 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 2001, 21(17):6732-6744
4 Integrin Is Expressed during Peripheral Nerve Regeneration
and Enhances Neurite Outgrowth
Mariette G.
Vogelezang1,
ZhiQiang
Liu2,
João
B.
Relvas1,
Gennadij
Raivich2,
Steven S.
Scherer3, and
Charles
ffrench-Constant1
1 Department of Medical Genetics, University of
Cambridge and Cambridge Centre for Brain Repair, University Forvie
Site, Cambridge, CB2 2PY, United Kingdom,
2 Department of Neuromorphology, Max Planck Institute for
Neurobiology, D-82152 Martinsried, Germany, and
3 Department of Neurology, The University of Pennsylvania
Medical Center, Philadelphia, Pennsylvania 19104
 |
ABSTRACT |
We have shown previously that repair in the peripheral nervous
system is associated with a reversion to an embryonic pattern of
alternative splicing of the extracellular matrix molecule fibronectin. One of the consequent changes is a relative increase in the number of
fibronectins expressing the binding site for 4 integrins. Here we
show that 4 integrins are expressed on dorsal root ganglion neuron
cell bodies and growth cones in the sciatic nerve during regeneration
and that the interaction of 4 integrin with alternatively spliced
isoforms of recombinant fibronectins containing the 4 binding site
enhances neurite outgrowth in dorsal root ganglion neurons. The
pheochromocytoma (PC12) neuronal cell line, which normally
extends neurites poorly on fibronectin, does so efficiently when 4
is expressed in the cells. Experiments using chimeric integrins
expressed in PC12 cells show that the 4 cytoplasmic domain is
necessary and sufficient for this enhanced neurite outgrowth. In both
dorsal root ganglion neurons and PC12 cells the 4 cytoplasmic domain
is tightly linked to the intracellular adapter protein paxillin. These
experiments suggest an important role for 4 integrin and paxillin in
peripheral nerve regeneration and show how alternative splicing of
fibronectin may provide a mechanism to enhance repair after injury.
Key words:
integrin; peripheral nerve regeneration; fibronectin; alternative splicing; paxillin; 4; PC12 cell; dorsal root ganglia; chimera; LDV
 |
INTRODUCTION |
Damage to the peripheral nervous
system (PNS) is followed by Wallerian degeneration of axons distal to
the lesion site associated with increased expression of extracellular
matrix (ECM) molecules including fibronectin (FN) (Lefcort et al.,
1992 ; Martini, 1994 ; Scherer and Salzer, 1996 ). Antibody-blocking
experiments suggest that these increased levels of FN contribute to the
subsequent repair (Toyota et al., 1990 ; Wang et al., 1992 ; Bailey et
al., 1993 ; Agius and Cochard, 1998 ). FN is expressed as different
isoforms generated by alternative splicing of the primary gene
transcript. Two type III repeats EIIIA and EIIIB are either included or
excluded, whereas the V (IIICS) region can be partly or completely
excluded in patterns that differ between species (Schwarzbauer et al., 1983 , 1987 ; Tamkun et al., 1984 ; Kornblihtt et al., 1985 ; Gutman and
Kornblihtt, 1987 ; Zardi et al., 1987 ). In the rat, three different forms (V0, V95, and V120) can be generated (Fig.
1). The latter two differ by the
inclusion or exclusion of the first 25 amino acids, a segment called
V25. This segment contains a cell-binding sequence Leu-Asp-Val
(LDV) that is recognized by the integrins 4 1 and 4 7
(Wayner et al., 1989 ; Guan and Hynes, 1990 ). This cell-binding site is
distinct from the Arg-Gly-Asp (RGD) sequence within the
10th type III repeat (Fig. 1), recognized
by other integrins including 5 1 (Ruoslahti, 1996 ). The expression
of the alternatively spliced isoforms of FN in vivo is
developmentally regulated. Most FN mRNA early in development is EIIIA+,
EIIIB+, and V+, whereas in the adult these exons are excluded in a
cell- and tissue-specific pattern (Magnuson et al., 1991 ;
ffrench-Constant, 1995 ; Peters and Hynes, 1996; Peters et al.,
1996 ).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 1.
Schematic drawing of rat FN and the recombinant
fragments made in this study. Shaded boxes mark the
three alternatively spliced regions in FN. Each of the recombinant
fragments used is illustrated, and the approximate molecular size
shown. The 5 1 recognition sequence, Arg-Gly-Asp
(RGD) is located in the 10th type III
repeat. The 4 1 binding sequence Leu-Asp-Val (LDV)
is located in the V25 fragment. Note the pattern of V region splicing,
as described in the introductory remarks, shown in the two sets of
recombinant FNs: 8V120 and 11V120, V95, and V0. The V120 form contains
a 25 amino acid sequence (V25) that includes the LDV sequence to which
4 1 binds. This is shown as a light gray box. In
those recombinant FNs in which this sequence was mutated to LAV (to
abolish 4 1 binding), the V25 region is shown as a black
box. Construction of the recombinant fragments is described in
Materials and Methods. All fragments carry at their C termini the 232 amino acid sequence of the human IgG1 Fc that is
represented by the filled rectangles.
|
|
The regulation of splicing suggests that the alternatively spliced
isoforms of FN possess unique properties. In light of this, we
previously examined the pattern of FN splicing during sciatic nerve
regeneration in the rat. We observed an increase in the relative
percentage of EIIIA+, EIIIB+, and V25+ forms of FN in the nerve
(Mathews and ffrench-Constant, 1995 ; Vogelezang et al., 1999 ), as also
described in other models of injury and disease (for review, see
ffrench-Constant, 1995 ). The relative increase of the 4 integrin
binding site within V25 (from 19% of total FN mRNA to 29-38%,
becoming the most abundant V isoform) was of particular interest.
Previous work has shown distinct roles for the 4 and 5 integrins
in neural crest cell migration (Dufour et al., 1988 ; Kil et al., 1998 )
and dorsal root ganglion (DRG) neurite outgrowth (Humphries et al.,
1988 ). We therefore proposed a model in which increased expression of
V25 would enhance neurite outgrowth by simultaneous presentation of the
4 1 and 5 1 cell-binding sites to the regrowing axon. The
goals of this study were twofold: first, to test the predictions from
this model that 4 integrins would be expressed on regenerating
growth cones in the adult nerve and would activate intracellular
signaling pathways leading to enhanced neuronal growth; second, to
begin to identify the initial components of the intracellular signaling
pathway involved.
 |
MATERIALS AND METHODS |
Antibodies. The following antibodies were used: mouse
anti-rat 4, clone MR 4-1 (PharMingen, San Diego, CA); rat
anti-mouse 4, clone R1-2 (PharMingen); mouse anti-human 4, clone
HP2/1 (Chemicon, Temecula, CA); hamster anti-rat 1, clone HA2/5
(PharMingen); hamster anti-rat 5, clone HM 5-1 (PharMingen); mouse
anti-human 5, clone IIA1 (PharMingen); polyclonal rabbit anti- v
(Chemicon); mouse anti-rat 6 1 (Chemicon); polyclonal goat
anti-rat FN (Calbiochem, San Diego, CA); polyclonal rabbit anti-human
IgG1 Fc (Sigma, Poole, UK);
polyclonal anti-galanin (Peninsula Laboratories, Belmont, CA);
and polyclonal anti-calcitonin gene-related peptide (CGRP; Peninsula).
