 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2001, 21(15):5439-5448
Paralytic Zebrafish Lacking Acetylcholine Receptors Fail to
Localize Rapsyn Clusters to the Synapse
Fumihito
Ono1,
Shin-ichi
Higashijima1, 2, 3,
Anatoly
Shcherbatko1,
Joseph R.
Fetcho1, and
Paul
Brehm1
1 Department of Neurobiology and Behavior, State
University of New York at Stony Brook, Stony Brook, New York 11794, 2 Precursory Research for Embryonic Science and Technology,
Japan Science and Technology Corporation, Tokyo, Japan 332-0012, and
3 National Institute for Basic Biology, Okazaki, Japan
351-0198
 |
ABSTRACT |
Physiological analysis of two lines of paralytic mutant zebrafish,
relaxed and sofa potato, reveals defects
in distinct types of receptors in skeletal muscle. In sofa
potato the paralysis results from failed synaptic transmission
because of the absence of acetylcholine receptors, whereas
relaxed mutants lack dihydropyridine receptor-mediated
release of internal calcium in response to the muscle action potential.
Synaptic structure and function appear normal in
relaxed, showing that muscle paralysis per se does not impede proper synapse development. However, sofa potato
mutants show incomplete development of the postsynaptic complex.
Specifically, in the absence of ACh receptors, clusters of the
receptor-aggregating protein rapsyn form in the extrasynaptic membrane
but generally fail to localize to the subsynaptic region. Our results
indicate that, although rapsyn molecules are capable of
self-aggregation, interaction with ACh receptors is required for proper
subsynaptic localization.
Key words:
zebrafish; mutant; neuromuscular junction; acetylcholine
receptor; dihydropyridine receptor; rapsyn; clustering
 |
INTRODUCTION |
Studies using lines of mutant
zebrafish have advanced our understanding of nervous system development
significantly. In particular, many key components governing
early differentiation have been identified. By contrast, few studies
have used mutant zebrafish to identify key components involved in the
physiological dysfunction of either nerve or muscle. Notable exceptions
are studies on the paralytic mutant fish, nic, shown to
result from a mutation in the subunit of the muscle nicotinic
receptor (Westerfield et al., 1990 ) and macho, a
touch-insensitive mutant, shown to lack Na+ channel function in the afferent
sensory cells of the nervous system (Ribera and Nüsslein-Volhard,
1998 ). Surprisingly little attention has been paid to the mechanisms
causal to locomotory dysfunction, given the large number of available
mutant lines generated by ethylnitrosourea. These locomotory
dysfunctional mutant lines exhibit behavioral manifestations ranging
from uncoordinated swimming to total paralysis (Granato et al., 1996 ).
To explore the physiological underpinnings of these locomotory
problems, we initiated a hierarchical battery of morphological and
physiological analyses. In particular, we used two lines of transgenic
fish, one stably expressing green fluorescent protein (GFP) in motor neurons and the other stably expressing a rapsyn-GFP fusion protein in
muscle, together enabling analysis of presynaptic and postsynaptic structures in vivo. This hierarchical approach provided for
assignment of the dysfunction to the motor neuron, nerve-muscle
synapse, or muscle proper. Our findings indicated two different and
individually well characterized muscle receptor types as causal to the
paralysis of sofa potato (sop) and
relaxed (red) mutant lines. In the process of
revealing the molecular mechanisms responsible for paralysis, we
discovered, quite unexpectedly, a previously unidentified role for the
acetylcholine receptor. Sofa potato mutant fish form
membrane clusters of the receptor-associated protein rapsyn, but these clusters localize poorly to subsynaptic membrane because of the absence
of the ACh receptor.
 |
MATERIALS AND METHODS |
Strains of fish. Mutant fish, sop
tj19d (sofa potato) and
red ts25a (relaxed), were
obtained from The Max Planck Institute (Tübingen, Germany)
(Granato et al., 1996 ). After the cross of heterozygote parents,
homozygous relaxed or sofa potato embryos were
selected on the basis of an inability to move in response to touch. For some experiments sofa potato and relaxed fish
were crossed with fish expressing GFP under control of the
neural-specific Islet-1 promoter (Higashijima et al., 2000 ),
and embryos that were heterozygous for the GFP transgene and homozygous
for sop or red genes were tested. Another stable
line of fish was developed that expressed a gene encoding a rapsyn-GFP
fusion protein. To make the rapsyn-GFP construct, we amplified
the mouse rapsyn coding sequence cDNA by PCR from embryonic mouse day
17 (E17) cDNA (Clontech, Palo Alto, CA). The primers used were
5', CTAGAATTCGCCACCATGGGGCAGGACCAGAC, and
3', TCTGGATCCACAAAGCCCGGCTT. The
EcoRI and BamHI sites used in the cloning are
underlined. The 5'-primer also included a Kozak consensus sequence for
initiation of the translation. The amplified rapsyn cDNA was subcloned
into pEGFP-N1 (Clontech). To make the final plasmid construct for the
-actin/rapsyn-GFP transgene fish, we subcloned, in this order, the
zebrafish -actin promoter sequence (Higashijima et al., 1997 ), the
rapsyn-GFP cDNA, and bovine growth hormone poly(A) signal, derived
from pcDNA3 (Invitrogen, Carlsbad, CA), in the pBluescript SK vector
(Stratagene, La Jolla, CA). Generation of transgenic fish was performed
as reported previously (Higashijima et al., 1997 ). One of 10 fish
produced fluorescent embryos.
Imaging of neurons and neuromuscular junctions. For in
vivo imaging, fluorescent embryos were anesthetized first in 10%
Hank's solution with 0.02% MS222 (Fetcho and O'Malley, 1995 ),
embedded in 1% agarose, and mounted on a coverslip. The nerve and
muscle were visualized through the transparent skin with an inverted Zeiss 510 confocal laser-scanning microscope (Oberkochen, Germany). To
label the ACh receptors in GFP-expressing lines, we peeled the skin
from the opposite side of the fish to allow for access of
rhodamine-conjugated -bungarotoxin (Molecular Probes, Eugene, OR).
The fish were kept in 100% Hank's solution containing
10 7
M toxin for 15 min. Then the fish were washed for
2 hr in toxin-free Hank's solution to remove nonspecific binding of
the toxin.
Immunohistochemical labeling was performed on 5-d-old fish that were
fixed with 4% paraformaldehyde at 4°C. The fish were washed with
distilled water for 5 min, treated with acetone for 7 min at 20°C,
and thoroughly washed again with water. After incubation in PBS
(Life Technologies, Grand Island, NY) containing 2% horse serum
and 0.5% Triton X-100, the fish were treated with the primary antibody
(mAb35; 1:3000; Research Biochemicals, Natick, MA). After thorough
washing, the fish were incubated with an FITC-conjugated donkey
anti-rat IgG secondary antibody (1:100). The fish were washed for an
additional 2 hr before testing.
To view synaptic terminals in the rapsyn-GFP line of fish, we
anterogradely labeled motor neurons with Texas Red-dextran (Molecular Probes). For this purpose, injection electrodes with a tip diameter of
~15 µm were filled with a solution containing 50 mg/ml dye. The tip
of the electrode was inserted into the spinal cord. Within seconds the
dye diffused out the tip, and the electrode was withdrawn immediately.
Within 15 min after injection the fluorescence was observed to label
the motor neurons and their associated terminals.
