 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2001, 21(14):5017-5026
Cyclin-Dependent Kinases and P53 Pathways Are Activated
Independently and Mediate Bax Activation in Neurons after DNA
Damage
Erick J.
Morris1,
Elizabeth
Keramaris2,
Hardy
J.
Rideout3,
Ruth S.
Slack2,
Nicholas J.
Dyson1,
Leonidas
Stefanis3, and
David S.
Park2
1 Massachusetts General Hospital Cancer Center,
Laboratory of Molecular Oncology, Charlestown, Massachusetts 02129, 2 Neuroscience Research Institute, University of Ottawa,
Ottawa, Ontario K1H 8M5, Canada, and 3 Columbia University,
New York, New York 10032
 |
ABSTRACT |
DNA damage has been implicated as one important initiator of cell
death in neuropathological conditions such as stroke. Accordingly, it
is important to understand the signaling processes that control neuronal death induced by this stimulus. Previous evidence has shown
that the death of embryonic cortical neurons treated with the
DNA-damaging agent camptothecin is dependent on the tumor suppressor
p53 and cyclin-dependent kinase (CDK) activity and that the inhibition
of either pathway alone leads to enhanced and prolonged survival. We
presently show that p53 and CDKs are activated independently on
parallel pathways. An increase in p53 protein levels, nuclear
localization, and DNA binding that result from DNA damage are not
affected by the inhibition of CDK activity. Conversely, no decrease in
retinoblastoma protein (pRb) phosphorylation was observed in
p53-deficient neurons that were treated with camptothecin. However,
either p53 deficiency or the inhibition of CDK activity alone inhibited
Bax translocation, cytochrome c release, and
caspase-3-like activation. Taken together, our results indicate that
p53 and CDK are activated independently and then act in concert to
control Bax-mediated apoptosis.
Key words:
apoptosis; p53; CDK; neuronal; cell cycle; Bax
 |
INTRODUCTION |
Neuronal apoptosis is an important
component of brain ontogeny (Oppenheim, 1991 ) and is important in the
progression of neuropathological conditions such as stroke and
neurodegenerative disease (Stefanis et al., 1997 ; Cotman, 1998 ; Dirnagl
et al., 1999 ). Previous work by ourselves and others demonstrated that
DNA damage activates the apoptotic process in neurons. For example,
irradiation (Enokido et al., 1996b ), cytosine arabinoside (AraC;
Winkelman and Hines, 1983 ; Wallace and Johnson, 1989 ; Martin et al.,
1990 ; Tomkins et al., 1994 ; Park et al., 1998b ), cisplatin (Gill and
Windebank, 1998 ), topoisomerase-II inhibitors (Nakajima et al., 1994 ;
Tomkins et al., 1994 ), and the topoisomerase-I inhibitor camptothecin (Morris and Geller, 1996 ; Park et al., 1997b , 1998a , 2000 ) all induce
apoptotic neuronal cell death. A number of these agents cause
peripheral neuropathies and neurodegeneration (Winkelman and Hines,
1983 ; Baker et al., 1991 ; Vogel and Horoupian, 1993 ; Mansfield and
Castillo, 1994 ). DNA damage also may participate in initiating
cell death in neuropathological conditions such as stroke (Chen et al.,
1997 ). Given these observations, it has become increasingly important
to understand the downstream signaling events that control DNA
damage-evoked neuronal cell death.
Several molecular events that mediate death in some neuronal apoptosis
paradigms have been described. For example, it has been suggested
previously that proteins that normally function to control cell cycle
progression in actively dividing cells may play required roles in the
death of terminally differentiated postmitotic neurons (Farinelli and
Greene, 1996 ; Park et al., 1996 , 1997a ,b , 1998a , 2000 ; Gill and
Windebank, 1998 ). In support of this, changes have been reported in
levels of cyclin-dependent kinases (CDKs) as well as changes of their
activating cyclin partners during trophic factor deprivation (Gao and
Zelenka, 1995 ), cisplatin-induced injury (Gill and Windebank, 1998 ),
stroke (Timsit et al., 1999 ; Osuga et al., 2000 ), and in brains of
Alzheimer's disease patients (McShea et al., 1997 ; Vincent et al.,
1997 ; Busser et al., 1998 ). Specific to DNA damage, CDK inhibition, by
both pharmacological and molecular means, prevents the death of
sympathetic and/or cortical neurons evoked by UV irradiation, AraC,
and/or camptothecin (Park et al., 1997b , 1998a ,b , 2000 ). Furthermore,
studies that use camptothecin have demonstrated an increase in cyclin
D1-associated kinase activity and protection by the expression of
dominant-negative CDK4/6 (Park et al., 1998a ). These studies indicate
that CDK4/6 activity plays a required role in DNA damage-evoked
neuronal apoptosis.
At least three other molecular events have been suggested to be
required for the neuronal death that follows DNA damage. These include
the tumor suppressor p53 (Enokido et al., 1996a ; Xiang et al., 1998 ;
Giovanni et al., 2000 ), the proapoptotic Bcl2-related Bax (Xiang et
al., 1998 ; Keramaris et al., 2000 ), and the various death effector
protease enzymes, caspases (Stefanis et al., 1999 ; Keramaris et al.,
2000 ). The obligate nature of p53 in some neuronal death paradigms is
evidenced by significant neuroprotection in p53-deficient neurons
exposed to excitotoxic injury (Xiang et al., 1996 ), ischemia (Crumrine
et al., 1994 ), and DNA damage (Johnson et al., 1999 ; Giovanni et al.,
2000 ). Similarly, multiple groups reported that Bax-deficient neurons
are resistant to death that is evoked by apoptotic initiators,
including trophic factor deprivation (Deckwerth et al., 1998 ) and DNA
damage (Xiang et al., 1998 ). Finally, the inhibition of caspases also
has been shown to inhibit apoptotic neuronal death that is evoked by
numerous different apoptotic initiators, including DNA damage (Stefanis
et al., 1999 ; Keramaris et al., 2000 ).
Although the individual components that play an obligate role in the
neuronal death that is induced by DNA damage are being delineated, the
biochemical relationship between these molecular signaling events is
less clear. Accordingly, the present study explores the relationship
among the apoptotic control elements, CDKs, p53, Bax, cytochrome
c, and caspases in camptothecin-induced neuronal death.
 |
MATERIALS AND METHODS |
Materials. Flavopiridol {L86-8275, [( )
cis-5,7-dihydroxy-2-(2-chlorophenyl)- 8[4-(3-hydroxy-1-methyl)-piperidinyl]-4H-benzopyran-4-one]} was a generous gift from Dr. Peter J. Worland (National Cancer Institute, Bethesda, MD). Camptothecin was obtained from Sigma (St.
Louis, MO). Boc-aspartyl (OMe)-fluoromethylketone (BAF) and zVAD-fmk were purchased from Enzyme Systems Products (Dublin, CA).
