 |
 Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2001, 21(15):5449-5460
Constitutive "Light" Adaptation in Rods from G90D Rhodopsin:
A Mechanism for Human Congenital Nightblindness without Rod Cell
Loss
Paul A.
Sieving1,
Michael L.
Fowler1,
Ronald
A.
Bush1,
Shigeki
Machida1,
Peter D.
Calvert2,
Daniel G.
Green1,
Clint L.
Makino2, and
Christina L.
McHenry1
1 Department of Ophthalmology and Visual Sciences,
University of Michigan, Ann Arbor, Michigan 48105, and
2 Department of Ophthalmology, Massachusetts Eye and Ear
Infirmary, Harvard Medical School, Boston, Massachusetts
02114
 |
ABSTRACT |
A dominant form of human congenital nightblindness is caused by a
gly90 asp (G90D) mutation in rhodopsin. G90D has been shown to
activate the phototransduction cascade in the absence of light in vitro. Such constitutive activity of G90D rhodopsin
in vivo would desensitize rod photoreceptors and lead to
nightblindness. In contrast, other rhodopsin mutations typically give
rise to nightblindness by causing rod cell death. Thus, the proposed
desensitization without rod degeneration would be a novel mechanism for
this disorder. To explore this possibility, we induced mice to express
G90D opsin in their rods and then examined rod function and morphology,
after first crossing the transgenic animals with rhodopsin
knock-out mice to obtain appropriate levels of opsin expression.
The G90D mouse opsin bound the chromophore and formed a bleachable
visual pigment with  max of 492 nm that supported rod
photoresponses. (G+/ , R+/) retinas, heterozygous for both G90D and
wild-type (WT) rhodopsin, possessed normal numbers of photoreceptors
and had a normal rhodopsin complement but exhibited considerable loss of rod sensitivity as measured electroretinographically. The rod photoresponses were desensitized, and the response time to peak was
faster than in (R+/) animals. An equivalent desensitization resulted
by exposing WT retinas to a background light producing 82 photoisomerizations rod 1
sec1, suggesting that G90D rods in darkness
act as if they are partially "light-adapted." Adding a second G90D
allele gave (G+/+, R+/) animals that exhibited a further increase of
equivalent background light level but had no rod cell loss by 24 weeks
of age. (G+/+, R/) retinas that express only the mutant rhodopsin
develop normal rod outer segments and show minimal rod cell loss even
at 1 year of age. We conclude that G90D is constitutively active in
mouse rods in vivo but that it does not cause
significant rod degeneration. Instead, G90D desensitizes rods by a
process equivalent to light adaptation.
Key words:
constitutive activity; rhodopsin; light adaptation; retinal degeneration; rod photoreceptor; photoresponse; congenital
nightblindness; transgenic mouse
| |
INTRODUCTION |
Night vision is initiated when a rod
photoreceptor absorbs a single photon (Hecht et al., 1942 ). Photon
absorption causes a conformational change in the light-sensitive
rhodopsin molecule and triggers the phototransduction cascade. The
remarkable ability of the visual system to detect single photons
requires that rhodopsin remains quiescent in the dark. Indeed, the
half-life for the spontaneous activation of rhodopsin is ~400 years.
However, because each rod contains 108
rhodopsin molecules, thermal activation results in spontaneous bumps
that resemble single-photon events every 100-200 sec in rods
maintained in the dark (Baylor et al., 1984). Rod dark noise measurements indicate that rod noise, generated from spontaneous activity of rhodopsin, limits behavioral sensitivity and sets the
ultimate limit for absolute sensitivity of night vision (Baylor et al.,
1984; Aho et al., 1988). If rhodopsin thermal activity were increased
only slightly (Barlow, 1988) or if a genetic mutation resulted in
constitutively active rhodopsin (Rao et al., 1994), the false light
signals that are generated within the rod would compete with dim
external stimuli and desensitize night vision.
We previously reported on a human pedigree with congenital
nightblindness that cosegregated in autosomal dominant fashion with a
G90D rhodopsin mutation (Sieving et al., 1995). More than 80 other
rhodopsin mutations cause human autosomal dominant retinitis pigmentosa, in which nightblindness results from rod cell death (Berson, 1993). The G90D disease was unusual, however, in that the
retinas clinically appeared to be minimally affected and the condition
was nearly nonprogressive, suggesting that rods were not being lost
with age. Furthermore, the rhodopsin density was measured in one
G90D-affected subject using in vivo fundus reflection densitometry and was normal, indicating preservation of photon capture.
The reduced photon capture associated with even a 50% reduction in
rhodopsin density would elevate visual perceptual thresholds only 0.3 log unit, far less than the 3 log unit loss experienced by G90D
subjects. The G90D mutation lies within the opsin pocket opposite to
the lys-296 Schiff-base attachment of the 11-cis-retinal
chromophore. We proposed that the G90D mutation destabilized the
attachment, leading to endogenous signaling noise that physiologically
desensitized the rods without causing significant cell death. G90D
rhodopsin was subsequently shown by biochemical assay to activate
transducin independent of light (Rao et al., 1994), termed
"constitutive activation" (Robinson et al., 1992).
We undertook this study to learn whether G90D expression in
vivo impaired rod function without causing rod cell loss.
Transgenic approaches have previously been used to study the effects of
other rhodopsin mutants that cause retinitis pigmentosa in humans. For example, the P23H rhodopsin transgenic mouse (Olsson et al., 1992; Naash et al., 1993) and rat (Steinberg et al., 1996) successfully reproduced the rod degeneration and corresponding rod functional impairment (Machida et al., 2000) present in human P23H rhodopsin patients (Berson et al., 1991). Transgenic mice carrying other human
retinitis pigmentosa rhodopsin mutations also showed progressive rod
degeneration (Huang et al., 1993; Li et al., 1994, 1996; Sung et al.,
1994; Chen et al., 1995). Interestingly, a transgenic mouse carrying
K296E rhodopsin, which exhibits biochemical "constitutive activity"
in vitro (Robinson et al., 1992), failed to show
physiological light-adaptation effects in vivo by
electroretinogram (ERG) recordings (Li et al., 1995). Instead, ERG
losses in K296E mice correlated with the degree of photoreceptor
degeneration. Thus, our expectation that mutant G90D rhodopsin in the
mouse retina might demonstrate congenital nightblindness without rod
cell loss was novel.