Colocalization of Texas Red-labeled terminals and rapsyn-GFP was
quantitated by off-line analysis of confocal images. The fractional
area of red-positive pixels in a 1024 × 1024 unprocessed image
that also scored positive for green was used to compute the coefficient
of colocalization for each field. Green-positive pixels lacking
associated red-positive pixels are expected to occur, because some
nerve terminals were not labeled in the injection process. The myosepta
regions were excluded from analysis because this area represents the
largest tract of axons of the motor neurons. Multiple fields were
counted in each fish; typically, a single field comprised approximately
one-half of a body segment. The detection threshold for scoring a pixel
as either green- or red-positive was set to the midpoint of the full
range of intensities for that color, measured for each image.
For measurement of GFP fluorescence of motor neurons and rapsyn-GFP,
excitation was 488 nm and emission was bandpass-filtered between 505 and 530 nm. The fluorescence associated with both Texas Red and
rhodamine was viewed by using 543 nm excitation and 560 nm long-pass
emission filter. FITC immunohistochemical labeling of ACh receptors
used 488 nm excitation and 505-550 nm emission filter.
Measurements from dissociated myocytes. To obtain individual
muscle cells, we decapitated anesthetized fish between the ages of 3 and 5 d and cut them into several pieces. The pieces were treated
with 1% collagenase for 1 hr and triturated; the dissociated muscle
cells were plated on either plastic dishes or
poly-L-lysine-treated glass coverslips. Then the coverslips
were flooded with the culture medium containing 60% L-15 (Life
Technologies), 10 mM HEPES, 100 U/ml
penicillin/streptomycin, and 0.5% horse serum. Adherent phase-bright myocytes were used on the same day or the day after dissociation.
To stain for T-tubules, we soaked dissociated myocytes from wild-type
and relaxed mutant fish in solution containing 5 µM of Di-8-ANEPPS (Molecular Probes) for 2 min
and then washed and viewed them with a Plan Apochromatic 100×
objective (numerical aperture, 1.4), using 488 nm excitation and 560 nm
long-pass filter. To disrupt T-tubules, we treated the myocytes with 2 M formamide for 15 min, followed by a 40 min
wash. Finally, the myocytes were labeled with Di-8-ANEPPS as described above.
Intracellular calcium responses to caffeine were measured in
dissociated muscle from both wild-type or relaxed mutants.
Dissociated myocytes from day 3 fish were soaked in an extracellular
solution containing 5 µM fura-2 AM for 15 min
and washed in a fura-free solution for an additional 15 min. The
extracellular solution contained (in mM) 100 NaCl, 2 KCl, 2 CaCl2, 1 MgCl2, 5 HEPES, and 3 glucose, pH 7.4. The method
for photometric calcium measurement was similar to that described
previously (Heidelberger and Matthews, 1992 ). A stable baseline
fluorescence signal was established by using excitation wavelengths of
360 and 390 nm with a photo multiplier tube. Calcium transients were
measured in response to puffer application of either a high
K+ or caffeine solution. For caffeine
application, 3 mM caffeine was diluted into the
extracellular solution. The high potassium solution contained (in
mM) 50 NaCl, 52 KCl, 2 CaCl2, 1 MgCl2, 5 HEPES,
and 3 glucose, pH 7.4. Signals were obtained with X-chart in Macintosh,
and the ratio of emissions at 360 and 390 nm excitations was calculated.
Electrophysiology of dissociated cells. Patch-clamp
recordings of myocytes were made by the whole-cell ruptured technique. Patch pipettes were pulled to an outer diameter of 2-3 µm and fire-polished immediately before use. The electrode resistance corresponded to 3-5 M , and the access resistance after rupture was
10-20 M . The pipette solution used for current-clamp recording of
the myocyte action potential and voltage-clamp recording of ACh-activated current contained (in mM) 120 KCl, 5 BAPTA,
and 5 HEPES, pH 7.1. For voltage-clamp recording of
Na+ current the pipette solution contained
(in mM) 58 CsCH3SO3, 32 CsCl, 10 EGTA,
and 10 HEPES, pH 7.1. The extracellular solution for both current- and
voltage-clamp recordings contained (in mM) 100 NaCl, 2 KCl,
0.2 CaCl2, 2.8 MgCl2, 3 glucose, and 5 HEPES, pH 7.4. Membrane currents were recorded with an
EPC-9 amplifier (List Electronics, Darmstadt-Eberstad, Germany). The
currents were sampled at 50 kHz and filtered at 3-5 kHz before
analysis. Capacitive transients were compensated by using a combination of manual compensation on the amplifier and a P/10 protocol. Data were
analyzed with Pulsefit (HEKA, Lambrecht, Germany) and IgorPro (WaveMetrics, Lake Oswego, OR) software.
For the recording of dihydropyridine (DHP) charge movement in myocytes,
a prepulse protocol similar to that described by Adams et al. (1990)
was used with some modifications. The command voltage was stepped from
a holding potential of 90 to 30 mV for 250 msec, then to 50 mV
for 5 msec, then to the test potential for 20 msec, and finally back to
90 mV. The pipette solution contained (in mM) 130 Cs-aspartate, 5 MgCl2, 10 EGTA, and 10 HEPES, pH
7.1. External solution contained (in mM) 130 TEA-Cl, 10 CaCl2, 1 MgCl2, 10 HEPES,
0.5 CdCl2, and 0.1 LaCl3,
pH 7.4.
In vivo recording of synaptic currents. Embryos at days
6 or 7 were fixed with tungsten pins to a 35 mm plastic dish coated with Sylgard (Dow Corning, Midland, MI) and placed under a stereo microscope. The dish was flooded with a recording solution containing (in mM) 105 NaCl, 4 CaCl2, 1 MgCl2, 2 KCl, 5 HEPES, and 3 glucose, pH 7.4. For
mutants, only embryos with vigorous heartbeat were used for the
experiment. The skin was peeled from one side of the fish with tungsten
needles and forceps to allow access to muscle. The recording techniques
were similar to those used for dissociated myocytes. The pipette
solution contained (in mM) 120 KCl, 5 HEPES, and 5 BAPTA,
pH 7.1. To stimulate the spinal cord, we pressed etched platinum wire
electrodes on the body surface from above and below the fish at the
level of spinal cord. With the exception of the fine tip, each
electrode was insulated along the entire length with a coating of
glass. Attempts were made to locate the stimulating and recording
electrodes in the same segments of the tail. Spinal neurons were
stimulated with a Grass Instruments (West Warwick, RI) model SD5
stimulator, and the stimulus strength was adjusted to the lowest
voltage that consistently would evoke synaptic responses in muscle.
With short pulse durations of 60-100 µsec, the stimulus amplitude
generally corresponded to 5-20 V.
 |
RESULTS |
Sofa potato mutant fish lack
acetylcholine receptors
Homozygous sofa potato mutants were identified by their
inability to swim when prodded mechanically. Direct depolarization of
dissociated myotomal muscle, via either fast application of a high
K+ solution or electrical stimulation,
resulted in muscle contractures that were similar to those of wild-type
fish. These results indicated that the dysfunction is likely to reside
upstream of excitation-contraction coupling in this mutant line.