Knock-out mice. p53 and Bax-deficient (C57BL/6 background)
neurons were obtained from embryos derived from heterozygous pairings. Genotyping of each individual embryo was performed by PCR as follows: (1) p53 was genotyped by using GTATCTGGAAGACAGGCAGAC (O-p53-1) and
TGTACTTGTAGTGGATGGTGG (O-p53-2) primers to detect the wild-type allele
(450 bp) and TATACTCAGAGCCGGCCT (O-p53-X7) and TTCCTCGTGCTTTACGGTATC (O-neo-2) primers to detect the targeted allele (533 bp). PCR conditions included 94°C for 5 min (1 cycle), 94°C for 1 min, 55°C for 1 min, 72°C for 1 min (30 cycles), and 72°C for 10 min. (2) Bax was genotyped by using GTTGACCAGAGTGGCGTAGG (BaxIN5R), CCGCTTCCATTGCTCAGCGG (NEOR), and GAGCTGATCAGAACCATCATG (BaxEX5F) primers. BaxIN5R and BaxEX5F primers were used to amplify a 304 bp
fragment from the wild-type Bax allele. BaxIN5R and NEOR were used to
amplify a 504 bp fragment from the targeted Bax allele. PCR conditions
included 94°C for 5 min (1 cycle), 94°C for 1 min, 62°C for 1 min, 72°C for 1.5 min (30 cycles), and 72°C for 7 min.
Culture and survival of cortical neurons. Mouse cortical
neurons were cultured from embryonic day 15 (E15) mice (CD1, Charles River, Wilmington, MA; or p53 or Bax heterozygous breedings) as described previously (Giovanni et al., 2000 ). For the knock-out studies
each individual embryo was dissected and plated individually. The
neurons were plated into 24-well dishes (~200,000 cells/well) or
6-well dishes (1-3 million cells/well) coated with
poly-D-lysine (100 µg/ml) in serum-free medium [N2/DMEM
(1:1) supplemented with 6 mg/ml D-glucose, 100 µg/ml
transferrin, 25 µg/ml insulin, 20 nM progesterone, 60 µM putrescine, 30 nM selenium]. At 1-2 d
after initial plating the medium was exchanged with serum-free medium supplemented with camptothecin (10 µM), flavopiridol (1 µM), and/or BAF/zVAD (100 µM), as indicated
in this text and figures. At appropriate times of culture under the
conditions described in this text, the cells were lysed and the numbers
of viable cells were evaluated. Briefly, cells were lysed in 200 µl
of cell lysis buffer (0.1× PBS, pH 7.4, containing 0.5% Triton X-100,
2 mM MgCl2, and 0.5 gm/100 ml
cetyldimethylethylammonium bromide), which disrupts cells but leaves
the nuclei intact. Then 10 µl of sample from each culture was loaded
onto a hemacytometer, and the number of healthy intact nuclei was
evaluated by phase microscopy. Nuclei that displayed characteristics of
blebbing, disruption of nuclear membrane, phase-bright apoptotic
bodies, and chromatin margination were excluded. All experimental
points are expressed as a percentage of cells plated on day 0. Alternatively, the cells were collected and analyzed for biochemical
analyses as described below.
Western blot analyses. Cortical neurons were dissociated and
cultured as described above. The neurons were washed twice in PBS and
harvested in SDS-loading buffer. Protein (10 µg) was loaded onto
SDS-polyacrylamide gels and transferred onto nitrocellulose membrane as
described previously. Blots were probed with anti-p53 (PharMingen, San
Diego, CA), anti-Bax (Santa Cruz, Santa Cruz, CA), anti-phospho-pRb
(NEN, Boston, MA), or anti-actin (Sigma) antibodies as indicated.
Caspase activity. Cortical neurons were harvested at the
indicated times for caspase activity. Briefly, the cells were washed two times in PBS and collected in caspase lysis buffer as described previously (Stefanis et al., 1999 ). Then the cells were incubated on
ice for 20 min and sonicated briefly for 3 sec. Next the extract was
centrifuged for 15 min at 12,000 rpm on an Eppendorf tabletop centrifuge. The supernatant was collected and assayed for protein by
Bradford (Bio-Rad, Hercules, CA). In any single experiment an equal
amount of protein (~5 µg of protein) was incubated with DEVDamino-fluoro-coumarin as described previously. An increase in fluorescence was measured with a fluorometer (400 nm excitation, 505 nm emission) as described previously (Stefanis et al., 1996).
p53 electrophoretic mobility shift assay (EMSA). Cortical
neurons (E16) were harvested at the times indicated in a lysis solution containing (in mM) 100 HEPES buffer, 5 MgCl2, 2.5 EDTA, and 0.5 PMSF plus 20% glycerol,
0.5 M KCl, 20 µM sodium orthovanadate, and
0.1% NP40 as described previously (Macleod et al., 1996 ). Cell lysate
(10 µg) was incubated with binding buffer [(in mM) 250 KCl, 100 HEPES, and 5 DTT plus 0.5% Triton X-100, 5 mg/ml BSA, 50%
glycerol (Macleod et al., 1996 )] containing 0.1 µg/µl sonicated
herring sperm, 1 µl of anti-p53 antibody (AB-1; Oncogene Research
Products, San Diego, CA), and
32P-radiolabeled p53 double-stranded probe
(CCTGCCTTGCCTGGACTTGC; 60,000 cpm). p53 probes were prepared by
annealing single-strand oligonucleotides (each 1 µg/µl) in 50 mM final NaCl at 95°C for 5 min. Annealed DNA (50 µl)
was incubated for 30 min in a reaction containing 10× reaction buffer,
25 mM dNTP (C, T, G only),
32P-dATP (Amersham, Arlington Heights,
IL), and Klenow. The reaction was purified through a Sephadex G-25 spin
column, and radioactivity levels were evaluated. A 100-fold excess (100 µg/µl) of unlabeled p53 oligonucleotide was used as one control for
binding specificity. Each sample was resolved on a 5% polyacrylamide
gel and visualized by autoradiography.
Immunofluorescence. Cortical neurons were dissociated and
cultured, as described above. After various times of camptothecin treatment, the neurons were fixed with 3.7% paraformaldehyde for 30 min at 4°C. The cells were washed with PBS and incubated in PBS
containing 10% serum and 0.4% Triton X-100. Then the neurons were
incubated with rabbit anti-p53 (1:20; Santa Cruz SC-6243) or anti-Bax
(1:500; Santa Cruz P19; Trevigen YTH6A7) antibodies in PBS containing
2% normal goat serum (NGS) and 0.4% Triton X-100 for 1 hr. After
washing, rhodamine-linked (1:100; Molecular Probes, Eugene, OR) or
CY-3-linked (1:300 Jackson Laboratories, Bar Harbor, ME) secondary
antibody was added in PBS containing 2% NGS and 0.4% Triton X-100 for
20 min. Hoechst dye 33342 (Sigma) or Yo-Yo (1:1500; Molecular Probes)
then was added to stain the nuclei. Cells were visualized under
fluorescent/confocal microscopy. For Bax staining, similar results were
obtained with both antibodies. The antibodies also were tested in
Bax-deficient neuronal cultures. Although diffuse and sometimes dim
granular staining was observed in Bax-deficient neurons that were
untreated or treated with camptothecin, the bright punctate labeling
observed in camptothecin-treated wild-type cells was not present.