| |
MATERIALS AND METHODS |
Generation of G90D transgenic mice. Studies were
conducted according to principles of the Society for Neuroscience,
using protocols reviewed at the University of Michigan. A 15 kb
rhodopsin genomic clone was isolated from an adult BALB/c mouse liver
genomic lambda library (Clontech, Palo Alto, CA). The clone
contained 5 kb upstream from exon 1 to direct expression specifically
to the rod photoreceptors (Lem et al., 1991; Zack et al., 1991;
Quiambao et al., 1997). This was cloned into pGEM-5Zf() (Promega,
Madison, WI) and designated pRHO-5. An Eco-RI fragment containing the
coding sequence was subcloned into pBS2SK() (Stratagene, La Jolla,
CA), and two separate site-directed mutagenesis procedures were
performed (Transformer Site-Directed Mutagenesis Kit, Clontech). The
G90D mutation was made using the oligonucleotide
TGGTGGTGAAGTCTCCGAAGACCATG. A second, conservative mutagenesis (A337V)
substituted a valine, found in normal human rhodopsin, for the alanine
in mouse rhodopsin. Transgene expression could be tracked then using
the 3A6 rhodopsin antibody that recognizes human V337 opsin but not
mouse A337 opsin (Al-Ubaidi et al., 1990; Olsson et al., 1992). The
A337V change lies distant from known functional opsin domains, and
expression of human opsin (which contains the valine residue at codon
337) on mouse (R/) background has no effect on ERG b-wave threshold or amplitude-intensity relations (McNally et al., 1999). The transgene construct was spliced together from the corresponding
EcoRI-HindIII fragment of both constructs, cloned
back into pRHO-5, and checked for normal sequence across the splice
regions. The rhodopsin construct was injected into fertilized eggs from
a C57BL/6 cross DBA mouse mating and implanted into pseudopregnant
females. Sixty-three founder mice were produced, and selected lines
were propagated by mating with C57BL/6 mice (Jackson Laboratories, Bar
Harbor, ME). Animals were housed in controlled lighting measuring 5 lux at cage level on a 12 hr light/dark cycle.
Genotyping. DNA was extracted from mouse tail. The transgene
was identified on WT (R+/+) rhodopsin background by PCR amplification using primers AAGCAGCCTTGGTCTCTGTC (forward) and GTCTCTCTGCTCATACCTCC (reverse), which give a 435 bp fragment of exon 1 across the G90D site.
Because the G90D mutation destroys the Tfi-I site in this fragment,
overnight restriction with Tfi-I enzyme reduces the WT fragment to a
327 bp fragment but leaves the 435 bp transgenic fragment uncut.
Genomic copy number relative to WT was estimated by comparing band
densities after Tfi-I restriction. Typing for the A337V transgene site
was by PCR amplification using exon 5 primers TGTATGCTCACCACGCTGTGC
(forward) and CTTGTCATGTTCCTGATAGACAAGC (reverse), which give a 394 bp
band. Restricting with Aci-I enzyme gave 23, 39, 47, and 285 bp
fragments for WT and 23, 39, 47, 285, and 324 bp fragments for the
transgene. Genotyping of mice with or without the G90D transgene on
hemizygous (R+/) or homozygous (R/) background was done using
long-range PCR across the G90D site in exon 1 and the neomycin
knock-out cassette in exon 2 using primers
TTTATGTGCCCTTCTCCAACGTCACAGGCGT (forward, 5' of codon 90) and
TGATCCAGGTGAAGACCACACCCATGATAGC (reverse, 3' of the PolII:Neomycin cassette). The G90D and WT alleles both give a 1950 bp product that was
restricted with Tfi-I to give three bands at 476/617/820 bp for the
G90D transgene, whereas WT gives four bands at 244/476/576/617 bp. The
rhodopsin knock-out allele contains an additional 3100 bp of the
neomycin cassette, so long-range PCR gives a 5050 bp band.
mRNA. Mice were killed with sodium pentobarbital
overdose (300 mg/kg, i.p.); the retinas were removed and quickly frozen
in liquid nitrogen. mRNA was prepared using a Micro-Fast Track mRNA Isolation Kit (Invitrogen, San Diego, CA). First-strand synthesis was
performed using reverse transcriptase (RT)-PCR primers in exon 1 surrounding codon 90: AAGCAGCCTTGGTCTCTGTC (forward) and GTCTCTCTGCTCATACCTCC (reverse). Restricting the RT-PCR product to
completion overnight with Tfi-I cleaved the WT cDNA to give a 327 bp
band but left the 435 bp G90D band intact. Band densities were
determined by optical scanning, and the relative densities, corrected
for molecular weight, gave the relative amounts of G90D and WT mRNA. In
line 202 animals, the G90D/WT mRNA ratio in (G+/, R+/+) mice was 0.82 (0.80 and 0.84, in two different animals), equivalent to a 1.64 ratio
of G90D per single WT allele. A similar result was obtained from two
(G+/, R+/) mice that gave an mRNA ratio for transgene: WT of 1.49 (1.43 and 1.56, in two different animals).
Whole retina rhodopsin assay. Procedures were performed
under dim red or infrared light using infrared goggles. Mice were dark-adapted overnight for 12 hr and then killed by sodium
pentobarbital overdose (300 mg/kg, i.p.). Retinas were removed through
a slit in the cornea (Fulton et al., 1982) and homogenized in 0.5 ml of
1% emulphogene (Williams et al., 1998) in 1.5 ml Eppendorf tubes. The
tubes were kept in the dark for 1 hr at 4°C and centrifuged; the
absorbance of the supernatant was determined between 400 and 700 nm
(Lambda 20 UV-Visible Spectrophotometer; PerkinElmer Life Sciences,
Norwalk, CT). Rhodopsin was bleached completely by exposure to bright,
white fluorescent light for 10 min and then rescanned to obtain
postbleach spectra. Spectra were zeroed at 700 nm, and difference
spectra were obtained by subtracting postbleach from prebleach spectra.
Rhodopsin quantity was calculated in nanomoles per eye using absorbance
at the max of the difference spectra and
extinction coefficients of 42,700 M1
cm1 for WT rhodopsin and 37,000 M1
cm1 for G90D rhodopsin (Zvyaga et al.,
1996). max values of the difference spectra
were obtained by least-squares fitting of a pigment nomogram in
polynomial form (Dawis, 1981). Fits generally extended across a range
of 450 or 470 to 575 nm.