4 integrin immunohistochemistry in sensory ganglia and sciatic
nerve. All operations were performed under anesthesia with tri-Brom-Ethanol (Avertin; Sigma), 0.4 mg/gm body weight, on 2- to
3-month-old mice. The animal experiments and care protocols were
approved by the Regierung von Oberbayern (AZ 211-2531-10/93 and AZ
211-2531-37/97). The left sciatic nerve was cut or crushed at the
sciatic notch, and the animals were killed in ether after 4 d. For dorsal root ganglia, the animals were flushed for 5 min with
PBS (20 ml/min) then perfusion-fixed with 200 ml of 4%
formaldehyde (FA) in PBS (4% FA-PBS). The L5 ganglia were
removed from the operated and contralateral side, post-fixed in 1%
FA-PBS for 2 hr, cryoprotected with 30% sucrose overnight, covered
with OCT (Miles, Elkhart, IN), frozen on dry ice, and cut in a cryostat at 18°C. Twenty 20 µm longitudinal sections were collected on warm glass slides coated with 0.5% gelatin (Merck, Darmstadt, Germany), refrozen on dry ice, and stored at 80°C for further use.
For immunohistochemistry on crushed sciatic nerves, the brief perfusion
with PBS and 4% FA-PBS was followed by a slow, 60 min perfusion-fixation with 1% FA-PBS. The sciatic nerve was then immediately dissected for a length of 20 mm, covered with OCT, frozen
on dry ice, and cut longitudinally at 10 µm thickness. Nerve and
ganglia sections were processed for immunohistochemistry as described
by Möller et al. (1996) and Werner et al. (2000) . Briefly,
the sections were dried, fixed in 4% paraformaldehyde in phosphate
buffer (PB; 100 mM
Na2HPO4, pH 7.4) for 5 min,
washed twice in PB, and washed once in PB with 0.1% bovine serum
albumin (PB-BSA; Sigma). DRG sections were preincubated for 1 hr with 5% goat serum in PB, incubated with a 1:1000 diluted rat monoclonal antibody R1-2 (PharMingen) against the 4 integrin subunit overnight at 4°C in PB-BSA, then with a biotinylated goat anti-rat secondary antibody (1:100 in PB-BSA; Vector Laboratories, Wiesbaden, Germany) for 1 hr at room temperature (RT), washed again (PB/BSA, PB/BSA, PB,
PB), followed for 1 hr with ABC-reagent (Vector) in PB at RT, washed
(PB, PB, PB, PBS), and finally visualized using diaminobenzidine (DAB;
0.5 gm/l in PBS; Sigma) with 0.01%
H2O2 for 5 min at RT. The
sections were then washed again, dehydrated in alcohol and xylene, and
mounted in Depex. Digital micrographs of the brainstem were taken in a
Zeiss Axiophot microscope with a 5× objective and a Sony 89B CCD
(model CX-77CC) and imported into the Optimas 6.2 (Bothell, WA) imaging
system using an Image Technology OFG card (VP-1100-768).
For axonal colocalization of the 4 integrin in the regenerating
sciatic nerve, the fixed sections were preincubated with 5% donkey
serum (Sigma) in PB and then simultaneously incubated overnight with
the monoclonal 4 antibody (1:1000) and polyclonal rabbit antibodies
against CGRP or galanin (1:600) from Peninsula. The sections were
washed, incubated simultaneously with two secondary antibodies,
biotin-conjugated donkey anti-rabbit Ig and FITC-conjugated goat
anti-rat Ig or goat anti-hamster Ig and (1:100 in PB-BSA; Dianova,
Hamburg, Germany), then washed again and incubated with a tertiary
FITC-conjugated donkey anti-goat antibody (1:100 in PB-BSA; Sigma) and
Cy3-Avidin (1:1000 in PB-BSA; Dianova) for 2 hr at RT. After washing,
the sections were covered with VectaShield (Vector) and stored in the
dark at 4°C for further use. For visualizing the immunofluorescence
double-labeling, digital micrographs of the FITC for the integrin
staining and the Cy3 fluorescence for the respective axonal marker
representing an area of 50 by 50 µm (1024 × 1024 pixels;
grayscale 0-255) were taken with a Leica TCS 4D confocal laser
microscope using a 100× objective and 2× zoom. The fluorescence was
excited using low Ar-Kr laser power (0.25 V) at wavelengths of 488 nm
for FITC and 568 nm for Cy3 and detected using the BP-FITC
filter for FITC and the LP590 filter for Cy3, respectively. Nine
consecutive, equidistant levels spanning 10 µm were recorded and
condensed to a single bitmap using the MaxIntens algorithm.
4 integrin in situ hybridization. Adult (10- to 13-week-old) Sprague Dawley rats were anesthetized (50 mg/kg
pentobarbital, i.p.), and the left sciatic nerve was exposed at the
sciatic notch. The nerve was transected with iridectomy scissors, and
it was ascertained that the transection was complete. All animal
protocols were approved by the Institutional Animal Care and Use
Committee of The University of Pennsylvania. Four days after nerve
injury, the animals were overdosed (with an intraperitoneal dose of
pentobarbital), and perfused with saline followed by 4%
paraformaldehyde in PBS. The L4 and L5 segment of the spinal cord, as
well as the left and right L4 and L5 dorsal root ganglia were removed
and placed in the same fixative overnight at 4°C. The tissues were
rinsed in PBS, infiltrated in 20% sucrose in PBS, then embedded in
OCT. Five-micrometer-thick sections were mounted on Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA), and they were
air-dried and stored at 80°C.
The cDNA for 4 was obtained by reverse transcription of total RNA
extracted from rat spleen, using random hexanucleotides (first strand
cDNA synthesis kit; Amersham Pharmacia Biotech, Arlington Heights,
IL). Briefly, a 1157 bp fragment corresponding to the
cytoplasmic domain and part of the extracellular domain of 4 was
amplified by PCR using primers introducing BamHI and SalI sites: 3' end primer; 5'-GCG CGC GTC GAC GCG TCA TCA
TTG CTT TTG CTG-3', 5'end primer; 5'-GCG CGC GGA TCC TAT CTT GCT GTT GGG AG-3'. The fragment was cloned into pBluescript KS and transcribed using the T3 and T7 promoters to generate antisense and sense cRNAs,
respectively. The transcription reaction consisted of ~1 µg of
linearized plasmid DNA template, 10 mM DTT,
digoxygenin (DIG)-NTP labeling mix (Roche Products,
Hertforshire, UK), 40 U of RNase inhibitor (Roche), and 20 U of
T3 or T7 RNA polymerases in transcription buffer (Roche). The product
was purified using nick columns, then precipitated, washed, and stored
at 80°C in DEPC H2O. Integrity of the RNA
probes was verified by gel electrophoresis. For prehybridization,
frozen sections were thawed at room temperature for 30 min, fixed with
paraformaldehyde in PBS for 10 min, acetylated in a solution of
4× SSC, pH 8.0, containing 0.25% acetic anhydride and 0.1 M triethanolamine for 10 min at room temperature,
dehydrated in ethanol, delipidated in chloroform, and air-dried. The
labeled cRNA probe was dissolved to a final concentration of 125 ng/µl in the hybridization solution (50% v/v formamide, 4× SSC, 1×
Denhardt's solution, 100 µg/ml herring sperm DNA, 100 µg/ml polyA,
and 10% w/v dextran sulfate), and applied onto each slide under
coverslips. Hybridization was allowed to proceed for 14-18 hr at
+65°C. Slides were dipped into 4× SSC, and then coverslips were
carefully removed. Slides were further washed 10 min in 1× SSC, then
incubated 30 min with RNase A (Boehringer Mannheim, Indianapolis, IN)
and 30 min in RNase A buffer alone at 37°C, washed three times for 40 min each at +65°C in 1× SSC, 50% formamide, 0.1% Tween 20 and two
times for 30 min each in 100 mM maleic acid, 150 mM NaCl, 0.1% Tween 20, pH 7.5. RNA
hybrids were visualized in situ by immunohistochemistry with
alkaline phosphatase-conjugated anti-DIG antibody (Boehringer kit)
according to the manufacturer's instructions, except that polyvinyl
alcohol (10% w/v) was included in the final color reaction to
increase sensitivity. Slides were then dehydrated in ethanol and xylene
and mounted under coverslips in Eukitt medium (Agar Scientific Ltd.,
Stansted, UK).
