 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2001, 21(15):5587-5596
Interactions between Fibroblast Growth Factors and Notch Regulate
Neuronal Differentiation
Clare H.
Faux1,
Ann M.
Turnley1,
Ruwan
Epa2,
Roberto
Cappai3, and
Perry F.
Bartlett1
1 The Walter and Eliza Hall Institute of Medical
Research, The Royal Melbourne Hospital, Victoria 3050, Australia, and
Departments of 2 Physiology and 3 Pathology,
The University of Melbourne, Parkville, Victoria 3010, Australia
 |
ABSTRACT |
The differentiation of precursor cells into neurons has been shown
to be influenced by both the Notch signaling pathway and growth factor
stimulation. In this study, the regulation of neuronal differentiation
by these mechanisms was examined in the embryonic day 10 neuroepithelial precursor (NEP) population. By downregulating Notch1 expression and by the addition of a Delta1 fusion protein (Delta
Fc), it was shown that signaling via the Notch pathway inhibited neuron
differentiation in the NEP cells, in vitro. The expression of two of the Notch receptor homologs, Notch1
and Notch3, and the ligand Delta1 in these NEP cells was found to be
influenced by a number of different growth factors, indicating a
potential interaction between growth factors and Notch signaling.
Interestingly, none of the growth factors examined promoted neuron
differentiation; however, the fibroblast growth factors (FGFs) 1 and 2 potently inhibited differentiation. FGF1 and FGF2 upregulated the
expression of Notch and decreased expression of Delta1 in
the NEP cells. In addition, the inhibitory response of the cells to the
FGFs could be overcome by downregulating Notch1 expression and by
disrupting Notch cleavage and signaling by the ablation of the
Presenilin1 gene. These results indicate that FGF1 and FGF2 act via the
Notch pathway, either directly or indirectly, to inhibit
differentiation. Thus, signaling through the Notch receptor may be a
common regulator of neuronal differentiation within the developing forebrain.
Key words:
Notch; Delta; growth factors; fibroblast growth factor
(FGF); neuroepithelial precursor cells; regulation of
differentiation
 |
INTRODUCTION |
The complex array of neurons and
glia within the nervous system initially arise from the neuroepithelial
precursor (NEP) cells found within the neural tube. It now appears that
cell interactions are pivotal regulators of neuron differentiation, in
addition to allowing cell proliferation and the continual renewal of
the precursor population. The Notch receptor, and its ligands Delta and
Serrate/Jagged, are membrane-bound proteins that provide an essential
mechanism of interaction between adjacent cells. Studies examining the
role of Notch signaling during development have found it to be
associated with the inhibition of neurogenesis (Austin et al., 1995 ;
Chitnis et al., 1995 ; Dorsky et al., 1995 , Nakamura et al., 2000 ).
However, the exact role of Notch and Delta in mammalian CNS precursor
cells remains to be determined.
The Notch receptor is a 300 kDa protein with a single transmembrane
domain. The extracellular domain of Notch consists of epidermal growth
factor (EGF)-like repeats, which are required for ligand binding, and a
second region, the Lin12/Notch repeat region. The intracellular domain
also contains highly conserved domains, the RAM23 domain and the
cdc10/ankyrin repeat (Fleming 1998 ), which bind to intracellular
proteins that regulate Notch signaling. Delta also contains EGF-like
repeats in the extracellular domain; however, receptor binding occurs
via the Delta/Serrate/Lag (DSL) domain, at the N terminus of the
protein (Fleming 1998 ).
Analysis of Notch signaling has shown that the intracellular domain is
cleaved after ligand binding (Schroeter et al., 1998 ), a process
that appears to be mediated by Presenilin proteins (De Strooper et al.,
1999 ; Song et al., 1999 ; Steiner et al., 1999 ). The intracellular
domain of Notch is directed to the nucleus (Tamura et al., 1995 ), where
it initiates transcription of certain basic helix-loop-helix (bHLH)
genes (Jarriault et al., 1998 ), resulting in the inhibitory cellular
response and the downregulation of Delta expression (Heitzler et al.,
1996 ; Parks et al., 1997 ). Delta expression is also regulated by
various bHLH transcription factors, which are essential for
neurogenesis (Ma et al., 1996 , 1998 ; Fode et al., 1998 ; Casarosa et
al., 1999 ). Although many of the proteins involved in Notch signaling
have been discovered, extracellular factors that regulate the pathway
remain to be determined.
Various growth factors are also important for the development of the
nervous system, many of which inhibit neuronal differentiation. These
include fibroblast growth factor 1 (FGF1) and FGF2 (Murphy et al.,
1990 ; Drago et al., 1991 ), leukemia inhibitory factor (Bonni et al.,
1997 ; Koblar et al., 1998 ), and bone morphogenetic proteins (Shou et
al., 1999 ). The inhibitory nature of these factors prompted our
examination of potential interactions between growth factors and the
Notch signaling pathway.
In the present study we have shown that FGF1, FGF2, or Notch signaling
in mouse NEP cells inhibited neuron differentiation and that expression
of Delta and Notch within these cells was regulated by FGF1 and FGF2.
The inhibition of neurogenesis with FGF could be overcome by disrupting
Notch signaling in vitro, indicating that inhibition caused
by FGF may be regulated by the Notch pathway.
 |
MATERIALS AND METHODS |
Reagents. Recombinant FGF2 was obtained from
Boehringer Mannheim (Roche, Germany). Recombinant FGF1, brain-derived
neurotrophic factor (BDNF), and neurotrophin (NT)-3 were obtained from
PeproTech Inc. Recombinant FGF8, transforming growth factor
(TGF) 5, and oncostatin M (OSM) were obtained from R&D
Systems. Recombinant bone morphogenetic protein (BMP) 2 and BMP4 were
obtained from Genetics Institute. CNTF was obtained from Alomone labs
(Jerusalem, Israel). Recombinant leukemia inhibitory factor
(LIF) was obtained from AMRAD. Each of the growth factors was used at
50 ng/ml unless stated otherwise, except recombinant LIF (specific
activity 108 U/mg), which was used at a
concentration of 1000 U/ml in culture.
Isolation of embryonic day 10 neuroepithelial precursor
cells. Embryonic day 10 (E10) NEP cells were isolated from CBA
mice as described previously (Murphy et al., 1990 ). Cells were
dissociated into a single-cell suspension, washed, and resuspended in
serum-free media before plating onto tissue culture plates coated with
poly-DL-ornithine (Sigma, St. Louis, MO) and
laminin (Life Technologies, Gaithersburg, MD). Cells were plated at
high cell density, in either 24-well or 96-well plates (Falcon) or
Terasaki plates (Bio-Rad, Burlingame, CA) at 200,000, 15,000 and 2,000 cells per well, respectively. The serum-free media was the media
hormone mix described previously by Reynolds and Weiss (1992) and
Gritti et al. (1996) . When cultured in the presence of serum, cells
were grown in Monomed (Life Technologies) with part A supplement (CSL).
E10 NEP cells were isolated from Presenilin1 null mutant mice (Wong et
al., 1997 ) obtained from Dr. Hui Zheng (Baylor College of Medicine).
The genotypes of individual mice were determined by PCR using primers
to Presenilin1, 5' primer,
AGCCAAGAACGGCAGCAGCAGCATGACAGGCAGAG, and 3' primer,
CTTCCATGAGCCATTTGCTAAGTGC, and the neo gene CCATTGCTCAGCGGTGCTGTCCAT as
described by Qian et al. (1998) .