To investigate upstream signaling, we excited spinal motor neurons by
extracellular stimulation of the spinal cord. In wild-type embryos,
increasing stimulus strength resulted in visible contractions of
segmental muscle. However, stimulation of sofa potato
embryos resulted in no visible contractions at similar stimulus
intensity, consistent with the idea that the defect was in either motor
neuron excitability or neuromuscular transmission. Synaptic function was tested directly by means of patch-clamp recording of myotomal muscle in intact, restrained fish. In wild-type fish both spontaneous and stimulus-evoked synaptic currents could be recorded (Fig. 1). Both forms of synaptic response were
blocked after the addition of
10 7
M -bungarotoxin ( -Btx). By contrast,
recordings from muscle of sofa potato fish indicated no
signs of either spontaneous or evoked synaptic currents (Fig. 1).

View larger version (87K):
[in this window]
[in a new window]
|
Figure 1.
Expression of cytoplasmic GFP in motor neurons of
wild-type and mutant fish. Left, The somas and axons of
secondary motor neurons expressing the GFP are visualized (see
Materials and Methods). The stacked images were obtained from intact
fish because of the transparency of the skin. The skin exhibits
autofluorescence that can be detected along the top edge of the body.
The wild-type and both mutant fish were 5 d old. Scale bar, 50 µm. Right, Electrophysiological recordings of evoked
synaptic currents from voltage-clamped muscle cells after extracellular
stimulations of spinal cord (see Materials and Methods). The stimulus
artifact precedes the synaptic response in muscle. Note the lack of
response in sofa potato muscle.
|
|
To determine whether synaptic failure originated from presynaptic or
postsynaptic dysfunction, we tested the ability of muscle to respond to
direct application of ACh. For this purpose we dissociated individual
muscle cells from wild-type and sofa potato mutant fish and
measured inward current responses to applied ACh (Fig. 2). In all eight wild-type muscle cells
that were tested at 90 mV, large responses to puffer-applied 10 µM ACh were observed. By contrast, all
sofa potato muscle cells that were tested failed to show
inward current responses to applied ACh. These results pointed to an
absence of functional ACh receptors as causal to the paralysis.

View larger version (74K):
[in this window]
[in a new window]
|
Figure 2.
Labeling of ACh receptors by -bungarotoxin and
immunohistochemistry. Shown is the response of muscle cells from
5-d-old wild-type (top trace) and sofa
potato (bottom trace) fish to transiently
applied 10 µM ACh. Note the lack of response by
sofa potato muscle. Muscle from wild-type/Isl1-GFP
(top) and sofa potato/Isl1-GFP
(bottom) lines was treated with
rhodamine- -bungarotoxin. In the top panel the
red fluorescence in wild-type muscle corresponds to the
location of ACh receptors. The green fluorescence from
the cytoplasmic GFP indicates the location of axons and synaptic
terminals. The plane of focus was set at a different level from the
spinal cord so that the somata of motor neurons are not seen. In
sofa potato fish (bottom) the
green fluorescence resulting from GFP is observed, but
no red fluorescence corresponding to rhodamine- -Btx
is observed. The right panels show black and white
images of mAb35 labeling of ACh receptors in fixed muscle from 5-d-old
fish. Some autofluorescence from the skin is seen along the edge of the
tail. Fluorescence that is associated with the labeling of ACh
receptors is absent in sofa potato muscle. Scale bars,
50 µm.
|
|
To determine whether postsynaptic ACh receptors were present but not
functional, we labeled intact fish with rhodamine-conjugated -Btx
(Rh- -Btx; Fig. 2). Muscle from wild-type fish exhibited intense
staining at both the ends of the muscle cells and at discrete sites
within the muscle cells. However, no labeling was observed in muscle
from sofa potato. Even after dissociation, careful scrutiny of the muscle surface revealed no evidence of labeling by -Btx in
these mutant fish. As further evidence that the receptors were absent,
we labeled muscle by using the mAb35 monoclonal antibody which is
directed against epitopes on the subunit of the receptor that are
different from the -Btx binding. In muscle from wild-type fish,
mAb35 labeling revealed a receptor distribution consistent with the
findings based on an -Btx staining site (Fig. 2, Anti-AChR; Saedi et
al., 1990 ). However, in sofa potato fish the mAb35 failed to
exhibit any specific labeling, as was observed for -Btx staining. Thus, the collective results from Btx and mAb35 labeling indicate that
ACh receptors are absent in muscle from sofa potato fish.
To determine whether the paralysis hindered differentiation of the
innervating motor neurons, we crossed sofa potato fish with
wild-type fish stably expressing GFP in the nervous system (Higashijima
et al., 2000 ). The expression of GFP in the parental transgenic line
was restricted, primarily to the cranial motor neurons and secondary
motor neurons in the trunk (Fig. 1). The motor neurons projecting to
ventral muscle, however, were not well labeled, so we restricted our
analysis to dorsal muscle. The labeling in these neurons was so intense
that it was possible to resolve the projections as well as the
individual terminals in both sofa potato and wild-type fish.
In sofa potato fish, lacking ACh receptors and synaptic
transmission, it appears that the motor neurons are still capable of
forming terminal-like endings on the myotomal muscle (Fig. 1).
Relaxed mutant lacks proper
excitation-contraction coupling
Unlike sofa potato fish, homozygous relaxed
mutants were unable to contract their myotomal tail muscle in response
to direct extracellular electrical stimulation. Additionally,
depolarization of dissociated tail muscle from relaxed
mutants showed no ability to contract in response to the rapid
application of high K+ solution. These
results indicated that the defect in relaxed resided
downstream of synaptic transmission, in the muscle proper. Therefore,
our starting point for physiological analyses of this mutant line was
analysis of muscle function.
Whole-cell patch-clamp measurements from relaxed myotomal
muscle indicated that excitability was intact (Fig.
3A). First, current-clamp
recordings from dissociated muscle revealed
Na+-based action potentials at
depolarization that were similar to wild-type muscle cells (Fig.
3A). Second, whole-cell voltage-clamp recordings from
relaxed muscle revealed robust voltage-dependent Na+ currents that were similar, in both
voltage dependence and kinetics, to those in wild-type muscle (Fig.
3A). The finding that relaxed muscle can generate
action potentials pointed to a dysfunction further downstream than
membrane excitation mechanisms.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 3.
Relaxed mutant fish show
functional defects in DHP receptors. A, Top
traces, Voltage records from a dissociated myocyte from
relaxed fish showing responses to current injection. One
trace shows a subthreshold passive response, and a second trace shows a
muscle action potential when the stimulus strength was increased. The
dashed line denotes 0 mV. Bottom traces,
Inward Na+ currents in response to 10 msec test
pulses from muscle cells of relaxed mutant fish. The
potential was stepped from 90 mV in 10 mV increments to test
potentials ranging from 50 to +10 mV. B, Photometric
measurements of intracellular calcium levels in wild-type and
relaxed myocytes. Shown are the changes in ratio of
fura-2 AM fluorescence measured at 360 and 390 nm wavelength
excitation. The wild-type muscle responses to puffer-applied 52 mM K+ solution and 3 mM
caffeine solution are indicated by the arrows. Muscle
from relaxed mutant fish responded to caffeine but
failed to respond to high K+ solution.
C, Dissociated myotubes from wild-type and
relaxed mutants stained with Di-8-ANNEPS show the
distribution of z-bands. Disruption of wild-type T-tubules by treatment
with 2 M formamide led to a disappearance of the
fluorescence labeling by the dye. Scale bar, 5 µm. D,
Whole-cell recordings of charge displacement in myocytes from wild-type
and relaxed fish are shown. Traces from muscle cells of
similar sizes, capacitance, and age (3 d old) are shown for wild-type
and mutant fish. The responses to the test potentials are indicated.
