 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2001, 21(14):5066-5078
Plasma Membrane Ca2+-ATPase Isoform 2a Is the PMCA of
Hair Bundles
Rachel A.
Dumont1, 2,
Ulysses
Lins4,
Adelaida G.
Filoteo5,
John T.
Penniston5,
Bechara
Kachar4, and
Peter G.
Gillespie2, 3
1 Department of Physiology, Johns Hopkins University,
Baltimore, Maryland 21205, 2 Oregon Hearing Research Center
and 3 Vollum Institute, Oregon Health Sciences University,
Portland, Oregon 97201, 4 Section on Structural Cell
Biology, National Institute on Deafness and Other Communication
Disorders, National Institutes of Health, Bethesda, Maryland 20892, and
5 Department of Biochemistry and Molecular Biology, Mayo
Foundation, Rochester, Minnesota 55905
 |
ABSTRACT |
Mechanoelectrical transduction channels of hair cells allow for the
entry of appreciable amounts of Ca2+, which
regulates adaptation and triggers the mechanical activity of hair
bundles. Most Ca2+ that enters transduction channels
is extruded by the plasma membrane Ca2+-ATPase
(PMCA), a Ca2+ pump that is highly concentrated in
hair bundles and may be essential for normal hair cell function.
Because PMCA isozymes and splice forms are regulated
differentially and have distinct biochemical properties, we
determined the identity of hair bundle PMCA in frog and rat hair cells.
By screening a bullfrog saccular cDNA library, we identified abundant
PMCA1b and PMCA2a clones as well as rare PMCA2b and PMCA2c clones.
Using immunocytochemistry and immunoprecipitation experiments, we
showed in bullfrog sacculus that PMCA1b is the major isozyme of hair
cell and supporting cell basolateral membranes and that PMCA2a is the
only PMCA present in hair bundles. This complete segregation of PMCA1
and PMCA2 isozymes holds for rat auditory and vestibular hair cells;
PMCA2a is the only PMCA isoform in hair bundles of outer hair cells and vestibular hair cells and is the predominant PMCA of hair bundles of
inner hair cells. Our data suggest that hair cells control plasma
membrane Ca2+-pumping activity by targeting specific
PMCA isozymes to distinct subcellular locations. Because PMCA2a is the
only Ca2+ pump present at appreciable levels in hair
bundles, the biochemical properties of this pump must account fully for
the physiological features of transmembrane Ca2+
pumping in bundles.
Key words:
hair cells; stereocilia; cochlea; calcium; calcium pump; isozymes
 |
INTRODUCTION |
Ca2+ is
a key modulator of mechanoelectrical transduction by hair cells, the
sensory cells of the inner ear. Transduction is elicited by deflection
of the hair bundle, the sensory organelle of the hair cell (for review,
see Hudspeth et al., 2000 ). Bundle deflection leads directly to the
opening of cation-selective transduction channels, which permit
significant entry of Ca2+ (Lumpkin et al.,
1997 ; Ricci and Fettiplace, 1998 ). Entering Ca2+ regulates both fast (Crawford et al.,
1991 ) and slow (Eatock et al., 1987 ) adaptation in hair cells and also
triggers bundle movements opposing the stimulus (Benser et al., 1996 ;
Ricci et al., 2000 ). In addition, Ca2+ may
regulate the formation of the transduction apparatus (Zhao et al.,
1996 ).
Each hair bundle is composed of dozens to hundreds of actin-filled
stereocilia and, with the exception of the mammalian cochlea, a single
axonemal cilium called the kinocilium. Because the bundle is exposed to
an unusual extracellular fluid, endolymph, which is high in
K+ and low in
Na+, Ca2+
cannot be removed from bundles with
Na+/Ca2+
exchangers. Furthermore, stereocilia lack intracellular stores to
sequester Ca2+. Consequently, hair bundles
rely on mobile Ca2+ buffers (Ricci et al.,
1998 ) and the plasma membrane Ca2+-ATPase
(PMCA) to regulate Ca2+ levels in
stereocilia (Lumpkin and Hudspeth, 1998 ; Ricci et al., 1998 ; Yamoah et
al., 1998 ); indeed, the majority of the
Ca2+ that enters through transduction
channels is removed by PMCA (Lumpkin and Hudspeth, 1998 ).
Four PMCA genes (PMCA1-4) have been identified;
further isoform diversity is generated by alternative splicing in two
regions, A and C (Keeton et al., 1993 ). Although the functional
consequences of alternative splicing within region A are poorly
understood (Hilfiker et al., 1994 ), splicing in region C alters the
affinity of PMCA for calmodulin (Enyedi et al., 1994 ) and removes or
adds phosphorylation sites (Enyedi et al., 1997 ).
All PMCA isoforms and many of their splice variants are expressed in
the mammalian cochlea (Crouch and Schulte, 1996 ; Furuta et al., 1998 ).
Furthermore, hair cells contain high levels of PMCA (Crouch and
Schulte, 1995 ; Apicella et al., 1997 ; Street et al., 1998 ; Yamoah et
al., 1998 ); levels are particularly high in the hair bundle (Crouch and
Schulte, 1995 ; Yamoah et al., 1998 ). Although the subcellular
distribution of each isozyme and functional significance for expression
of multiple PMCA genes remain unknown, at least one of these isozymes,
PMCA2, is required for auditory and vestibular function (Kozel et al.,
1998 ; Street et al., 1998 ; Takahashi and Kitamura, 1999 ). This
requirement for PMCA2 in the inner ear, coupled with the high
concentration of PMCA in bundles and essential functions of
Ca2+ in transduction, led us to surmise
that Ca2+ regulation in hair bundles was
essential for auditory and vestibular function. To better understand
the bundle Ca2+ regulation and the
consequences of PMCA activity in stereocilia, we identified PMCA
isoforms and splice variants in auditory and vestibular epithelia and
determined that the hair bundle isoform was PMCA2a.
 |
MATERIALS AND METHODS |
Isolation of bullfrog PMCA clones. PMCA1-specific and
PMCA2-specific DNA fragments were synthesized from bullfrog liver and lung RNA by RT-PCR. Total RNA was subjected to reverse
transcription (Superscript II RNase H-reverse transcriptase, Life
Technologies, Grand Island, NY) and was followed by PCR, using
degenerate primers (5' to 3': Df1, GAYGCNTGYGARACNATG; Dr1,
GGCGCAAGCTTRTCRTANACRTTNCKNCCCCACAT; Dr2,
RAANGTRTANACYTTRTA). The amplification protocol comprised 5 min at
94°C, 30 cycles of 20 sec at 94°C, 2 min at 50°C ( 0.5°C for
each consecutive cycle), 2 min at 72°C, followed by 14 cycles of 20 sec at 94°C, 2 min at 50°C, 2 min at 72°C, and a final 10 min at
72°C. PCR products were cloned (TA Cloning Kit, Invitrogen, Carlsbad,
CA) and sequenced. To generate probes for library screening, we
amplified PMCA1 or PMCA2 fragments by PCR and labeled them with
[32P]dCTP, using random hexamers
(Amersham Pharmacia Biotech, Piscataway, NJ). The labeled PCR products
were used to screen a bullfrog (Rana catesbeiana) sacculus
cDNA library in Lambda ZAP Express (Stratagene, La Jolla, CA)
constructed by Stefan Heller (Rockefeller University, New York, NY);
~600,000 plaques were screened with each probe. To obtain
insert-containing pBK-CMV phagemids, we performed in vivo
excisions on isolated clones by following the manufacturer's protocol (Stratagene).
Analysis of PMCA1 and PMCA2 splicing. Purified total RNA
(RNeasy Kit, Qiagen, Valencia, CA) was primed with random hexamers and
was reverse transcribed (ThermoScript RT-PCR System, Life Technologies). Nested primers that flank splice regions A and C in
bullfrog PMCA1 (F1Cf1, GCAGAGAGGGAGTTACGCCG; F1Cf2,
GGTCAGATCTTATGGTTTAG; F1Cr1, CATTTGAAGTCCAAGGAGC; F1Cr2,
GCACTCTTCTGCCTGCTGC) and PMCA2 (F2Af1, CTCATGTGATGGAAGGCTC; F2Af2,
GAAGAATGCTTGTAACAGC; F2Ar1, TGCCTA TCTGCACTGCCAG; F2Ar2,
GGTCAGCTTGCCCTGTAGG; F2Cf1, CGCCTGACACAGAAGGAGG; F2Cf2,
GGGAGTTAAGAAGAGGGC; F2Cr1, CTTCCTCTGCCGGGCATCC; F2Cr2, GCAGTGCCATCTCCAGC) or rat PMCA2 region A (R2A+1,
GGACGGATGGTGGTGACTG; R2A+2, GCTGTGGGTGTCAACTCTC; R2A 1,
AGATGGCTGTGGCGTTACC; R2A 2, ACCACCAGCACCGTCACAC) were used in PCR
analysis for variability within these regions. The amplification
protocol comprised 4 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 50-55°C, 45 sec at 72°C, and a final 10 min at 72°C.
Isozyme-selective antibodies. Antibody names, specificities,
and antigens used for their generation are listed in Table
1. Synthetic PMCA peptides, designed with
an added N- or C-terminal cysteine residue, were used for the
production of antisera (GeneMed Synthesis, South San Francisco, CA). To
purify antipeptide antibodies, we coupled peptides to SulfoLink resin
(Pierce, Rockville, IL) via their terminal cysteine residues at a
density of 1 mg of peptide/ml of resin. Antipeptide antisera, diluted
with 10 vol of 25 mM Tris, pH 8, were passed over a 0.5-1
ml peptide column three to four times. After washing the column with 20 vol of 25 mM Tris, pH 8, and 10 vol of 500 mM
NaCl/25 mM Tris, pH 8, we eluted the antibodies with 100 mM glycine, pH 2.5, followed by 100 mM CAPS
(3-(cyclohexylamino)-1-propane sulfonic acid), pH 11. Antibodies
eluted with acid or base were neutralized, pooled, and dialyzed
against PBS containing 0.02% sodium azide. The production of
polyclonal antibodies specific for rat PMCA isoforms was described
previously (Filoteo et al., 1997 ); they were subjected to affinity
purification with methods similar to those described above. The
monoclonal antibody NR4 (JA9) was raised against human erythrocyte PMCA
and was directed toward an epitope very near the N terminus of isoform
4 (Adamo et al., 1992 ; Caride et al., 1996 ).