RT-PCR analysis. RNA was purified from tissue and cultured
cells using the RNeasy minikit (Qiagen, Hilden, Germany). RNA was reverse transcribed using Superscript II (Life Technologies) with 10 pmol oligo-dT (Promega, Madison, WI) as primer and 1 µg of total RNA.
The RNA and oligo-dT were denatured by heating to 70°C before rapidly
chilling on ice. The reverse transcription reaction was performed in a
volume of 20 µl containing 1× Superscript II buffer, 0.1 mM DTT, and 10 µM each of
dATP, dTTP, dCTP, and dGTP for 1 hr at 42°C. For PCR
amplification, specific oligonucleotide primer pairs were incubated
with 2 µl cDNA and 2.5 U/µl pfu polymerase (Stratagene, La Jolla,
CA) in a 100 µl reaction mix that included 1× buffer and 200 µM each of dATP, dTTP, dCTP, and dGTP. Typical cycle conditions were 1 min at 94°C, 1 min at 55°C, and 2 min at
72°C for 35 cycles. Ten microliters of the reaction were then separated on a 1% agarose gel and visualized by ethidium bromide staining.
The primers for RT-PCR analysis were as follows: mouse
Notch1 5' primer, TTACAGCCACCATCACAGCCACACC and 3'
primer, ATGCCCTCGGACCAATCAGA; mouse Notch2 5' primer,
GAGGCGCTCTTCTGCTGTTGAAGA and 3' primer, ATAGAGTCACTGAGCTCTCGGACAG;
mouse Notch3 5' primer, ACACTGGGAGTTCTCTGT and 3' primer,
GTCTGCTGGCATGGGATA; mouse Delta1, 5' primer
TGTGACGAGCACTACTACGGAGAAG and 3' primer, AGTAGTTCAGGTCTTGGTTGCAGAA; and
mouse -actin 5' primer RT-PCR -actin
5' primer, CTGAAGTACCCATTGAACATGGC and 3' primer CAGAGCAGTAATCTCCTTCTGCAT.
Northern blot analysis. RNA was isolated from cells cultured
in 24-well plates for 24 hr in the presence of various growth factors
and serum using the RNeasy minikit (Qiagen). After electrophoresis through a 0.8% agarose-formaldehyde gel, RNA was capillary
transferred to Hybond nylon membrane (Amersham, Arlington Heights, IL)
overnight using 20× SSC buffer and then fixed to the filter by
exposure to UV light using a Stratalinker (Stratagene). The filter was prehybridized for 2 hr at 68°C in a solution containing 4× SSC, 5×
Denhardt's solution (0.1% Ficoll, 0.1% polyvinylpyrrolidine, 0.1%
BSA), 2.5% SDS, and 100 µg/ml salmon sperm DNA.
32P-labeled probes (with a specific
activity of at least 106 cpm/ml) were made
using random primer DNA synthesis with the NEBlot Kit (New England
Biolabs, Beverly, MA) using double-stranded DNA fragments of Notch1
(base pairs 1-889), Notch3 (base pairs 3340-4250), and Delta1 (base
pairs 1850-1648). Probes were boiled for 5 min before addition to the
hybridization solution and hybridized overnight at 68°C. Unbound
probe was removed by washing twice in 2× SSC, 0.1%SDS and then twice
in 0.2× SSC, 0.1%SDS for 15 min each wash. Filters were exposed to
phosphorimager screens (Molecular Dynamics, Sunnyvale, CA) and scanned
by a Molecular Dynamics Phosphorimager. The RNA level of Notch1,
Notch3, or Delta1 was quantified using ImageQuant 5.0 (Molecular
Dynamics) and by comparison with the total amount of RNA loaded using a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe. Filters were
stripped of probes for reprobing by boiling in 0.1% SDS.
Treatment with the Delta1 immunoglobulin Fc fusion protein (Delta
Fc). The extracellular domain of mouse Delta1, not including the
transmembrane domain, was cloned into a derivative of the vector
pEF-BOS (Mizushima and Nagata, 1990 ) containing the Fc region (hinge,
CH2, and CH3 domains) of the genomic human IgG1 gene. The resultant
plasmid, encoding Delta Fc, was transiently transfected into 293T cells
by calcium phosphate transfection. The pEF-BOS vector expressing the Fc
region alone was used as a control (control Fc). The transfected cells
were lysed in a lysis buffer containing (in mM):
10 HEPES, pH 7.3, 10 NaCl, 1 KH2PO4, 1 CaCl2, 0.5 MgCl2, and 5 NaHCO3, by dounce homogenization on ice. The
lysate was centrifuged at 11,000 × g for 10 min to pellet the nuclei and unbroken cells. Production of the Delta Fc
protein and the control Fc protein was detected in the supernatant by
Western blot analysis with a peroxidase-conjugated polyclonal antibody
to human IgG (Dako, Glostrup, Denmark).
E10 NEP cells were cultured in 96-well plates in the media specified
for 16 hr before treating with the supernatant obtained from the above
cell lysate. The supernatant was added to the cells at a 1:4 dilution
in the culture media. The cells were cultured for a further 24 or 48 hr
before fixing in 2% paraformaldehyde, staining for
microtubule-associated protein 2 (MAP2) and DAPI, and performing cell
counts as described below.
Treatment with antisense oligonucleotide. Antisense
oligonucleotides were used to downregulate the expression of
Notch1 in the E10 NEP cells. The antisense oligonucleotides
were designed against the EGF repeat region of the Notch1
gene (Austin et al., 1995 ) and had an adamentane group attached to the
5' end via a carbon linker. Nonsense oligonucleotides were used
as a control and contained the same ratio of base pairs found in the
antisense oligonucleotides but in a random order. The sequence for the
antisense oligonucleotide was 5'-GAAGTCATTAACACGCTGCACAC, and for
the nonsense oligonucleotide it was 5'-TACATCAGCAGACTACACGAGTC. The
oligonucleotides were purified by HPLC and resuspended in a 1%
cyclodextrin solution. The adamentane and cyclodextrin enhance the
entry of the oligonucleotide into the cell (Epa et al., 2001 ).
Freshly dissected E10 NEP cells were mixed with the oligonucleotides at
5 µM immediately before plating. Cells were
plated in 96-well plates and cultured for 48 hr before they were fixed
with 2% paraformaldehyde and MAP2-positive cells were counted.
Immunohistochemistry and cell counts. After fixing in 2%
paraformaldehyde for 20 min at room temperature, cells were incubated in 100% cold methanol at 20°C for a further 20 min to permeabilize the cells. The cells were washed three times in PBS and blocked by
incubating the cells in PBS containing 1% fetal calf serum and 1%
normal horse serum for 20 min at room temperature. To stain the
MAP2-positive neurons, cells were incubated with a monoclonal anti-MAP2
antibody (Sigma) diluted 1:400 in PBS, 1% FCS for 30 min. After a
second wash step, a biotin-conjugated horse anti-mouse Ig secondary
antibody (Vector Laboratories, Burlingame, CA) was added to the cells
(1:200) for 20 min, followed by a third wash step and incubation with
an avidin-horse radish peroxidase complex (Vectorstain Kit, Vector).