In retinas expressing a mixture of G90D and WT rhodopsins,
hydroxylamine (NH2OH) was added to the extracted
rhodopsin to determine the separate quantities of G90D and WT
rhodopsin. Hydroxylamine does not react with unbleached WT rhodopsin,
but with bleached WT pigment it forms stable retinal oxime with
max = 367 nm (Crescitelli, 1956). The
rhodopsin Schiff base becomes accessible to hydroxylamine only after
the Glu113 counterion is at least partially protonated during bleaching
(Sakmar et al., 1989; Zvyaga et al., 1993). However, hydroxylamine
reacts with unbleached G90D pigment with a decay half-time of 2.7 min
at pH 8.0 and 15°C (Zvyaga et al., 1996). Retinas were washed in
10-12 ml of distilled H2O to remove blood contaminants that react with hydroxylamine and then were extracted overnight in 0.5% dodecyl maltoside at 4°C in Tris maleate, pH 6-8
(Zvyaga et al., 1994). Absorbance of the extract was scanned between
400 and 700 nm before and after adding NH2OH to
the cuvette, for a final concentration of 100 mM, and then
again after incubating for 10 min in the dark at room temperature.
Then, the extract was bleached completely by exposure to white
fluorescent light for 10 min, and the absorbance was scanned a final
time. Difference spectra for G90D absorbance were obtained by
subtracting the spectrum after NH2OH from the
spectrum before, both in darkness. WT absorbance was obtained by
subtracting the light-bleached spectrum from the spectrum after
NH2OH treatment but before light exposure. We
verified experimentally that adding hydroxylamine did not change the
absorbance values of WT rhodopsin. Comparisons of spectra from WT
retinas with and without hydroxylamine showed no change in spectral
bandwidth or max, indicating that the
contribution from the hydroxylamine-sensitive cone pigments was not
detectable and that any contribution of the retinal oxime product to
the absorbance at the peak of the difference spectra was minor.
Previous work indicated that for a difference spectrum with a peak near
490 nm, retinal oxime changes max by <0.2 nm
(Knowles and Dartnall, 1977).
Histology. Eyes were removed and fixed overnight at 4°C in
4% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M cacodylate buffer. The globes were trimmed,
post-fixed in 1% osmium for 1 hr, and embedded in epon for light
microscopy. Sections (1 µm thick) were cut along the vertical
meridian passing through the optic nerve and stained with toluidine
blue. Quantitative comparisons of photoreceptor cell numbers were made
by counting the number of nuclei across the outer nuclear layer
(ONL) width (LaVail et al., 1999; Sugawara et al., 2000). These
measurements were made at 200 µm intervals along 3600-4000 µm
expanses of the retina under 20× magnification with a Zeiss optical
microscope. Retinal thickness is erratic at the margins near the ora
serrata, and these positions were not included. Thickness of the rod
outer segment (ROS) and rod inner segment (RIS) layers were measured.
Immunohistochemistry was performed using the 3A6 and 1D4 antibodies
(gift of Dr. Robert Molday, University of British Columbia, Vancouver, Canada). 3A6 conjugates with human opsin containing V337 (MacKenzie et al., 1984; Nathans and Hogness, 1984) but not with
mouse A337 opsin (Al-Ubaidi et al., 1990; Olsson et al., 1992), and
consequently, the 3A6 antibody recognizes the G90D/A337V transgene
product but not WT mouse opsin. The 1D4 antibody was developed against
an epitope at 341-348 for bovine opsin (Molday and MacKenzie, 1983;
MacKenzie et al., 1984) and recognizes both mouse WT A337 and the
transgene 337V opsin (Olsson et al., 1992). Eyes were fixed overnight
in 4% paraformaldehyde in 0.1 M phosphate buffer at 4°C,
rinsed in 0.1 M phosphate buffer, trimmed, and cryoprotected in increasing concentrations of sucrose in buffer. They
were frozen in OCT that was diluted 1:2 in 20% sucrose/buffer for
cryostat sectioning. Sections (10 µm thick) were taken along the
vertical meridian and mounted on poly-L-lysine coated
slides. Nonspecific antibody binding was blocked by incubating sections for 1 hr with 20% normal goat serum (NGS) in 0.25% Triton X-100 and
0.1 M PBS. Then, sections were incubated for 2 hr in
primary antibody diluted 1:10 for the rhodopsin 1D4 antibody or 1:50
for the rhodopsin 3A6 antibody in PBS, 0.25% Triton X-100, and 2% NGS. Sections were washed and incubated for 1 hr in
tetramethylrhodamine isothiocyanate-conjugated goat anti-mouse IgG
(Sigma, St. Louis, MO) that was diluted 1:64. Sections were
final-washed, coverslipped, and photographed.
ERG recordings in vivo. Mice were dark adapted for 12 hr,
anesthetized with ketamine (75 mg/kg, i.m.) and xylazine (13.6 mg/kg, i.m.), and prepared under dim red light of <0.01 scotopic
cd/m2. Pupils were dilated with topical
0.05% phenylepherine HCl and 0.05% atropine. Body temperature was
maintained on a warming block at 38°C. A chlorided silver wire loop
electrode was held on the cornea with a drop of methylcellulose. The
differential electrode was a second loop placed beneath the upper
eyelid; a subcutaneous wire on the forehead was the neutral electrode.
Ganzfeld white light illumination was provided by a quartz-halogen
lamp (2800°K color temperature) that had unattenuated
intensity of 130 cd/m2. Electronic
shutters controlled exposure duration that was nominally 50 msec.
Interstimulus interval was 50 sec for dim stimuli near threshold, and
single traces were collected for intensities of the highest 2 log
units. Responses were amplified at 0.1-1000 Hz and computer averaged.
Cone-driven responses were isolated by light adapting the animals with
a 35 cd/m2 full-field white background for
20 min before photopic recordings. Stimulus luminances in Table
3 are given in photopic candela seconds per square meter.
These can be converted to scotopic units by adding 0.143 log units for
the 2800°K color source (Wyszecki and Stiles, 1982, their Table
2.4.4). We previously measured the increment threshold function of the
WT mouse rod-driven b-wave and specified the background in photopic
candela per square meter (Toda et al., 1999). We converted the
photometric intensities to physiological quantal fluxes for the murine
eye, following Lyubarsky and Pugh (1996) and Pugh (1998) and
recognizing that 1 cd/m2 =  lux for an
extended Ganzfeld source. Transmissivity of the rodent lens (Gorgels
and van Norren, 1992) is ~1.6 times greater than the human lens
(Wyszecki and Stiles, their Table 2.4.6) for = 500 nm. Using
these factors in the conversion schema above, an ERG Ganzfeld stimulus
of 2800°K with surface luminance of 1 cd/m2 (at = 500 nm) yields 2575 photoisomerizations rod1
sec1 (Rh*
rod1
sec1) for the mouse.