Cloning specific domains of rat FN. The Signal-pIgplus
vector for the mammalian production of fusion proteins with a
C-terminal Fc tail (human IgG1 Fc) was used. In
addition to the Fc sequence, the vector includes the CD33 signal
sequence to facilitate the secretion of the fusion proteins. FN
fragments that begin and end precisely at the boundaries of individual
type III domains were cloned into the vector. The various recombinant
fragments contain the three possible combinations of the V region and
encompass the type III repeats 8-15 and 11-15 (Fig. 1). The FN cDNA
was obtained by reverse transcription of total RNA extracted from rat
liver, using random hexanucleotides. Briefly, the fragments were
amplified by PCR using primers with the appropriate restriction sites
and cloned in frame into the NheI and NotI sites
of Signal-pIgplus. All cDNA fragments obtained were sequenced.
Site-directed mutagenesis. The 8V120 FN fragment was
subjected to site-directed mutagenesis using the Quikchange mutagenesis kit (Stratagene, La Jolla, CA) following manufacturer's instructions. The LDV sequence within V25 was mutated to LAV using the following primers: GGACCAGAGATCTTGGCTGTTCCCTCCACAG (sense) and the
matching antisense strand. Base substitution at the site of mutation
was confirmed by DNA sequencing. The fragment containing the mutated LAV sequence was excised with BamHI-NotI and
subcloned into 11V120 to create 11LAV.
Purification of recombinant FN fragments. The Signal-pIgplus
expression vector allows for a purification strategy by affinity isolation on Protein A sepharose. COS7 cells were transiently transfected with recombinant DNA using the FuGENE 6 transfection reagent (Roche) according to manufacturer's instructions. After 24 hr
of incubation the cells were washed twice with PBS, and the medium was
replaced by chemically defined/Sato's serum-free medium for
2-3 d. The conditioned media were collected and loaded on a Protein
A-Sepharose (Sigma) column. Recombinant FNs were eluted using 0.1 M citrate buffer at pH 3.5. The final
concentrations were determined by UV absorption. Protein sizes were
confirmed on SDS-PAGE as described by Laemmli. In addition, purified
fragments were separated on 7% (8-15) and 10% (11-15)
polyacrylamide gels and transferred to nitrocellulose membranes. The
membranes were incubated with antibodies against rat FN and human
IgG1 Fc and revealed using ECL reagents (Amersham
Pharmacia Biotech).
Protein adsorption assay. Briefly, 96-well tissue culture
dishes were adsorbed for 3 hr with anti-IgG1 Fc
antibody, washed with PBS, and incubated overnight at 4°C with
various concentrations of recombinant fragments in PBS. Wells were
rinsed with PBS and postadsorbed for 1 hr with 3% heat-inactivated
bovine serum albumin (BSA) in PBS and washed three times with PBS.
Adsorbed polypeptides were quantitated using anti-pFN antiserum and an
HRP-conjugated secondary antibody and OPD peroxidase substrate
tablets (Sigma). Results were read on a PerkinElmer reader at 450 nm.
Cell culture. COS7 and NIH 3T3 cells were grown in
DMEM supplemented with 10% fetal calf serum (FCS),
penicillin-streptomycin, and 2 mM glutamine (Sigma).
Rat pheochromocytoma (PC12) cells were grown on
poly-D-lysine-coated tissue culture flasks in DMEM
supplemented with 10% horse serum (HS), 5% FCS,
penicillin-streptomycin, and 2 mM glutamine. For priming
with NGF, PC12 cells were passaged onto collagen-coated (calf skin
collagen; Sigma) Petri dishes at a density of
104 cells/cm2
and cultured for 4-5 d in DMEM complemented with 1%
ITS+ premix (Collaborative
Research, Bedford, MA) and 50 ng/ml 2.5S NGF (Serotec, Oxford,
UK). For neurite outgrowth assays, NGF-primed cells were passaged by
gentle trituration and cultured on the desired substrate in the same
defined medium.
Individual DRGs from newborn Sprague Dawley rats (P1 or P2) were
dissected into Ca2+,
Mg2+-free HBSS and incubated with
0.25% trypsin for 30 min at 37°C. Ganglia were dissociated by
trituration, and cells were washed twice in DMEM supplemented with 10%
FCS to stop the reaction. The cell suspension was then enriched for
neuronal cells by preplating for 60 min in 35 mm dishes. The unattached
neurons were then collected, washed, gently centrifuged, and either
used directly for neurite outgrowth assays or for long-term DRG neuron
cultures. For DRG cultures, the neurons were plated onto FN-coated
(plasma FN; Sigma) 90 mm tissue culture dishes. The culture medium
consisted of DMEM supplemented with Ultroser G serum substitute (Life
Technologies, Gaithersburg, MD), 0.1× B27 (Life Technologies), 2 mM glutamine, penicillin-streptomycin, 50 ng/ml 2.5 S NGF,
and 40 µM AraC. For neurite outgrowth assays, the medium
solely consisted of DMEM complemented with 2 mM glutamine,
penicillin-streptomycin, 1% ITS+ premix,
and 50 ng/ml 2.5 S NGF.
Neurite outgrowth assay. All neurite outgrowth assays were
performed in 4-well tissue culture plates. For preparation of the substrates, ligands were diluted into PBS and deposited as 30 µl
drops in the center of the wells. The dishes were first coated with 10 µg/ml anti-IgG1 Fc for 4 hr at RT, washed two
times with PBS, and then postadsorbed with the various fragments
overnight at 4°C. The wells were washed three times with PBS, and
neurons or PC12 cells were deposited in 30 µl drops on the substrates at a density of 5×
102/cm2.
After 1 hr, when the cells were attached and the medium was added to a
final volume of 200 µl. In perturbation experiments, GRGDSP peptides
(Life Technologies) were added to the medium to a final concentration
of 0.1 µg/ml. To monitor the efficacy or toxicity of the peptides,
parallel control experiments without any additive and with inactive
GRGESP peptides were conducted.