The MAP2-positive cells were then visualized by the reaction of
hydrogen peroxide and 3.3'-diaminobenzidine tetrahydrochloride (DAB) to
form a colored product. Cells were washed and stored in PBS containing
0.1% sodium azide. To visualize all cells present in the cultures, the
fluorescent DNA binding dye DAPI (Molecular Probes) was added with
secondary antibody at a 1:1000 dilution. The cells were then visualized
by fluorescence microscopy.
When experiments were performed in 96-well plates, five randomly
selected fields of view at 20 magnification were counted. When
experiments were performed in Terasaki plates, the entire well was
counted. The results were expressed as the number of MAP2-positive
neurons produced per 100 DAPI-positive cells counted, with a minimum of
200 cells counted per well. Cell viability was assessed by the nuclear
morphology after DAPI staining. In each experiment four wells of each
condition were counted, and each experiment was repeated at least three
times. All values are expressed as the mean ± SEM.
 |
RESULTS |
Delta1 and Notch1, -2, and -3 are
expressed in mouse neuroepithelial precursor cells
Previous reports indicated that Delta1 expression was
first detectable in the mouse CNS at E8 and continued to be expressed in the ventricular zone until approximately E14 (Bettenhausen et al.,
1995 ; Dunwoodie et al., 1997 ). The various Notch homologs were also
reported to be expressed from embryonic day 8 in the mouse nervous
system: Notch3 expressed first, followed by
Notch2 and Notch1 (Lardelli et al., 1994 ;
Williams et al., 1995 ; Lindsell et al., 1996 ; Sestan et al., 1999 ;
Redmond et al., 2000 ). To determine whether the precursor population
from the developing forebrain expressed the various forms of Notch and
Delta at the onset of neuronal differentiation, the stage at which they
were to be assayed in vitro, RT-PCR analysis was performed
on NEP cells isolated from E10 forebrains. mRNA for Notch1,
-2, and -3 and Delta1 were all found
to be present in the freshly isolated E10 NEP cells and in cells that
had been cultured at high cell density in vitro in the
presence of serum for 24 and 72 hr (Fig.
1).

View larger version (78K):
[in this window]
[in a new window]
|
Figure 1.
The expression of Notch and Delta in the
neuroepithelial precursor cells of the developing mouse nervous system.
RT-PCR analysis showing expression of Notch1,
Notch2, Notch3, Delta1,
and the -actin control gene in E10
mouse embryos, in E10 NEP cells, and in E10 NEP cells cultured in the
presence of serum for 24 and 72 hr.
|
|
Delta1 inhibits the differentiation of E10 neuroepithelial
precursor cells
To determine the effect of signaling through Notch on E10 NEP
cells in vitro, a fusion protein containing the
extracellular domain of Delta1 joined to human IgG1Fc (Delta Fc) was
constructed (Fig. 2A).
The Delta Fc protein was expressed in transiently transfected 293T
cells and detected by Western blot analysis (Fig.
2B). The Delta Fc cell lysate, or a lysate from cells
transiently transfected with a control IgG1 vector (Fig.
2B, control Fc), were added to E10 NEP
cells cultured in the absence of serum, and the number of MAP2-positive
neurons generated was analyzed. No difference in the number of neurons
generated was observed 24 hr after the addition of Delta Fc compared
with controls. After 48 hr, however, Delta Fc was able to significantly
inhibit neuron differentiation, compared with the controls, to the
extent that no new neurons were generated between 24 and 48 hr in the
presence of Delta Fc (Fig. 2C). To ensure that the
inhibition of differentiation was caused by the Delta Fc protein and
not other factors expressed by the 293T cells, the Delta Fc and Fc
proteins were purified by size separation chromatography and added to
the NEP cells for 48 hr (data not shown). Compared with the neuron
number after the addition of Fc cell lysate, the number of neurons
produced with the purified Fc protein (21.5 ± 0.2%) and Delta Fc
protein (14.5 ± 0.75%) was increased. However, the purified
Delta Fc protein inhibited neuron differentiation to the same degree as
that observed with the Delta Fc cell lysate. To determine whether Delta
Fc was signaling via Notch, Delta Fc was added to cells from
Presenilin1 knock-out animals. Presenilin1 is required for the cleavage
of the intracellular domain of Notch after ligand binding (Song et al.,
1999 ; Struhl and Greenwald, 1999 ) and therefore Notch signaling is
disrupted in the Presenilin1-deficient cells. The Delta Fc cell lysate
was added to NEP cells from wild-type animals (+/+) and animals with a
heterozygous (+/ ) or homozygous ( / ) deletion in
Presenilin1, and the production of neurons after 48 hr in
culture was assessed (Fig. 2D). The inhibition of
neuronal differentiation observed in the wild-type cells in response to
Delta Fc was consistent with that seen in Figure 2C after 48 hr. In contrast, Delta Fc was unable to inhibit the differentiation of
NEP from Presenilin1 knock-out animals (Fig. 2D). In
addition, although a low level of inhibition was observed by Delta Fc
in the Presenilin1 heterozygous cells, this inhibition was not
significantly different from the control. These data suggest that Delta
Fc signals via Notch to inhibit neuronal differentiation in the
neuroepithelial precursor cell population.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2.
The extracellular domain of Delta1 inhibits the
differentiation of E10 neuroepithelial precursor cells but is unable to
inhibit the differentiation of NEP cells with a mutation in
Presenilin1. A, Schematic diagram of
full-length Delta1, the Delta Fc fusion protein, showing the
extracellular domain of Delta1 fused to the human IgG1 Fc, and the
control human Fc proteins. The various sequence motifs are defined by
shaded boxes and depicted at the bottom
of the figure. DSL, Delta/Serrate/Lag domain; TM
Domain, transmembrane domain. B, Western blot
analysis showing expression of the Delta Fc protein and the control Fc
in the cell lysate of transiently transfected 293T cells. The protein
was detected using an antibody to human IgG1. C,
Assessment of the number of MAP2-positive neurons produced by E10 NEP
cells in vitro, after the addition of Delta Fc or
control Fc cell lysates. Cells were cultured in the absence of serum in
96-well plates. No difference in neuron production was observed after
24 hr, whereas after 48 hr Delta Fc significantly inhibited neuron
differentiation (*p < 0.05; mean ± SEM).
D, Delta Fc or control Fc cell lysate was added to
wild-type NEP cells (+/+) or NEP cells containing a heterozygous (+/ )
or homozygous ( / ) deletion in the Presenilin1 gene.
Cells were cultured in the absence of serum in 96-well plates for 48 hr
(*p < 0.05; mean ± SEM).
|
|
Growth factors can influence the expression of Notch and Delta by
E10 NEP cells in vitro
Little is known about the upstream factors that may regulate the
Notch-Delta inhibitory pathway. It is possible that various growth
factors act to inhibit neurogenesis, at least in part, by regulating
the level of Delta or Notch expression. To examine this question more
closely, we initially sought to determine which growth factors
influenced the neuronal differentiation of the E10 NEP cells. Northern
blot analysis then was used to quantify changes in the expression of
Notch and Delta induced by these factors.
It was found that the presence of serum in the medium significantly
inhibited the differentiation of precursor cells into neurons (Fig.