Rod photovoltage recording from isolated retina. Animals
were dark adapted for 12 hr and prepared under dim infrared
illumination. An animal was deeply anesthetized with sodium
pentobarbital, decapitated, and enucleated. The globe was hemisected
near the ora serrata and placed in Ringer's solution at room
temperature; the retina was gently detached. A small piece of retina
was placed receptor side up on Millipore filter in the recording
chamber and bathed in Ringer's solution consisting of (in
mM): NaCl, 110; KCl, 5; Na2HP04, 0.8;
NaH2PO4, 0.1;
NaHCO3, 30; MgSO4, 1;
CaCl2, 1.8; glucose, 22; glutamine, 0.25. The
solution was warmed to 36-37°C and bubbled with a 95%
O2/5% CO2 mixture, which
maintained the pH between 7.45 and 7.55. Recordings were performed in a
light-tight Faraday cage. Monochromatic stimuli of 500 nm (10 nm
HBW) were generated by a photoflash of <1 msec duration.
Intensity was controlled with neutral density filters. The 500 nm
photon flux of the flash was determined by physiological comparison of
the b-wave intensity-response function that was elicited by a second
light source calibrated using a radiometric detector (model S370; UDT
Instruments, Orlando, FL). Responses were amplified at 0-400 Hz,
digitized at 1000 kHz, and stored. Photovoltage measurements were made
with a pair of saline-filled 5-25 Mohm glass microelectrodes that were
positioned across the photoreceptor layer by micromanipulators. The
numbers of photoisomerizations per rod were calculated, assuming a
quantum efficiency of bleaching of 0.5, a pigment density of 0.3 (i.e., a 50% absorption probability), and a rod cross-sectional area of 2.3 µm2 [for additional details, see Green
and Kapousta-Bruneau (1999a,b)].
Single unit rod suction electrode recordings. A limited set
of recordings of light-induced changes in ROS current of single rods
was made using suction electrodes as described in Sung et al. (1994).
After dark adapting a mouse for at least 12 hr, we removed and minced
its retinas. Samples were placed into an experimental chamber and
perfused continuously with an enriched Locke's solution at 35-37°C.
The outer segments of single rods were drawn into a suction electrode,
and the responses to brief flashes were recorded with a
current-to-voltage converter (Axopatch 200; Axon Instruments, Foster
City, CA). The transgenic G90D mice were from founder 202 and were
expressing mutant opsin on a background of two normal WT rhodopsin
alleles (G+/, R+/+). These were 19- to 20-week-old animals (animals
491 and 488, line 202). Two WT (R+/+) littermates (5-6 weeks of
age) were also studied, and results from the control mice were similar
to those reported earlier for rods from C57BL/6 and C57BL/6 × DBA
mice (Raport et al., 1994).
Statistical treatment. Because most measurements were made
across three to five different genotypes, with the possibility of
multiple pair-wise comparisons, the analysis was performed by one-way
ANOVA with the Tukey post-test to detect significant differences
between statistically appropriate pairs within each group.
| |
RESULTS |
Preliminary studies of G90D on (R+/+) genetic background
We created a transgenic mouse expressing G90D rhodopsin in the
rods and then bred the transgene into the hemizygous and homozygous rhodopsin knock-out background. We were interested in two questions. Does expression of G90D rhodopsin decrease rod sensitivity to photic
stimulation, and is the desensitization independent of rod cell death?
These questions were approached by histological examination of the
retinas and from physiological recordings of the light responses.
The first G90D transgenic animals expressed the mutant opsin on a WT
(R+/+) genetic background. Founder mice were screened by ERG recordings
to search for animals that showed a loss of sensitivity, and lines were
developed from founders 116 and 202. These two lines both expressed a
single G90D allele on a WT background (G+/, R+/+), and both showed
>1 log unit elevation of the dark-adapted b-wave threshold. In
histological sections of line 116 retinas at 8 weeks, the ONL, which is
made up of photoreceptor nuclei, was reduced in thickness, and the rod
outer segments ROSs appeared to be disrupted. Genomic Southern blot
analysis indicated that line 116 carried a transgene copy number two to
three times greater than line 202. Because rod degeneration can result
from excessive expression of even wild-type opsin (Olsson et al.,
1992), we would not be able to sort out rod deterioration caused by
high transgene copy number for other effects, and we did not examine
line 116 animals further.
In line 202 animals, by contrast, the (G+/, R+/+) retinas showed
minimal anatomical changes at 8 weeks, and the rhodopsin content was
only ~0.1 log unit lower than in WT C57BL/6 mice. It was clear that
the ERG sensitivity loss in these line 202 animals was disproportionate
to the decrease in photon catch.
Single rods from a few animals of line 202 were studied by suction
electrode recording and showed reduced flash sensitivity. For WT rods,
the flash strength at 500 nm required to produce half-maximum
responses, i0, was 54 ± 16 photons
µm2 (mean ± SD,
n = 7). The sensitivity of (G+/, R+/+) rods was depressed and required higher flash intensity of 107 ± 32 photons µm2 (n = 7;
p < 0.002) to reach half-maximum responses. Therefore, at least some of the defects in the ERG were traced directly to functional changes in rod photoreceptors. The flash response onset was
also faster in transgenic rods. For dim flashes, the time to peak for
WT was 140 ± 17 msec (n = 7), and for the G90D
transgenics, 103 ± 10 msec (n = 5;
p < 0.001). For half maximal responses, the time to
peak for WT was 128 ± 11 msec (n = 6), whereas
this was faster for transgenic rods at 99 ± 11 msec
(n = 5; p < 0.02), consistent with a
light adaptation effect.
G90D on (R+/) genetic background
In an attempt to eliminate overexpression of rhodopsin as
contributing to rod degeneration and to match the genomic
constitution of WT and G90D rhodopsin present in the human condition
more closely, we crossed the 202 line with rhodopsin knock-out mice
(Humphries et al., 1997). We obtained a stable line of mice carrying
one G90D allele on a background of a single WT rhodopsin allele (G+/, R+/). In terms of the expression levels of WT and G90D rhodopsin, (G+/, R+/) mice roughly corresponded to the autosomal
dominant trait in the G90D human family. Both the 202 line and the
knock-out animals were propagated by mating with C57BL/6 mice, and by
the time the final histology and ERG analyses were performed, these mice were primarily in the C57BL/6 background.