Similar results have been reported previously (Putcha et al., 1999 ) for
Bax staining in sympathetic neurons.
 |
RESULTS |
Death commitment of cortical neurons exposed to DNA damage
We showed previously that the treatment of embryonic cortical
neurons with the DNA topoisomerase-1 inhibitor camptothecin induces
apoptotic death (Morris and Geller, 1996 ; Park et al., 1997b , 1998a ,
2000 ; Keramaris et al., 2000 ). To investigate more closely the
mechanisms of death evoked by this DNA-damaging agent, we first
determined the commitment point for death in this paradigm. Cultured
cortical neurons were pulse treated with camptothecin for various
times, followed by its removal. As shown in Figure 1A, the commitment
point for neuronal death, as defined by the time at which 50% neuronal
death occurs by 24 hr in response to pulse treatment, was ~4 hr. This
indicated that biochemical events before this time point likely control
the irreversible decision to undergo apoptosis. Accordingly, we next
examined the pathway of upstream events that control this commitment
phase.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1.
Determination of the commitment point for neuronal
death by DNA damage and protection by CDK inhibitors. A,
Determination of the commitment point for neuronal death by DNA damage.
Cortical cultures were treated with camptothecin (campto; 10 µM) at 0 hr and removed at the indicated times; neuronal
survival was determined at 24 hr after treatment. B,
Determination of the commitment point for protection by CDK inhibition.
The CDK inhibitor flavopiridol (1 µM) was added to
cortical cultures treated with camptothecin at the indicated times;
neuronal survival was determined at 24 hr after treatment. In each
experiment the viability was assessed by nuclear counts. Each
point is the mean ± SEM of data from three
cultures.
|
|
p53 and cyclin-dependent kinases are activated independently and
before death commitment
As previously reported, neurons that are deficient for p53
(Johnson et al., 1999 ; Giovanni et al., 2000 ) or are treated with the
CDK inhibitor flavopiridol (Park et al., 1997b ) are resistant to DNA
damage-evoked death, indicating that the p53 and CDK signals play a
required role in death in this paradigm. Our present evidence indicates
that these signals are early temporal events that are activated before
death commitment. As determined by Western blot analyses, total
cellular p53 protein levels increase starting ~2-4 hr after
camptothecin exposure (Fig.
2A,B). Importantly, the
ability of p53 to bind consensus p53 DNA sequence as one marker of p53
activity also begins to increase at this time (Fig. 2C). By
EMSA a p53-specific band increases starting ~2 hr after DNA damage
(Fig. 2C). This band could be competed by excess unlabeled oligonucleotide (Fig. 2D). In addition, this p53 band
was not detectable in lysates prepared from camptothecin-treated
p53-deficient neurons. Both controls indicate the p53-specific nature
of this band. p53 binding was not observed in untreated control
neurons.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 2.
Induction of p53 expression and p53-specific DNA
binding activity is not affected by cotreatment with the CDK inhibitor
flavopiridol. Total cell lysates were prepared from wild-type cortical
cultures treated with camptothecin (campto; 10 µM) alone or cotreated with flavopiridol (1 µM) and analyzed for p53 expression by Western blot
analyses (A, B) or DNA binding by EMSA
(C), as indicated in Materials and Methods.
Densitometric analysis from three experiments (mean ± SEM) with
and without flavopiridol cotreatment is shown. D, So
that the specific nature of the EMSA band could be ensured, cell
extracts from wild-type or p53-deficient neurons were untreated or
treated with camptothecin (10 µM) for 8 hr and analyzed
for p53 binding to a labeled p53 oligonucleotide probe by EMSA.
cold comp, The addition of unlabeled probe as a
competitor for radiolabeled probe. The band labeled p53 is the only
band present in the camptothecin-treated wild-type or heterozygous
extracts and is missing in the untreated and p53-deficient
extracts.
|
|
Similar to early p53 induction, activation of CDKs, as determined by
phosphorylation of retinoblastoma protein (pRb) on a CDK4/6
phosphorylation consensus site, occurs 1 hr after camptothecin treatment (Park et al., 2000 ). Consistent with this observation, flavopiridol must be added by 1 hr after the initiation of camptothecin treatment to rescue neurons fully from DNA damage (Fig.
1B).
We next determined whether p53 and CDK were activated along the same
pathway or whether they acted independently. In this regard, we first
examined whether inhibition of the CDK pathway would prevent the
activation of p53. Interestingly, cotreatment with the CDK inhibitor
flavopiridol did not block the increase in total cellular p53 protein
levels after camptothecin treatment (Fig. 2B).
Because CDKs are known to regulate p53 function (Wang and Prives,
1995 ), we performed EMSA to determine the consensus DNA binding
activity of p53 in neurons after DNA damage. However, no effect on DNA
binding activity was observed with flavopiridol cotreatment (Fig.
2C). Finally, to ensure that CDK activity was not affecting
nuclear localization of p53, we examined p53 by immunofluorescence.
Treatment of cortical cultures with camptothecin (5 hr) alone resulted
in a profound increase in p53 staining in the nucleus (Fig.
3). Flavopiridol cotreatment did not
inhibit this nuclear accumulation of p53 (Fig. 3). In these experiments scattered cells with condensed nuclei were present in both control and
experimental wells as a result of background death from the dissection
and plating procedure. These cells were negative for p53 staining.
Taken together, the above data indicate that CDK activity is not
required for the DNA damage-inducible p53 response in neurons.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3.
Nuclear localization of p53 is not inhibited by
the inhibition of CDK. A, Immunofluorescence image of
cultured cortical neurons stained with nuclear dye or anti-p53
antibody. Where indicated, the cultures were treated with camptothecin
(campto; 10 µM) for 5 hr with and without
flavopiridol (1 µm) treatment. B, Quantitation of
neurons with positive nuclear staining for p53. Data are the mean ± SEM from three cultures.
|
|
To test whether p53 may act upstream of and activate the CDK pathway,
we examined whether p53-deficient neurons display decreased CDK
activity in response to camptothecin treatment. To determine this, we
monitored the phosphorylation status of the CDK substrate pRb. We used
a phosphospecific antibody that recognizes
Ser795 in pRb, a specific kinase target of
CDK4/6, to monitor the pRb phosphorylation after camptothecin
treatment. After camptothecin treatment we observed rapid, inducible
pRb phosphorylation in neurons within 1 hr (Fig.
4). We have shown previously that total pRb levels do not change at these times after camptothecin treatment (Park et al., 2000 ). A comparison of neurons cultured from either p53-heterozygous or p53-nullizygous mice demonstrated no significant differences in the levels of phospho-pRb by Western analysis when normalized to actin levels (Fig. 4). Taken together, these data suggest
that CDK activation and p53 induction mechanisms likely occur
independently during the apoptosis of DNA-damaged neurons.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 4.