3A) and increased the overall
number of cells present in the culture (Fig. 3B). Because of
the response observed with serum, we examined the effect of various
growth factors on cells cultured in either the presence or absence of
serum. Each dose of growth factor that was added to the cells ensured
that the cells were maximally stimulated by that growth factor. Members of the fibroblast growth factor family, FGF1, FGF2, and FGF8, were all
found to inhibit the neuronal differentiation of the E10 NEP cells and
caused a significant increase in cell number in both the presence and
absence of FCS (Fig. 3A,B). LIF
caused a slight increase, although not significant, in cell number and inhibited neuronal differentiation. However, both of these effects were
observed only when serum was present in the cultures, suggesting that
certain factors present in FCS are able to alter the response of the
cells to LIF. In contrast, OSM, another member of the neurocytokine family, caused a decrease in cell number but had no effect on neuron
differentiation. A decrease in cell number occurred when members of the
TGF superfamily, BMP2, BMP4, TGF 3, and TGF 5 were added to the
cultures alone. However, with serum present, only TGF 5 affected cell
number. TGF 5 also caused a slight decrease in the percentage of
neurons produced, whereas BMP2, BMP4, and TGF 3 did not alter
neurogenesis. NT-3 decreased the number of cells present in the
cultures, whereas BDNF had no effect on either cell number or
differentiation (Fig. 3).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 3.
Serum and growth factors affect the neuronal
differentiation (A) and overall number of cells
(B) generated by E10 NEP cells in
vitro. E10 NEP cells were cultured in Terasaki plates for 48 hr
in the presence or absence of serum with growth factors.
A, The effect on neurogenesis was analyzed by examining
the number of MAP2-positive neurons produced per 100 cells.
B, The total number of DAPI-positive cells per well. The
production of neurons and the number of cells present in cultures
without growth factor were compared with those with growth factor added
(* denotes significant differences when serum is present; # denotes
significant differences when serum is absent; p < 0.05; mean ± SEM). FGF, Fibroblast growth factor;
BMP, bone morphogenetic protein; TGF ,
transforming growth factor ; LIF, leukemia inhibitory
factor; OSM, oncostatin M; BDNF,
brain-derived neurotrophic factor; NT-3, neurotrophin
3.
|
|
Overall, none of the growth factors examined caused a significant
increase in the percentage of neurons generated in culture, but
several, including serum, inhibited the generation of neurons. To
determine whether the inhibitory response observed with several of the
growth factors was associated with a change in the expression levels of
Notch and Delta, Northern blot analysis was undertaken.
Serum increased the expression of Notch1 and decreased
expression of Delta1 in cultured E10 NEP cells but had no
effect on Notch3 expression (Fig.
4). The increase in Notch1
expression observed with serum was further enhanced by the presence of
FGF1, FGF2, FGF8, TGF 5, and LIF (Fig.
5A). Interestingly, in the
absence of serum, FGF1 significantly decreased Notch1
expression (Fig. 5B). BMP2 also decreased Notch1 expression
in the absence of serum, whereas it increased the expression of
Notch3 (Fig. 5C,D). Notch3 expression was also significantly increased in the absence of serum by
TGF 5, LIF, NT-3, and FGF2 (Fig. 5C,D). In
contrast, with serum present FGF2 did not increase Notch3
expression (Fig. 5C). Expression of Delta1 was
increased only by TGF -5, in both the presence and absence of serum
(Fig. 5E,F). FGF2 and BMP2
decreased expression of Delta1 in the absence of serum. This
decrease was found to be even greater when serum was present and was
also observed with the addition of FGF1 and serum. None of the other
growth factors examined altered Delta1 expression.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 4.
Serum alters the expression of
Notch1 and Delta1 but does not affect
Notch3 expression in E10 neuroepithelial cells. Cells
were cultured in the presence or absence of serum for 24 hr before the
RNA was extracted. Northern blot analysis was used to examine gene
expression, and the relative level of mRNA expressed was quantified by
phosphorimager analysis and comparison with GAPDH expression. Shown is
a representative of three independent experiments.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Figure 5.
Growth factors influence the expression of
Notch1 (A, B),
Notch3 (C, D), and
Delta1 (E, F). E10
neuroepithelial cells were cultured with growth factors in either the
presence (A, C, E) or
absence (B, D, F)
of serum for 24 hr. Northern blot analysis was used to examine gene
expression, and the relative level of mRNA was determined by
phosphorimager and comparison with GAPDH expression
(*p < 0.05; mean ± SEM).
|
|
FGF1 and FGF2 inhibit neurogenesis via the
Notch-Delta pathway
To determine whether the upregulation of Notch
expression with FGF1, FGF2, or serum was related to the low neuronal
number, an antisense oligonucleotide, designed to downregulate Notch1 expression, was used in the assay. The antisense oligonucleotide, designed against the EGF repeat coding region of the mouse
Notch1 gene, has previously been shown to reduce Notch1
expression in neural cells in vitro (Austin et al., 1995 ).
To confirm the specificity and efficacy of the oligonucleotide for
Notch1, the antisense oligonucleotide was shown to effectively
downregulate Notch1 expression in 293T cells transiently
transfected with a Notch1 plasmid, when compared with
nonsense controls (Fig.
6A). Addition of the
antisense oligonucleotide to NEP cells grown in serum alone resulted in a significant increase in the production of MAP2-positive neurons, compared with the nonsense control cultures. FGF1 still exerted some
inhibitory effects in the presence of antisense oligonucleotide, in
that it did not completely restore the number of neurons generated in
the no-factor control. However, when compared with the FGF1 nonsense
control, a significant increase in neurons was observed (Fig.
6B) with antisense. In contrast, the antisense
oligonucleotides were unable to alter neuron number when cells were
cultured in 50 ng/ml FGF2 (Fig. 6B). However, when
the FGF-2 concentration was lowered to 10 or 5 ng/ml, a significant
increase in neuron production was observed with the antisense
oligonucleotide compared with nonsense controls (Fig.
6C).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6.
The production of neurons by E10 NEP cells is
increased after the downregulation of Notch1 expression by antisense
oligonucleotides. A, Northern blot analysis was used to
assess the downregulation of Notch1 expression in 293T
cells transiently transfected with a Notch1 plasmid.
Antisense or nonsense oligonucleotides (5 µM) were added
to the cells 24 hr after transfection, and RNA was extracted 48 hr
later. B, E10 NEP cells were cultured with 5 µM antisense or nonsense oligonucleotide in the presence
of serum alone (No factor) or with serum plus FGF1 or
FGF2 (50 ng/ml) for 48 hr. An increase in neuron production was
observed after antisense treatment in serum and serum plus FGF1, but
not in FGF2. C, E10 NEP cells were cultured with 5 µM antisense or nonsense oligonucleotide in serum plus
FGF2 at varying concentrations (50, 10, and 5 ng/ml). An increase in
neuron production was observed after antisense treatment at lower
concentrations of FGF2 (*p < 0.05; mean ± SEM).
|
|
To further establish the role of Notch during FGF signaling, E10 NEP
cells from animals with a deletion in the Presenilin1 gene
were examined after stimulation with either FGF1 or FGF2. Cells from
wild-type animals (+/+) or animals heterozygous (+/ ) or homozygous
( / ) for the Presenilin1 deleted allele, were cultured in
either the presence or absence of serum and with 50 ng/ml FGF2 or FGF1
for 24 hr (Fig. 7). Both FGF2 and FGF1
significantly inhibited the neuron differentiation of the wild-type
(+/+) cells. In contrast, however, FGF2 and FGF1 were unable to inhibit
the differentiation of cells from Presenilin1 homozygous knock-out
animals, in either the presence (Fig.