Because the allele number of both the transgene and WT gene could be
manipulated independently, there were several different possible
genotypes that one could compare. On the expectation (subsequently
borne out) that histological differences would be minimal between
(G+/, R+/) and (R+/), we compared littermates with these
genotypes that were obtained from breeding (G+/, R+/+) with (R/)
to see whether the presence of G90D would affect ERG sensitivity.
Histology
Mice expressing the G90D transgene on the heterozygous WT
background, (G+/, R+/), showed good preservation of photoreceptors when compared with (R+/) littermates even at 30 weeks (Fig.
1). G90D opsin expression in the (G+/,
R+/) retina and not in the (R+/) retina was demonstrated by using
the 3A6 antibody that recognizes the 337V epitope in the G90D transgene
product but does not recognize A337 of mouse WT opsin. Only the ROSs
were labeled, indicating that the mutant opsin was trafficked
appropriately and did not mislocalize as has been reported for other
mutant rhodopsins in transgenic mice (Sung et al., 1994) and in
postmortem eyes of humans with retinitis pigmentosa (Milam et al.,
1998). The ROS labeling was intense and uniform in sections across the entire retina, confirming that the 5 kb upstream promoter region of the
rhodopsin gene was sufficient for widespread retinal expression of
G90D.
View larger version (136K):
[in this window]
[in a new window]
|
Figure 1.
Histology and immunohistochemistry of 30-week-old
littermate (R+/) and (G+/, R+/) mice. Micrographs show regions
located approximately one-third the retinal distance from the optic
nerve to the ora serrata at two different magnifications
(top and bottom). ONL thickness was
comparable in both retinas (~9 nuclei). At higher magnification
(top), the rod outer segment lengths were similar in the
two retinas, as were the inner segment lengths. Cone photoreceptor
multilobed nuclei are visible just below the outer limiting membrane.
Inset, The 3A6 antibody, which is specific for G90D and
does not recognize WT opsin, shows proper localization of the mutant
rhodopsin in the ROS.
|
|
Morphometric analysis indicated that the addition of mutant G90D
rhodopsin to the (R+/) background did not cause degeneration (Table
1). For (G+/, R+/), neither ONL
thickness (p = 0.10) nor ROS length
(p = 0.52) was different from (R+/).
Similarly, comparison with WT (R+/+) control retinas showed no
difference in ONL width (p = 0.78) or ROS length
(p = 0.31) for 30 week age-matched animals. Even at an age of 51 weeks, photoreceptor cell number of
(G+/, R+/) was not statistically different from the 30 week WT
retinas, as determined by ONL width (p = 0.10).
Rhodopsin density and absorbance spectrum
Rhodopsin was extracted from the mouse retinas, and the amounts of
WT and G90D rhodopsin were determined spectrophotometrically (Table
2). G90D formed a pigment that was
bleachable with white fluorescent light (Fig.
2A,B).
In retinas expressing both WT and mutant pigment, i.e., (G+/, R+/),
the two forms of rhodopsin were distinguished using hydroxylamine (Fig.
2, E-G). WT rhodopsin is resistant to
hydroxylamine treatment in darkness, but the G90D pigment becomes
chemically bleached by hydroxylamine even in darkness, yielding G90D
opsin and a stable retinal oxime with max of
367 nm (Zvyaga et al., 1996). Although (G+/, R+/) retinas had a greater total amount of rhodopsin than (R+/) retinas
(p = 0.04), there was a net decrease in the
amount of WT rhodopsin (p = 0.02). Apparently,
addition of the G90D allele caused downregulation of WT rhodopsin
expression.
View larger version (33K):
[in this window]
[in a new window]
|
Figure 2.
Visual pigment absorbance
spectra. A, B, Difference spectra from a (G+/+, R/)
mouse expressing only G90D pigment. C, D, Difference
spectra from an (R+/) mouse expressing only WT pigment. Molar amounts
(nanomoles per retina) were calculated using the extinction
coefficients 42,700 M1
cm1 for WT and 37,000 M
1 cm1 for G90D (Zvyaga et al.,
1996). B, D, Spectral maxima were derived by
least-squares fitting of the log relative absorbance data with a
polynomial implementation (Dawis, 1981) of the Dartnall (1953)
nomogram. E-G, Hydroxylamine separation of
G90D from WT pigment in a (G+/, R+/) mouse. E, The
spectrum of the rhodopsin extract was measured
(Pre-bleach) and then remeasured after sequential
exposure to hydroxylamine (After
NH2OH) and light
(After-bleach), respectively. The raw spectra were
zeroed at 700 nm. F, The calculated difference spectra.
Subtraction of After NH2OH from the
Pre-bleach spectra gives the G90D spectrum; subtraction
of After-bleach from After NH2OH spectra gives the WT
spectrum. Molar amounts of each rhodopsin were calculated using the
appropriate extinction coefficients for each pigment (as above).
G, Spectral maxima of G90D and WT rhodopsin derived by
least-squares fitting of the difference spectra to the Dartnall
nomogram. Fitting to the mixture (Total) pigment
data indicated a max of ~499 nm, although this fit is
not shown, because the nomogram must be adjusted for the mixed G90D
plus WT pigments.
|
|
Spectrophotometric analysis gave a mean max of
501.8 nm for WT rhodopsin and 492 nm for G90D (Fig. 2, Table 2).
Spectra were determined by three independent assays that all gave the same result of an 8-10 nm blue-shift for the G90D pigment: (1) G90D
pigment was measured directly by extracting it from (G+/+, R/)
animals that are expressing two G90D alleles and lack WT rhodopsin; (2)
the spectral absorbance of WT rhodopsin from (R+/) retinas was
subtracted from measurements of (G+/, R+/) retina; and (3) (G+/,
R+/) difference spectra were determined from absorbance measurements
taken before and after treatment of the rhodopsin with hydroxylamine.
G90D mouse pigment was blue-shifted similar to that of the bovine G90D
spectrum previously noted by Kaushal and Khorana (1994) and by Zvyaga
et al. (1996).