Phosphorylation of pRb is not inhibited by
p53 deficiency during DNA damage-induced neuronal apoptosis.
A, Western immunoblots (probed with anti-phospho-Rb
Ser795 antibody) of whole-cell lysates of cortical
neurons from p53-heterozygous or p53-nullizygous embryos after
treatment with camptothecin (campto; 10 µM)
for the indicated times. B, Densitometric analyses of
the Western immunoblots. All data points were normalized to actin
expression levels. Data are the mean ± SEM from three experiments
and are expressed relative to the initial amount of
phosphorylated pRb at time 0.
|
|
p53 and CDK-mediated pathways act cooperatively to mediate Bax
activation, consequent cytochrome c release, and caspase
activation
The observations described above indicate that the activation of
p53 and CDKs occurs independently. We next determined whether putative
downstream effectors of p53- or CDK-mediated pathways activate a common
death element. Bax has been shown previously to be required for
cytochrome c release, caspase activation, and apoptotic
death after DNA damage. Accordingly, we examined whether the inhibition
of either the p53 or CDK pathway was sufficient to affect Bax activity.
Previous results in several death paradigms have indicated that
Bax expression can be induced by p53
activity. However, as shown in Figure
5A, total cellular protein
levels of Bax, as measured by Western blot analyses, do not change with
camptothecin treatment. Instead, immunocytochemical analyses indicates
that Bax translocates to mitochondria. As shown in Figure
5B, Bax appears punctate after camptothecin treatment.
Similar results were obtained for two Bax antibodies (see Materials and
Methods). As would be expected if caspases act downstream of Bax, the
general caspase inhibitor zVAD-fmk had no effect on Bax translocation
(Fig. 5C). This punctate appearance is localized
mitochondrially; 45% of neurons (n = 141) from
cultures cotreated with camptothecin and BAF (100 µM) for 12 hr displayed colocalization of
punctate Bax and mitotracker mitochondrial staining (data not shown). A
significant percentage (35%), however, was positive for punctate Bax
expression although negative for mitotracker staining (data not shown),
presumably because of the ongoing death process and loss of membrane
potential as previously reported after camptothecin treatment (Stefanis et al., 1999 ).

View larger version (70K):
[in this window]
[in a new window]
|
Figure 5.
DNA damage-induced Bax translocation is inhibited
by either p53 deficiency or CDK inhibition. A, Bax
protein levels do not change during the death of cortical neurons
evoked by DNA damage. Shown are Western immunoblots of whole-cell
lysates of cortical neurons after various periods of treatment with
camptothecin (campto; 10 µM). Antibody
specificity is demonstrated for Western analysis by using lysates from
Bax-deficient neurons. Control for protein loading is indicated by
actin expression. B, Immunofluorescence micrograph of
Bax translocation in cortical neurons of Bax ( / ), p53 ( /+), or
p53 ( / ) backgrounds. Where indicated, the cultures were treated
with camptothecin (CA; 10 µM; 10 hr) alone
or cotreated with the caspase inhibitor zVAD (100 µM) or
the CDK inhibitor flavopiridol (FL; 1 µM).
Punctate staining is indicative of Bax translocation from the cytosol
and is quantitated in C. Data are the mean ± SEM
from three cultures.
|
|
Interestingly, inhibition of either the CDK or p53 pathway individually
is sufficient to inhibit Bax translocation when compared with untreated
control cultures (Fig. 5C). Total Bax levels in neurons from
p53-deficient and littermate control animals, as measured by Western
blot analyses, were identical (data not shown). Consistent with these
findings, p53-deficient neurons exposed to DNA damage did not show a
loss of punctate immunocytochemical cytochrome c staining
when compared with littermate controls (Fig. 6). Inhibition of cytochrome c
release by flavopiridol has been reported previously (Stefanis et al.,
1999 ). Conversely, p53 protein levels and DNA binding activity were not
impaired in Bax-deficient neurons after camptothecin treatment when
compared with littermate controls (Fig.
7). Consistent with the notion of caspase
activity as a more distal death effector, the induction of p53 protein and DNA binding also is still observed in neurons cotreated with general caspase inhibitors (Fig. 8).
Taken together, these findings indicate that both p53 and CDK pathways
act upstream of and are required to mediate Bax translocation,
consequent cytochrome c release, and caspase activation.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 6.
Cytochrome c (cytC)
release is blocked by p53 deficiency during DNA damage-induced neuronal
apoptosis. Cortical neurons from p53-heterozygous or p53-nullizygous
embryos were cultured and treated with camptothecin (campto;
10 µM) for 12 hr. Quantitation of cytochrome
c release (bottom; as indicated by
punctate-to-diffuse expression in top) is shown. Data
are the mean ± SEM from three cultures. * indicates significance
(p < 0.05, as derived from Student's t
test).
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 7.
Bax deficiency does not inhibit p53 induction or
DNA binding in neurons exposed to DNA damage. Bax-heterozygous or
Bax-nullizygous neurons were treated with camptothecin
(campto; 10 µM) for the indicated times and
analyzed for p53 protein levels by Western blot analyses
(A) and for DNA binding by EMSA
(B). For B, representative
radiographs and densitometric analysis from three experiments
(mean ± SEM) are shown.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 8.
The general caspase inhibitor BAF does not inhibit
p53 induction or DNA binding in neurons exposed to DNA damage. Cortical
neurons were treated with camptothecin (campto; 10 µM) alone or cotreated with BAF (100 µM)
for the indicated times and analyzed for p53 protein levels by Western
blot analyses (A) and DNA binding by EMSA
(B). For B, representative
radiographs and densitometric analysis from three experiments
(mean ± SEM) are shown.
|
|
p53, CDKs, Bax, and delayed death
p53-Deficient neurons are protected from DNA damage almost
completely for 48 hr. However, survival is not complete at later time
points (Fig. 9). Because p53 and CDKs
appear to regulate both Bax translocation and caspase activity after
short periods of camptothecin treatment, we explored the possibility
that death in p53-deficient neurons after prolonged camptothecin
exposure may result from the parallel proximal CDK pathway, with
consequent delayed activation of caspase activity. Control cultures
treated with camptothecin showed robust DEVD-AFC cleavage activity at 24 hr. However, no significant caspase activity was detected in p53-deficient cultures treated with camptothecin, even at 72 hr when
delayed death occurs (Fig. 9B). Unfortunately, flavopiridol in and of itself is variably toxic at 72 hr, making analyses of delayed
death difficult (Fig. 9A; data not shown). Death in these cultures at 72 hr, which may be a combination of delayed death and/or
toxicity, also is not accompanied by caspase-3-like activity (Fig.