Glutathione S-transferase (GST) or Escherichia
coli maltose-binding protein (MBP) was fused to N-terminal amino
acids of PMCA1 (amino acids 1-96) and PMCA2 (amino acids 1-99) in the
vectors pGEX-6P-1 (Amersham Pharmacia Biotech) and pMAL-p2 (New England Biolabs, Beverly, MA), respectively. Fusion proteins were expressed in
E. coli and purified by glutathione or amylose affinity
chromatography. Purified GST fusion proteins were injected into rabbits
for the production of isoform-selective antibodies (Covance Research
Products, Denver, PA). Antibodies were affinity purified on MBP-PMCA or GST-PMCA fusion protein columns, which were constructed by coupling fusion proteins to CNBr-Sepharose (Amersham Pharmacia Biotech) at a
density of 1-5 mg of protein/ml of agarose. Antibodies against the N
terminus of PMCA1 and PMCA2 were purified as described for antipeptide
antibodies, with an additional negative selection step. To remove
antibodies that recognize either PMCA1 and GST, first we passed
GST-PMCA2 antiserum over a GST-PMCA1-Sepharose column. The flow through
from this step subsequently was passed over an MBP-PMCA2-Sepharose
column; bound antibodies were eluted as described above. Similarly,
GST-PMCA1 antiserum first was passed over a GST-PMCA2-Sepharose
precolumn and then purified on an MBP-PMCA1-Sepharose column.
Immunocytochemistry. Auditory and vestibular organs from
postnatal day 21 (P21) or older rats were dissected in MEM (Life Technologies) with an added 25 mM HEPES, pH 7.5. Bullfrog
sacculi were dissected in bullfrog saline solution [(in
mM) 110 NaCl, 2 KCl, 2 MgCl2, 3 D-glucose, 10 HEPES, pH 7.25] containing 4 mM CaCl2. Hair cells were isolated as described
previously (Yamoah et al., 1998 ). Tissues or dissociated hair cells
were fixed in 3% formaldehyde in saline for 30 min, washed in PBS, and
then permeabilized and blocked for 1 hr in blocking solution (PBS, 0.2% saponin, 3% donkey serum, and 1% bovine serum albumin).
Formaldehyde was obtained as a 16% solution in sealed ampoules from
Electron Microscopy Sciences (Fort Washington, PA). Tissues were
incubated overnight at room temperature with 2.5 µg/ml primary
antibody in the blocking solution, washed in PBS, and then incubated
with a secondary antibody (5 µg/ml Cy5-conjugated donkey anti-rabbit IgG or donkey anti-mouse IgG; Jackson ImmunoResearch Laboratories, West
Grove, PA) and 0.25 µM FITC-phalloidin (Sigma, St. Louis, MO) in the blocking solution for 1-3 hr. In some experiments utriculi were colabeled with an antibody against the calcium-binding protein calretinin (1:200; Chemicon, Temecula, CA). Cells and tissues were
washed in PBS, mounted with Vectashield (Vector, Burlingame, CA), and
viewed with Plan Apochromat 40' (numerical aperture, 1.00) and 60'
(numerical aperture, 1.40) oil lenses on a Nikon TE 300 inverted
microscope with a Bio-Rad MRC 1024 confocal imaging system (Hercules,
CA). Acquired images were processed with Scion Image (version 1.62a)
and Photoshop (version 5.03; Adobe Systems, San Jose, CA).
SDS-PAGE and immunoblotting. Proteins were separated by
SDS-PAGE that used 10% acrylamide gels with a 150:1
acrylamide-to-bisacrylamide ratio and were transferred to
polyvinylidene fluoride blotting membranes in 7.5% methanol and 7.5 mM CAPS, pH 11, at 100 V for 2 hr with cooling. To enhance
protein mobilization from the acrylamide gel, we added hemoglobin to
the samples and to the pretransfer equilibration solution, as described
previously (Gillespie and Gillespie, 1997 ). PMCA was detected with the
5F10 antibody (Affinity BioReagents, Golden, CO) as described
previously (Yamoah et al., 1998 ), with a 5F10 dilution of 1:5000,
alkaline phosphatase-conjugated goat anti-mouse IgG (Jackson
ImmunoResearch Laboratories) at 1:20,000, 0.1 mM of the
chemiluminescence reagent CSPD [disodium
2-chloro-5-(4-methoxyspiro{1,2-dioxetane-3,2'-(5'-chloro)-tricyclo[3.3.1.13,7]
decan}-4-yl)-1-phenyl phosphate; Tropix, Bedford, MA], and 10% Sapphire (Tropix), an enhancing reagent.
Immunoprecipitation. Hair bundles were purified from
bullfrog sacculi by using the twist-off technique (Gillespie and
Hudspeth, 1991 ). For each experiment we estimated the number of
saccular equivalents of bundles that had been isolated so that one
saccular equivalent is 100% recovery. Detergent-soluble proteins were
extracted (Yamoah et al., 1998 ) from bullfrog residual maculae or
purified hair bundles with 250 µl of immunoprecipitation solution
[1% Triton X-100 and (in mM) 1 DTT, 150 NaCl, 25 HEPES,
pH 7.5, plus 10 µM leupeptin, 10 µM
pepstatin, 200 µM PMSF, and 0.1 mg/ml hemoglobin]. Extracts were incubated on ice for 4 hr with 6 µg of
affinity-purified anti-PMCA antibody. Immune complexes were
precipitated by adding 15 µl of donkey anti-rabbit IgG conjugated to
Sepharose, incubating for 2 hr at 4°C with gentle agitation, and
centrifuging to sediment the antibody-Sepharose complex. Donkey
anti-rabbit IgG-Sepharose was prepared by coupling 2 mg of purified
donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories) to 1 ml of
CNBr-Sepharose. After three 250 µl washes of immunoprecipitation
solution, the immune complexes were recovered by incubating at 65°C
for 20 min in an SDS-PAGE sample buffer that included 2% SDS and 100 mM DTT. For sequential immunoprecipitations additional
anti-PMCA antibodies (6 µg) were added to the supernatant from the
first immunoprecipitation, and the immune complexes were isolated as
described above. In some cases a third immunoprecipitation was
performed. Proteins from the final supernatant were precipitated with 6 vol of acetone at 20°C and then solubilized in SDS-PAGE sample
buffer. Proteins were electrophoresed and transferred to blotting
membranes; PMCA was detected with 5F10 as described above.
Immunoelectron microscopy. Postembedding immunoelectron
microscopy was performed as described previously (Petralia et al., 1997 ). Rat cochleae were positioned gently onto a 400-mm-thick slice of
Bacto-agar (Difco Laboratories, Detroit, MI) and mounted on filter
paper glued to an aluminum specimen holder. Then the specimens were
quick frozen by contact with a liquid nitrogen-cooled sapphire block of
a Life Cell CF0100 quick-freezing machine (Research and Manufacturing,
Tucson, AR) and promptly transferred to liquid nitrogen. Frog sacculi
were fixed in 4% paraformaldehyde plus 0.5% glutaraldehyde in 0.1 M phosphate buffer, cryoprotected in 30% glycerol, and
frozen in liquid propane. All frozen samples were freeze substituted in
1.5% uranyl acetate in methanol at 90°C, infiltrated with Lowicryl
HM-20 resin at 45°C, and polymerized with ultraviolet light.
Ultrathin sections were obtained on a Ultracut microtome, collected in
nickel grids, and used in immunocytochemistry. Sections were picked up
on grids and were incubated in 0.1% sodium borohydride and 50 mM glycine in 5 mM Tris and 0.1% Triton X-100, pH 7.4 (TBST) for 10 min, blocked with 10% normal goat serum in TBST
for 10 min, and then incubated for 2 hr in primary antibody in 1%
normal goat serum/TBST. Grids were rinsed three times in TBST, blocked
with 1% goat serum/TBST for 10 min, and then were incubated in
gold-labeled secondary antibodies (10 nm gold particles conjugated to
goat anti-rabbit IgG, diluted 1:20; Sigma) in 1% serum/0.5%
polyethylene glycol (Mr = 20,000) in
TBST for 1 hr. Grids were washed in TBST and water, stained with uranyl
acetate, and observed in JEOL 1010 or Zeiss EM902 transmission electron microscopes.
Other methods. Amino acid alignments were created with the
MegAlign software (DNAstar, Madison, WI). By convention (Carafoli and
Stauffer, 1993 ; Strehler and Zacharias, 2001 ), PMCA isozymes are
referred by their isoform numeral (1-4), splicing region C variant by
small case letters (a-f), and splicing region A
variants by small case letters (v-z) (e.g., PMCA2av). In
some cases we dropped one or both of the splicing region letters (e.g.,
PMCA2 with the F2N antibody, which recognized all PMCA2 forms, or
PMCA2a with the F2a antibody, which recognized the splicing region C form but did not distinguish splicing region A variants).
 |
RESULTS |
Isolation of bullfrog sacculus PMCA cDNA clones
To identify PMCA isoforms of bullfrog saccular hair cells, we
first cloned several PMCA cDNAs from a saccular library. A vestibular organ ~1 mm in diameter, the sacculus contains ~2500 hair cells and
twice as many supporting cells surrounded by a simple epithelium consisting of nonsensory cells (Jacobs and Hudspeth, 1990 ). Because no
bullfrog PMCA sequences were available, we first aligned mammalian PMCA
sequences and identified several regions of complete amino acid
identity in all isozymes from all available species. Using degenerate
oligonucleotides corresponding to these regions, we amplified PMCA
fragments by using RT-PCR with RNA isolated from bullfrog tissues.