Analysis of neurite outgrowth. Measures were taken after 24 and 48 hr (separate sets of dishes). Dishes were viewed under a Zeiss
phase microscope, and random fields were recorded on videotape. The
percentage of neurons with at least one neurite equal or greater than
one cell body diameter in length was determined relative to the total
population of attached neurons. The approximate length of the single
longest neurite was also determined. Determinations were made on at
least five separate experiments; for percentages of neurons bearing
neurites, >100 neurons per culture were counted, and for neurite
lengths measurements at least 50 neurons per well were measured. For
the experiments using PC12 cell lines, untransfected and
mock-transfected cells were used as negative controls. Assays were
conducted on both experimental and control cell lines in parallel, and
the results were normalized to the control values. Each assay was
repeated five times, and the mean was determined. In addition, for
experiments on transfected PC12 cells, the assays were also repeated
with three independently generated cell lines. Statistical analysis was
performed using Student's t test.
Construction of integrin chimeras. cDNAs encoding the
wild-type human 4 and human 5 chains were gifts from M. E. Hemler (Dana-Farber Cancer Institute, Boston, MA) and R. Horwitz (University of Virginia, Charlottesville, VA),
respectively. Generation of truncated integrin subunits and
chimeric integrins containing the extracellular and transmembrane
domain of the 5 chain and the cytoplasmic domains of either 4 or
6 is described in detail elsewhere (Relvas et al., 2001 ). Briefly, a
cytoplasmic truncation of the 5 chain was performed by the ligation
to the HindIII site immediately preceding the GFFKR motif of
a synthetic double stranded oligonucleotide encoding the GFFKR sequence
followed by a stop codon. The truncation of the 4 chain was
performed by site-directed mutagenesis to introduce a stop codon after
the GFFKR, using the primer GG AAG GCT GGC TTC TTT AAA AGA
TAA TAC AAA TCT ATC CTA CAA G (sense). To generate the
5 4 and 5 6 chimeras, the cytoplasmic tail of the human 5
sequence was excised using the HindIII site immediately
preceding the GFFKR motif. The 4 and 6 cytoplasmic tails,
starting from the GFFKR motif, were amplified by PCR, introducing a
HindIII restriction site at the 5'end and a SalI
site at the 3' end. Amplified tails were cloned in frame of the 5
extracellular sequence into the HindIII restriction site.
All cDNAs obtained were sequenced. The integrin sequences were then
excised with SalI and subcloned into the XhoI
site of the bicistronic retroviral vector pLXIN (Clontech, Palo Alto, CA).
Transfection and selection of stable clones. The constructs
were transfected into the GP+86 packaging cell line, using FuGENE 6 as
transfection reagent. Cells were maintained in DMEM supplemented with
10% FCS, penicillin-streptomycin, 2 mM
glutamine, and 1 mg/ml G418 (Life Technologies) until clones appeared.
The GP+86 cells were then replated and when at 60-70% confluence,
were washed, and medium without G418 was added. The conditioned medium
was collected after 24 hr, filtered (0.45 µm pore size), and either used immediately or aliquoted, frozen, and kept at 70°C. Virus titer was determined using NIH 3T3 cells. PC12 cells were infected in
the presence of polybrene and selected and maintained with 1 mg/ml G418.
Cell labeling and immunoprecipitation. Cell surface
molecules were labeled with 0.1 mg/ml NHS-LC-biotin (Pierce) in PBS
at 37°C for 30 min. Cells were washed three times with cell wash buffer (50 mM Tris-HCl, pH 7.5, 0.15 M NaCl, 1 mM
CaCl2, and 1 mM
MgCl2), scraped, and lysed on ice for 30 min in
extraction buffer (cell wash buffer plus 1% Triton X-100, 0.05% Tween
20, 2 mM PMSF, 1 µg/ml pepstatin A, 2 µg/ml
aprotinin, 5 µg/ml leupeptin, 2 mM sodium
vanadate, 2 mM sodium fluoride, and 4 mM sodium pyrophosphate). After
centrifuging at 14,000 rpm for 20 min at 4°C, the insoluble pellet
was resuspended using a syringe with a 25 gauge needle in 100 µl of
solubilization buffer composed of 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM
MgCl2, 1% Triton X-100, 0.5% SDS, 1 mM PMSF, 1 µg/ml pepstatin A, 2 µg/ml
aprotinin, and 5 µg/ml leupeptin. The cell lysates were incubated
with 30 µl protein A-Sepharose (Amersham Pharmacia Biotech). The
lysates were precleared by two sequential 2 hr incubations, and
immunoprecipitations were performed overnight at 4°C. When hamster or
mouse monoclonal antibodies were used, rabbit anti-hamster or rabbit
anti-mouse antisera (Nordic Immunological Laboratories) were also added
to the tubes. All antibodies were used at a dilution of 1:250. The
beads were washed five times with immunoprecipitation buffer (identical
to cell wash buffer except for 0.5 M NaCl and 1%
NP-40), and the precipitated polypeptides were extracted with SDS
sample buffer. Precipitated cell surface biotin-labeled molecules were
separated by SDS-PAGE under nonreducing conditions and detected with
streptavidin-peroxidase followed by ECL (Amersham Pharmacia Biotech).
Cell adhesion assay. Ninety-six-well plates were coated
overnight at 4°C with 200 µl of PBS containing protein ligands. The wells were washed with PBS and blocked for 1 hr with 3% heat-denatured BSA. The wells were washed again, and 1 × 105 or 5 × 104 primed PC12 cells (in a 100 µl of
cell suspension) were added per well and incubated for 30 min at
37°C. The wells were then washed two times with DMEM, fixed for 15 min with methanol, and stained with a 0.2% solution of crystal violet
in 2% ethanol. The wells were washed once with
H2O, the crystal violet stain was solubilized in
50 µl of a 1% solution of SDS, and adhesion was quantitated by
measuring the absorbance at 570 nm. Results are reported as the mean
with the SD. Background cell binding to BSA was subtracted. Results are
expressed relative to the reference value of 100% adhesion. To
estimate this reference value, a 100 µl of cell suspension was
centrifuged. The pellet was fixed, stained, washed, resuspended in 50 µl of 1% SDS, and absorbance was measured. All experiments were
repeated at least three times.
 |
RESULTS |
4 integrin in sensory ganglia neurons and regenerating
sciatic nerve
Previous immunohistochemical studies on integrins in the normal
and injured mouse CNS revealed strong 4 immunoreactivity on
the activated microglial cells (Kloss et al., 1999 ) but no specific
labeling on the neighboring brainstem neurons after systemic treatment
with lipopolysaccharide (Kloss et al., 2001 ) or on facial motorneurons
after peripheral axotomy (Kloss et al., 1999 ). As shown in Figure
2A, however, there is
strong 4 immunoreactivity on the cell bodies of peripheral sensory
neurons in the dorsal root ganglia. Both small- and large-caliber
sensory neurons were 4-positive, and this cellular pattern and the
staining intensity did not change after transection of the sciatic
nerve (Fig. 2B). Motorneurons in the spinal cord did
not show 4 immunoreactivity (data not shown).

View larger version (82K):
[in this window]
[in a new window]
|
Figure 2.
4 integrin expression after sciatic nerve
injury in mouse and rat. A and B show
4 immunoreactivity visualized by immunoperoxidase in the L5 spinal
ganglia 4 d after axotomy of the mouse sciatic nerve. Note that
4 is expressed within the DRG neurons on both the control,
unlesioned (A), and lesioned
(B) side, without any changes in expression
level. C-E show the effects of axotomy on 4 mRNA
levels in rat sciatic nerve, as assessed by in situ
hybridization on sections of DRG neurons from the experimental
(C, E) and control (D) side.