Functional analysis
The functional consequence of G90D opsin expression in rods was
assessed by recording the ERG. In contrast to single cell recordings of
rods, which were selective for responsive cells, the ERG averaged the
activity of all rods in the retina. In addition, the ERG provided a
gauge of the neural activity downstream from the rods. The ERG
waveforms and intensity-response relations for four different
genotypes are shown in Figures 3 and
4. The three genotypes with (R+/) are
considered here, and the remaining genotype on the (R/) background
will be described below. The sensitivity of (R+/) mice was ~0.3 log
unit lower than for (R+/+) mice, as was also reported for
the rhodopsin knock-out mice developed by Lem et al. (1999). The
(R+/) will provide the baseline for functional comparisons. Compared
with (R+/), the addition of one transgene allele (G+/, R+/)
resulted in a 0.37 log unit sensitivity loss for the a-wave
(p < 0.01), which reflects photoreceptor activity directly (Penn and Hagins, 1969). The scotopic b-wave, which
arises through activity of bipolar cells postsynaptic to the
photoreceptors (Faber, 1969; Robson and Frishman, 1995; Kofuji et al.,
2000), showed a sensitivity loss of 1.1 log units
(p < 0.01) (Table
3). Both results were highly significant
and could not be accounted for by a change in photon capture, because
the total rhodopsin content of the (G+/,R+/) retina was greater than that of (R+/) (p = 0.04) (Table 2).
(G+/, R+/) retinas had 0.12 log unit less WT rhodopsin than (R+/)
retinas, but even if it were argued that G90D rhodopsin was inactive
and that only WT rhodopsin contributed to the photoresponse, the 0.12 log unit decrease of photon catch by WT rhodopsin could not account for the sensitivity loss. Nor was the desensitization caused by loss of
photoreceptor cells, because even at 30 weeks of age, the (G+/, R+/) retina showed good preservation of photoreceptors compared with
(R+/) littermates (Fig. 1). Comparable loss of ERG threshold sensitivity was also observed in recordings of young, 3- to 4-week-old (G+/, R+/) animals (data not shown), consistent with a congenital phenotype. The a-wave recordings demonstrate that the locus of the
retinal sensitivity loss lies within the rods.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
Dark-adapted ERG responses recorded in
vivo. Flash densities are given on the left.
Responses are from single animals representative of each genotype.
Traces show averages of 10 trials, except for the responses to the two
brightest flashes, which were single trials.
|
|
View larger version (33K):
[in this window]
[in a new window]
|
Figure 4.
Dark-adapted ERG stimulus-response relations for
the b-wave (top) and a-wave (bottom)
recorded in vivo as in Figure 3. To avoid contamination
by postphotoreceptoral ERG sources, the a-wave amplitudes were measured
at a fixed time after flash onset equivalent to 14 msec after
appearance of the a-wave for dim flashes and were not measured at the
a-wave trough, which changes in time with flash intensity. Five mice of
each genotype were recorded at the following ages: (R+/), 17 weeks;
(G+/, R+/), 16 weeks; (G+/+, R+/), 24 weeks; (G+/+, R/), 27 weeks.
|
|
Adding the second G90D allele, i.e., (G+/+, R+/) animals, caused a
further substantial sensitivity loss, greatly disproportionate to the
minimal change in rod count or ROS length (Table
4; see Discussion for P23H rhodopsin
mutant animals). ONL width of (G+/+, R+/) remained essentially
identical to (R+/) (p = 0.96), and ROS length
was only 12% shorter (p = 0.03). A-wave
threshold was desensitized by 1.1 log units from (R+/), and b-wave
threshold shifted 2 log units. Total rhodopsin density in (G+/+,R+/)
was essentially the same as in (R+/), with 60% in the mutant G90D form.
Photoreceptor function was examined further by placing paired
electrodes across the photoreceptor layer in isolated retinas to record
photoreceptor responses with minimal contamination from responses of
other cell types located in other retinal layers. (G+/, R+/) rods
showed a threshold shift of 0.66 log units at higher flash strengths
when compared with (R+/) rods (Fig.
5C). The (G+/,R+/) rod
photoresponses also had a shorter time-to-peak compared with (R+/)
responses (Fig. 6). Faster response
kinetics and decreased sensitivity are associated with light adaptation (Dowling, 1967; Baylor et al., 1984), and these results indicate that
G90D pigment caused the (G+/, R+/) rods to act as if they were
light adapted even when they were maintained in darkness. The (R+/)
rod photoresponses had a slightly shorter time-to-peak compared with
(R+/+) responses (Fig. 5) as has been reported by Lem et al. (1999);
this may result from increased mobility of rhodopsin in the disc
membrane consequent to its decreased density in (R+/).
View larger version (44K):
[in this window]
[in a new window]
|
Figure 5.
Rod a-wave photovoltages recorded from
the isolated retinas of 14- to 16-week-old animals. Flash strengths
increased by one-half log unit steps up to a maximum of 1060 Rh*
rod1 flash1. Flashes were
given at time 0. A-C show the sensitivity shift from
the G90D transgene on heterozygous rhodopsin knock-out background.
A, B, Rod photovoltage responses of
(R+/) and (G+/, R+/) retinas. C, The
intensity-response relationships were fitted with Michaelis-Menten
functions of Vmax
I/(I +  ). Values of
Vmax (in mV) were 0.438, 0.387, and 0.361 for (R+/+), (R+/), and (G+/, R+/), respectively, and sigma values
(in Rh* rod1 flash1) were 43, 55, and 251, respectively. (G+/, R+/) curve shows a rightward
sensitivity shift of 0.66 log unit from (R+/). D-F
show the sensitivity shift of rod photovoltage of WT retina after the
application of a light-adapting background. Dark-adapted
(D) and with a steady background
(E) of 328 quanta rod1
sec1 (equivalent to 82 Rh*
rod1 sec1) that decreases the
response sensitivity and shifts the intensity-response curve
right by 0.70 log unit to reach the criterion response
of one-half dark-adapted response amplitude
(F).
|
|
View larger version (37K):
[in this window]
[in a new window]
|
Figure 6.
Kinetics of averaged, normalized rod a-wave
photovoltages elicited by dim flashes and recorded from excised
retinas. Top, (R+/+) animals show faster time to peak of
the light-adapted rod response compared with the dark-adapted response.