7A,B) or absence (Fig.
7C,D) of serum. In addition, the neuronal
differentiation of the Presenilin1 heterozygous cells was not inhibited
by FGF1 (Fig. 7A,C) or FGF2 when
serum was present (Fig. 7A). However, in the absence of
serum, FGF2 continued to inhibit the differentiation of the
heterozygous cells (Fig. 7D). Interestingly, compared with
the wild-type controls, a significant increase in the production of
MAP2-positive neurons was also observed by the Presenilin1 homozygous
knock-out cells. An increase in neuron production by the Presenilin1
homozygous knock-out cells also occurred in the presence of FGF1 and
FGF2. These results suggest that FGF1 and FGF2 require Notch signaling
to inhibit the neuronal differentiation of the E10 NEP cells.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 7.
FGF2 and FGF1 do not inhibit the neuronal
differentiation of NEP cells from Presenilin1 knock-out animals.
A, E10 NEP cells from wild-type animals (+/+) or from
animals with a heterozygous (+/ ) or homozygous ( / ) deletion in
Presenilin1 were cultured for 24 hr in the presence of serum and serum
plus FGF1 (50 ng/ml). B, Cells were cultured in serum
and serum plus FGF2. C, Cells were cultured in
serum-free media alone and with FGF1. D, Cells were
cultured in serum-free media alone and with FGF2
(*p < 0.05; mean ± SEM).
|
|
Delta1 inhibits neuron differentiation in the presence of FGF1, but
not in the presence of FGF2
In the absence of serum, there is significant neuronal
production in the presence of inhibitory growth factors, especially FGF1 (Fig. 3A). Because these conditions are associated with
lowered levels of Notch expression and therefore lowered Notch
signaling (Fig. 5B), we examined whether this component of
neuronal production could be inhibited if Notch signaling was further
activated by adding exogenous Delta Fc to these cultures. Similar to
the results obtained in serum-free cultures without any growth factors
added (Fig. 2C), the addition of Delta Fc to NEP cells
stimulated with FGF1 had no effect on neuron production within the
first 24 hr but showed significantly lower numbers of neurons compared
with controls at 48 hr (Fig.
8A). In contrast, Delta
Fc was unable to alter the inhibitory activity of FGF2 at 24 or 48 hr
(Fig. 8A). In the presence of FCS, no significant
effect of the exogenous Delta on neuron production was observed under
any condition (Fig. 8B).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 8.
Delta Fc inhibits the differentiation of E10 NEP
cells cultured in the presence of FGF1, but not in the presence of FGF2
or serum. A, E10 NEP cells were cultured in serum-free
media (No factor) and with either FGF1 (50 ng/ml) or
FGF2 (50 ng/ml) for 24 and 48 hr after the addition of the Delta Fc or
control Fc cell lysate. No difference in neuron production was observed
after 24 hr in culture, but after 48 hr Delta Fc decreased the number
of neurons produced in the presence of FGF1, but not FGF2
(*p < 0.05; mean ± SEM) B,
E10 NEP cells were cultured in the presence of serum alone (No
factor) or serum plus FGF1 or FGF2 (50 ng/ml) for 48 hr after
the addition of Delta Fc or control Fc cell lysate. No difference in
the number of neurons produced was observed. C, The
overall number of cells cultured in the absence of serum (No
factor) or with FGF1 or FGF2 was unaltered by the Delta Fc cell
lysate. Note the increase in cell number with both FGF1 and FGF2.
|
|
To examine whether the inhibitory effect of exogenous Delta on
FGF1-stimulated neuronal production was associated with changes to
overall growth of the precursor population, the total number of cells
present in the culture was examined. No difference in the number of
cells was observed between Delta Fc-treated cultures and controls at 48 hr (Fig. 8C), when the cells were cultured either in
serum-free media without growth factors or in the presence of FGF1 or
FGF2 (50 ng/ml).
The effect of exogenous Delta was next examined under conditions in
which precursor cells were first prevented from differentiating by
culturing them in FGF-2 and serum for 24 hr, then allowing neuronal
differentiation to occur by removing the growth factor and serum (Fig.
9). Significant inhibition of the number
of neurons generated was observed 48 hr after serum and growth factor
removal compared with controls (Fig. 9). Similarly, if cells were
placed in FGF1 after the removal of FGF2 and serum, exogenous Delta was able to significantly decrease the number of neurons generated at 48 hr. If placed back into FGF-2, however, there was no effect of Delta Fc
on neuronal production, which remained at very low levels at 48 hr.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 9.
Delta Fc inhibition of neuron differentiation
after removal of serum and FGF2. E10 neuroepithelial cells were
cultured for 24 hr in the presence of serum and FGF2 (50 ng/ml). The
serum and growth factors were then removed to allow the cells to
differentiate, and the Delta Fc or control Fc cell lysate was added. No
difference in the number of MAP2-positive neurons produced was observed
24 hr after the addition of Delta Fc compared with controls. Neuron
production was decreased 48 hr after replacing the media with
serum-free media or FGF1 (50 ng/ml) and adding Delta Fc, but not when
the media was replaced with FGF2 and Delta Fc (*p < 0.05; mean ± SEM).
|
|
 |
DISCUSSION |
The present study shows that at high cell density, which allows
for the intimate cell interactions that occur in vivo, the differentiation of neural precursors into neurons is largely regulated by inhibitory signals. Two ligand-activated signaling systems significantly influenced the neuronal differentiation of
neuroepithelial precursors: the FGF receptor pathway and the Notch
receptor pathway. Furthermore, the evidence suggests that these two
systems interact, and the inhibitory action of growth factors, such as
FGF1 and 2, on the precursor cells may be mediated via the Notch pathway.
Notch was shown to be directly involved in regulating the step from
precursor to neuron, because addition of Delta1 almost totally
abrogated the generation of neurons from E10 NEP cells during the
24-48 hr culture period. The action of Notch was confirmed by the
increase in neuron production observed when Notch signaling was
inhibited, either by downregulating Notch levels with antisense or when
examining Presenilin1-deficient NEP cells. Presenilin1 mediates the
intracellular cleavage of Notch, and without cleavage Notch signaling
is markedly reduced (De Strooper et al., 1999 ; Song et al., 1999 ;
Struhl and Greenwald 1999 ). The requirement for Presenilin1 in Notch
cleavage remains controversial, given that Presenilin2 may partially
compensate for the loss of Presenilin1 (Berechid et al., 1999 ; Steiner
et al., 1999 ). However, in the developing mouse brain, Presenilin1 is
expressed at significantly higher levels than Presenilin2 (Lee et al.,
1996 ), indicating that in NEP cells, Presenilin1 is of primary
importance. The inability of Delta Fc to inhibit the differentiation of
the Presenilin1 null NEP cells indicates that Notch signaling is
disrupted. Furthermore, the increase in neuron production observed by
the Presenilin1 null NEP cells suggests that Presenilin1 is required to
inhibit neuron differentiation. This is consistent with the premature differentiation of progenitor cells observed by Presenilin1 knock-out mice in vivo (Handler et al., 2000 ). A role for Notch
signaling in the regulation of NEP cell differentiation has been
suggested previously, after the examination of animals with a deletion
of HES1, a bHLH factor that operates downstream of Notch
activation (Jarriault et al., 1995 ), where an increase in neuron number
was observed (Nakamura et al., 2000 ). Precursor cell differentiation in
Xenopus and in chick retina is also regulated by Notch
(Austin et al., 1995 ; Chitnis et al., 1995 ; Dorsky et al., 1997 ),
because downregulation of Notch expression or activity increased neuron number, whereas the overexpression of Delta inhibited neuron differentiation.