Using Df1 and Dr1 primers, we amplified a 1.2 kb PCR product from
bullfrog liver; all clones isolated from this PCR reaction were shown
by sequencing to be closely related to mammalian PMCA1 (data not
shown). Df1 and Dr2 primers produced a single 0.35 kb bullfrog lung PCR
product, shown by cloning and sequencing to be PMCA2 (data not shown).
Although not exhaustive, this PCR screen produced useful clones for the
identification of bullfrog PMCA1 and PMCA2.
We used the cloned PCR products to screen a bullfrog sacculus cDNA
library. Using the PMCA1 probe, we identified ~150 positive clones
(of 600,000 screened), one of which appeared to be full length (Figs.
1, 2). At sequencing, this clone included
a 1.3 kb unspliced intron with 39 stop codons, shared approximately equally by all three frames. To confirm that this insert was not present in the mature mRNA, we sequenced three other library clones, none of which had the insert. The corrected sequence of 4575 bases, tentatively identified as PMCA1, encoded a protein of 1214 amino acids
(134,560 Da). Using the PMCA2 probe, we isolated ~120 clones (of
700,000 screened), one of which appeared to be full length (Figs. 1,
2). This clone also was spliced incompletely; to determine the correct
sequence, we sequenced two other library clones and five PCR products
that were amplified from bullfrog sacculus cDNA. This large clone also
had a two nucleotide deletion in the coding sequence; we sequenced two
additional library clones to correct the sequence. Because few cDNAs
have been cloned from R. catesbeiana libraries, we are
uncertain whether the high frequency of untranslatable clones reflects
a species phenomenon or simply poor luck. The corrected sequence of
4416 bases, tentatively identified as PMCA2, encoded a protein of 1213 amino acids (132,801 Da).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1.
Cloning, structure, and alternative splicing of
bullfrog PMCA isozymes. Horizontal lines indicate the
extent of each cDNA that is sequenced, and the lines are aligned with a
diagram of PMCA. Ten putative transmembrane domains
(shaded and numbered), the
phosphointermediate aspartate residue, and the 5F10 antibody binding
site are indicated. A, Bullfrog sacculus PMCA1.
PMCA1C#3 indicates the clone that was used to derived
most of the sequence for PMCA1; at the indicated 1.3 kb insert three
other clones were sequenced too. Df1 and
Dr1 indicate the positions of primers used in bullfrog
liver RT-PCR to generate a PMCA1-specific probe. Splicing region A and
C variants are indicated; we detected only x and
b. B, Bullfrog sacculus PMCA2.
PMCA2C#4 indicates the clone that was used to derived
most of the sequence for PMCA2. At the position indicated with an
asterisk, the site of a 2 bp deletion, we sequenced two
additional clones to confirm the correct sequence. In addition, we
sequenced at least two library clones and five PCR products at splicing
region C; only PMA2C#4 included a 300 bp unspliced
insert. Variants v, w, and
z were detected at splicing region A; variants
a, b, and c were detected
at splicing region C. Df1 and Dr2
indicate positions of primers used in bullfrog lung RT-PCR to generate
a PMCA2-specific probe.
|
|
We analyzed predicted amino acid sequences of bullfrog PMCA clones to
determine their relationship to known PMCA isozymes. For each bullfrog
sequence, high amino acid identity with other PMCAs extends throughout
all cytoplasmic loops and the 10 putative transmembrane domains. The
phosphoenzyme intermediate aspartate residue present in all P-type
ATPases (Carafoli and Stauffer, 1993 ) is conserved in bullfrog PMCA1
(residue 469) and PMCA2 (residue 513). In addition, key residues in
transmembrane domains that are critical for
Ca2+ pumping in PMCA [P422, E423, P426,
A854, N879, M882, D883, Q971, and E975 in human PMCA4 (Guerini et al.,
1996 , 2000 )] were present in bullfrog PMCA1 (residues 426, 427, 430, 860, 885, 888, 889, 975, and 981) and PMCA2 (residues 470, 471, 474, 903, 928, 931, 932, 1020, and 1024). By examining the N-terminal ~15
amino acids, which vary widely between different isozymes, we
determined that our sequences were related most closely to PMCA1 and
PMCA2 (Fig. 2A,B). At
the amino acid level, bullfrog PMCA1 was 88.7% identical to rat PMCA1,
and bullfrog PMCA2 was 90.1% identical to rat PMCA2 (excepting
alternative splicing regions A and C). These high sequence similarities
establish that these isozymes are the bullfrog orthologs of PMCA1 and
PMCA2.

View larger version (115K):
[in this window]
[in a new window]
|
Figure 2.
Sequence analysis of bullfrog sacculus
PMCA1bx and PMCA1av isozymes. Highlighted residues are
those with identity to the aligned residues in at least one other PMCA.
Splicing region A is underlined in light
gray; splicing region C is underlined in
dark gray. A, Bullfrog sacculus PMCA1bx
(fPMCA1bx) aligned with human PMCA1bx
(hPMCA1bx) and rat PMCA1bx (rPMCA1bx).
Protein translation likely initiates at nucleotides 340-342; this is
the first AUG codon of a long open reading frame and matches the second
AUG of the mammalian PMCA1 sequence. B, Bullfrog
sacculus PMCA2av (fPMCA2av) aligned with human
PMCA2az (hPMCA2az) and rat PMCA2aw
(rPMCA2aw). Nucleotides 328-330 correspond to the first
AUG codon of a long open reading frame and match the known translation
start site of mammalian PMCA2. C, Bullfrog sacculus
splicing region A variant PMCA2av (fPMCA2av)
aligned with rat PMCA2 splice region A variants w,
x, y, and z
(rPMCA2w, rPMCA2x,
rPMCA2y, rPMCA2z, respectively).
D, Bullfrog sacculus PMCA2 splice region C variants
identified in the sacculus cDNA library.
|
|
Because of the importance of alternative splicing for PMCA regulation,
we examined bullfrog sacculus PMCA1 and PMCA2 library clones and RT-PCR
products from sacculus RNA for alternative splicing in regions A and C. For PMCA1 we detected only x and b variants at
sites A and C (Figs. 1, 2, Table 2).
The slicing of PMCA2 was more complex. The full-length PMCA2 clone used
a novel splicing region A variant, which we named v (Fig.
2C). Interestingly, the cDNA sequence of this variant begins
with GT, the consensus splice donor dinucleotide, and ends with AG, the
consensus splice acceptor dinucleotide (Green, 1991 ), suggesting that
this sequence can be removed by alternative splicing. PCR analysis of
>50 library clones indicated that all were of splice form
v; in addition, RT-PCR analysis on bullfrog sacculus RNA
showed that, in addition to the abundant v, PMCA2 splicing region A variants w and z were also present
(Table 2). The v splice form was not specific to the inner
ear, however, but also was found in bullfrog PMCA2 in brain, kidney,
lung, and retina (data not shown). The full-length PMCA2 clone
incorporated the a splice variant in splicing region C (Fig.
2D); in other library clones a was the
predominant form (98 of 103 clones), although b (4 of 103)
and c (1 of 103) also were detected (Table 2). The a variant was the only splicing region C sequence identified
by RT-PCR from saccular RNA (Table 2). The two major PMCA transcripts in bullfrog sacculus hence encoded PMCA1bx and PMCA2av.
Localization of PMCA isoforms in bullfrog sacculus
To localize saccular PMCA isoforms, we generated polyclonal
antibodies selective for specific PMCA isozymes and splice variants (see Table 1) and used them for immunocytochemistry. Because fusion
proteins used for generation of the F1N and F2N antibodies contained
substantial sequence identity within the PMCA coding regions, we
generated selective antibodies by performing sequential negative and
positive affinity selection. Affinity-purified F1N recognized PMCA1,
but not PMCA2, fusion proteins on immunoblots, whereas F2N recognized
PMCA2, but not PMCA1, fusion proteins (data not shown). All antibodies
also exhibited minimal cross-reactivity with other bullfrog saccular
proteins on blots (see Fig. 5A) and therefore were useful
tools for localizing PMCA isozymes in bullfrog saccular tissue.
Antibodies listed in Table 2 were used to detect PMCA isozymes within
the bullfrog sacculus (Fig. 3). The PMCA1
N terminus antibody (F1N) strongly labeled basolateral membranes of
hair cells (Fig. 3A); although PMCA1 usually was excluded
completely from apical membranes, in rare instances we observed faint
hair bundle labeling. Plasma membranes of supporting cells also were labeled with PMCA1-selective antibodies. An identical labeling pattern
was observed with the use of an antibody (Fb) that was raised against a
peptide sequence within the b splice forms of bullfrog PMCA1
and PMCA2 (Fig. 3B,C); because rat PMCA3b contains an
identical sequence, this antibody also may detect a putative bullfrog
PMCA3b. Labeling with either antibody was usually more intense in hair
cells with larger cell body diameters. No labeling was observed when an
irrelevant affinity-purified antibody was used; furthermore, the
peptide used to raise the Fb antiserum blocked labeling with Fb. Both
observations indicate the specificity of the PMCA1 immunolabeling.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 3.