Bottom, The (G+/, R+/) response has faster kinetics
than the (R+/) response in which both were recorded in complete
darkness.
|
|
The dark activity of G90D rhodopsin in producing this threshold
elevation of (G+/, R+/) retinas was estimated by observing the
effect of an adapting background light in elevating the threshold of WT
(R+/+) retinas (Fig. 5D-F). The 0.66 log
unit decrease in photoresponse sensitivity of (G+/, R+/) compared
with (R+/) could be replicated in WT by exposing the retina to
environmental light equivalent to 328 quanta
rod1 sec1
(Fig. 5F), which shifted the WT sensitivity rightward
by ~0.7 log unit using a criterion of one-half amplitude of the
dark-adapted responses. Using standard assumptions that 25% of photons
incident on the rod are absorbed and isomerize rhodopsin (designated
Rh*) (Cone, 1963), this indicated that the G90D rods behaved as if they
were being stimulated internally by an "equivalent light" of 82 Rh*
rod1
sec1.
A second estimate of G90D endogenous noise was developed from the ERG
a-wave recordings of the intact eye (Fig. 3). Threshold of the (G+/,
R+/) a-wave response was shifted 0.37 log unit compared with (R+/)
(Table 3). The calibration derived above was used, i.e., that
exposure to environmental light of 328 quanta rod1 sec1
(Fig. 5) desensitized WT photovoltages by 0.7 log unit. Assuming that
the Weber-Fechner fraction of increment threshold is linear in this
range and that 25% of incident photons isomerize rhodopsin, the
equivalent light internal to each rod photoreceptor was 38 Rh*
rod1 sec1
by this measure.
A third estimate of G90D endogenous activity can be obtained from the
sensitivity shift observed for the b-wave that was recorded from the
intact eye (Fig. 3). B-wave threshold for (G+/, R+/) was shifted by
1.09 log units compared with (R+/) animals (Table 3). Using the
increment sensitivity function that we had previously determined for WT
mice (Toda et al., 1999), this shift represents an equivalent
background of 1.92 log photopic cd/m2,
or 32 Rh* rod1
sec1. From these several different and
independent estimates, rods in the (G+/, R+/) acted as though they
were exposed to an equivalent internal light in the range of 32-82 Rh*
rod1
sec1. This is roughly in the range of or
slightly higher than the "equivalent background" of 10 Rh*
rod1 sec1
that was estimated for the G90D human family with autosomal dominant congenital nightblindness (Sieving et al., 1995).
Adding the second G90D allele, (G+/+, R+/) animals, increased the
relative expression of mutant rhodopsin and gave total rhodopsin
quantity comparable with (R+/) retina (Table 2). The b-wave threshold
shift was 2.05 log units for (G+/+, R+/), compared with (R+/)
animals (Table 3). Increment threshold studies with WT showed that a
comparable shift resulted from a steady background of 0.90 log
cd/m2 (Toda et al., 1999) or ~390 Rh*
rod1
sec1.
G90D on (R/) genetic background
G90D as a structural substitute for WT rhodopsin
Line 202 animals were bred further to put both single and double
alleles of the G90D transgene on the homozygous knock-out (R/)
background (Figs. 7, 8). Both
the (R/) and (G+/, R/) retinas initially develop essentially
normal numbers of photoreceptor nuclei, as shown by ONL column counts
at 4 weeks (Table 4). However, the (R/) retina does not produce
rhodopsin and does not form ROS; instead, it has a zone of amorphous
material between the ONL and RPE. (R/) has progressive loss of rod
nuclei, and cone nuclei are also subsequently lost. By 14 weeks, only
two or fewer rows of photoreceptor nuclei remain (Fig. 7). In contrast,
rods in the (G+/, R/) retina do express rhodopsin (Fig. 7), and they successfully elaborate outer segments. Although this demonstrates that G90D opsin can serve as a structural substitute for WT rhodopsin in the elaboration of ROS, the (G+/, R/) retina still degenerates slowly with age. At 14 weeks, ROSs are still present, but the ONL
thickness is only ~60% of normal.
View larger version (123K):
[in this window]
[in a new window]
|
Figure 7.
Rescue by G90D rhodopsin. Top, Five
week (R/) has normal ONL but no structured ROS, and 1D4 antibody
shows no opsin expression (inset, top
left). Five week (G+/, R/) develops ROS with G90D opsin
expression as shown by the 3A6 antibody labeling (inset,
top right). Bottom, Fourteen week
(R/) ONL has degenerated to less than a single row of cells that
are mostly cone multilobed nuclei. Fourteen week (G+/, R/) shows
relative rod rescue with an ONL thickness of approximately six nuclei
and ROS still present.
|
|
We suspected that the slow degeneration in the (G+/, R/) retina
might result from a gene dosage effect, because a single transgene
allele expresses opsin at approximately one-half the level of a single
WT allele [(G+/, R+/) versus (R+/) retina; Table 2], and some
loss of photoreceptor cells was observed in (R+/) retinas at a later
age (Humphries et al., 1997; Lem et al., 1999). This possibility was
explored by evaluating mice with two G90D alleles on the knock-out
background (G+/+, R/). Mice were identified by quantitative mRNA
analysis, which showed three relatively discrete levels of G90D mRNA
corresponding to the presence of zero, one, or two G90D alleles. The
G90D double allele status was confirmed then by mating with WT (R+/+)
mice in which all progeny carried the G90D transgene in tail DNA assays
of >20 pups and all progeny of mating with (R/) lacked the WT
alleles. The number of G90D alleles in progeny was determined then by
quantitative RT-PCR, which indicated the result unambiguously.
Examples of (G+/+, R/) retinas are shown in Figure 8. Both retinas
show substantial photoreceptor rescue at 36 and 55 weeks of age, with ONL thickness of 6-8 cells and ROS length of 20-22 µm. Electron microscopy of the 36-week-old retina showed well formed ROS with uniform disc spacing and good registration of the disc rims at the ROS
plasma membrane (Fig. 8). Even heterozygous rhodopsin knock-out mice, without the transgene, show some ONL thinning by 1 year
of age (Fig. 8), and three (R+/) retinas at 14 months of age averaged
approximately five cell ONL widths. Consequently the (G+/+,
R/) retinas show good photoreceptor preservation at this age.
View larger version (162K):
[in this window]
[in a new window]
|
Figure 8.