9A). Finally, Bax-deficient neurons displayed some death at
72 hr (Fig. 9C). No caspase-3-like activity was detected in Bax-deficient neurons undergoing delayed death. Taken together, these
results suggest that death in the presence of prolonged camptothecin treatment in the absence of p53 is caspase-independent. These results also suggest that the CDK and p53 pathways cooperate to
mediate caspase activity and do not activate the conserved distal death
effector pathway individually.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 9.
Delayed death in flavopiridol-treated,
p53-deficient, or Bax-deficient mice is not accompanied by
caspase-3-like activity. DNA damage-induced caspase activation in
neurons is CDK-, p53-, and Bax-dependent. Cortical neurons were treated
with camptothecin (campto; 10 µM) and assessed
for survival (left column) or DEVD-AFC cleavage activity
(right column). For survival experiments, each
point is the mean ± SEM of data from three
cultures. Cleavage activity in camptothecin-treated wild-type or
p53/Bax littermate cultures was assessed only at 0 and 24 hr because of
low levels of total protein observed at later time points.
A, Wild-type cortical neurons were cotreated with
flavopiridol (1 µM). B, p53-Deficient
neurons or littermate controls. C, Bax-deficient neurons
or littermate controls.
|
|
 |
DISCUSSION |
DNA damage-induced neuronal apoptosis
DNA damage is a potent inducer of neuronal apoptosis.
Although significant insight has been made regarding the requirement of
individual death components after DNA damage, the way in which these
signals are ordered remains less clear. Accordingly, we studied basic
neuronal death signaling evoked by DNA damage, using the prototypical
DNA topoisomerase-I inhibitor camptothecin (a neurotoxic, anticancer
DNA-damaging agent; Morris and Geller, 1996 ). We and others have
identified previously the required roles for various death-signaling
pathways, including p53 (Johnson et al., 1999 ; Giovanni et al., 2000 ),
CDKs (Park et al., 1997b , 1998a , 2000 ), Bax (Xiang et al., 1998 ;
Keramaris et al., 2000 ), and caspases (Stefanis et al., 1999 ; Keramaris
et al., 2000 ) in this paradigm. Presently, we studied the temporal and
biochemical relationship between these signaling pathways.
CDKs and p53: Upstream death regulators are
activated independently
Our previous evidence demonstrated that pharmacological CDK
inhibitors (Park et al., 1997b ) as well as the expression of DN Cdk4/6
(Park et al., 1998a ) inhibit the death of cortical neurons exposed to
camptothecin. In addition, we and others have shown that p53-deficient
neurons are resistant to camptothecin-induced death (Johnson et al.,
1999 ; Giovanni et al., 2000 ). Our present evidence indicates that these
obligate death events are proximal signals that are initiated
independently and temporally before death commitment, which occurs at
~4 hr, as indicated by our camptothecin withdrawal experiment.
By delayed addition of the pharmacological CDK inhibitor flavopiridol
for varying times, we also find that CDKs must be inhibited 2 hr
after the initiation of camptothecin treatment. This time point also
correlates well with the activation of camptothecin-induced, cyclin
D1-associated kinase activity in neurons, an event that begins at 1 hr
and peaks at 4 hr after treatment (Park et al., 1998a ). Moreover, it is
consistent with the CDK-dependent phosphorylation of pRb, which also
occurs at 1 hr (Park et al., 2000 ), and strongly supports a role for
CDK4/6 as a proximal death signal that is activated shortly after DNA damage.
Expression of the p53 tumor suppressor protein after DNA damage results
in the transcriptional regulation of various genes for which the
activity coordinates G1 arrest, DNA repair, and apoptosis (Jacks and Weinberg, 1996 ). Induction of cellular levels of
p53 protein as well as DNA binding activity increases at ~2 hr, a
time point before death commitment. The observation that Bax deficiency
or caspase inhibition had no effect on p53 activity also implicates p53
as a more proximal death effector.
The manner in which CDK and p53 are related biochemically is unclear.
Numerous interactions between the CDK pathway and p53 have been
described. In proliferating systems CDKs can regulate p53 activity by
several mechanisms. p53 can be a direct downstream kinase substrate for
CDKs, including cdc2/cyclin B and CDK2-cyclin A (Wang and Prives,
1995 ). In addition, p53 is regulated indirectly downstream of CDK4/6
via phosphorylation of pRb, consequent induction of p19ARF, and
stabilization of p53 (Bates et al., 1998 ). However, our data indicate
that CDK inhibition has no effect on p53 levels, DNA binding, or
nuclear localization. This indicates that direct regulation of p53 by
CDKs does not occur in neurons after DNA damage. In addition, it
appears unlikely that the pRB/E2F/p19ARF pathway regulates the p53
signal in this death paradigm.
Conversely, support for p53 as an upstream regulator of CDKs comes from
observations that p53 is a transcriptional activator of the CDK
inhibitor p21WAF1/CIP1 (Dulic et
al., 1994 ). However, in this case, p21 would inhibit CDK
activity, and our data indicate that CDKs are activated after DNA
damage. Moreover, our present data indicate that p53 deficiency has no
effect on pRb phosphorylation. Finally, we have shown previously that
p21 is not upregulated after camptothecin treatment (Park et al.,
2000 ). Taken together, this evidence indicates that p53 and CDKs are
activated independently and do not modulate their respective activities
directly. However, we cannot rule out the possibility that other p53
members such as p73 (Pozniak et al., 2000 ; Stiewe and Putzer, 2000 ) may
act upstream or downstream of CDKs.
CDKs and p53 cooperate to mediate Bax activation, cytochrome
c release, and caspase activation
The above results led us to examine whether p53 and CDKs activate
completely separate pathways of death or whether they interact at a
more distal point in the death program. We and others have shown that
Bax activation is required for apoptotic death after DNA damage (Xiang
et al., 1998 ; Keramaris et al., 2000 ). We presently show that this
activation does not occur via the increase in Bax levels but by
translocation to mitochondrial-like compartments. Interestingly,
inhibition of either the p53 or CDK pathway alone is sufficient to
block Bax activation. These results suggest functional cooperativity
between p53- and CDK-mediated events in promoting Bax translocation.
Consistent with this observation, p53 deficiency or CDK inhibition
alone also inhibits cytochrome c release from the
mitochondria and caspase activation.
The manner by which CDKs and p53 or its downstream effectors may
cooperate to mediate Bax activity is unclear. We have shown that the
activation of Cdk4/6 leads to pRb phosphorylation/inactivation after
DNA damage and that expression of a mutant of pRb with multiple phosphorylation sites removed, including the CDK site, leads to neuroprotection from DNA damage (Park et al., 2000 ). One consequence of
deregulated pRb activity may be the inappropriate activation of E2F
members, the best-characterized target of pRb regulation. Indeed, E2Fs
can induce death in both proliferating cell types (Qin et al., 1994 ;
Hiebert et al., 1995 ) and neurons (Hou et al., 2000 ; O'Hare et al.,
2000 ) when overexpressed; expression of DN DP-1, an obligate binding
partner to E2F family members (Wu et al., 1996 ), is also protective in
multiple neuronal death paradigms, including DNA damage (Giovanni et
al., 1999 ; Park et al., 2000 ). Finally, E2F-1 deficiency can protect
against numerous neuronal apoptotic initiators, including -amyloid
toxicity (Giovanni et al., 2000 ), low K+
(O'Hare et al., 2000 ), stroke (MacManus et al., 1999 ), and
staurosporine (Hou et al., 2000 ).