Localization of bullfrog sacculus PMCA isozymes by
immunofluorescence. Left columns, Actin
(FITC-phalloidin); middle columns, PMCA; right
columns, combined actin (red) and PMCA
(green). A, F1N labeling for
PMCA1. Shown is a cross section through a bullfrog sacculus; plasma
membranes of hair cells and supporting cells (arrow) are
labeled. B, Fb labeling for PMCA1b and PMCA2b. Shown is
a cross section through bullfrog sacculus hair cells and supporting
cells. C, Fb labeling for PMCA1b and PMCA2b. The hair
bundle is unlabeled. D, F2N labeling for PMCA2. Shown
are apical surfaces of bullfrog sacculus hair cells and supporting cells; there is PMCA2 labeling
in stereocilia and in the pericuticular necklace
(arrow). E, F2N labeling for PMCA2. Shown
is labeling in an isolated hair cell; there is strong labeling near the
base of the tallest stereocilia and labeling along the apical surface
(arrow). F, F2a labeling for PMCA2a.
Shown is a whole-mount view of hair bundles. G, F2v for
PMCA2v. Shown is a whole-mount view of hair bundles. Scale bars:
A-C, F, G, 10 µm;
D, 5 µm; E, 2 µm.
|
|
Hair bundles in bullfrog sacculi were labeled intensely by antibodies
selective for the PMCA2 N terminus (F2N; Fig. 3D,E), for the
PMCA2a splice form (F2a; Fig. 3F), or for the PMCA2v
splice form (F2v; Fig. 3G). Labeling often appeared to be
concentrated near stereociliary tips, although sacculus-to-sacculus
variability was noted. In addition, PMCA2-selective antibodies labeled
the apical surface of the hair cell and a punctate ring surrounding the
cuticular plate (Fig. 3D). For each of these features the labeling was specific; no labeling was observed with an irrelevant primary antibody, and the peptide used to raise the F2v antibody blocked hair cell labeling with F2v. No PMCA2 labeling was detected in
the basolateral membrane of hair cells, in supporting cells, or in
extramacular nonsensory epithelial cells of the bullfrog sacculus.
We used immunoelectron microscopy to localize PMCA1 and PMCA2 at the
ultrastructural level (Fig. 4). Using
postembedding labeling on freeze-substituted saccular tissue, we found
strong PMCA1 immunoreactivity along membranes of hair cells (Fig.
4A) and supporting cells (data not shown). PMCA2
immunoreactivity was observed only along stereocilia membranes and at
the apical surface of the hair cell (Fig. 4B-E). No
PMCA2 labeling was seen along hair cell basolateral membranes or in
supporting cells.

View larger version (123K):
[in this window]
[in a new window]
|
Figure 4.
Localization of bullfrog sacculus PMCA isozymes by
immunoelectron microscopy. A, F1N labeling for PMCA1.
Shown is a hair cell basolateral membrane. B-E, F2N
labeling for PMCA2. B, Stereociliary tips.
C, Stereocilium shaft. D, Cross section
through stereocilia. E, Hair cell apical surface. Scale
bars, 100 nm.
|
|
These immunolabeling data indicate that PMCA1b is a major isozyme of
hair cell basolateral membranes, and PMCA2a is a major isozyme of hair
bundles. Nevertheless, other PMCA isozymes, not detected with our
antibodies, also could be present in sacculi. Although the NR3
antibody, raised against rat PMCA3, did not label bullfrog sacculi
(data not shown), its cross-reactivity with a putative bullfrog PMCA3
isozyme is unknown. Because immunolabeling cannot exclude the presence
of PMCA3 or other isozymes, we turned to protein biochemistry to
address the identity of hair bundle and somatic PMCA isozymes.
Protein immunoblot analysis of bullfrog sacculus PMCA isozymes
We analyzed PMCA1 and PMCA2 by protein immunoblotting, using each
of the antibodies we previously had used for immunocytochemistry. With
each antibody, as well as with the pan-PMCA antibody 5F10, we detected
two to three bands of 130-170 kDa in whole bullfrog sacculus (Fig.
5A). Only the antibody against
the v form of PMCA2 (F2v) did not react efficiently with
sacculus PMCAs on immunoblots. The higher molecular mass forms of PMCA
were not unexpected; PMCA isozymes (particularly PMCA2) often migrate
in SDS-PAGE with a second band ~20 kDa larger than the expected
protein product (Hilfiker et al., 1994 ).

View larger version (63K):
[in this window]
[in a new window]
|
Figure 5.
Protein immunoblot and immunoprecipitation
analysis of bullfrog sacculus PMCA isozymes. A,
Immunoblotting of whole bullfrog sacculus with 5F10 and
isozyme-selective antibodies. One saccular equivalent was used for each
lane. B, 5F10 immunoblot indicating efficiency of
acetone precipitation. Extracts from bullfrog sacculi either were added
directly to sample buffer (Extract) or were precipitated
with acetone (Acetone). Band intensities were similar,
indicating that acetone precipitation was efficient. C,
5F10 detection of PMCAs sequentially immunoprecipitated from a residual
macula extract (five saccular equivalents) with PMCA-selective
antibodies. F/T, Flow through, those proteins that did
not bind to any of the precipitating antibodies. D, Same
immunoprecipitation and detection conditions as in C,
except that the antibody order is changed. E, 5F10
detection of PMCAs sequentially immunoprecipitated from a hair bundle
extract (47 saccular equivalents) with PMCA-selective antibodies.
Indicated bands (*) were derived from the precipitating antibodies
(data not shown).
|
|
Immunoprecipitation of bullfrog sacculus PMCA isozymes
We used an immunoprecipitation approach to confirm the identity of
the principal PMCA isoforms of bullfrog hair cell somas and hair
bundles. We precipitated PMCAs from saccular protein extracts with
selective antibodies and then analyzed all precipitated and
unprecipitated PMCAs by immunoblotting with the pan-PMCA antibody 5F10.
Because 5F10 cross-reacts with all four mammalian PMCA isozymes (Caride
et al., 1996 ) as well as with PMCAs in a wide range of species (Borke
et al., 1989 ; de Talamoni et al., 1993 ; Benaim et al., 1995 ), we
expected to analyze all saccular PMCA isozymes simultaneously in these experiments.
To perform these immunoprecipitation experiments, we solubilized PMCA
from tissue extracts with Triton X-100 and then sequentially precipitated each extract with isoform-selective PMCA antibodies. Proteins remaining in the supernatant after immunoprecipitation were
precipitated with acetone. For a comprehensive examination of PMCA
isozymes, including those for which we had no specific antibody, we
required complete acetone precipitation of remaining PMCAs; by
examining total PMCA before and after acetone precipitation, we
demonstrated that this precipitation was efficient (Fig.
5B). PMCA was detected in immunoprecipitates and the final
supernatant by SDS-PAGE and immunoblotting with 5F10.
We first determined which PMCA isozymes were present in bullfrog
residual macula (Gillespie and Hudspeth, 1991 ), the saccular tissue
remaining after hair bundle isolation (Fig. 5C,D). This tissue contains bundleless hair cells, supporting cells, and a few
nonsensory extramacular cells. When F1N was used as the first precipitating antibody (Fig. 5C), most of the PMCA in the
residual macula extract was precipitated. When Fb was used before F1N, Fb precipitated most PMCA (Fig. 5D). PMCA1 precipitated by
F1N, but not Fb (Fig. 5D), may be another PMCA1 splicing
region C variant, although our molecular cloning and RT-PCR experiments
only detected the b form. Alternatively, proteolysis might
have eliminated the Fb antibody epitope. Very little PMCA2 was present
in the residual macula tissue (Fig. 5C,D). PMCA precipitated
by Fb, but not F1N, in Figure 5C may be PMCA3b; in addition,
there was a small amount of PMCA that was not precipitated by any of
our antibodies, which may have been other PMCA3 splice variants or
PMCA4. The results from these immunoprecipitation experiments thus
demonstrate that the principal residual macula isozyme is PMCA1b,
consistent with immunocytochemical results (see Fig. 3).
We next examined the identity of PMCA isozymes in purified hair bundles
(Gillespie and Hudspeth, 1991 ). F2a immunoprecipitated all PMCA from a
hair bundle protein extract; neither F2N nor F1N precipitated any
additional PMCA, and no PMCA remained in the final supernatant (Fig.
5E). Besides showing that the only bundle PMCA is PMCA2a,
the data also demonstrated the effectiveness of the hair bundle
purification. Although only a few saccular equivalents of PMCA1 give a
strong 5F10 signal (e.g., Fig. 5C,D), we saw no significant
5F10 reactivity in 47 saccular equivalents of hair bundles when PMCA1
antibodies were used for immunoprecipitation (Fig. 5E).
Our experimental conditions insured that all 5F10-reactive PMCA
isoforms from the sacculus, presumably all saccular PMCA molecules, could be analyzed in a single experiment. The data therefore
established conclusively that PMCA2a is the hair bundle PMCA isozyme in
the bullfrog sacculus and that PMCA1b accounts for a majority of the PMCA in the rest of the sacculus.
PMCA isoforms in rat organ of Corti and utriculus
To determine the generality of the bullfrog sacculus localization
results, we examined PMCA isozyme distribution in auditory and
vestibular organs of rat, where we could use antibodies selective for
each of the four known PMCA isozymes (see Table 1; Filoteo et al.,
1997 ). To confirm that PMCAs 1-4 are the only PMCAs present in
vertebrates, we used the BLAST search algorithm (Altschul et al., 1990 )
to search for genes related to PMCA within the human genome
(http://www.ncbi.nlm.nih.gov/genome/seq/HsBlast.html). Each human PMCA
cDNA identified only its own gene and the other three PMCA genes and,
in one case, a sarcoplasmic-endoplasmic reticulum
Ca2+-ATPase (data not shown). These data
suggest that, if any other PMCAs are present in the genome, they are
related much more distantly to PMCAs 1-4 than each is to the others.