Histology from two (G+/+, R/) retina at ages
of 36 and 55 weeks. Both show minimal ONL thinning and ROS of nearly
normal length. Electron microscopy of the 36 week retina shows well
formed ROS with uniformly spaced discs and good registration of the
disc rims at the ROS plasma membrane. The (R+/) also shows ONL
thinning in a representative 52-week-old mouse.
|
|
The rescue effect of two G90D alleles was evaluated further by
comparing structure and function of littermates, with five (G+/+,
R+/) mice and five (G+/+, R/) mice obtained from parental mating
of (G+/+, R/) to (G+/, R+/), with genotypes confirmed by
analysis of tail DNA as above. At 24-27 weeks, retinas of (G+/+, R+/) and (G+/+, R/) genotypes had similar ROS length
(p = 0.85), and the ONL width was nearly the
same (Table 4). The ERG, however, showed that eliminating the WT allele
caused a sensitivity loss (Table 3). Compared with (G+/+, R+/) mice,
b-wave threshold of (G+/+, R/) mice was elevated by 0.63 log unit
(p < 0.01), and the a-wave threshold was
elevated by 0.41 log unit (p < 0.01). Retinal
rhodopsin measurements of these same 10 mice showed that they differed
only by the presence or absence of WT rhodopsin, because the quantity
of G90D rhodopsin was identical in the two genotypes at ~0.2 nmol per
retina (Table 2). The total rhodopsin density in the (G+/+, R/)
retinas was 64% of (G+/+, R+/) retinas, accounting for 0.19 log unit
elevation of a-wave threshold by photon catch loss. The remaining 0.22 log unit difference in a-wave threshold can be attributed to the lower
efficiency of G90D function measured in vitro by Zvyaga et
al. (1996), in which the G90D extinction coefficient was 13% lower and
activation of transducin by G90D was 41% less than that of WT
rhodopsin, with a net functional efficiency of G90D lower than WT by
0.29 log unit. Zvyaga et al. (1996) also noted that the G90D activated
in vitro was 4.6 times shorter than WT rhodopsin. This
factor should not play a role in vivo, however, because
phosphorylation and arrestin binding quench the rhodopsin R* active
state rather than a thermal transition. The lifetime of WT meta-II
active state is ~1-2 min at 37°C. If the G90D rhodopsin lifetime
is foreshortened to 60 sec/4.6 = 13 sec, this is still far slower
than inactivation by phosphorylation that begins within 100 msec of R*
formation and is complete within 500 msec (Chen et al., 1995) and by
arrestin binding that commences within 150 msec (Xu et al., 1997).
G90D rhodopsin supports phototransduction in rods
(R/) mice have a negligible a-wave even under dark-adapted
conditions [e.g., see the (R/) responses in Toda et al., (1999)]. This is not surprising because all ERG activity of (R/) mice is
cone-mediated, even under dark-adapted conditions (Toda et al., 1999),
and the murine cone-driven photopic a-wave is quite small. Consequently
the presence of a dark-adapted a-wave in the recordings of (G+/+,
R/) mice in Figures 3 and 4 is evidence that G90D rhodopsin can
mediate light-evoked rod responses in vivo. Furthermore, the
b-wave threshold of (G+/+, R/) is 1.4 log units lower than the
threshold of cone responses of (R/) (Table 3), which further
indicates that G90D rods can mediate light responses.
| |
DISCUSSION |
G90D fulfillment of the ROS requirement for rhodopsin
(R/) rods lack rhodopsin and fail to produce outer segments
(Humphries et al., 1997; Lem et al., 1999). The presence of ROS in
(G+/, R/) indicates that G90D provides a suitable replacement for
WT rhodopsin. Nevertheless, rods from (G+/, R/) animals were
slowly lost with age. However, with the increased G90D expression in
(G+/+, R/) mice, roughly one-fourth to one-half of normal WT
rhodopsin levels, rod survival was markedly prolonged, with only
minimal rod loss even at 1 year of age. Interestingly, the presence of
the G90D transgene appeared to downregulate the expression of WT
rhodopsin when added to (R+/) background. Because a twofold increase
in transgene copy number, from one to two alleles, yielded less than a
twofold increase in G90D rhodopsin, there may have been some
downregulation of G90D expression as well.
"Dark-light" in G90D vision
The human G90D phenotype of congenital nightblindness in the
absence of clinically apparent retinal degeneration led us to hypothesize that rod function was impaired separately from any rod loss
(Sieving et al., 1995). This is now supported by findings in these G90D
mice. (G+/, R+/) mice as young as 3-4 weeks of age showed the rod
functional deficit, consistent with the human G90D congenital
phenotype. The desensitization increased with the number of G90D
alleles expressed. G90D formed a bleachable pigment that supported
normal photoactivation of transduction leading to rod responses
in vivo. Therefore, the desensitization cannot be explained
by a decreased quantal catch or by an inability to generate a
photoresponse. G90D pigment in mice also decreased the maximal a-wave
and b-wave amplitudes and caused an acceleration of the rod response
kinetics. As also occurs for retinal desensitization from a background
light (Green and Powers, 1982), desensitization of the b-wave was
greater than that of the a-wave in G90D animals.
These effects were mimicked in WT rods by exposing them to continuous
environmental light. Background light giving rise to 82 Rh*
rod1 sec1
caused a sensitivity change in WT rod photovoltages comparable with
that from adding a single G90D allele to the (R+/) genotype. Endogenous G90D light was also observed on ERG recordings that indicated an equivalent of 38 Rh* rod1
sec1 for the a-wave sensitivity loss and
32 Rh* rod1
sec1 for the b-wave shift for (G+/,
R+/) vs (R+/). This is 3-4 log units greater than the normal WT
rate of photon-like discrete noise events of ~0.01
rod1 sec1
measured from Macaca fascicularis rods in darkness
(Baylor et al., 1984). The phosphodiesterase activity produced by this
level of equivalent endogenous light would be sufficient to explain much of the flash desensitization and acceleration of the flash response kinetics (Nikonov et al., 2000). The in vivo
measurements from G90D mice are consistent with in vitro
biochemical studies demonstrating that G90D rhodopsin activates
transducin in darkness (Rao et al., 1994). We conclude that G90D
rhodopsin gives rise to an increased intrinsic noise equivalent to an
endogenous dark-light signal that leaves the rod in a desensitized,
partially light-adapted state. This distinguishes the G90D phenotype
from other forms of congenital stationary nightblindness caused by
synaptic or trans-synaptic deficits (Bech-Hansen et al., 2000).
G90D rhodopsin has properties that mimic cone pigment: G90D is
spectrally shifted from rhodopsin, G90D is chemically degraded by
hydroxylamine, photoactivated G90D decays more rapidly than WT
rhodopsin, and G90D activates the phototransduction cascade in
darkness. Dark activity by cone pigments |
TOP
ABSTRACT
INTRODUCTION