During early CNS development, the inhibition of neuron differentiation
after Notch signaling potentially allows the precursor population to be
maintained. This is consistent with findings that the overexpression of
Notch3 during CNS development results in an expansion of the progenitor
pool (Lardelli et al., 1996 ). However, in addition to decreasing neuron
number, Notch activation in the developing forebrain in vivo
has been shown to promote the differentiation of radial glial cells
(Gaiano et al., 2000 ). Thus, Notch signaling may actively direct the
differentiation of precursor cells into alternative cell types. Further
experimentation with the NEP cells in vitro may clarify the
role of Notch signaling in promoting precursor differentiation.
The identity of the specific Notch receptor activated by the
Delta1 Fc protein is uncertain because the NEP cells expressed three of
the Notch receptors. The preference of individual ligands for receptors
remains unclear, although Jagged1 may preferentially activate Notch2
(Shimizu et al., 1999 ), whereas Delta1 appears to preferentially
activate Notch1 (Weinmaster 1998 ). The present studies also suggest
that Notch1 is of primary importance, because the downregulation of
Notch1 with antisense was not compensated by the presence of Notch2 and
-3. Furthermore, in situ hybridization analysis has shown
that Notch1 is the primary Notch receptor expressed by forebrain NEP
cells, whereas here Notch2 and -3 are expressed only weakly (Lardelli
et al., 1994 ; Williams et al., 1995 ).
The first indication that growth factors may regulate precursor
differentiation through regulating Notch activity was the finding that
different growth factors altered Notch and Delta expression. With the
exception of FGF8, each growth factor that was examined increased the
expression of one or two of the Notch homologs, whereas
Delta1 expression was decreased in response to FGF1, FGF2,
and BMP2 and increased by TGF 5. Previously, indirect associations
between Notch signaling and growth factors have been made by examining
the bHLH transcription factors that are involved in Notch signaling.
NGF inhibited the DNA binding ability of HES1, thereby allowing the
differentiation of PC12 cells (Strom et al., 1997 ), whereas BMP2, BMP4,
and EGF decreased expression of MASH 1 (Ahmad et al., 1998 ; Shou et
al., 1999 ), which has been implicated in the regulation of Delta
expression and is essential for neurogenesis (Chitnis and Kintner,
1996 ; Casarosa et al., 1999 ).
The finding that FGF1 and FGF2 stimulated precursor cell proliferation
and inhibited neuron differentiation was consistent with previous
reports from in vitro culture (Murphy et al., 1990 ; Kilpatrick and Bartlett, 1993 ; Ghosh and Greenberg, 1995 ; Vaccarino et
al., 1999 ) and with the role of FGF2 in vivo as the primary stimulator of precursor cell division in the developing forebrain (Vaccarino et al., 1999 ). Although an increase in the absolute number
of neurons was observed after FGF2 infusion in vivo
(Vaccarino et al., 1999 ), this response was interpreted as being caused
by increased number of cell cycles of the precursors, which ultimately generated more neurons. Thus, it appears that precursor proliferation and inhibition of differentiation are inextricably mixed, and this
study cannot choose between these as the primary physiological effects
of the FGFs. Nevertheless, it appears that Notch signaling is involved
in maintaining this state. FGF1 and FGF2 significantly upregulated
Notch1 expression in the NEP cells. Furthermore,
Delta1 expression was downregulated by these factors, which
is consistent with enhanced Notch signaling (Kunisch et al., 1994 ;
Heitzler et al., 1996 ). It remains uncertain how Notch signaling is
maintained after the downregulation of Delta expression. Other Notch
ligands, however, are also expressed at this stage of development
(Dunwoodie et al., 1997 ). In addition, it has been suggested that Delta
is cleaved at the cell surface releasing a soluble form of Delta, which
may continue to activate Notch (Qi et al., 1999 ). The link between Notch expression levels and FGF-induced neuronal inhibition was
shown by the increased neuronal numbers when Notch signaling was
reduced, either by inhibiting the Presenilin1-mediated cleavage of
Notch or by downregulating Notch1 expression. These data indicate that
the inhibition of differentiation observed in response to FGF1 and FGF2
is mediated, at least in part, via the Notch signaling pathway.
The difference between the biological functions of FGF1 and FGF2 has
been difficult to determine. These factors may have distinct roles
given that FGF2 is expressed at E9, whereas FGF1 is expressed at
E11(Nurcombe et al., 1993 ). Although the effect of FGF1 and FGF2 on the
NEP cells was similar, FGF2 was a more potent inhibitor of neuronal
differentiation, and unlike FGF1, Delta Fc was unable to enhance this
FGF2 inhibitory response, indicating that FGF2 may stimulate the Notch
signaling pathway to a greater extent than FGF1. The differences
between FGF1 and FGF2 may be explained by their differential activation
of one of the FGF receptors expressed on the NEP cells (Kalyani et al.,
1999 ). A possible mechanism of differential FGF receptor activation
involves the binding of heparan sulfate proteoglycans (HSPGs), which
regulate ligand-receptor binding and differ in their specificity for
the FGFs. At E10 the HSPGs that are produced preferentially bind FGF2,
whereas at E12 the binding affinity switches to FGF1 (Nurcombe et al.,
1993 ). Therefore, in the NEP population, FGF2 may be binding with
higher affinity, causing the complete activation of the Notch pathway, whereas without the specific HSPGs, FGF1 may not be able to elicit its
full effect and therefore Notch signaling is limited.
The inhibitory effect of serum on neuronal differentiation may also be
caused by Notch signaling. Serum upregulated Notch1 levels and
downregulated Delta1 levels in the NEP cells. In addition, the
inhibition observed in response to serum was overcome by downregulating Notch expression and activity (Figs. 6, 7). Interestingly, although serum increased Notch1 expression, Notch3 expression was unaltered. In
contrast, BMP2 caused the opposite effect by increasing the expression
of Notch3 but not Notch1. Factors such as BMP2 or those present in
serum therefore may elicit their effects via specific Notch receptors.
Our data suggest that the primary function of signaling through the
Notch receptor is the inhibition of precursor cell differentiation. The
growth factors FGF1 and FGF2 appear to act via the Notch pathway to
inhibit neuron differentiation. Given the ability of other growth
factors to regulate Notch and Delta expression, it is likely that many
growth factors regulate neuronal differentiation in a similar manner.
Other cellular responses to growth factors, such as proliferation,
differentiation, and survival, are probably mediated via separate and
distinct pathways. To elucidate this, however, a more detailed analysis
of the relationships between the growth factor signaling pathways and
Notch signaling is required.
 |
FOOTNOTES |
Received Jan. 18, 2001; revised April 12, 2001; accepted May 9, 2001.
This work was supported by The National Health and Medical Research
Council of Australia, The Australasian Spinal Research Trust, and the
Co-operative Research Center for Cellular Growth Factors. We thank Dr.
Hui Zeng for providing the Presenilin1 knock-out mice and Leanne
Stewart and Rachael Borg for assistance with the Presenilin1 knock-out
mice. We also thank Dr. Jeff Nye for the gift of the Notch1 expressing plasmid.