The voltage protocols and solutions that were used to eliminate ionic
and capacitive currents are indicated in Materials and Methods. In the
associated plot the charge movement integrals
(Qon) for wild-type
(filled circles) and relaxed
(filled triangles) fish are plotted against test
potential voltages. The mean values and SDs for seven muscle cells are
shown. The data are fit according to:
Qon = Qmax/{1 + exp [ (V V1/2Q)/kQ]},
where Qmax is the maximum charge,
V1/2Q is the voltage at which one-half of
the charge has moved, and kQ is a slope
factor. For the fitted curve of wild-type
Qon shown in the graph,
Qmax = 10.8, V1/2Q = 9.85, and
kQ = 11.1.
|
|
A defect in contractile machinery proper could be excluded by
experiments in which caffeine was applied directly to dissociated muscle. When 3 mM caffeine was puffed on either muscle from
relaxed or wild-type fish, contractions ensued. Caffeine is
known to cause the direct release of internal calcium via activation of
the ryanodine receptor, the physiological trigger for a normal release
of calcium. To establish further that these contractions were a
consequence of calcium release, we loaded muscle from
relaxed and wild-type fish with a fura-2 AM calcium
indicator. Photometric measurements of internal calcium levels with the
fura-2 AM indicator were used to follow calcium concentration changes
in muscle (Fig. 3B). Application of either high
K+ solution or a solution containing 3 mM caffeine led to transient and large increases
in internal calcium in wild-type muscle. By contrast, high
K+ solution did not alter internal calcium
levels in muscle from relaxed mutants. However, as in
wild-type muscle, 3 mM caffeine elicited calcium
responses in relaxed muscle. These findings circumscribed a
radius of dysfunction in relaxed residing somewhere between the muscle action potential and the release of internal calcium.
Coupling between the muscle action potential and intracellular calcium
release requires that the action potential propagate into the T-tubular
system and subsequently activate DHP receptors via depolarization. We
first explored the possibility that T-tubules may be disrupted
physically in the muscle of relaxed, thereby interrupting
the propagation of the action potential. For this purpose, individual
dissociated muscle cells were stained with a membrane-selective dye
Di-8-ANEPPS, a dye that specifically labels plasma membrane and
T-tubular membrane (Huser et al., 1996 ; Lipp et al., 1996 ). In
dissociated muscle from wild-type fish, clear labeling of the z-band
regions by the dye was observed (Fig. 3C). In muscle cells
pretreated with formamide to break the connection between the T-tubules
and the muscle plasma membrane, no staining of z-bands was observed.
Labeling of relaxed mutant muscle by Di-8-ANEPPS was similar
to that obtained for wild-type muscle, indicating that the disruption
of T-tubules was not causal to paralysis.
Dysfunction at the level of DHP receptors was examined by recording the
DHP gating charge movements elicited by muscle membrane depolarization.
In mammalian muscle the proper functioning of this population of
voltage-sensing receptors is reflected in the large charge movements
recorded at their simultaneous activation (Melzer et al., 1995 ). To
observe charge movements of the DHP receptors, we first blocked all
active conductances in the muscle cells. Ionic currents were blocked by
the use of an external solution containing low concentrations of
Na+ along with the calcium channel
blockers Cd2+ and
La3+. Outward
K+ current was blocked by the inclusion of
Cs+ in the pipette. The charge movements
associated with the Na+ channel activation
were attenuated by the use of a conditioning depolarization that
inactivated the channels. Muscle membrane capacitive currents were
compensated, and residual currents were subtracted from the records by
means of P/10 protocols. The residual current observed during test
pulse depolarizations reflects the DHP gating charge (Adams et al.,
1990 ). This method resulted in currents that could be recorded on
depolarization, which were ascribed to charge movements of the DHP
receptor (Fig. 3D). In wild-type muscle we recorded
asymmetrical on- and off-gating currents over a range of potentials.
When the integrals of on-gating charge movement were calculated and
plotted against membrane voltage, the plots were fit well with the
Boltzmann equation (Fig. 3D). The parameters gained from
fitting were close to those observed in intramembrane charge movement
in mouse (Adams et al., 1990 ). In contrast to the robust on- and
off-gating charge movements in wild-type muscle, recordings from
paralytic muscle revealed severely reduced charge movements. In three
muscle cells that were tested from relaxed we were unable to
record any gating charge movements. We therefore suspect dysfunctional
DHP receptors as the culprit protein, rendering excitation-contraction
coupling in relaxed muscle ineffective.
As with sofa potato we crossed the motor neuron-GFP line
with relaxed to generate paralytic fish with fluorescent
motor neurons. Comparisons of the overall morphology of the GFP-labeled
motor neurons in relaxed showed no obvious difference
from wild type (Fig. 1). Furthermore, recordings of synaptic
currents from voltage-clamped muscle cells in relaxed
indicated that synaptic function is unaffected by the mutation (Fig.
1). Thus, muscle paralysis has no obvious deleterious effects on either
the motor neuron morphology or neuromuscular transmission.
Postsynaptic organization is disrupted in
sofa potato
The specific absence of ACh receptors at neuromuscular junctions
in sofa potato embryos raised the question of the
distribution and function of ACh receptor-associated proteins.
Intimately associated with ACh receptors at the synapses are rapsyn
molecules, which are responsible for clustering of the receptors
(Froehner et al., 1990 ; Apel et al., 1995 ; Gautam et al., 1995 ). To
visualize the distribution of rapsyn molecules in living fish, we first
generated a stable line of fish expressing a rapsyn-GFP fusion
protein. The GFP was fused to the C-terminal end of the mouse rapsyn
protein. The expression of this fusion protein was under the control of a muscle-specific actin promoter (Higashijima et al., 1997 ); therefore, the rapsyn-GFP was transcribed and expressed in skeletal muscle from
very early developmental stages. We crossed sofa potato with fish expressing rapsyn-GFP and compared the distribution of
rapsyn-GFP in wild-type and sofa potato background,
designated as wild-type/rapsyn-GFP and sofa
potato/rapsyn-GFP.
In 7-d-old wild-type/rapsyn-GFP fish the majority of rapsyn-associated
fluorescence was clustered in the myotomal muscle (Fig. 4). Colabeling with Rh- -Btx indicated
a close correspondence between the distribution of rapsyn and ACh
receptor clusters (Fig. 4). All clusters of ACh receptors were
colocalized with rapsyn-GFP. However, slight evidence of unclustered
rapsyn could be observed as a thin layer of diffuse labeling in the
membrane of muscle cells, and this rapsyn appeared sometimes to lack
associated Rh- -Btx label. Such a close correspondence between
clustered rapsyn and ACh receptor was not seen in 2-d-old fish (Fig.
4). At these earlier stages of development, muscle pioneer cells
(Currie and Ingham, 1996 ) expressed rapsyn clusters that lacked
associated Rh- -Btx label, whereas the clustered Rh- -Btx label
invariably was associated with the rapsyn-GFP label. The receptorless
clusters of rapsyn-GFP in these muscle pioneer cells likely reflect
the very early stages of neuromuscular synapse development.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 4.