E2F members, however, are not the only factors that are regulated by
pRb. At present, the list of pRb-interacting factors numbers >110
(Morris and Dyson, 2001 ). At least two pRb-interacting factors, nuclear
factor- B (NF B; Tamami et al., 1996 ) and c-Jun kinase (JNK;
Chauhan et al., 1999 ; Shim et al., 2000 ), have been described that also
are modulated by p53. Interestingly, Vousden and colleagues (Ryan et
al., 2000 ) reported that p53-mediated death requires NF B activity.
This is significant in light of the evidence that pRb also can repress
NF B transcriptional activity (Tamami et al., 1996 ), suggesting one
connection between p53 and CDKs. In addition, JNK activity, a mediator
of neuronal death in numerous circumstances (Xia et al., 1995 ; Yang et
al., 1997 ; Eilers et al., 1998 ; Watson et al., 1998 ), is inhibited by
pRb binding (Shim et al., 2000 ). p53 also can bind to (Buschmann et al., 2000 ) and mediate the activation of JNK (Mazzoni et al., 1999 ),
suggesting an additional link between the CDK and p53 pathways.
It must be noted that the parallel/cooperative interaction between the
p53 and CDK pathway is context-specific. For example, CDKs also mediate
the activation of caspases in models of -amyloid toxicity (Giovanni
et al., 2000 ) and K+ deprivation, which do
not appear to be p53-dependent (M. O'Hare, D. S. Park,
unpublished results). Whether proximal death signals other than p53
cooperate with the CDK pathway in these instances remains to be determined.
Delayed death evoked by DNA damage is not dependent on the core
conserved death program
Our present data indicate that, whereas p53 deficiency results in
nearly full protection for 48 hr after camptothecin exposure, death
occurs slowly thereafter. Similar death is observed in Bax-deficient neurons, and the activation of caspases does not accompany this delayed
death. This evidence indicates that delayed death does not involve the
core conserved apoptotic pathway. We have reported previously that
caspase inhibition also results in delayed death, which is terminal
deoxynucleotidyl transferase-mediated biotinylated UTP nick end
labeling-negative (TUNEL-negative; Stefanis et al., 1999 ), suggesting a
nonclassical apoptotic pathway of delayed death. Importantly, the
observed absence of caspase activity during delayed death reinforces
the cooperative nature of the downstream effectors of p53- and
CDK-mediated pathways. In this regard, activation of the CDK pathway in
the absence of p53 does not activate caspases, even during the delayed
death process, suggesting that both pathways must be active for caspase
activation to occur.
In conclusion, select signal transduction pathways that occur in
cortical neurons in response to DNA damage can be ordered into a
simplified model, as represented in Figure
10. DNA damage induces immediate early
responses that activate at least two distinct signaling pathways
involving (1) p53 induction and (2) CDK activation. We hypothesize
that, whereas these two pathways are activated in a parallel manner,
their downstream effectors cooperate to mediate the distal core death
program (Bax translocation, cytochrome c release, and
caspase activity). Because numerous other death/survival signals also
are known to modulate neuronal apoptosis, it will be important to
explore their requirements for death and place them temporally and
biochemically in this growing signaling picture.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 10.
Proposed model for role of CDK, pRb, p53, Bax,
and caspases in the death of cortical neurons evoked by DNA damage (see
Discussion for summary).
|
|
 |
FOOTNOTES |
Received Dec. 7, 2000; revised April 18, 2001; accepted April 24, 2001.
This work was supported by the Heart and Stroke Foundation of Canada
and the Medical Research Council of Canada (D.S.P.). D.S.P. is the
recipient of a Glaxo- Wellcome Award in Stroke. L.S. is the recipient
of a Burroughs Wellcome Award in Biomedical Sciences.
E.J.M. and E.K. contributed equally to this manuscript.
Correspondence should be addressed to Dr. David S. Park at the above
address. E-mail: dpark{at}uottawa.ca.
 |
REFERENCES |
-
Baker WJ,
Royer Jr GL,
Weiss RB
(1991)
Cytarabine and neurologic toxicity [see comments].
J Clin Oncol
9:679-693[Abstract].
-
Bates S,
Phillips AC,
Clark PA,
Stott F,
Peters G,
Ludwig RL,
Vousden KH
(1998)
p14arf links the tumour suppressors Rb and p53 [letter].
Nature
395:124-125[Medline].
-
Buschmann T,
Adler V,
Matusevich E,
Fuchs SY,
Ronai Z
(2000)
p53 phosphorylation, association with murine double minute 2, c-Jun NH2-terminal kinase, p14ARF, p300/CBP during the cell cycle and after exposure to ultraviolet irradiation.
Cancer Res
60:896-900[Abstract/Free Full Text].
-
Busser J,
Geldmacher DS,
Herrup K
(1998)
Ectopic cell cycle proteins predict the sites of neuronal cell death in Alzheimer's disease brain.
J Neurosci
18:2801-2807[Abstract/Free Full Text].
-
Chauhan D,
Hideshima T,
Treon S,
Teoh G,
Raje N,
Yoshihimito S,
Tai YT,
Li W,
Fan J,
DeCaprio J,
Anderson KC
(1999)
Functional interaction between retinoblastoma protein and stress-activated protein kinase in multiple myeloma cells.
Cancer Res
59:1192-1195[Abstract/Free Full Text].
-
Chen J,
Jin K,
Chen M,
Pei W,
Kawaguchi K,
Greenberg DA,
Simon RP
(1997)
Early detection of DNA strand breaks in the brain after transient focal ischemia: implications for the role of DNA damage in apoptosis and neuronal cell death.
J Neurochem
69:232-245[ISI][Medline].
-
Cotman CW
(1998)
Apoptosis decision cascades and neuronal degeneration in Alzheimer's disease.
Neurobiol Aging
19:S29-S32[ISI][Medline].
-
Crumrine RC,
Thomas AL,
Morgan PF
(1994)
Attenuation of p53 expression protects against focal ischemic damage in transgenic mice.
J Cereb Blood Flow Metab
14:887-891[ISI][Medline].
-
Deckwerth TL,
Easton RM,
Knudson CM,
Korsmeyer SJ,
Johnson Jr EM
(1998)
Placement of the BCL2 family member BAX in the death pathway of sympathetic neurons activated by trophic factor deprivation.
Exp Neurol
152:150-162[ISI][Medline].
-
Dirnagl U,
Iadecola C,
Moskowitz MA
(1999)
Pathobiology of ischaemic stroke: an integrated view.
Trends Neurosci
22:391-397[ISI][Medline].