C and D show the expression of 4 mRNA
in both large- and small-diameter neurons (large and
small arrows, respectively) both before
(C) and 4 d after axotomy
(D). E shows a sense control with
no nonspecific hybridization. F-I represent higher
power confocal images showing 4 immunoreactivity
(green) and either CGRP or Galanin
(red) in the distal stump 4 d after sciatic nerve
crush. These show the presence of discrete foci of 4 associated with
growth cones marked by CGRP or galanin immunoreactivity, confirming the
presence of this integrin in regenerating nerves. Note that some of the
4 immunoreactivity in these confocal images is seen at the edge of
the CGRP-galanin-labeled areas, as would be expected given the cell
surface expression of 4 integrin and the cytoplasmic localization of
CGRP or galanin within the growth cones.
|
|
In addition to these studies on protein expression, we also examined
the effect of transection on 4 mRNA expression. We performed in situ hybridization experiments with antisense and sense
rat 4 probes using rat tissue, as described in Materials and
Methods. Consistent with our experiments showing no change in protein
expression after axotomy, we also found no change in the pattern of
4 mRNA expression, with both large- and small-diameter neurons
labeled in the DRG (Fig. 2C-E). The small-diameter neurons
showed greater levels of 4 mRNA than the larger diameter neurons, as
judged by staining intensity (Fig. 2C,D), but this
semiquantitative technique revealed no changes in overall expression
levels after injury. As expected from the immunohistochemical studies,
we also found no expression of 4 mRNA in spinal cord motorneurons
(data not shown).
To confirm the presence of the 4 immunoreactivity on the
regenerating axons, the mouse sciatic nerve was crushed, and the distal
part of the nerve, 4-6 mm below the crush site, was examined by
immunohistochemistry and confocal microscopy 4 d after injury. At
high magnification, 4 immunoreactivity was present in discrete foci
of ~0.5 µm diameter that were aligned longitudinally like pearls on
a bead (Fig. 2F,H). Double staining with
antibodies against the neuropeptides CGRP or galanin, present in large
subpopulations of axotomized sensory neurons (Dumoulin et al., 1991 ;
Zhang et al., 1998 ), frequently revealed an association of 4 with
CGRP or galanin-labeled axons or growth cones (with the latter shown in
Fig. 2F-I). These observations therefore
demonstrate the expression of 4 on the regenerating growth cones in
the injured nerve.
Neurite outgrowth of DRG neurons on recombinant FN fragments
Having demonstrated expression of 4 on DRG neurons in
vivo, we next analyzed the role of this integrin in neurite
extension. To do this, we made recombinant FN fragments with or without
either the V25 region or the RGD sequence and used them as substrata for DRG neurons.
A total of eight different rat FN fragments were used in this study,
and their nomenclature is shown in Figure 1. Fragments were made to
either include both the central cell binding domain located within
10th type III repeat together with the
three possible combinations of the alternatively spliced V region or to
include only the V region isoforms. We therefore chose to span repeats
8-15 (to include the RGD sequence in repeat number 10) or 11-15 (to
exclude the RGD sequence), all without inclusion of the alternatively
spliced EIIIA exon. The FN fragments were generated by RT-PCR from rat liver and cloned as described in Materials and Methods. FN fragments were expressed as chimeric proteins with the signal sequence of CD33
and a C-terminal Fc tail (human IgG1 Fc), as
described in Materials and Methods. The Fc tail will allow dimerization
of the fragments, thereby better mimicking the dimer conformation of
soluble, plasma-derived FN in vivo. The purified proteins
gave single bands after SDS-PAGE and Western blot analysis under
reducing conditions (Fig. 3). The
relative molecular masses of FN fragments were consistent with the
expected sizes. All recombinant proteins were reactive toward anti-Fc
and anti-FN antibodies (Fig. 3).

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3.
SDS-PAGE and immunoblot analyses of recombinant
fragments. A, Recombinant FN fragments purified on
protein A-Sepharose columns, as described in Materials and Methods,
were subjected to SDS-PAGE under reducing condition and visualized by
Coomassie staining. Molecular weight markers are shown on the
left. Note that all fragments appear as single bands.
B, Purified FN fragments (0.5 µg/lane) were subjected
to SDS-PAGE under reducing conditions followed by immunoblotting with
polyclonal anti-Fc antibody. Left, 8-15 fragments.
Right, 11-15 fragments.
|
|
Whole dorsal root ganglia or dissociated DRG neurons from newborn rats
[postnatal day 1 (P1)-P2] were then seeded onto 4-well plates coated
with an antiserum to IgG1 Fc, followed by
equimolar concentrations of recombinant FN fragments. In previous
control experiments the binding of recombinant fragments to the dishes precoated with anti-Fc antibodies was evaluated quantitatively by
ELISA, using a polyclonal goat antiserum to FN. Saturation of surfaces
did not vary significantly from protein to protein, and all proteins
saturated at concentrations >5 µg/ml (data not shown). For routine
experiments, substrata were adsorbed with 10 µg/ml of antiserum to
IgG1 Fc, followed by 50 nM of
recombinant proteins (~5 µg/ml for 8-15 fragments). DRG neurons
extended neurites on FN in a time-dependent manner, and the rate of
outgrowth was linear for 48 hr (Fig.
4A). Throughout these
studies, whole ganglia and dissociated neurons yielded essentially the
same results, and therefore only the results for dissociated neurons
are shown. The rate of outgrowth of the dissociated cells was, however,
strongly dependent on cell density. To facilitate quantitation, and
also to avoid fasciculation, neurons were seeded at the low surface density of 5 × 102/cm2.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4.
Effect of the V region on neurite outgrowth of DRG
neurons. Neurons were plated on the three different 8-15 fragments, as
described in Materials and Methods. Neurite outgrowth was quantitated
after 24 and 48 hr. In each experiment at least 50 neurons were
measured, the median was determined, and the values were normalized
relative to the neurite outgrowth on 8V120 after 24 hr. Data represent
the mean from five separate experiments ± SEM. A,
Neurite outgrowth of DRG neurons over 48 hr. B, Neurite
outgrowth of DRG neurons after 48 hr on 8V120, 8V95, and 8V0 ± 0.1 µg/ml RGD or RGE peptides. Note the enhanced neurite outgrowth on
V120 isoforms (*p < 0.01). C,
Neurite outgrowth of DRG neurons on 8V120 and 8LAV, after 48 hr, ± RGD
peptides. Note the enhanced neurite outgrowth on V120 isoforms is
abolished when the LDV sequence within V120 is mutated to LAV
(*p < 0.01).
|
|
Neurite outgrowth was greatest on the V120-containing fragments.
Neurite length on 8V120 was twice that on 8V95 and 8V0 (Fig. 4A,B). When RGD peptides were added to the medium as
competitive inhibitors of the RGD binding site in the
10th repeat, neurite outgrowth was nearly
abolished on 8V95 and 8V0, but not on 8V120, which retained a reduced
outgrowth-promoting activity (Fig. 4B). Control
Arg-Gly-Glu (RGE) peptides had no effect. On fragments lacking
the main cell-binding site, neurons extended neurites on 11V120 but not
on 11V95 and 11V0, and RGD peptides had no effect on neurite outgrowth
(data not shown). Interestingly, 11V95 supported weak outgrowth,
whereas outgrowth on 11V0 was no greater than BSA-blocked,
IgG1 Fc-coated plastic. The percentages of cells
extending neurites on the different substrates mirrored precisely their
neurite lengths. Forty-one percent of neurons extended neurites on
8V120, as opposed to 28 and 25% on 8V95 and 8V0, respectively.