Developmental changes in the relationship between
ACh receptor and rapsyn-GFP distribution. Left,
Rapsyn-GFP distribution in the tail muscle of an intact 7-d-old
wild-type/rapsyn-GFP fish (top), dissociated
wild-type/rapsyn-GFP myocyte (middle), and 2-d-old
wild-type/rapsyn-GFP fish (bottom). The
green fluorescence indicates the distribution of
rapsyn-GFP. Middle, The distribution of fluorescence
associated with the labeling of ACh receptors by rhodamine- -Btx in
the same muscle shown at the left. Right,
The green fluorescence associated with the rapsyn-GFP
fusion protein and the red fluorescence from the
rhodamine- -Btx-labeled ACh receptors are merged for the
left and middle images. Scale bars:
Top, 50 µm; middle, 20 µm;
bottom, 10 µm.
|
|
To establish further the interdependence between ACh receptors and
rapsyn, we examined the sofa potato/rapsyn-GFP fish. In these embryos, muscle labeling by rapsyn-GFP was observed despite the
lack of ACh receptors (Fig. 5). The
distribution of rapsyn-GFP in intact and dissociated muscle from
sofa potato was qualitatively similar to that observed for
wild type. Specifically, both diffuse labeling and well defined
clusters of rapsyn-GFP were observed (Fig. 5).

View larger version (67K):
[in this window]
[in a new window]
|
Figure 5.
The distribution of rapsyn-GFP fluorescence in
5-d-old sofa potato mutant fish. The distribution of
rapsyn-GFP in intact tail muscle (left) and in a
dissociated myocyte (right) is shown also. Scale bars:
Left, 50 µm; right, 20 µm.
|
|
To determine whether the fluorescence clusters in wild-type/rapsyn-GFP
fish and sofa potato/rapsyn-GFP fish corresponded to the
sites of synaptic contact, we labeled a small population of motor
neurons with Texas Red-dextran by anterograde labeling. In this manner
the distribution of rapsyn-GFP and presynaptic terminals could be
compared directly for correspondence. We first established that a close
correspondence existed between the Texas Red-labeled terminals and the
rapsyn-GFP clusters in wild-type/rapsyn-GFP muscle (Fig.
6). Because all neurons were not labeled
effectively with Texas Red, some of the rapsyn clusters lacked
associated labeled terminals. However, the striking qualitative overlap
between labeled terminals and associated rapsyn-GFP clusters confirmed the idea that rapsyn was located beneath the nerve terminals in wild-type muscle.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 6.
The rapsyn clusters localize beneath nerve
terminals in wild-type fish, but not in sofa potato
mutant fish. The distribution of nerve terminal endings for
wild-type/rapsyn-GFP (top left) and sofa
potato/rapsyn-GFP (top right) lines are shown
by red fluorescence. Some, but not all, of the nerve
terminals in the field of view were labeled by anterograde filling of
the motor neurons with Texas Red-dextran. The distribution of the
rapsyn-GFP fusion protein is shown for the same wild-type and
sofa potato muscles in the middle panels.
The merge is shown in the bottom panels. Scale bars, 50 µm.
|
|
These data from wild-type fish contrasted sharply with those from
sofa potato/rapsyn-GFP fish. At 5 d of age most of the
nerve terminal endings that were labeled effectively with Texas
Red-dextran in sofa potato/rapsyn-GFP fish lacked
corresponding rapsyn-GFP label in muscle (Fig. 6). This lack of
coincidence was most obvious in the middle of the muscle cell where
punctate synapses could be identified reliably. Some correspondence was
seen between the myosepta labeling by both rapsyn-GFP and Texas Red.
However, the coincidence may be a simple result of the fact that the
motor neurons run along the myosepta to innervate the muscle;
therefore, the overlap may not represent true synaptic contacts.
Additionally, myotendinous localizations of ACh receptors and
associated rapsyn localization have been reported in a number of
preparations despite the absence of synaptic contacts (Chen et al.,
1990 ). Therefore, we restricted our analyses to the midregion of muscle cells.
To compute the extent of colocalization of terminal and rapsyn
labeling, we scored each pixel in individual fields for the presence of
either green or red fluorescence (Fig.
7). The detection threshold for scoring a
pixel as either red- or green-positive was set to the 50% intensity
level for the overall range in each field. We then quantitated the
overlap on the basis of the fraction of red pixels that also scored
positive for a green signal (Fig. 7). The converse correlation, being
green pixels with or without red signal, was not computed because it
would underestimate greatly the extent to which colocalization occurs.
In all cases it was impossible to fill all of the motor neurons in the
field, leaving some terminals unlabeled. Measurements in eight fields
of wild-type/rapsyn-GFP fish indicate a mean coefficient of
colocalization corresponding to 0.46 compared with 0.11 for sofa
potato/rapsyn-GFP (Fig. 7). These differences are highly
significant (p 0.01, unpaired Student's t test). Despite the low value for sofa
potato/rapsyn-GFP fish, it appears that infrequent, but authentic
colocalization occurs (Fig. 7). The 11% overlap measured for
sofa potato/rapsyn-GFP is higher than would be predicted by
random overlap. On the other hand, the estimated colocalization in
wild-type/GFP rapsyn fish is likely to be an underestimate for two
reasons. First, no corrections for differences in emission intensity of
Texas Red and GFP were made. Consequently, slight differences in
cluster sizes for green and red fluorescence emitters are scored as
nonoverlapping. This error is probably small because changing the
detection threshold from 50 to 35% did not alter the coefficient of
colocalization significantly. Second, we do not have an additional
marker to distinguish between axons and terminal, so some of the red
fluorescence is likely to represent tangential images of axons where no
rapsyn-GFP signal would be expected. Thus, the sofa potato
fish exhibit a greatly impaired ability to localize rapsyn-GFP to
subsynaptic terminals compared with wild-type fish.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7.
Quantitation of nerve terminal and rapsyn
colocalization. The distribution of Texas Red-labeled terminals
(red fluorescence) and GFP labeled rapsyn
(green fluorescence) are shown for wild-type
(left) and sofa potato
(right) muscles. In the top panels the
merged images of Texas Red and GFP fluorescence distributions with
colocalization in yellow are shown. The
second and third panels show separate
digitally processed images indicating the pixels exceeding the 50%
threshold values for red (Red > 50%) or green (Green > 50%) fluorescence intensities. All pixels falling below the
detection threshold of 50% were converted to values corresponding to
white. In the bottom panels
(Overlap), the red pixels colocalizing
with green pixels are coded orange. The
coefficients of colocalization for both wild-type and sofa
potato, based on the fractional overlap of red
pixels by green pixels, are indicated for the images
shown. The mean coefficients for the overall data are indicated in the
histogram along with the number of fields that were measured and the
SDs.
|
|
 |
DISCUSSION |
Relatively few physiological studies have capitalized on the
readily available supply of neurologically relevant mutant lines of
zebrafish. In particular, the locomotory mutants are especially well
tailored for analysis of physiological function as a result of the
unparalleled access to both nerve and muscle. Our study offers a
systematic approach that can be applied easily to such mutants to
establish the precise site of physiological dysfunction. The results of
such analyses point to the effectiveness by which specific defects can
be identified by the use of physiological analysis alone. In our case
we found that the two mutant lines, which exhibited the same behavioral
phenotype, resulted from defects in two distinct receptor types in
muscle. Perhaps the most important outcome of this study, however, is
the demonstration that such mutants can be used to identify new and
unexpected functions for even the most well characterized receptor types.
