: Elsevier.
-
Zhang N,
Martin GV,
Kelley MW,
Gridley T
(2000)
A mutation in the Lunatic fringe suppresses the effects of a Jagged2 mutation on inner hair cell development in the cochlea.
Curr Biol
10:659-662[ISI][Medline].
-
Zheng JL,
Gao WQ
(2000)
Overexpression of Math1 induces robust production of extra hair cells in postnatal rat inner ears.
Nat Neuroci
3:580-586.
-
Zheng JL,
Shou J,
Guillemot F,
Kageyama F,
Gao WQ
(2000)
Hes1 is a negative regulator of inner ear hair cell differentiation.
Development
127:4551-4560[Abstract].
-
Zine A,
de Ribaupierre F
(1999)
Tissue specific levels and cellular distribution of epidermal growth factor receptors within control and neomycin-damaged neonatal rat organ of Corti.
J Neurobiol
38:313-322[Medline].
-
Zine A,
Van de Water TR,
de Ribaupierre F
(2000a)
Notch signaling regulates the pattern of auditory hair cell differentiation in mammals.
Development
127:3373-3383[Abstract].
-
Zine A,
Nyffeler M,
de Ribaupierre F
(2000b)
Spatial expression patterns of epidermal growth factor receptor gene transcripts in the postnatal mammalian cochlea.
Hear Res
141:19-27[Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21134712-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
E. Y. Ma, E. W Rubel, and D. W. Raible
Notch Signaling Regulates the Extent of Hair Cell Regeneration in the Zebrafish Lateral Line
J. Neurosci.,
February 27, 2008;
28(9):
2261 - 2273.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Sajan, M. E. Warchol, and M. Lovett
Toward a Systems Biology of Mouse Inner Ear Organogenesis: Gene Expression Pathways, Patterns and Network Analysis
Genetics,
September 1, 2007;
177(1):
631 - 653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fischer and M. Gessler
Delta Notch and then? Protein interactions and proposed modes of repression by Hes and Hey bHLH factors
Nucleic Acids Res.,
July 14, 2007;
35(14):
4583 - 4596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. McDermott Jr., J. M. Baucom, and A. J. Hudspeth
Analysis and functional evaluation of the hair-cell transcriptome
PNAS,
July 10, 2007;
104(28):
11820 - 11825.
| |