These experiments show that, in keeping with previous results using V25
peptides and proteolytic fragments of FN (Humphries et al., 1988 ), both
the RGD sequence and the V25 region promote neurite outgrowth in an
additive manner. To confirm that the neurite outgrowth-promoting
activity of V25 containing fragments resides in the 4 1 binding
sequence LDV, we mutated this sequence to LAV (8LAV), as described in
Materials and Methods. The increased outgrowth observed on 8V120 was
abolished on 8LAV. 8LAV supported the same neurite outgrowth-promoting
activity as 8V95 and was blocked to the same extent by RGD peptides
(Fig. 4C). Similarly, 11LAV supported only weak neurite
outgrowth, as previously found with 11V95.
Comparison of neurite outgrowth and integrin expression in PC12
cells and DRG neurons
To examine integrin function further in PNS neurons we switched to
the use of the PC12 cell line to facilitate the use of genetic
manipulation to express different integrin subunits. PC12 cells are
known to adhere well to laminin and type IV collagen but to attach
poorly to FN (Tomaselli et al., 1987 ). As expected, therefore, we found
that PC12 cells extended relatively short neurites on FN when compared
with DRG neurons (Fig. 5A).
This appeared to be mediated by RGD-binding integrins, because neurite outgrowth was nearly completely blocked on all 8-15 fragments by RGD
peptides (Fig. 5B). In contrast to the DRG neurons, the V25
fragment showed no enhanced neurite-outgrowth promoting activity in
PC12 cells, because 8V120 showed no greater neurite outgrowth-promoting activity than 8V95 and 8V0. Moreover, 11V120, like 11V95 and 11V0, was
totally ineffective at promoting neurite outgrowth (data not shown).

View larger version (47K):
[in this window]
[in a new window]
|
Figure 5.
Integrin function and expression in DRG neurons
and PC12 cells. A, Direct comparison of neurite
outgrowth of DRG neurons and PC12 cells on FN after 24 hr.
B, Effect of the V region on neurite outgrowth of PC12
cells. PC12 were plated on 8V120, 8V95, and 8V0, ± RGD peptides, and
neurites were measured after 24 and 48 hr. In each experiment the
neurites of at least 50 cells were measured, the median was determined,
and the values were normalized relative to the neurite outgrowth on
8V120 after 24 hr. Data represent the mean outgrowth at 48 hr from five
separate experiments ± SEM. Note that PC12 cells do not show
increased neurite outgrowth on V120-containing fragments and that
outgrowth on all fragments is essentially completely blocked with RGD
peptides (*p < 0.01). C, Cell
lysates from DRG neurons (surface-labeled with biotin) were
precipitated with anti- 4 Ab, anti- 5 Ab, and anti- 1 Ab.
Immunoprecipitated proteins (equal amounts of protein were loaded) were
separated by SDS-PAGE on 7% gels under nonreducing conditions,
transferred to a nitrocellulose membrane, and detected with
streptavidin peroxidase and ECL. Note that the neurons express both
4 1 and 5 1. D, Cell lysates from PC12 cell
(surface-labeled with biotin) were immunoprecipitated with anti- 1,
anti- 2, anti- 3, anti- 4, anti- 5, anti- 6, anti- v, and
anti- 1 antibodies and visualized as with the DRG neurons. Note that
PC12 cells express low levels of 5 but no 4.
|
|
These results showing that the PC12 cells do not respond to the V25
segment suggested that DRG neurons would express both 4 1 and
5 1, whereas PC12 cells would express only 5 1. We found that
the antibodies used against 4 and 5 integrins worked poorly in
Western blotting studies, and the endogenously expressed integrins in
DRG or PC12 cultures were therefore analyzed by immunoprecipitation of
detergent extracts of surface-biotinylated cells as described in
Materials and Methods. This method also ensures that only integrins expressed on the cell surface are identified. In non-reducing SDS-PAGE,
immunoprecipitations of rat DRG neuronal cultures with anti- 5,
anti- 4, and anti- 1 identified biotin-labeled subunits with the
expected mobilities of 5 1 and 4 1 (Fig. 5C). In
contrast and as predicted, PC12 cells did not express any detectable
endogenous integrin 4 subunit, and the level of 5 expression was
very low (Fig. 5D). In comparison, 1, 6, 3, and
v are all strongly expressed, consistent with previous studies, with
1 1, 3 1, and 6 , representing the predominant 1
integrins (Tomaselli et al., 1990 ).
Effects of integrin expression on PC12 neurite outgrowth
The lack of endogenous 4 integrin on the PC12 cells and the
consequent lack of V25-stimulated outgrowth allows the use of exogenous
4 expression to determine the function of this integrin. We
therefore generated stable cell lines expressing either full-length human 4 ( 4 4) or a truncated 4 (cytoplasmic tail deletion: 4a0). Analysis of 4 expression by immunoprecipitation using an
anti- 4 monoclonal antibody (mAb) yielded similar levels of 4 and
1 proteins for each transfectant (Fig.
6A). In addition, an
anti- 1 mAb immunoprecipitated the transfected 4 4 or 4a0 in
association with 1 (data not shown), confirming the formation and
expression on the cell surface of 4 1 heterodimers in both lines.
In neurite outgrowth assays, 4 4 restored in PC12 cells the
significantly increased outgrowth seen in DRG neurons on both 11V120
and 8V120, and RGD peptides did not block this effect (Fig. 6B). As expected, this effect was not seen on V95 or
V0 isoforms lacking V25 (Fig. 6B) or on the 8LAV and
11LAV isoforms (data not shown), confirming the specificity of the
exogenously expressed 4 1 integrin for the LDV sequence in V25. In
contrast to the full-length 4 4, the cytoplasmic domain truncated
4a0 had no effect on outgrowth as compared to mock-transfected and
untransfected PC12 cells (Fig. 6B).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 6.
Effect of 4 transfection on the
neurite outgrowth of PC12 cells. A, PC12 cell lines
expressing 4 4 and 4 0 chains were surface-labeled with
biotin and extracted with 1% Triton X-100. Immunoprecipitations were
performed on equal amounts of protein with anti-human 4 antibody.
Note that the full-length and truncated integrin are expressed at
similar levels. Because the deletion only lacks 24 of the 999 amino
acids in 4, no size difference would be expected at this resolution.