-
Dulic V,
Kaufmann WK,
Wilson SJ,
Tlsty TD,
Lees E,
Harper JW,
Elledge SJ,
Reed SI
(1994)
p53-Dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest.
Cell
76:1013-1023[ISI][Medline].
-
Eilers A,
Whitfield J,
Babij C,
Rubin LL,
Ham J
(1998)
Role of the Jun kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons.
J Neurosci
18:1713-1724[Abstract/Free Full Text].
-
Enokido Y,
Araki T,
Aizawa S,
Hatanaka H
(1996a)
p53 involves cytosine arabinoside-induced apoptosis in cultured cerebellar granule neurons.
Neurosci Lett
203:1-4[ISI][Medline].
-
Enokido Y,
Araki T,
Tanaka K,
Aizawa S,
Hatanaka H
(1996b)
Involvement of p53 in DNA strand break-induced apoptosis in postmitotic CNS neurons.
Eur J Neurosci
8:1812-1821[ISI][Medline].
-
Farinelli SE,
Greene LA
(1996)
Cell cycle blockers mimosine, ciclopirox, and deferoxamine prevent the death of PC12 cells and postmitotic sympathetic neurons after removal of trophic support.
J Neurosci
16:1150-1162[Abstract/Free Full Text].
-
Gao CY,
Zelenka PS
(1995)
Induction of cyclin B and H1 kinase activity in apoptotic PC12 cells.
Exp Cell Res
219:612-618[ISI][Medline].
-
Gill JS,
Windebank AJ
(1998)
Cisplatin-induced apoptosis in rat dorsal root ganglion neurons is associated with attempted entry into the cell cycle.
J Clin Invest
101:2842-2850[ISI][Medline].
-
Giovanni A,
Wirtz-Brugger F,
Keramaris E,
Slack R,
Park DS
(1999)
Involvement of cell cycle elements, cyclin-dependent kinases, pRb, and E2F/DP, in
-amyloid-induced neuronal death.
J Biol Chem
274:19011-19016[Abstract/Free Full Text]. -
Giovanni A,
Keramaris E,
Morris EJ,
Hou ST,
O'Hare M,
Dyson N,
Robertson GS,
Slack R,
Park DS
(2000)
E2F-1 mediates death of
-amyloid-treated cortical neurons in a manner independent of p53 and dependent on Bax and caspase-3.
J Biol Chem
275:11553-11560[Abstract/Free Full Text]. -
Hiebert SW,
Packham G,
Strom DK,
Haffner R,
Oren M,
Zambetti G,
Cleveland JL
(1995)
E2F-1 × DP-1 induces p53 and overrides survival factors to trigger apoptosis.
Mol Cell Biol
15:6864-6874[Abstract].
-
Hou ST,
Callaghan D,
Fournier MC,
Hill I,
Kang L,
Massie B,
Morley P,
Murray C,
Rasquinha I,
Slack R,
MacManus JP
(2000)
The transcription factor E2F-1 modulates apoptosis of neurons.
J Neurochem
75:91-100[ISI][Medline].
-
Jacks T,
Weinberg RA
(1996)
Cell-cycle control and its watchman [comment].
Nature
381:643-644[Medline].
-
Johnson MD,
Kinoshita Y,
Xiang H,
Ghatan S,
Morrison RS
(1999)
Contribution of p53-dependent caspase activation to neuronal cell death declines with neuronal maturation.
J Neurosci
19:2996-3006[Abstract/Free Full Text].
-
Keramaris E,
Stefanis L,
Maclaurin J,
Harada N,
Takaku K,
Ishikawa T,
Taketo MM,
Robertson GS,
Nicholson DW,
Slack RS,
Park DS
(2000)
Involvement of caspase-3 in apoptotic death of cortical neurons evoked by DNA damage.
Mol Cell Neurosci
15:368-379[ISI][Medline].
-
Macleod KF,
Hu Y,
Jacks T
(1996)
Loss of Rb activates both p53-dependent and independent cell death pathways in the developing mouse nervous system.
EMBO J
15:6178-6188[ISI][Medline].
-
MacManus JP,
Koch CJ,
Jian M,
Walker T,
Zurakowski B
(1999)
Decreased brain infarct following focal ischemia in mice lacking the transcription factor E2F-1.
NeuroReport
10:2711-2714[Medline].
-
Mansfield SH,
Castillo M
(1994)
MR of cis-platinum-induced optic neuritis.
AJNR Am J Neuroradiol
15:1178-1180[Abstract].
-
Martin DP,
Wallace TL,
Johnson Jr EM
(1990)
Cytosine arabinoside kills postmitotic neurons in a fashion resembling trophic factor deprivation: evidence that a deoxycytidine-dependent process may be required for nerve growth factor signal transduction.
J Neurosci
10:184-193[Abstract].
-
Mazzoni IE,
Said FA,
Aloyz R,
Miller FD,
Kaplan D
(1999)
Ras regulates sympathetic neuron survival by suppressing the p53-mediated cell death pathway.
J Neurosci
19:9716-9727[Abstract/Free Full Text].
-
McShea A,
Harris PL,
Webster KR,
Wahl AF,
Smith MA
(1997)
Abnormal expression of the cell cycle regulators P16 and CDK4 in Alzheimer's disease.
Am J Pathol
150:1933-1939[Abstract].
-
Morris EJ, Dyson NJ (2001) Retinoblastoma protein partners.
Adv Cancer Res, in press.
-
Morris EJ,
Geller HM
(1996)
Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity.
J Cell Biol
134:757-770[Abstract/Free Full Text].
-
Nakajima M,
Kashiwagi K,
Ohta J,
Furukawa S,
Hayashi K,
Kawashima T,
Hayashi Y
(1994)
Etoposide induces programmed death in neurons cultured from the fetal rat central nervous system.
Brain Res
641:350-352[ISI][Medline].
-
O'Hare MJ,
Hou ST,
Morris EJ,
Cregan SP,
Xu Q,
Slack RS,
Park DS
(2000)
Induction and modulation of cerebellar granule neuron death by E2F-1.
J Biol Chem
275:25358-25364[Abstract/Free Full Text].
-
Oppenheim RW
(1991)
Cell death during development of the nervous system.
Annu Rev Neurosci
14:453-501[ISI][Medline].
-
Osuga H,
Osuga S,
Wang F,
Fetni R,
Hogan MJ,
Slack RS,
Hakim AM,
Ikeda J,
Park DS
(2000)
Cyclin-dependent kinases as a therapeutic target for stroke.
Proc Natl Acad Sci USA
97:10254-10259[Abstract/Free Full Text].
-
Park DS,
Farinelli SE,
Greene LA
(1996)
Inhibitors of cyclin-dependent kinases promote survival of postmitotic neuronally differentiated PC12 cells and sympathetic neurons.
J Biol Chem
271:8161-8169[Abstract/Free Full Text].