In the mutant line relaxed, synaptic transmission and
synaptic morphology appeared completely normal, despite complete muscle paralysis. The lack of contraction in response to depolarization could
result from muscle defects in either ryanodine receptors (RyR) or
dihydropyridine (DHP) receptors. Our finding that caffeine-induced contracture can be elicited in relaxed indicates that
functional ryanodine receptors are present in relaxed mutant
fish. Furthermore, measurement of the gating charge movement from
myotomal muscle of relaxed points to a specific defect in
the DHP receptor, similar to that published for dysgenic mouse mutants
(Tanabe et al., 1988 ; Adams et al., 1990 ). The charge movements
recorded from wild-type zebrafish myotomal muscle compare favorably
with those that have been published for mouse skeletal muscle.
Additionally, both relaxed mutant zebrafish and dysgenic
mouse muscle show considerably reduced charge movement. In a RyR
knock-out mouse the ionic conductance through the DHP receptor was
reduced, whereas the charge movement remained intact (Nakai et al.,
1996 ), once again pointing to the DHP receptor as the locus of
disturbance in relaxed. The DHP receptors in mouse muscle
are composed of several subunits, and muscle lacking either 1 or subunits fails to contract and exhibits reduced charge movement
(Knudson et al., 1989 ; Melzer et al., 1995 ; Gregg et al., 1996 ). On the
other hand, studies to date have indicated only a single DHP receptor
subunit in fish (Grabner et al., 1991 ). If this is the case, then the
mutation in relaxed likely resides in the gene coding for
the 1 subunit. Confirmation of the locus of the mutation will
require analysis of the primary sequence of this gene in wild type and
relaxed.
Unlike the case for relaxed, paralysis in sofa
potato results from an upstream defect involving neuromuscular
transmission. Specifically, evoked and spontaneous synaptic responses
are absent in recordings from in vivo muscle, pointing to a
postsynaptic origin of the defect. As with relaxed,
morphological analyses of GFP-filled motor neurons and associated
presynaptic terminals revealed no obvious defects in sofa
potato mutant embryos. The inability of sofa potato
muscle to respond to applied ACh, along with the absence of labeling by
either -Btx or mAb35 antibodies, points to an absence of ACh
receptor subunits in muscle membrane. In the only other published
analysis of a locomotory mutant zebrafish line, nic,
paralysis was shown to be a result of a defect in nicotinic receptors.
Nic subsequently was shown to represent a splicing defect in
the subunit, thereby inhibiting receptor expression (Sepich et al.,
1998 ). Complementation studies with nic mutant fish have
indicated that sofa potato is not a mutation in the gene
encoding the subunit (Granato et al., 1996 ). Given the lack of
available sequence information, it is possible that the point mutation
in sofa potato is not located in one of the four additional
receptor subunits. However, should the mutation be mapped to one of
these receptor subunits, the subunit seems the most viable
candidate. Receptors lacking , , or subunits can still result
in significant levels of expression (Jackson et al., 1990 ; Kullberg et
al., 1990 ; Liu and Brehm, 1993 ), whereas -less receptors exhibit
little or no function when they are expressed exogenously.
Analysis of sofa potato neuromuscular synapses revealed
unexpected insights into the relationship between the ACh receptor and
the receptor-aggregating subunit rapsyn. Potential sites of interaction
have been identified on rapsyn (Ramarao and Cohen, 1998 ), but the
corresponding interaction sites on the ACh receptor have been very
elusive. The difficulty in identifying the nature of receptor-rapsyn
interactions has greatly hampered understanding of the mechanisms
governing receptor clustering. For example, it is clear that rapsyn is
required for receptor aggregation, but no studies on muscle have
determined conclusively whether the clustering ability of rapsyn
requires association with a receptor. In studies on QT6 fibroblast
cells clustering by exogenously expressed rapsyn proteins occurred in
the absence of ACh receptors (Phillips et al., 1991 ; Apel et al.,
1997 ), but doubts as to the physiological relevance of this finding
have been raised by similar studies on muscle. For example, in cultured
myotubes derived from mice deficient in muscle-specific kinase (MuSK),
neither rapsyn nor receptor clusters were observed (DeChiara et al.,
1996 ; Zhou et al., 1999 ). The different findings for these two cell
types could be reconciled by the presence of an endogenous MuSK
functional homolog in the fibroblast cells (Burden, 1998 ).
Alternatively, clustering in nonmuscle may occur via pathways distinct
from those involved in nerve-induced clustering. Such alternative
pathways also may underlie the formation of nonsynaptic clusters on
muscle in vivo and at focal adhesion zones on muscle in cell
culture (Liu and Westerfield, 1992 ). To resolve such issues requires
the analysis of neuromuscular synapses formed in
vivo.
Our use of zebrafish has provided the first opportunity for in
vivo study of rapsyn clustering. In 5-d-old wild-type fish an
excellent correspondence was observed between the distribution of
exogenously expressed rapsyn and ACh receptors, consistent with
previous reports on endogenous rapsyn distribution in mammalian skeletal muscle (Noakes et al., 1993 ). This correspondence further validates the use of exogenous rapsyn-GFP for our in vivo
study. Unlike the findings from 5-d-old muscle, we observed a lack of correspondence between rapsyn-GFP and receptor in newly developed muscle from 2-d-old fish. In muscle from these young fish the aggregated ACh receptors were always associated with rapsyn-GFP, but
receptorless rapsyn-GFP clusters also were observed. In addition to
these findings, we observed frequent rapsyn-GFP clusters in muscle
from sofa potato mutants lacking ACh receptors. Thus, the ability of exogenously expressed rapsyn-GFP to self-cluster in wild-type and in mutant sofa potato fish agrees with
previous nonmuscle expression systems, including both QT6 and
Xenopus oocyte expression systems (Phillips et al., 1991 ;
Apel et al., 1997 ).
On the basis of these findings, it is tempting to speculate that rapsyn
clustering normally precedes association with ACh receptors during
development. Although controversial, it has been proposed that
association with ACh receptor precedes the formation of rapsyn clusters
(Fuhrer et al., 1999 ; Marchand et al., 2000 ). We cannot exclude the
possibility that, in our case, the lack of close correspondence between
rapsyn and ACh receptor may be exaggerated greatly by the
overexpression of rapsyn-GFP. In young fish the actin promoter drives
rapsyn-GFP expression to higher levels and earlier in development than
likely occurs for endogenous rapsyn (Yoshihara and Hall, 1993 ). Despite
the uncertainty as to the physiological role played by early
receptorless rapsyn clusters, our findings support a previous proposal
that ACh receptors have the capability to associate postinsertionally
with rapsyn (Phillips et al., 1991 ).
The most unexpected outcome of the analysis of the sofa
potato mutant line was the finding that exogenously expressed
rapsyn-GFP clusters, lacking associated ACh receptors, rarely were
localized to the subsynaptic region of muscle. On average, 46% of the
red pixels (nerve terminals) colocalized to green pixels (rapsyn-GFP) in wild-type fish, whereas only 10% colocalization was observed for
sofa potato. The occasional colocalization in sofa
potato is not predicted on the basis of random occurrence and
suggests that receptorless rapsyn clusters are capable of subsynaptic
synaptic recognition, but much more weakly than their
receptor-associated rapsyn counterparts. One attractive possibility is
that subsynaptic complexes can form, but, without the ACh receptor
present for stabilization, the clusters diffuse into the extrasynaptic
membrane. In this regard it would be useful to know whether the
endogenous rapsyn exhibits a distribution similar to the rapsyn-GFP.
However, all of the rapsyn antibodies that were tested failed to
cross-react with zebrafish rapsyn (data not shown). Once again, the
excellent correspondence seen in wild-type muscle between rapsyn-GFP
and terminal staining shows that the inability of rapsyn-GFP clusters to target properly in sofa potato was not an artifact of
overexpression of a fusion protein. Thus, we conclude that the ACh
receptor is involved somehow in directing the rapsyn cluster to
subsynaptic membrane.