Correspondence should be addressed to Dr. Perry F. Bartlett,
Development and Neurobiology Group, The Walter and Eliza Hall Institute
of Medical Research, Post Office, The Royal Melbourne Hospital,
Victoria 3050, Australia. E-mail:
bartlett{at}wehi.edu.au.
 |
REFERENCES |
-
Ahmad I,
Dooley CM,
Afiat S
(1998)
Involvement of Mash1 in EGF-mediated regulation of differentiation in the vertebrate retina.
Dev Biol
194:86-98[ISI][Medline].
-
Austin CP,
Feldman DE,
Ida Jr JA,
Cepko CL
(1995)
Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch.
Development
121:3637-3650[Abstract].
-
Berechid BE,
Thinakaran G,
Wong PC,
Sisodia SS,
Nye JS
(1999)
Lack of requirement for presenilin1 in Notch1 signaling.
Curr Biol
9:1493-1496[ISI][Medline].
-
Bettenhausen B,
Hrabe de Angelis M,
Simon D,
Guenet JL,
Gossler A
(1995)
Transient and restricted expression during mouse embryogenesis of Dll1, a murine gene closely related to Drosophila Delta.
Development
121:2407-2418[Abstract].
-
Bonni A,
Sun Y,
Nadal-Vicens M,
Bhatt A,
Frank DA,
Rozovsky I,
Stahl N,
Yancopoulos GD,
Greenberg ME
(1997)
Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway.
Science
278:477-483[Abstract/Free Full Text].
-
Casarosa S,
Fode C,
Guillemot F
(1999)
Mash1 regulates neurogenesis in the ventral telencephalon.
Development
126:525-534[Abstract].
-
Chitnis A,
Kintner C
(1996)
Sensitivity of proneural genes to lateral inhibition affects the pattern of primary neurons in Xenopus embryos.
Development
122:2295-2301[Abstract].
-
Chitnis A,
Henrique D,
Lewis J,
Ish-Horowicz D,
Kintner C
(1995)
Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta.
Nature
375:761-766[Medline].
-
De Strooper B,
Annaert W,
Cupers P,
Saftig P,
Craessaerts K,
Mumm JS,
Schroeter EH,
Schrijvers V,
Wolfe MS,
Ray WJ,
Goate A,
Kopan R
(1999)
A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain.
Nature
398:518-522[Medline].
-
Dorsky RI,
Rapaport DH,
Harris WA
(1995)
Xotch inhibits cell differentiation in the Xenopus retina.
Neuron
14:487-496[ISI][Medline].
-
Dorsky RI,
Chang WS,
Rapaport DH,
Harris WA
(1997)
Regulation of neuronal diversity in the Xenopus retina by Delta signaling.
Nature
385:67-70[Medline].
-
Drago J,
Murphy M,
Carroll SM,
Harvey RP,
Bartlett PF
(1991)
Fibroblast growth factor-mediated proliferation of central nervous system precursors depends on endogenous production of insulin-like growth factor I.
Proc Natl Acad Sci USA
88:2199-2203[Abstract/Free Full Text].
-
Dunwoodie SL,
Henrique D,
Harrison SM,
Beddington RS
(1997)
Mouse Dll3: a novel divergent Delta gene which may complement the function of other Delta homologues during early pattern formation in the mouse embryo.
Development
124:3065-3076[Abstract].
-
Epa WR,
Barrett GL,
Bartlett PF
(2001)
Oligonucleotides as inhibitors of protein synthesis.
Methods Mol Biol
169:223-242[Medline].
-
Fleming RJ
(1998)
Structural conservation of Notch receptors and ligands.
Semin Cell Dev Biol
9:599-607[ISI][Medline].
-
Fode C,
Gradwohl G,
Morin X,
Dierich A,
LeMeur M,
Goridis C,
Guillemot F
(1998)
The bHLH protein Neurogenin 2 is a determination factor for epibranchial placode-derived sensory neurons.
Neuron
20:483-494[ISI][Medline].
-
Gaiano N,
Nye JS,
Fishell G
(2000)
Radial glial identity is promoted by Notch1 signaling in the murine forebrain.
Neuron
26:395-404[ISI][Medline].
-
Ghosh A,
Greenberg ME
(1995)
Distinct roles for bFGF and NT-3 in the regulation of cortical neurogenesis.
Neuron
15:89-103[ISI][Medline].
-
Gritti A,
Parati EA,
Cova L,
Frolichsthal P,
Galli R,
Wanke E,
Faravelli L,
Morassutti DJ,
Roisen F,
Nickel DD,
Vescovi AL
(1996)
Multipotential stem cells from the adult mouse brain proliferate and self-renew in response to basic fibroblast growth factor.
J Neurosci
16:1091-1100[Abstract/Free Full Text].
-
Handler M,
Yang X,
Shen J
(2000)
Presenilin-1 regulates neuronal differentiation during neurogenesis.
Development
127:2593-2606[Abstract].
-
Heitzler P,
Bourouis M,
Ruel L,
Carteret C,
Simpson P
(1996)
Genes of the Enhancer of split and achaete-scute complexes are required for a regulatory loop between Notch and Delta during lateral signaling in Drosophila.
Development
122:161-171[Abstract].
-
Jarriault S,
Brou C,
Logeat F,
Schroeter EH,
Kopan R,
Israel A
(1995)
Signaling downstream of activated mammalian Notch.
Nature
377:355-358[Medline].
-
Jarriault S,
Le Bail O,
Hirsinger E,
Pourquie O,
Logeat F,
Strong CF,
Brou C,
Seidah NG,
Israel A
(1998)
Delta-1 activation of notch-1 signaling results in HES-1 transactivation.
Mol Cell Biol
18:7423-7431[Abstract/Free Full Text].
-
Kalyani AJ,
Mujtaba T,
Rao MS
(1999)
Expression of EGF receptor and FGF receptor isoforms during neuroepithelial stem cell differentiation.
J Neurobiol
38:207-224[ISI][Medline].
-
Kilpatrick TJ,
Bartlett PF
(1993)
Cloning and growth of multipotential neural precursors: requirements for proliferation and differentiation.
Neuron
10:255-265[ISI][Medline].
-
Koblar SA,
Turnley AM,
Classon BJ,
Reid KL,
Ware CB,
Cheema SS,
Murphy M,
Bartlett PF
(1998)
Neural precursor differentiation into astrocytes requires signaling through the leukemia inhibitory factor receptor.
Proc Natl Acad Sci USA
95:3178-3181[Abstract/Free Full Text].
-
Kunisch M,
Haenlin M,
Campos-Ortega JA
(1994)
Lateral inhibition mediated by the Drosophila neurogenic gene delta is enhanced by proneural proteins.
Proc Natl Acad Sci USA
91:10139-10143[Abstract/Free Full Text].
-
Lardelli M,
Dahlstrand J,
Lendahl U
(1994)
The novel Notch homologue mouse Notch 3 lacks specific epidermal growth factor-repeats and is expressed in proliferating neuroepithelium.
Mech Dev
46:123-136[ISI][Medline].
-
Lardelli M,
Williams R,
Mitsiadis T,
Lendahl U
(1996)
Expression of the Notch 3 intracellular domain in mouse central nervous system progenitor cells is lethal and leads to disturbed neural tube development.
Mech Dev
59:177-190[ISI][Medline].