-
Park DS,
Levine B,
Ferrari G,
Greene LA
(1997a)
Cyclin-dependent kinase inhibitors and dominant negative cyclin-dependent kinase 4 and 6 promote survival of NGF-deprived sympathetic neurons.
J Neurosci
17:8975-8983[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Greene LA,
Geller HM
(1997b)
G1/S cell cycle blockers and inhibitors of cyclin-dependent kinases suppress camptothecin-induced neuronal apoptosis.
J Neurosci
17:1256-1270[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Padmanabhan J,
Shelanski ML,
Geller HM,
Greene LA
(1998a)
Cyclin-dependent kinases participate in death of neurons evoked by DNA-damaging agents.
J Cell Biol
143:457-467[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Stefanis L,
Troy CM,
Shelanski ML,
Geller HM,
Greene LA
(1998b)
Multiple pathways of neuronal death induced by DNA-damaging agents, NGF deprivation, and oxidative stress.
J Neurosci
18:830-840[Abstract/Free Full Text].
-
Park DS,
Morris EJ,
Bremner R,
Keramaris E,
Padmanabhan J,
Rosenbaum M,
Shelanski ML,
Geller HM,
Greene LA
(2000)
Involvement of retinoblastoma family members and E2F/DP complexes in the death of neurons evoked by DNA damage.
J Neurosci
20:3104-3114[Abstract/Free Full Text].
-
Pozniak CD,
Radinovic S,
Yang A,
McKeon F,
Kaplan DR,
Miller FD
(2000)
An anti-apoptotic role for the p53 family member, p73, during developmental neuron death.
Science
289:304-306[Abstract/Free Full Text].
-
Putcha GV,
Deshmukh M,
Johnson Jr EM
(1999)
BAX translocation is a critical event in neuronal apoptosis: regulation by neuroprotectants, BCL-2, and caspases.
J Neurosci
19:7476-7485[Abstract/Free Full Text].
-
Qin XQ,
Livingston DM,
Kaelin Jr WG,
Adams PD
(1994)
Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53-mediated apoptosis.
Proc Natl Acad Sci USA
91:10918-10922[Abstract/Free Full Text].
-
Ryan KM,
Ernst MK,
Rice NR,
Vousden KH
(2000)
Role of NF-
B in p53-mediated programmed cell death.
Nature
404:892-897[Medline]. -
Shim J,
Park HS,
Kim MJ,
Park J,
Park E,
Cho SG,
Eom SJ,
Lee HW,
Joe CO,
Choi EJ
(2000)
Rb protein down-regulates the stress-activated signals through inhibiting c-Jun N-terminal kinase/stress-activated protein kinase.
J Biol Chem
275:14107-14111[Abstract/Free Full Text].
-
Stefanis L,
Burke RE,
Greene LA
(1997)
Apoptosis in neurodegenerative disorders.
Curr Opin Neurol
10:299-305[ISI][Medline].
-
Stefanis L,
Park DS,
Friedman WJ,
Greene LA
(1999)
Caspase-dependent and -independent death of camptothecin-treated embryonic cortical neurons.
J Neurosci
19:6235-6247[Abstract/Free Full Text].
-
Stiewe T,
Putzer BM
(2000)
Role of the p53-homologue p73 in E2F-1-induced apoptosis.
Nat Genet
26:464-469[ISI][Medline].
-
Tamami M,
Lindholm PF,
Brady JN
(1996)
The retinoblastoma gene product (Rb) induces binding of a conformationally inactive nuclear factor-
B.
J Biol Chem
271:24551-24556[Abstract/Free Full Text]. -
Timsit S,
Rivera S,
Ouaghi P,
Guischard F,
Tremblay E,
Ben-Ari Y,
Khrestchatisky M
(1999)
Increased cyclin D1 in vulnerable neurons in the hippocampus after ischaemia and epilepsy: a modulator of in vivo programmed cell death?
Eur J Neurosci
11:263-278[ISI][Medline].
-
Tomkins CE,
Edwards SN,
Tolkovsky AM
(1994)
Apoptosis is induced in postmitotic rat sympathetic neurons by arabinosides and topoisomerase II inhibitors in the presence of NGF.
J Cell Sci
107:1499-1507[Abstract].
-
Vincent I,
Jicha G,
Rosado M,
Dickson DW
(1997)
Aberrant expression of mitotic cdc2/cyclin B1 kinase in degenerating neurons of Alzheimer's disease brain.
J Neurosci
17:3588-3598[Abstract/Free Full Text].
-
Vogel H,
Horoupian DS
(1993)
Filamentous degeneration of neurons. A possible feature of cytosine arabinoside neurotoxicity.
Cancer
71:1303-1308[ISI][Medline].
-
Wallace TL,
Johnson Jr EM
(1989)
Cytosine arabinoside kills postmitotic neurons: evidence that deoxycytidine may have a role in neuronal survival that is independent of DNA synthesis.
J Neurosci
9:115-124[Abstract].
-
Wang Y,
Prives C
(1995)
Increased and altered DNA binding of human p53 by S and G2/M, but not G1 cyclin-dependent kinases.
Nature
376:88-91[Medline].
-
Watson A,
Eilers A,
Lallemand D,
Kyriakis J,
Rubin LL,
Ham J
(1998)
Phosphorylation of c-Jun is necessary for apoptosis induced by survival signal withdrawal in cerebellar granule neurons.
J Neurosci
18:751-762[Abstract/Free Full Text].
-
Winkelman MD,
Hines JD
(1983)
Cerebellar degeneration caused by high-dose cytosine arabinoside: a clinicopathological study.
Ann Neurol
14:520-527[ISI][Medline].
-
Wu CL,
Classon M,
Dyson N,
Harlow E
(1996)
Expression of dominant-negative mutant DP-1 blocks cell cycle progression in G1.
Mol Cell Biol
16:3698-3706[Abstract].
-
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME
(1995)
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
-
Xiang H,
Hochman DW,
Saya H,
Fujiwara T,
Schwartzkroin PA,
Morrison RS
(1996)
Evidence for p53-mediated modulation of neuronal viability.
J Neurosci
16:6753-6765[Abstract/Free Full Text].
-
Xiang H,
Kinoshita Y,
Knudson CM,
Korsmeyer SJ,
Schwartzkroin PA,
Morrison RS
(1998)
Bax involvement in p53-mediated neuronal cell death.
J Neurosci
18:1363-1373[Abstract/Free Full Text].
-
Yang DD,
Kuan CY,
Whitmarsh AJ,
Rincon M,
Zheng TS,
Davis RJ,
Rakic P,
Flavell RA
(1997)
Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the Jnk3 gene.
Nature
389:865-870[Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21145017-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Y. R. Gonzalez, Y. Zhang, D. Behzadpoor, S. Cregan, S. Bamforth, R. S. Slack, and D. S. Park
CITED2 Signals through Peroxisome Proliferator-Activated Receptor-{gamma} to Regulate Death of Cortical Neurons after DNA Damage
J. Neurosci.,
May 21, 2008;
28(21):
5559 - 5569.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|