Localization of the rapsyn-receptor complex to the synapse is known to
require interaction with MuSK (Fig.
8A), a transmembrane muscle protein that is localized to the synapse by secretion of neuronal agrin (DeChiara et al., 1996 ; Glass et al., 1996 ). Hints as to
how MuSK signals the rapsyn-receptor complex have been provided by
studies on muscle derived from genetically altered knock-out mice and
QT6 fibroblasts (Gillespie et al., 1996 ; Apel et al., 1997 ; Glass et
al., 1997 ; Zhou et al., 1999 ). The interaction is thought to involve an
extracellular region of MuSK and intracellular rapsyn, requiring the
presence of an additional membrane-spanning signaling molecule (RATL)
to link MuSK and rapsyn (Fig. 8A; Apel et al., 1997 ).
No candidate for this link has yet been identified via molecular
analysis. Our observation that ACh receptors are necessary for
localization raises the possibility that the ACh receptor serves as
RATL. Consistent with this idea, the ACh receptor coimmunoprecipitates
MuSK (Fuhrer et al., 1997 , 1999 ). At odds with this idea is the
observation that coexpression of MuSK and rapsyn in QT6 cells results
in colocalization without the presence of ACh receptors (Apel et al.,
1997 ). However, this result is difficult to reconcile with the
conventional model, barring the existence of an endogenous RATL homolog
in fibroblasts. As discussed previously, resolution of this problem may
require that bona fide in vivo synapses be examined, wherein
the nerve-dependent localization can be examined directly. This is
possible in zebrafish.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 8.
Two models for the clustering and subsynaptic
positioning of ACh receptors. In the conventional model
(A) the ACh receptor-rapsyn complex is anchored
to synaptic MuSK via interactions with a hypothetical RATL.
B, A model based on our findings wherein clustering and
positioning occur as separate processes. The final anchoring of the
complex to MuSK occurs via the ACh receptor in this model.
|
|
In conclusion, our findings have shed new light on the potential
interactions between the ACh receptor and the associated clustering
proteins rapsyn and MuSK. The model presented in Figure 8B showing the relationship among these three
molecules is speculative in that the sites of interaction between MuSK
and ACh receptor are unknown. However, our findings indicate that
developmental acquisition of the high-density ACh receptor subsynaptic
aggregates occurs in two distinct steps, an idea proposed by Zhou et
al. (1999) . First, clustering of receptors occurs as a direct
consequence of interactions with rapsyn: molecules, as we demonstrate
in this study, that have an intrinsic ability to self cluster. Second, the clusters are localized to the synapse by interactions requiring the
receptor rather than by rapsyn alone. Identification of putative genetic defects in sofa potato by physiological analysis now
provides a way that the signaling pathways involved in synaptic
differentiation can be studied easily in vivo.
 |
FOOTNOTES |
Received Feb. 22, 2001; revised May 8, 2001; accepted May 15, 2001.
This study was supported by National Institutes of Health Grants
NS-18205 (P.B.) and NS-26539 (J.R.F.). We thank Dr. Frohnhoefer (Max
Planck Institute) for providing sofa potato and
relaxed mutant fish. Joan Speh offered expertise in
immunohistochemistry and confocal microscopy. Shelagh Palma performed
the genetic crosses, maintained the fish lines, and provided the
embryos for analysis. We are grateful to Drs. Mandel and Matthews for
help with molecular- and calcium-imaging aspects of the project. The
rapsyn-GFP fish was made when S.H. was in Dr. Ueno's lab at the
National Institute for Basic Biology, Japan.
Correspondence should be addressed to Dr. Fumihito Ono, Department of
Neurobiology and Behavior, State University of New York at Stony Brook,
Stony Brook, NY 11794. E-mail: fono{at}notes.cc.sunysb.edu.
 |
REFERENCES |
-
Adams BA,
Tanabe T,
Mikami A,
Numa S,
Beam KG
(1990)
Intramembrane charge movement restored in dysgenic skeletal muscle by injection of dihydropyridine receptor cDNAs.
Nature
346:569-572[Medline].
-
Apel ED,
Roberds SL,
Campbell KP,
Merlie JP
(1995)
Rapsyn may function as a link between the acetylcholine receptor and the agrin-binding dystrophin-associated glycoprotein complex.
Neuron
15:15-26.
-
Apel ED,
Glass DJ,
Moscoso LM,
Yancopoulos GD,
Sanes JR
(1997)
Rapsyn is required for MuSK signaling and recruits synaptic components to a MuSK-containing scaffold.
Neuron
18:623-635[ISI][Medline].
-
Burden SJ
(1998)
The formation of neuromuscular synapses.
Genes Dev
12:133-148[Free Full Text].
-
Chen Q,
Sealock R,
Peng HB
(1990)
A protein homologous to the Torpedo postsynaptic 58K protein is present at the myotendinous junction.
J Cell Biol
110:2061-2071[Abstract/Free Full Text].
-
Currie PD,
Ingham PW
(1996)
Induction of a specific muscle cell type by a hedgehog-like protein in zebrafish.
Nature
382:452-455[Medline].
-
DeChiara TM,
Bowen DC,
Valenzuela DM,
Simmons MV,
Poueymirou WT,
Thomas S,
Kinetz E,
Compton DL,
Rojas E,
Park JS,
Smith C,
DiStefano PS,
Glass DJ,
Burden SJ,
Yancopoulos GD
(1996)
The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo.
Cell
85:501-512[ISI][Medline].
-
Fetcho JR,
O'Malley DM
(1995)
Visualization of active neural circuitry in the spinal cord of intact zebrafish.
J Neurophysiol
73:399-406[Abstract/Free Full Text].
-
Froehner SC,
Luetje CW,
Scotland PB,
Patrick J
(1990)
The postsynaptic 43K protein clusters muscle nicotinic acetylcholine receptors in Xenopus oocytes.
Neuron
5:403-410[ISI][Medline].
-
Fuhrer C,
Sugiyama JE,
Taylor RG,
Hall ZW
(1997)
Association of muscle-specific kinase MuSK with the acetylcholine receptor in mammalian muscle.
EMBO J
16:4951-4960[ISI][Medline].
-
Fuhrer C,
Gautam M,
Sugiyama JE,
Hall ZW
(1999)
Roles of rapsyn and agrin in interaction of postsynaptic proteins with acetylcholine receptors.
J Neurosci
19:6405-6416[Abstract/Free Full Text].
-
Gautam M,
Noakes PG,
Mudd J,
Nichol M,
Chu GC,
Sanes JR,
Merlie JP
(1995)
Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice.
Nature
377:232-236[Medline].
-
Gillespie SK,
Balasubramanian S,
Fung ET,
Huganir RL
(1996)
Rapsyn clusters and activates the synapse-specific receptor tyrosine kinase MuSK.
Neuron
16:953-962[ISI][Medline].
-
Glass DJ,
Bowen DC,
Stitt TN,
Radziejewski C,
Bruno J,
Ryan TE,
Gies DR,
Shah S,
Mattsson K,
Burden SJ,
DiStefano PS,
Valenzuela DM,
DeChiara TM,
Yancopoulos GD
(1996)
Agrin acts via a MuSK receptor complex.
Cell
85:513-523[ISI][Medline].