By performing immunocytochemistry in rat tissues, we therefore were
able to use antibodies against all PMCA gene products.
We first examined the organ of Corti, the sensory
epithelium of the mammalian auditory system. In this tissue PMCA2
immunoreactivity was restricted in hair cells to bundles and apical
surfaces (Fig. 6B,F). Labeling
was intense in bundles of outer hair cells; bundles of inner hair cells
had far less immunoreactivity, which occasionally appeared to be
concentrated at stereociliary tips. An identical labeling pattern was
observed with F2a (Fig. 6C), indicating that PMCA2a is
present in hair bundles.

View larger version (64K):
[in this window]
[in a new window]
|
Figure 6.
Localization of rat organ of Corti PMCA isozymes
by immunofluorescence and immunoelectron microscopy. Shown are cross
sections through the rat organ of Corti. Left columns,
Actin (FITC-phalloidin); middle columns,
PMCA immunolabeling; right columns, combined actin
(red) and PMCA (green). In the
left columns the arrowheads point to the
single row of inner hair cells and three rows of outer hair cells.
A, NR1 labeling for PMCA1. Basolateral membranes of
inner hair cells were labeled (arrow). B,
NR2 labeling for PMCA2. Hair bundles of outer hair cells were labeled
intensely; modest immunoreactivity was present on bundles of inner hair
cells (arrow). C, F2a labeling for
PMCA2a. Stereocilia of inner (arrow) and outer hair
cells were labeled. D, NR3 labeling for PMCA3.
Immunoreactivity was restricted to the pericuticular necklace
(arrow) and bundles of inner hair cells. Bundle labeling
was very low, when detectable. E, Diagram of the
mammalian organ of Corti indicating the approximate region of projected
confocal images. IHC, Inner hair cell;
OHC, outer hair cell; IPC, inner pillar
cell; OPC, outer pillar cell; DC,
Deiter's cell. F, NR2 labeling for PMCA2; shown is
postembedding immunoelectron microscopy on freeze-substituted rat
cochlear tissue. Left, Stereociliary shafts and tip.
Right, Cross section. PMCA2 is associated with plasma
membranes. Scale bars: A-D, 10 µm; F,
200 nm.
|
|
PMCA1 was located on basolateral membranes of inner hair cells (Fig.
6A) but was absent from their hair bundles. PMCA1 was never observed in basolateral membranes of outer hair cells, although on occasion we observed very low PMCA1 labeling on apical surfaces (data not shown). PMCA1 also was detected in the Deiter's cell cups,
where these cells cradle the base of outer hair cells. PMCA3 was
observed only in inner hair cells; this isozyme was located prominently
in a ring near the inner hair cell cuticular plate and at lower levels
on the apical surface of inner hair cells (Fig. 6D).
PMCA3 labeling was detected occasionally in the basolateral plasma
membrane of inner hair cells and, at very low levels, in bundles of
inner hair cells. Fb, which recognizes PMCAs 1b, 2b, and 3b, labeled
the plasma membrane of inner hair cell somas and Deiter's cell cups in
a similar pattern to that obtained with NR1 (data not shown).
Surprisingly, Fb also labeled plasma membranes of inner and outer
pillar cells as well as phalanges of Dieter's cells. None of the other
antibodies against rat PMCA, which recognize all known isozymes,
labeled these structures. PMCA4 was not detected in the organ of Corti.
We also examined PMCAs in the rat utriculus, a vestibular organ.
PMCA2 immunoreactivity was intense in hair bundles and was absent from
the rest of the tissue (Fig.
7B,C); furthermore, the vestibular bundle isoform was PMCA2a (Fig. 7D). F2N also
strongly labeled hair bundles of the semicircular canal (Fig.
7E). Although many vestibular hair bundles were labeled
intensely with antibodies against PMCA2, a subset of bundles had lower
levels of this isozyme. These bundles usually belonged to hair cells
that were immunoreactive for the calcium-binding protein calretinin;
consistent with their generally smaller bundles, these cells may be
immature type II hair cells (Dechesne et al., 1991 , 1994 ). Basolateral
membranes of utricular hair cells were labeled with antibodies against
PMCA1 and PMCA3. PMCA1 labeling was observed at substantial levels only in a fraction of hair cells (Fig. 7A). By contrast, PMCA3
labeling was apparent in nearly all hair cells, although it was usually considerably lower in calretinin-positive cells (Fig. 7D).
Like the supporting cells of the bullfrog sacculus, supporting cells of
the rat utriculus target PMCA1 to their plasma membranes, albeit at a
significantly lower level than in hair cells. We did not observe PMCA4
expression in rat vestibular organs.

View larger version (73K):
[in this window]
[in a new window]
|
Figure 7.
Localization of rat vestibular PMCA isozymes by
immunofluorescence. Cross sections through the rat utriculus
(A-D) and ampulla (E).
Left columns, Actin (FITC-phalloidin); middle
left columns, PMCA immunolabeling; middle right
columns, calretinin immunolabeling; right
columns, combined actin (red), PMCA
(green), and calretinin (blue).
A, NR1 labeling for PMCA1. Shown is a single confocal
section. B, NR2 labeling for PMCA2. Shown is a
projection of confocal sections covering ~10 µm depth. Some hair
bundles with low PMCA2 labeling belong to hair cells with high levels
of calretinin (arrowheads). C, F2a
labeling for PMCA2a. Shown is a projection of confocal sections
covering ~10 µm depth. Hair bundles with low PMCA2a and high
calretinin labeling are indicated by arrowheads.
D, NR3 labeling for PMCA3. Shown is a single confocal
section. Hair cells with low PMCA3 expression have high calretinin
levels (arrowheads). E, NR2 labeling for
PMCA2. Scale bar, 10 µm (applies to all panels).
|
|
We observed no immunolabeling of rat vestibular organs or organ of
Corti by using an antibody against the v splice variant of
PMCA2 (data not shown). To confirm the absence of this splice form in
rat hair cells, we performed RT-PCR on cochlea and utriculus RNA to
examine the splicing in region A. Using primers that flank splicing
region A, we found no evidence for the expression of a rat v
form, although we did amplify, clone, and sequence w, x, and z forms (see Table 2).
Because we used antibodies against all four known PMCA isozymes (see
Table 1), these data demonstrated that PMCA2a is the major bundle
isoform in rat hair cells, as it is in bullfrog hair cells. By
contrast, hair cells and supporting cells of the rat cochlea and
vestibular system use a variety of PMCA isozymes in their basolateral membranes.
 |
DISCUSSION |
Hair cells target PMCA isozymes to discrete subcellular locations.
In auditory and vestibular epithelia PMCA2a was the predominant calcium
pump of hair bundles; by contrast, PMCA1b was observed only on plasma
membranes of hair cell and supporting cell somas. Although we did not
detect PMCA4 in auditory or vestibular epithelia, we did observe PMCA3
in mammalian hair cells. This differential localization of PMCA
isoforms presumably reflects the need for independent
Ca2+ regulation in different cells and
within distinct subcellular compartments, such as the hair bundle (Fig.
8).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 8.
Schematic localization of PMCA isozymes in
auditory and vestibular epithelia. PMCA isozyme location is indicated
by black shading (intensity indicates relative amount)
and by arrows or arrowheads.
PMCA1 was located on basolateral membranes of bullfrog
and rat vestibular hair cells as well as inner hair cells. Occasional
labeling was seen on outer hair cell apical surfaces.
PMCA2 was present at high levels on bundles and apical
surfaces of vestibular hair cells and outer hair cells; levels were
lower on bundles of inner hair cells. In bullfrog sacculus the labeling
was also present in the pericuticular necklace. PMCA3
labeling was strong in the basolateral membranes of rat utriculus hair
cells; this isozyme was also present near the apical surface of inner
hair cells and, in some instances, in their bundles. HC,
Hair cell; PC N, pericuticular necklace;
SC, supporting cell; HC T-I, type I
vestibular hair cell; HC T-II, type II vestibular hair
cell.
|
|
PMCA isoforms in the bullfrog sacculus
In bullfrog sacculus we found prominent expression of PMCA1bx and
PMCA2av. Furthermore, sequential immunoprecipitation experiments suggested that PMCA2a is the only plasma membrane calcium pump in
bullfrog hair bundles, and PMCA1b is the principal one of the basolateral membrane. This conclusion rests on the assumption that the
monoclonal antibody 5F10 recognizes and binds all PMCA isoforms on
protein immunoblots. Although true for all four mammalian PMCA isoforms
(Caride et al., 1996 ), only when 5F10 can be tested against all
bullfrog PMCAs can we determine conclusively that no other PMCA
isoforms are located in hair bundles or hair cell plasma membranes.
Nevertheless, the conclusion that PMCA2a is the bundle isoform was
supported strongly by localization in the rat auditory and vestibular
systems; with the use of antibodies against all four PMCA isozymes,
PMCA2a was the only prominent hair bundle PMCA isozyme.
PMCA isoforms in the mammalian vestibular and auditory systems
In the organ of Corti the pan-PMCA monoclonal antibody
5F10 was used to localize PMCA to the surface of stereocilia of both inner and outer hair cells as well as along the basolateral membrane of
inner hair cells (Crouch and Schulte, 1995 ; Apicella et al., 1997 ;
Street et al., 1998 ). 5F10 immunoreactivity was absent from hair
bundles of mutant mice that lacked PMCA2 expression, suggesting that
this isozyme was prominent there (Street et al., 1998 ; Takahashi and
Kitamura, 1999 ). RT-PCR experiments identified PMCA1-4 gene products,
as well as many of their splice variants, in cochlea (Crouch and
Schulte, 1996 ; Furuta et al., 1998 ); furthermore, in situ
hybridization experiments localized PMCA2 transcripts to outer hair
cells and PMCA1 to inner hair cells (Furuta et al., 1998 ). Because PMCA
labeling was prominent in outer hair cells and PMCA2 transcripts were
localized there and because PMCA2b was the only PMCA2 splice variant
identified in cochlea by RT-PCR, PMCA2b was hypothesized to be the
stereocilia isoform (Crouch and Schulte, 1995 ; Furuta et al.,
1998 ).