-
Lee MK,
Slunt HH,
Martin LJ,
Thinakaran G,
Kim G,
Gandy SE,
Seeger M,
Koo E,
Price DL,
Sisodia SS
(1996)
Expression of presenilin 1 and 2 (PS1 and PS2) in human and murine tissues.
J Neurosci
16:7513-7525[Abstract/Free Full Text].
-
Lindsell CE,
Boulter J,
diSibio G,
Gossler A,
Weinmaster G
(1996)
Expression patterns of Jagged, Delta1, Notch1, Notch2, and Notch3 genes identify ligand-receptor pairs that may function in neural development.
Mol Cell Neurosci
8:14-27[ISI][Medline].
-
Ma Q,
Kintner C,
Anderson DJ
(1996)
Identification of neurogenin, a vertebrate neuronal determination gene.
Cell
87:43-52[ISI][Medline].
-
Ma Q,
Chen Z,
del Barco Barrantes I,
de la Pompa JL,
Anderson DJ
(1998)
Neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia.
Neuron
20:469-482[ISI][Medline].
-
Mizushima S,
Nagata S
(1990)
pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res
18:5322[Free Full Text].
-
Murphy M,
Drago J,
Bartlett PF
(1990)
Fibroblast growth factor stimulates the proliferation and differentiation of neural precursor cells in vitro.
J Neurosci Res
25:463-475[ISI][Medline].
-
Nakamura Y,
Sakakibara S,
Miyata T,
Ogawa M,
Shimazaki T,
Weiss S,
Kageyama R,
Okano H
(2000)
The bHLH gene hes1 as a repressor of the neuronal commitment of CNS stem cells.
J Neurosci
20:283-293[Abstract/Free Full Text].
-
Nurcombe V,
Ford MD,
Wildschut JA,
Bartlett PF
(1993)
Developmental regulation of neural response to FGF-1 and FGF-2 by heparan sulfate proteoglycan.
Science
260:103-106[Abstract/Free Full Text].
-
Parks AL,
Huppert SS,
Muskavitch MA
(1997)
The dynamics of neurogenic signaling underlying bristle development in Drosophila melanogaster.
Mech Dev
63:61-74[Medline].
-
Qi H,
Rand M,
Wu X,
Sestan N,
Wang W,
Rakic P,
Xu T,
Artavanis-Tsakonas S
(1999)
Processing of the Notch ligand Delta by the metalloprotease kuzbanian.
Science
283:91-94[Abstract/Free Full Text].
-
Qian S,
Jiang P,
Guan XM,
Singh G,
Trumbauer ME,
Yu H,
Chen HY,
Van de Ploeg LH,
Zheng H
(1998)
Mutant human presenilin 1 protects presenilin 1 null mouse against embryonic lethality and elevates Abeta1-42/43 expression.
Neuron
20:611-617[ISI][Medline].
-
Redmond L,
Oh SR,
Hicks C,
Weinmaster G,
Ghosh A
(2000)
Nuclear Notch1 signaling and the regulation of dendritic development.
Nat Neurosci
3:30-40[ISI][Medline].
-
Reynolds BA,
Weiss S
(1992)
Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system.
Science
255:1707-1710[Abstract/Free Full Text].
-
Schroeter EH,
Kisslinger JA,
Kopan R
(1998)
Notch 1 signaling requires ligand-involved proteolytic release of intracellular domain.
Nature
393:382-386[Medline].
-
Sestan N,
Artavanis-Tsakonas S,
Rakic P
(1999)
Contact-dependent inhibition of cortical neurite growth mediated by Notch signaling.
Science
286:741-746[Abstract/Free Full Text].
-
Shimizu K,
Chiba S,
Kumano K,
Hosoya N,
Takahashi T,
Kanda Y,
Hamada Y,
Yazaki Y,
Hirai H
(1999)
Mouse Jagged1 physically interacts with Notch2 and other Notch receptors. Assessment by quantitative methods.
J Biol Chem
274:32961-32969[Abstract/Free Full Text].
-
Shou J,
Rim PC,
Calof AL
(1999)
BMPs inhibit neurogenesis by a mechanism involving degradation of a transcription factor.
Nat Neurosci
2:339-345[Medline].
-
Song W,
Nadeau P,
Yuan M,
Yang X,
Shen J,
Yankner BA
(1999)
Proteolytic release and nuclear translocation of Notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations.
Proc Natl Acad Sci USA
96:6959-6963[Abstract/Free Full Text].
-
Steiner H,
Duff K,
Capell A,
Romig H,
Grim MG,
Lincoln S,
Hardy J,
Yu X,
Picciano M,
Fechteler K,
Citron M,
Kopan R,
Pesold B,
Keck S,
Baader M,
Tomita T,
Iwatsubo T,
Baumeister R,
Haass C
(1999)
A loss of function mutation of presenilin-2 interferes with amyloid beta-peptide production and notch signaling.
J Biol Chem
274:28669-28673[Abstract/Free Full Text].
-
Strom A,
Castella P,
Rockwood J,
Wagner J,
Caudy M
(1997)
Mediation of NGF signaling by post-translational inhibition of HES-1, a basic helix-loop-helix repressor of neuronal differentiation.
Genes Dev
11:3168-3181[Abstract/Free Full Text].
-
Struhl G,
Greenwald I
(1999)
Presenilin is required for activity and nuclear access of Notch in Drosophila.
Nature
398:522-525[Medline].
-
Tamura K,
Taniguchi Y,
Minoguchi S,
Sakai T,
Tun T,
Furukawa T,
Honjo T
(1995)
Physical interaction between a novel domain of the receptor Notch and the transcription factor RBP-J kappa/Su(H).
Curr Biol
5:1416-1423[ISI][Medline].
-
Vaccarino FM,
Schwartz ML,
Raballo R,
Nilsen J,
Rhee J,
Zhou M,
Doetschman T,
Coffin JD,
Wyland JJ,
Hung YT
(1999)
Changes in cerebral cortex size are governed by fibroblast growth factor during embryogenesis.
Nat Neurosci
2:246-253[ISI][Medline].
-
Weinmaster G
(1998)
Notch signaling: direct or what?
Curr Opin Genet Dev
8:436-442[ISI][Medline].
-
Williams R,
Lendahl U,
Lardelli M
(1995)
Complementary and combinatorial patterns of Notch gene family expression during early mouse development.
Mech Dev
53:357-368[ISI][Medline].
-
Wong PC,
Zheng H,
Chen H,
Becher MW,
Sirinathsinghji DJ,
Trumbauer ME,
Chen HY,
Price DL,
Van der Ploeg LH,
Sisodia SS
(1997)
Presenilin 1 is required for Notch1 and DII1 expression in the paraxial mesoderm.
Nature
387:288-292[Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21155587-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Nagao, M. Sugimori, and M. Nakafuku
Cross Talk between Notch and Growth Factor/Cytokine Signaling Pathways in Neural Stem Cells
Mol. Cell. Biol.,
June 1, 2007;
27(11):
3982 - 3994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. M. Vaccarino, D. M. Fagel, Y. Ganat, M. E. Maragnoli, L. R. Ment, Y. Ohkubo, M. L. Schwartz, J. Silbereis, and K. M. Smith
Astroglial Cells in Development, Regeneration, and Repair
Neuroscientist,
April 1, 2007;
13(2):
173 - 185.
| |