-
Glass DJ,
Apel ED,
Shah S,
Bowen DC,
DeChiara TM,
Stitt TN,
Sanes JR,
Yancopoulos GD
(1997)
Kinase domain of the muscle-specific receptor tyrosine kinase (MuSK) is sufficient for phosphorylation but not clustering of acetylcholine receptors: required role for the MuSK ectodomain?
Proc Natl Acad Sci USA
94:8848-8853[Abstract/Free Full Text].
-
Grabner M,
Friedrich K,
Knaus HG,
Striessnig J,
Scheffauer F,
Staudinger R,
Koch WJ,
Schwartz A,
Glossmann H
(1991)
Calcium channels from Cyprinus carpio skeletal muscle.
Proc Natl Acad Sci USA
88:727-731[Abstract/Free Full Text].
-
Granato M,
van Eeden FJ,
Schach U,
Trowe T,
Brand M,
Furutani-Seiki M,
Haffter P,
Hammerschmidt M,
Heisenberg CP,
Jiang YJ,
Kane DA,
Kelsh RN,
Mullins MC,
Odenthal J,
Nüsslein-Volhard C
(1996)
Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva.
Development
123:399-413[Abstract].
-
Gregg RG,
Messing A,
Strube C,
Beurg M,
Moss R,
Behan M,
Sukhareva M,
Haynes S,
Powell JA,
Coronado R,
Powers PA
(1996)
Absence of the
-subunit (cchb1) of the skeletal muscle dihydropyridine receptor alters expression of the 1 subunit and eliminates excitation-contraction coupling.
Proc Natl Acad Sci USA
93:13961-13966[Abstract/Free Full Text]. -
Heidelberger R,
Matthews G
(1992)
Calcium influx and calcium current in single synaptic terminals of goldfish retinal bipolar neurons.
J Physiol (Lond)
447:235-256[Abstract/Free Full Text].
-
Higashijima S,
Okamoto H,
Ueno N,
Hotta Y,
Eguchi G
(1997)
High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin.
Dev Biol
192:289-929[ISI][Medline].
-
Higashijima S,
Hotta Y,
Okamoto H
(2000)
Visualization of cranial motor neurons in live transgenic zebrafish expressing green fluorescent protein under the control of the islet-1 promoter/enhancer.
J Neurosci
20:206-218[Abstract/Free Full Text].
-
Huser J,
Lipsius SL,
Blatter LA
(1996)
Calcium gradients during excitation-contraction coupling in cat atrial myocytes.
J Physiol (Lond)
494:641-651[ISI][Medline].
-
Jackson MB,
Imoto K,
Mishina M,
Konno T,
Numa S,
Sakmann B
(1990)
Spontaneous and agonist-induced openings of an acetylcholine receptor channel composed of bovine muscle alpha-, beta-, and delta-subunits.
Pflügers Arch
417:129-135[ISI][Medline].
-
Knudson CM,
Chaudhari N,
Sharp AH,
Powell JA,
Beam KG,
Campbell KP
(1989)
Specific absence of the
1 subunit of the dihydropyridine receptor in mice with muscular dysgenesis.
J Biol Chem
264:1345-1348[Abstract/Free Full Text]. -
Kullberg R,
Owens JL,
Camacho P,
Mandel G,
Brehm P
(1990)
Multiple conductance classes of mouse nicotinic acetylcholine receptors expressed in Xenopus oocytes.
Proc Natl Acad Sci USA
87:2067-2071[Abstract/Free Full Text].
-
Lipp P,
Huser J,
Pott L,
Niggli E
(1996)
Spatially nonuniform Ca2+ signals induced by the reduction of transverse tubules in citrate-loaded guinea-pig ventricular myocytes in culture.
J Physiol (Lond)
497:589-597[ISI][Medline].
-
Liu DW,
Westerfield M
(1992)
Clustering of muscle acetylcholine receptors requires motoneurons in live embryos, but not in cell culture.
J Neurosci
12:1859-1866[Abstract].
-
Liu Y,
Brehm P
(1993)
Expression of subunit-omitted mouse nicotinic acetylcholine receptors in Xenopus laevis oocytes.
J Physiol (Lond)
470:349-363[Abstract/Free Full Text].
-
Marchand S,
Bignami F,
Stetzkowski-Marden F,
Cartaud J
(2000)
The myristoylated protein rapsyn is cotargeted with the nicotinic acetylcholine receptor to the postsynaptic membrane via the exocytic pathway.
J Neurosci
20:521-528[Abstract/Free Full Text].
-
Melzer W,
Herrmann-Frank A,
Luttgau HC
(1995)
The role of Ca2+ ions in excitation-contraction coupling of skeletal muscle fibres.
Biochim Biophys Acta
1241:59-116[Medline].
-
Nakai J,
Dirksen RT,
Nguyen HT,
Pessah IN,
Beam KG,
Allen PD
(1996)
Enhanced dihydropyridine receptor channel activity in the presence of ryanodine receptor.
Nature
380:72-75[Medline].
-
Noakes PG,
Phillips WD,
Hanley TA,
Sanes JR,
Merlie JP
(1993)
43K protein and acetylcholine receptors colocalize during the initial stages of neuromuscular synapse formation in vivo.
Dev Biol
155:275-280[ISI][Medline].
-
Phillips WD,
Kopta C,
Blount P,
Gardner PD,
Steinbach JH,
Merlie JP
(1991)
ACh receptor-rich membrane domains organized in fibroblasts by recombinant 43-kildalton protein.
Science
251:568-570[Abstract/Free Full Text].
-
Ramarao MK,
Cohen JB
(1998)
Mechanism of nicotinic acetylcholine receptor cluster formation by rapsyn.
Proc Natl Acad Sci USA
95:4007-4012[Abstract/Free Full Text].
-
Ribera AB,
Nüsslein-Volhard C
(1998)
Zebrafish touch-insensitive mutants reveal an essential role for the developmental regulation of sodium current.
J Neurosci
18:9181-9191[Abstract/Free Full Text].
-
Saedi MS,
Anand R,
Conroy WG,
Lindstrom J
(1990)
Determination of amino acids critical to the main immunogenic region of intact acetylcholine receptors by in vitro mutagenesis.
FEBS Lett
267:55-59[ISI][Medline].
-
Sepich DS,
Wegner J,
O'Shea S,
Westerfield M
(1998)
An altered intron inhibits synthesis of the acetylcholine receptor
-subunit in the paralyzed zebrafish mutant nic1.
Genetics
148:361-372[Abstract/Free Full Text]. -
Tanabe T,
Beam KG,
Powell JA,
Numa S
(1988)
Restoration of excitation-contraction coupling and slow calcium current in dysgenic muscle by dihydropyridine receptor complementary DNA.
Nature
336:134-139[Medline].
-
Westerfield M,
Liu DW,
Kimmel CB,
Walker C
(1990)
Pathfinding and synapse formation in a zebrafish mutant lacking functional acetylcholine receptors.
Neuron
4:867-874[ISI][Medline].
-
Yoshihara CM,
Hall ZW
(1993)
Increased expression of the 43-kD protein disrupts acetylcholine receptor clustering in myotubes.
J Cell Biol
122:169-179[Abstract/Free Full Text].
-
Zhou H,
Glass DJ,
Yancopoulos GD,
Sanes JR
(1999)
Distinct domains of MuSK mediate its abilities to induce and to associate with postsynaptic specializations.
J Cell Biol
146:1133-1146[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21155439-10$05.00/0
This article has been cited by other articles:
|