We show here, however, that PMCA2a is the major hair bundle PMCA not
only in bullfrog sacculus but also in bundles of rat organ of Corti,
utriculus, and semicircular canal. Furthermore, we did not observe hair
bundle labeling using an antibody that recognizes the b
sequence shared by PMCA1b, PMCA2b, and PMCA3b. Because PMCA2 protein
levels in inner hair cells are very low, it is not surprising that
in situ hybridization experiments did not detect PMCA2
transcripts in inner hair cells (Furuta et al., 1998 ). Although we
occasionally detected low levels of PMCA1 in bundles of outer hair
cells and PMCA3 in bundles of inner hair cells, PMCA2a was detected
consistently at moderate (inner hair cells) to very high (outer hair
cells) levels, suggesting that this isozyme is the principal
Ca2+ pump of cochlear hair bundles.
The presence of PMCA1b in the basolateral membrane of inner hair cells
resembled its expression in the bullfrog and rat vestibular system. By
contrast, no substantial amounts of PMCA were identified in basolateral
membranes of outer hair cells (see Fig. 6A; Crouch and Schulte, 1995 ). This latter observation perhaps is not surprising, given the near-crystalline packing of outer hair cell intramembrane particles that are thought to correspond to the motor responsible for
electromotility (Forge, 1991 ). PMCA3 was also absent from outer hair
cells, although it was present in inner hair cells. We consistently
observed PMCA3 in a ring below the apical surface that resembled the
pericuticular necklace (Hasson et al., 1997 ), a region that is richly
endowed with intracellular vesicles; in addition, PMCA3 was observed
occasionally in bundles of inner hair cells. A possible interpretation
of this localization is that PMCA3 is stored in the necklace and is
mobilized into hair bundles of inner hair cells under appropriate
conditions. Finally, we found no evidence for PMCA4 in the organ of
Corti. Previous in situ hybridization experiments suggested
that PMCA4 is expressed in the cochlea at very low levels, with the
exception of a short period of expression in inner hair cells that
peaked at P12 (Furuta et al., 1998 ). Because our observations were
confined to older rats, our inability to detect this isozyme was unsurprising.
Localization and targeting of PMCA isozymes
Within hair cells and supporting cells PMCA isozymes are targeted
to the apical domain exclusively or to the basolateral domain exclusively. Although splice variants may allow localization within a
domain, these sequences may not be those that dictate basolateral or
apical targeting. Conclusive determination of targeting mechanisms for
individual PMCA isozymes must await closer experimental examination, for example by the expression of PMCA1bx-PMCA2av chimeras in hair cells.
Within a domain PMCA isozymes did not always appear to be distributed
uniformly within the membrane. Localization may be specified by
splicing region C alternative exons. Human PMCA2b and PMCA4b bind via
their C termini to several membrane-associated scaffolding proteins
that contain PDZ domains (Kim et al., 1998 ). Bullfrog PMCA1b contains
the same C-terminal sequence (-ETSL) as human PMCA2b, suggesting that
it too could bind PDZ proteins, which could localize this isozyme
within the hair cell.
PMCA2 sometimes appeared to be concentrated near stereocilia tips (see,
for example, Fig. 3G) and in a broad band near the base of
the hair bundle (see, for example, Fig. 3E; Yamoah et al.,
1998 ). Bundle PMCA uses the a splicing variant, however, which apparently does not bind any PDZ-containing proteins (Kim et al.,
1998 ). Localization of PMCA2av within stereocilia might rely instead on
the novel v variant within splicing region A. The 12 extra
amino acids encoded by v resemble sequences that bind to src
homology 3 (SH3) domains; although matching the minimal sequence, PxxP,
required for SH3 binding, v does not match the more
stringent general consensus Px P, where is a hydrophobic amino
acid (Sudol, 1998 ). Although this putative SH3-binding domain conceivably could target PMCA2av to or localize it in bullfrog sacculus
hair bundles, its absence from rat vestibular and auditory PMCA2
suggests that other localization mechanisms may be used in rat and
perhaps in bullfrog hair cells.
PMCA2a as the stereocilia calcium pump
We have shown previously that PMCA is present in bullfrog hair
bundles at the very high membrane density of
~2000/µm2 (Yamoah et al., 1998 ).
Furthermore, this PMCA can be sufficiently active during transduction
to generate a measurable outward current (Yamoah et al., 1998 ) and
extrude most of the Ca2+ that enters a
stereocilium during transduction (Lumpkin and Hudspeth, 1998 ). The data
presented here show that the calcium pump responsible for this activity
is PMCA2a.
Why is PMCA2a restricted to the hair bundle? The hair cell may target
PMCA2a to the hair bundle simply so that a high calcium pump
concentration can be established there. If all PMCA2a travels to the
hair bundle, the hair cell can regulate the membrane density of this
protein in the stereocilia by controlling PMCA2a transcription and translation.
In addition, PMCA2 may have catalytic or regulatory properties that may
be relevant for hair bundle physiology. First, PMCA2 isoforms have
significantly lower values of Km for
Ca2+ than do other isoforms, indicating
that they can lower Ca2+ to substantially
lower levels than can other isozymes (Elwess et al., 1997 ; Strehler and
Zacharias, 2001 ). Resting hair bundle Ca2+
is very low (Denk et al., 1995 ; Lumpkin and Hudspeth, 1998 ); bundles
may use PMCA to lower Ca2+ to insulate
them from Ca2+ fluxes in the soma (Lenzi
and Roberts, 1994 ) or to permit specific bundle functions, such as tip
link regeneration (Zhao et al., 1996 ). Second, calmodulin activates
PMCA2 isozymes with a substantially greater affinity than with other
PMCA isozymes; this affinity difference may be irrelevant, however,
because of the high hair bundle calmodulin concentration (~70
µM; Walker et al., 1993 ). Finally, the variant
used at splicing region C may be relevant for hair bundle function. For
example, protein kinase C phosphorylates the a form of
PMCA2, preventing stimulation of the pump by calmodulin (Enyedi et al.,
1997 ). Only when PMCA2a is expressed and purified can we determine all
of the properties that are significant for hair bundle function,
including the maximal pumping rate of the pump,
H+ stoichiometry (Hao et al., 1994 ), and
dependence on ATP, Ca2+, and calmodulin.
PMCA may have a broader role within hair bundles other than simply
removing Ca2+ that enters during
transduction or from the soma. Hair cells in lower vertebrates are
capable of Ca2+-triggered bundle movements
(Benser et al., 1996 ; Ricci et al., 2000 ), which may be required for
sensitive detection of periodic stimuli (Hudspeth et al., 2000 ; Manley,
2000 ). Indeed, a PMCA2a-established spatiotemporal
Ca2+ gradient at the
Ca2+-sensitive site of the channel could
provide the energy source for active bundle movements (Hudspeth, 1997 ).
In the auditory system PMCA2a is present in an exceptionally high
density in outer hair cells, which are responsible for local mechanical
amplification (Dallos, 1992 ). Amplification, which is required for
sensitive stimulus detection and sharp frequency discrimination, may be powered by somatic electromotility (Ashmore and Kolston, 1994 ) or hair
bundle mechanical activity (Hudspeth et al., 2000 ). By establishing the
necessary energy source, PMCA2a would play a central role in any
bundle-based mechanism.
 |
FOOTNOTES |
Received Feb. 22, 2001; revised April 26, 2001; accepted May 1, 2001.
This work was supported by National Institutes of Health Grants
DC00979, DC04571, and DC02368 (P.G.G.) and GM28835 and DC04200 (J.P.).
We thank Stefan Heller for the bullfrog sacculus cDNA library and David
Corey for the original image used for Figure 8.
Correspondence should be addressed to Dr. Peter G. Gillespie, Oregon
Hearing Research Center and Vollum Institute, L335A/Oregon Health
Sciences University, 3181 SW Sam Jackson Park Road, Portland OR 97201. E-mail: gillespp{at}ohsu.edu.
 |
REFERENCES |
-
Adamo HP,
Caride AJ,
Penniston JT
(1992)
Use of expression mutants and monoclonal antibodies to map the erythrocyte Ca2+ pump.
J Biol Chem
267:14244-14249[Abstract/Free Full Text].
-
Altschul SF,
Gish W,
Miller W,
Myers EW,
Lipman DJ
(1990)
Basic local alignment search tool.
J Mol Biol
215:403-410[Web of Science][Medline].
-
Apicella S,
Chen S,
Bing R,
Penniston JT,
Llinas R,
Hillman DE
(1997)
Plasmalemmal ATPase calcium pump localizes to inner and outer hair bundles.
Neuroscience
79:1145-1151[Web of Science][Medline].
-
Ashmore JF,
Kolston PJ
(1994)
Hair cell-based amplification in the cochlea.
Curr Opin Neurobiol
4:503-508[Medline].
-
Benaim G,
Moreno SN,
Hutchinson G,
Cervino V,
Hermoso T,
Romero PJ,
Ruiz F,
de Souza W,
Docampo R
(1995)
Characterization of the plasma membrane calcium pump from Trypanosoma cruzi.
Biochem J
306:299-303.
-
Benser ME,
Marquis RE,
Hudspeth AJ
(1996)
Rapid, active hair bundle movements in hair cells from the bullfrog's sacculus.
J Neurosci
16:5629-5643[Abstract/Free Full Text].