4 80 and 70 represent two products generated by post-translational
cleavage of 4. B, Neurite outgrowth of PC12 cells
stably transfected with 4 4, 4 0, or vector alone on 8V120,
8V95, and 8V0. Neurites were measured after 24 and 48 hr. In each
experiment the neurites of at least 50 cells were measured, the median
was determined, and the values normalized to control neurite
outgrowth on 8V120 after 24 hr. Data represent the mean outgrowth at 48 hr of five separate experiments ± SEM. Note that the full-length,
but not the truncated, 4 subunit restores increased neurite
outgrowth of PC12 cells on V120-containing fragments
(*p < 0.01).
|
|
These results show that the expression of 4 is sufficient to restore
to PC12 cells the ability to respond by enhanced neurite outgrowth to
V25-containing forms of FN and suggests that this response requires the
4 cytoplasmic domain. To confirm the necessary role of the 4
cytoplasmic domain, we used a chimeric integrin strategy taking
advantage of the specificity of the 5 1 integrin for the RGD
sequence. If the 4 cytoplasmic domain is sufficient for neurite
outgrowth promotion, then an 5 4 chimera should promote enhanced
outgrowth on all FN substrata and not just on those containing the V25
region as with the 4 4 integrin. Full-length human 5 ( 5 5), truncated 5 (cytoplasmic tail deletion; 5a0), a
chimeric 5 containing the cytoplasmic domain of 4 ( 5 4) and
a chimeric 5 with the tail of 6 ( 5 6) were therefore
expressed on the surface of PC12 cell lines. Equivalent levels of
expression were confirmed by immunoprecipitation, and all 5 subunits
were shown to heterodimerize with 1 (Fig.
7A) (data not shown for
5 6). As expected, the three different substrates 8V120, 8V95, and
8V0 now all promoted neurite outgrowth equally for all transfectants (data not shown), because all contain the RGD sequence recognized by
the 5 1 integrin extracellular domains expressed on all the cell
lines. However, the four cell lines showed significant differences in
their ability to support neurite outgrowth, because PC12 cells transfected with 5 4 extended significantly longer neurites than 5 5, 5 6, and 5a0 (Fig. 7B,C). These
differences do not reflect changes in adhesion: in 30 min adhesion
assays the 5 5, 5a0, 5 4, 5 6 molecules all supported
similar adhesion on both 8-15 fragments and whole plasma FN (Fig.
7D). Adhesion was increased as compared with untransfected
and mock-transfected PC12 cells on FN, as expected given the expression
of 5 1, but no changes were seen in adhesion regulated by other
integrins to collagen and laminin (data not shown).

View larger version (60K):
[in this window]
[in a new window]
|
Figure 7.
Effect of chimeric 5 integrins on PC12 neurite
outgrowth. A, PC12 cell lines expressing 5 5,
5 0, and 5 4 chains were surface-labeled with biotin and
extracted with 1% Triton X-100. Immunoprecipitations were performed on
equal amounts of protein with anti-human 5 antibody and analyzed as
by SDS-PAGE on 7% gels followed by detection with streptavidin
peroxidase and ECL. Note the similar levels of expression of all
chimeras. B, Phase micrographs of individual PC12 cells
expressing different chimeras and grown on 8V0 substrates. Note the
enhanced outgrowth of the 5 4 cell line. C,
Quantification of the enhanced outgrowth of the 5 4 cells. Cell
lines expressing 5 5, 5 0, 5 4, and untransfected PC12
were plated on 8V0, and their neurites were measured after 24 and 48 hr. In each experiment the neurites of at least 50 cells were measured,
the median was determined, and the values normalized to PC12 control
after 24 hr. Data represent the mean outgrowth at 48 hr of seven
separate experiments conducted with three independently generated
clonal lines ± SEM. Note the enhanced outgrowth of the 5 4
cell line (*p < 0.05). D, Adhesion
of 5 5, 5 0, 5 6, 5 4, and mock-transfected cell
lines on FN. Adhesion assays were performed as described in Material
and Methods. Plates were coated with 50 nM FN fragments.
Results are reported as the mean ± SD of three experiments, each
performed in quadruplicate. Note that there is no difference between
the different 5 cell lines (*p < 0.05).
|
|
Association of paxillin with the 4 cytoplasmic domain
These results confirm an instructive role for the 4 cytoplasmic
domain in the signaling events that enhance neurite outgrowth in PC12
cells. In light of recent experiments showing that the adapter protein
paxillin is associated with the 4 cytoplasmic domain in non-neural
cells (Liu et al., 1999 ) and that expression of mutant forms of
paxillin can inhibit neurite formation in PC12 cells (Ivankovic-Dikic
et al., 2000 ), we next asked whether paxillin was associated with 4
in neurons. We therefore immunoprecipitated cell extracts from DRG
neurons (generated using Triton X-100 detergent as described in
Materials and Methods) with antibodies against 4, 5, or 1
integrin and then analyzed the precipitated proteins for the presence
of coimmunoprecipitated paxillin by Western blotting with anti-paxillin
antibodies. As shown in Figure
8A, two paxillin bands
(presumably representing different isoforms) were seen in the 4
immunoprecipitation, whereas no bands were seen following immunoprecipitation with anti- 5 or anti- 1. This suggests that paxillin is specifically associated with 4 but not 5 in DRG neurons. To confirm this we performed two further sets of experiments. First, we immunodepleted DRG cell extracts with either anti-paxillin or
anti-integrin antibodies and then asked to what extent the partner was
also depleted after removal of the targeted protein from the lysate. As
shown in Figure 8B, depletion with anti- 4 significantly reduced the level of paxillin within the remaining lysate, whereas anti- 5 had no effect. Similar results were obtained in the converse experiment, in which levels of 4 and 5 were analyzed in the remaining lysate after paxillin immunodepletion (data
not shown). Second, we re-immunoprecipitated proteins obtained after
immunoprecipitation of cell extracts with anti-paxillin antibodies and
found that 4 but not 5 was present in the proteins precipitated
by the anti-paxillin antibodies (Fig. 8C).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 8.
Association of paxillin with the 4 tail.
A, Identification of paxillin by Western blotting
immunoprecipitates generated using anti- 4, but not using anti- 1
or anti- 5, from biotin-labeled lysates of DRG neurons (top
panel). Two paxillin bands were detected, probably
representing the and isoforms of paxillin. The presence of
immunoprecipitated cell-surface proteins in the material used for
Western blotting was confirmed by detection with streptavidin
peroxidase and ECL (bottom panel). B,
Immunoprecipitation of paxillin from the DRG neuron lysates after
multiple immunodepletions with anti- 4, anti- 5, or irrelevant IgG
( 4, 5, mock depletions). Note the reduction in the level of
paxillin in the lysate depleted of 4 integrins. C,
Reimmunoprecipitation of 4 (lane 1) but not 5
(lane 2) from immunoprecipitates generated using
anti-paxillin antibodies on lysates of DRG neurons. D,
Cell lysates from PC12 cell lines expressing 4 4, 4 0,
5 5, 5 0, 5 6, or 5 4 were immunoprecipitated with
anti-human 4 (lanes 1, 2) or 5 (lanes
3-6) and then Western blotted with anti-paxillin
antibodies. Equal amounts of protein were used. Note that only those
cell lines expressing the 4 cytoplasmic domain show coassociation of
paxillin.
|
|
To examine the association of paxillin with 4 in PC12 cells, we
performed immunoprecipitation experiments using anti- 4 antibodies on
extracts of the cell lines expressing full length 4 4 or truncated 4a0 and then Western blotted the precipitated proteins with
anti-paxillin antibodies. Paxillin was present in the lysates from
cells expressing full-length 4, but was not seen in the lysates from
cells expressing the 4 cytoplasmic domain deletion (Fig.