-
Borke JL,
Epstein FH,
Penniston JT,
Kumar R
(1989)
Localization of a plasma membrane Ca2+ pump in gill chloride cells and kidney distal tubule cells of the American eel, Anguilla rostrata.
Bull Mt Desert Island Biol Lab
28:48-51.
-
Carafoli E,
Stauffer T
(1993)
The plasma membrane calcium pump: functional domains, regulation of activity, and tissue specificity of isoform expression.
J Neurobiol
25:312-324.
-
Caride AJ,
Filoteo AG,
Enyedi A,
Verma AK,
Penniston JT
(1996)
Detection of isoform 4 of the plasma membrane calcium pump in human tissues by using isoform-specific monoclonal antibodies.
Biochem J
316:353-359.
-
Crawford AC,
Evans MG,
Fettiplace R
(1991)
The actions of calcium on the mechanoelectrical transducer current of turtle hair cells.
J Physiol (Lond)
434:369-398[Abstract/Free Full Text].
-
Crouch JJ,
Schulte BA
(1995)
Expression of plasma membrane Ca-ATPase in the adult and developing gerbil cochlea.
Hear Res
92:112-119[Web of Science][Medline].
-
Crouch JJ,
Schulte BA
(1996)
Identification and cloning of site C splice variants of plasma membrane Ca-ATPase in the gerbil cochlea.
Hear Res
101:55-61[Web of Science][Medline].
-
Dallos P
(1992)
The active cochlea.
J Neurosci
12:4575-4585[Web of Science][Medline].
-
Dechesne CJ,
Winsky L,
Kim HN,
Goping G,
Vu TD,
Wenthold RJ,
Jacobowitz DM
(1991)
Identification and ultrastructural localization of a calretinin-like calcium-binding protein (protein 10) in the guinea pig and rat inner ear.
Brain Res
560:139-148[Web of Science][Medline].
-
Dechesne CJ,
Rabejac D,
Desmadryl G
(1994)
Development of calretinin immunoreactivity in the mouse inner ear.
J Comp Neurol
346:517-529[Web of Science][Medline].
-
Denk W,
Holt JR,
Shepherd GM,
Corey DP
(1995)
Calcium imaging of single stereocilia in hair cells: localization of transduction channels at both ends of tip links.
Neuron
15:1311-1321[Web of Science][Medline].
-
de Talamoni N,
Smith CA,
Wasserman RH,
Beltramino C,
Fullmer CS,
Penniston JT
(1993)
Immunocytochemical localization of the plasma membrane calcium pump, calbindin-D28k, and parvalbumin in Purkinje cells of avian and mammalian cerebellum.
Proc Natl Acad Sci USA
90:11949-11953[Abstract/Free Full Text].
-
Eatock RA,
Corey DP,
Hudspeth AJ
(1987)
Adaptation of mechanoelectrical transduction in hair cells of the bullfrog's sacculus.
J Neurosci
7:2821-2836[Abstract].
-
Elwess NL,
Filoteo AG,
Enyedi A,
Penniston JT
(1997)
Plasma membrane Ca2+ pump isoforms 2a and 2b are unusually responsive to calmodulin and Ca2+.
J Biol Chem
272:17981-17986[Abstract/Free Full Text].
-
Enyedi A,
Verma AK,
Heim R,
Adamo HP,
Filoteo AG,
Strehler EE,
Penniston JT
(1994)
The Ca2+ affinity of the plasma membrane Ca2+ pump is controlled by alternative splicing.
J Biol Chem
269:41-43[Abstract/Free Full Text].
-
Enyedi A,
Elwess NL,
Filoteo AG,
Verma AK,
Paszty K,
Penniston JT
(1997)
Protein kinase C phosphorylates the "a" forms of plasma membrane Ca2+ pump isoforms 2 and 3 and prevents binding of calmodulin.
J Biol Chem
272:27525-27528[Abstract/Free Full Text].
-
Filoteo AG,
Elwess NL,
Enyedi A,
Caride A,
Aung HH,
Penniston JT
(1997)
Plasma membrane Ca2+ pump in rat brain. Patterns of alternative splices seen by isoform-specific antibodies.
J Biol Chem
272:23741-23747[Abstract/Free Full Text].
-
Forge A
(1991)
Structural features of the lateral walls in mammalian cochlear outer hair cells.
Cell Tissue Res
265:473-483[Web of Science][Medline].
-
Furuta H,
Luo L,
Hepler K,
Ryan AF
(1998)
Evidence for differential regulation of calcium by outer versus inner hair cells: plasma membrane Ca-ATPase gene expression.
Hear Res
123:10-26[Web of Science][Medline].
-
Gillespie PG,
Gillespie SK
(1997)
Improved electrophoresis and transfer of picogram amounts of protein with hemoglobin.
Anal Biochem
246:239-245[Web of Science][Medline].
-
Gillespie PG,
Hudspeth AJ
(1991)
High-purity isolation of bullfrog hair bundles and subcellular and topological localization of constituent proteins.
J Cell Biol
112:625-640[Abstract/Free Full Text].
-
Green MR
(1991)
Biochemical mechanisms of constitutive and regulated pre-mRNA splicing.
Annu Rev Cell Biol
7:559-599[Web of Science].
-
Guerini D,
Foletti D,
Vellani F,
Carafoli E
(1996)
Mutation of conserved residues in transmembrane domains 4, 6, and 8 causes loss of Ca2+ transport by the plasma membrane Ca2+ pump.
Biochemistry
35:3290-3296[Medline].
-
Guerini D,
Zecca-Mazza A,
Carafoli E
(2000)
Single amino acid mutations in transmembrane domain 5 confer to the plasma membrane Ca2+ pump properties typical of the Ca2+ pump of endo(sarco)plasmic reticulum.
J Biol Chem
275:31361-31368[Abstract/Free Full Text].
-
Hao L,
Rigaud JL,
Inesi G
(1994)
Ca2+/H+ countertransport and electrogenicity in proteoliposomes containing erythrocyte plasma membrane Ca-ATPase and exogenous lipids.
J Biol Chem
269:14268-14275[Abstract/Free Full Text].
-
Hasson T,
Gillespie PG,
Garcia JA,
MacDonald RB,
Zhao Y,
Yee AG,
Corey DP
(1997)
Unconventional myosins in inner ear sensory epithelia.
J Cell Biol
137:1287-1307[Abstract/Free Full Text].
-
Hilfiker H,
Guerini D,
Carafoli E
(1994)
Cloning and expression of isoform 2 of the human plasma membrane Ca2+-ATPase.
J Biol Chem
269:26178-26183[Abstract/Free Full Text].
-
Hudspeth AJ
(1997)
Mechanical amplification of stimuli by hair cells.
Curr Opin Neurobiol
7:480-486[Web of Science][Medline].
-
Hudspeth AJ,
Choe Y,
Mehta AD,
Martin P
(2000)
Putting ion channels to work: mechanoelectrical transduction, adaptation, and amplification by hair cells.
Proc Natl Acad Sci USA
97:11765-11772[Abstract/Free Full Text].
-
Jacobs RA,
Hudspeth AJ
(1990)
Ultrastructural correlates of mechanoelectrical transduction in hair cells of the bullfrog's internal ear.
Cold Spring Harb Symp Quant Biol
55:547-561[Abstract/Free Full Text].
-
Keeton TP,
Burk SE,
Shull GE
(1993)
Alternative splicing of exons encoding the calmodulin-binding domains and C termini of plasma membrane Ca2+-ATPase isoforms 1, 2, 3, and 4.
J Biol Chem
268:2740-2748[Abstract/Free Full Text].
-
Kim E,
DeMarco SJ,
Marfatia SM,
Chishti AH,
Sheng M,
Strehler EE
(1998)
Plasma membrane Ca2+-ATPase isoform 4b binds to membrane-associated guanylate kinase (MAGUK) proteins via their PDZ (PSD-95/Dlg/ZO-1) domains.
J Biol Chem
273:1591-1595[Abstract/Free Full Text].
-
Kozel PJ,
Friedman RA,
Erway LC,
Yamoah EN,
Liu LH,
Riddle T,
Duffy JJ,
Doetschman T,
Miller ML,
Cardell EL,
Shull GE
(1998)
Balance and hearing deficits in mice with a null mutation in the gene encoding plasma membrane Ca2+-ATPase isoform 2.
J Biol Chem
273:18693-18696[Abstract/Free Full Text].
-
Lenzi D,
Roberts WM
(1994)
Calcium signaling in hair cells: multiple roles in a compact cell.
Curr Opin Neurobiol
4:496-502[Medline].
-
Lumpkin EA,
Hudspeth AJ
(1998)
Regulation of free Ca2+ concentration in hair cell stereocilia.
J Neurosci
18:6300-6318[Abstract/Free Full Text].
-
Lumpkin EA,
Marquis RE,
Hudspeth AJ
(1997)
The selectivity of the hair cell's mechanoelectrical transduction channel promotes Ca2+ flux at low Ca2+ concentrations.
Proc Natl Acad Sci USA
94:10997-11002[Abstract/Free Full Text].
-
Manley GA
(2000)
Cochlear mechanisms from a phylogenetic viewpoint.
Proc Natl Acad Sci USA
97:11736-11743[Abstract/Free Full Text].
-
Petralia RS,
Wang YX,
Mayat E,
Wenthold RJ
(1997)
Glutamate receptor subunit 2-selective antibody shows a differential distribution of calcium-impermeable AMPA receptors among populations of neurons.
J Comp Neurol
385:456-476[Web of Science][Medline].
-
Ricci AJ,
Fettiplace R
(1998)
Calcium permeation of the turtle hair cell mechanotransducer channel and its relation to the composition of endolymph.
J Physiol (Lond)
506:159-173[Abstract/Free Full Text].
-
Ricci AJ,
Wu YC,
Fettiplace R
(1998)
The endogenous calcium buffer and the time course of transducer adaptation in auditory hair cells.
J Neurosci
18:8261-8277[Abstract/Free Full Text].
-
Ricci AJ,
Crawford AC,
Fettiplace R
(2000)
Active hair bundle motion linked to fast transducer adaptation in auditory hair cells.
J Neurosci
20:7131-7142[Abstract/Free Full Text].
-
Street VA,
McKee-Johnson JW,
Fonseca RC,
Tempel BL,
Noben-Trauth K
(1998)
Mutations in a plasma membrane Ca2+-ATPase gene cause deafness in deafwaddler mice.
Nat Genet
19:390-394[Web of Science][Medline].
-
Strehler EE,
Zacharias DA
(2001)
Role of alternative splicing in generating isoform diversity among plasma membrane calcium pumps.
Physiol Rev
81:21-50[Abstract/Free Full Text].
-
Sudol M
(1998)
From src homology domains to other signaling modules: proposal of the "protein recognition code."
Oncogene
17:1469-1474[Web of Science][Medline].
-
Takahashi K,
Kitamura K
(1999)
A point mutation in a plasma membrane Ca2+-ATPase gene causes deafness in Wriggle Mouse Sagami.
Biochem Biophys Res Commun
261:773-778[Web of Science][Medline].
-
Walker RG,
Hudspeth AJ,
Gillespie PG
(1993)
Calmodulin and calmodulin-binding proteins in hair bundles.
Proc Natl Acad Sci USA
90:2807-2811[Abstract/Free Full Text].
-
Yamoah EN,
Lumpkin EA,
Dumont RA,
Smith PJ,
Hudspeth AJ,
Gillespie PG
(1998)
Plasma membrane Ca2+-ATPase extrudes Ca2+ from hair cell stereocilia.
J Neurosci
18:610-624[Abstract/Free Full Text].
-
Zhao Y,
Yamoah EN,
Gillespie PG
(1996)
Regeneration of broken tip links and restoration of mechanical transduction in hair cells.
Proc Natl Acad Sci USA
93:15469-15474[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21145066-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Brini and E. Carafoli
Calcium Pumps in Health and Disease
Physiol Rev,
October 1, 2009;
89(4):
1341 - 1378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Stapelbroek, T. A. Peters, D. H. A. van Beurden, J. H. A. J. Curfs, A. Joosten, A. J. Beynon, B. M. van Leeuwen, L. M. van der Velden, L. Bull, R. P. Oude Elferink, et al.
ATP8B1 is essential for maintaining normal hearing
PNAS,
June 16, 2009;
106(24):
9709 - 9714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lelli, Y. Asai, A. Forge, J. R. Holt, and G. S. G. Geleoc
Tonotopic Gradient in the Developmental Acquisition of Sensory Transduction in Outer Hair Cells of the Mouse Cochlea
J Neurophysiol,
June 1, 2009;
101(6):
2961 - 2973.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Grimm, S. Jors, and S. Heller
Life and Death of Sensory Hair Cells Expressing Constitutively Active TRPML3
J. Biol. Chem.,
May 15, 2009;
284(20):
13823 - 13831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Sousa, L. R. Andrade, F. T. Salles, A. M. Pillai, E. D. Buttermore, M. A. Bhat, and B. Kachar
The Septate Junction Protein Caspr Is Required for Structural Support and Retention of KCNQ4 at Calyceal Synapses of Vestibular Hair Cells
J. Neurosci.,
March 11, 2009;
29(10):
3103 - 3108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Grimm, M. P. Cuajungco, A. F. J. van Aken, M. Schnee, S. Jors, C. J. Kros, A. J. Ricci, and S. Heller
A helix-breaking mutation in TRPML3 leads to constitutive activity underlying deafness in the varitint-waddler mouse
PNAS,
December 4, 2007;
104(49):
19583 - 19588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Lang, V. Vallon, M. Knipper, and P. Wangemann
Functional significance of channels and transporters expressed in the inner ear and kidney
Am J Physiol Cell Physiol,
October 1, 2007;
293(4):
C1187 - C1208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Avissar, A. C. Furman, J. C. Saunders, and T. D. Parsons
Adaptation Reduces Spike-Count Reliability, But Not Spike-Timing Precision, of Auditory Nerve Responses
J. Neurosci.,
June 13, 2007;
27(24):
6461 - 6472.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. P. Raybould, D. J. Jagger, R. Kanjhan, D. Greenwood, P. Laslo, N. Hoya, C. Soeller, M. B. Cannell, and G. D. Housley
TRPC-like conductance mediates restoration of intracellular Ca2+ in cochlear outer hair cells in the guinea pig and rat
J. Physiol.,
February 15, 2007;
579(1):
101 - 113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ficarella, F. Di Leva, M. Bortolozzi, S. Ortolano, F. Donaudy, M. Petrillo, S. Melchionda, A. Lelli, T. Domi, L. Fedrizzi, et al.
A functional study of plasma-membrane calcium-pump isoform 2 mutants causing digenic deafness
PNAS,
January 30, 2007;
104(5):
1516 - 1521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Hill, C. L. Brett, A. Chyou, L. M. Kallay, M. Sakaguchi, R. Rao, and P. G. Gillespie
Vestibular Hair Bundles Control pH with (Na+, K+)/H+ Exchangers NHE6 and NHE9
J. Neurosci.,
September 27, 2006;
26(39):
9944 - 9955.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Grati, N. Aggarwal, E. E. Strehler, and R. J. Wenthold
Molecular determinants for differential membrane trafficking of PMCA1 and PMCA2 in mammalian hair cells
J. Cell Sci.,
July 15, 2006;
119(14):
2995 - 3007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Duncan, H. Yang, T. Doan, R. S. Silverstein, G. J. Murphy, G. Nune, X. Liu, D. Copenhagen, B. L. Tempel, F. Rieke, et al.
Scotopic visual signaling in the mouse retina is modulated by high-affinity plasma membrane calcium extrusion.
J. Neurosci.,
July 5, 2006;
26(27):
7201 - 7211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Hill, D. E. Williams, M. LeMasurier, R. A. Dumont, E. E. Strehler, and P. G. Gillespie
Splice-site A choice targets plasma-membrane Ca2+-ATPase isoform 2 to hair bundles.
J. Neurosci.,
June 7, 2006;
26(23):
6172 - 6180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Grati, M. E. Schneider, K. Lipkow, E. E. Strehler, R. J. Wenthold, and B. Kachar
Rapid turnover of stereocilia membrane proteins: evidence from the trafficking and mobility of plasma membrane Ca(2+)-ATPase 2.
J. Neurosci.,
June 7, 2006;
26(23):
6386 - 6395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Reiners, E. van Wijk, T. Marker, U. Zimmermann, K. Jurgens, H. te Brinke, N. Overlack, R. Roepman, M. Knipper, H. Kremer, et al.
Scaffold protein harmonin (USH1C) provides molecular links between Usher syndrome type 1 and type 2
Hum. Mol. Genet.,
December 15, 2005;
14(24):
3933 - 3943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Hackney, S. Mahendrasingam, A. Penn, and R. Fettiplace
The Concentrations of Calcium Buffering Proteins in Mammalian Cochlear Hair Cells
J. Neurosci.,
August 24, 2005;
25(34):
7867 - 7875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Schultz, Y. Yang, A. J. Caride, A. G. Filoteo, A. R. Penheiter, A. Lagziel, R. J. Morell, S. A. Mohiddin, L. Fananapazir, A. C. Madeo, et al.
Modification of Human Hearing Loss by Plasma-Membrane Calcium Pump PMCA2
N. Engl. J. Med.,
April 14, 2005;
352(15):
1557 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Xiang, D. Mohamalawari, and R. Rao
A Novel Isoform of the Secretory Pathway Ca2+,Mn2+-ATPase, hSPCA2, Has Unusual Properties and Is Expressed in the Brain
J. Biol. Chem.,
March 25, 2005;
280(12):
11608 - 11614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Desai, C. Zeh, and A. Lysakowski
Comparative Morphology of Rodent Vestibular Periphery. I. Saccular and Utricular Maculae
J Neurophysiol,
January 1, 2005;
93(1):
251 - 266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. A. Reinhardt, J. D. Lippolis, G. E. Shull, and R. L. Horst
Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2 Impairs Calcium Transport into Milk
J. Biol. Chem.,
October 8, 2004;
279(41):
42369 - 42373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Rzadzinska, M. E. Schneider, C. Davies, G. P. Riordan, and B. Kachar
An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal
J. Cell Biol.,
March 15, 2004;
164(6):
887 - 897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Si, H. Brodie, P. G. Gillespie, A. E. Vazquez, and E. N. Yamoah
Developmental Assembly of Transduction Apparatus in Chick Basilar Papilla
J. Neurosci.,
November 26, 2003;
23(34):
10815 - 10826.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Chicka and E. E. Strehler
Alternative Splicing of the First Intracellular Loop of Plasma Membrane Ca2+-ATPase Isoform 2 Alters Its Membrane Targeting
J. Biol. Chem.,
May 9, 2003;
278(20):
18464 - 18470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Cyr, R. A. Dumont, and P. G. Gillespie
Myosin-1c Interacts with Hair-Cell Receptors through Its Calmodulin-Binding IQ Domains
J. Neurosci.,
April 1, 2002;
22(7):
2487 - 2495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. DeMarco, M. C. Chicka, and E. E. Strehler
Plasma Membrane Ca2+ ATPase Isoform 2b Interacts Preferentially with Na+/H+ Exchanger Regulatory Factor 2 in Apical Plasma Membranes
J. Biol. Chem.,
March 15, 2002;
277(12):
10506 - 10511.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|