8D, lanes 1, 2). To confirm the requirement for the
cytoplasmic domain we repeated these experiments in the cell lines
expressing the different 5 chimeras, now using an anti- 5 antibody
for the immunoprecipitation step. Only in the cells expressing the 4
cytoplasmic domain did we observe paxillin within the precipitated
proteins (Fig. 8D), confirming that the specificity
of this interaction requires only the 4 cytoplasmic domain and is
not dependent on the extracellular domain of the subunit.
 |
DISCUSSION |
Our studies on the expression and function of integrins during
peripheral nerve regeneration and neurite outgrowth are significant for
three reasons. First, they show for the first time that the 4
integrin subunit is expressed on regenerating growth cones in
vivo. Second, they show how alternative splicing of an
extracellular matrix molecule after injury in the PNS can generate an
environment that enhances repair. Third, they provide the first
insights into the components of an intracellular signaling pathway
activated by these changes in alternative splicing that are likely to
play an important role in PNS regeneration.
Function of 4 integrin during nerve regeneration
A role for integrins in growth cone movement during neural
development and repair has been suggested by cell culture studies examining neurite outgrowth on different ECM components (Reichardt and
Tomaselli, 1991 ). Previous work has identified the 5 1 FN receptor
and the 7 1 laminin receptor on growth cones in vivo (Lefcort et al., 1992 ; Werner et al., 2000 ). Transgenic mice lacking 7 1 show impaired axon regeneration in the facial nerve,
confirming an important role for this integrin in regeneration (Werner
et al., 2000 ). The embryonic lethality of the 4-deficient mice (Yang et al., 1995 ) prevents a transgenic analysis of 4 function in regeneration, and we have therefore used a combination of in
vivo localization and in vitro neurite outgrowth assays
to address the role of this integrin. Our present results now show for
the first time that the 4 integrin is also expressed on a subset of
regenerating axonal growth cones. Previous studies in the adult have
suggested that 4 expression is confined to cells of the immune
system, although developmental studies have revealed a much wider
expression pattern in embryonic tissue including neural crest-derived
cells and retinal neurons (Sheppard et al., 1994 ; Stepp et al., 1994 ;
Kil et al., 1998 ). Our results showing expression of 4 on DRG
neurons in both uninjured and axotomized nerve shows that expression is
maintained on these neural crest-derived cells in the adult. The 4
integrin subunit can heterodimerize with either 1 or 7. The 1
subunit is expressed on regenerating growth cones, whereas 7 has
only been reported in cells of the immune system and endothelial cells
(Brezinschek et al., 1996 ; Wagner et al., 1996 ). We conclude,
therefore, that the 4 1 heterodimer is expressed on regenerating
growth cones in the peripheral nervous system and is likely to
represent the major, if not only, 4 integrin present.
Although both 4 and 7 integrins are expressed in DRG neurons
during regeneration, our data show two interesting differences between
the regulation of these two integrins in response to injury. First,
7 is expressed on motorneurons and on some small-caliber sensory
neurons, with mostly unmyelinated axons. Large-size sensory neurons,
with myelinated axons, are 7-negative. In contrast, the 4
integrin appears to be confined to large and small sensory neurons,
with no labeling seen in spinal cord motorneurons or in the neurons of
the motor facial nucleus (this study; Kloss et al., 1999 ). Second, 7
is upregulated in the cell bodies of both motor and sensory neurons
after injury. In contrast, we see no changes in the levels of 4
expression in DRG neurons after injury as judged either by
immunocytochemistry or in situ hybridization. These
observations show that there are at least three distinct mechanisms by
which integrin-ECM interactions can be altered after injury to promote
sensory neuron repair: first, by increasing the levels of ECM proteins,
as described for a number of molecules including fibronectin and
laminin; second, by upregulation of the integrin receptor as seen with
7; and third, as we show in this study, by alterations in the
expression of integrin binding sites within individual ECM molecules as
a consequence of alternative splicing. Clearly, these mechanisms are
complementary, and this study taken together with that of Lefcort et
al. (1992) showing upregulation of FN during peripheral nerve
regeneration shows how the first and third mechanisms may operate
simultaneously. Importantly, these mechanisms together provide a means
to enhance 4-mediated regeneration without any changes being
required in the levels of 4 expressed on the growth cones. However,
we cannot exclude the possibility that changes in either the level of
4 integrin activation or the subcellular localization, in the
absence of any changes in overall expression level, also contribute to enhancing repair.
4 integrin signaling mechanisms
Our results showing an instructive role for the 4 cytoplasmic
domain are consistent with previous studies using chimeric 4
extracellular domain integrins in K562 and Chinese hamster ovary
(CHO) cells. The 4 cytoplasmic tail increased cell migration when compared with 2 and 5 tails but reduced cell spreading, diminished adhesion strengthening under conditions of shear flow, and
impaired localization of the 4 1 integrin into focal adhesion complexes (Kassner et al., 1995 ). Enhanced migration with the 4
cytoplasmic domain was also seen in studies using 2 extracellular domain chimeras in rhabdomyosarcoma cells (Chan et al., 1992b ). This
evidence for increased migration and neurite outgrowth suggests that
the 4 cytoplasmic domain triggers specific intracellular signaling
pathways regulating these complex aspects of cell behavior. A potential
mechanism is provided by the recent observation that the 4
cytoplasmic domain binds to the signaling adapter protein paxillin,
whereas other cytoplasmic domains fail to bind. This association
increased the rates of focal adhesion kinase phosphorylation and cell
migration but reduced cell spreading (Liu et al., 1999 ; Liu and
Ginsberg, 2000 ). We show here that the 4 cytoplasmic domain also
binds paxillin in DRG neurons and PC12 cells. The PC12 cell experiments
also showed that the cytoplasmic domain was sufficient for binding,
because both 4 4 and 5 4 chimeras co-precipitated with
paxillin in detergent extracts. As described in CHO cells, no
association with the 1 cytoplasmic domain was present in our study.
This association of 4 and paxillin is interesting because a number
of studies implicate paxillin in neurite extension. Paxillin is an
adapter protein able to integrate adhesion and growth factor signaling
via a number of different binding domains (Turner, 2000 ). Previous
studies have shown changes in paxillin phosphorylation in association
with neurite outgrowth. Integrin-mediated adhesion to laminin in
neurons stimulates neurite outgrowth and causes both an increase in
tyrosine phosphorylation of paxillin and redistribution of
tyrosine-phosphorylated paxillin into the cytoskeletal fraction (Leventhal and Feldman, 1996 ; Curtis and Malanchini, 1997 ). Tyrosine phosphorylation of paxillin in PC12 cells is stimulated by the neurite
outgrowth-promoting nerve growth factor (NGF) (Khan et al., 1995 ;
Escalante et al. 2000 ). Whereas regulation of tyrosine phosphorylation
is recognized as a mechanism controlling growth cone behavior (Bixby
and Jhavbala, 1992 ; Goldberg and Wu, 1996 ; Desai et al., 1997 ; Cheng et
al., 2000 ), the mechanistic relationship between paxillin
phosphorylation and neurite outgrowth is unclear. Phosphorylation of
tyrosines 31 and 118 is necessary for the interaction with the adapter
molecule CrkII and collagen-induced cell migration (Petit et al.,
2000 ), and a mutant CrkII (Y222F) prevents NGF-stimulated neurite
outgrowth (Escalante et al., 2000 ). However, expression of a triple
tyrosine mutant form of paxillin (Y to F for tyrosines 31, 118 and 187, preventing phosphorylation) had no effect on PC12 neurite outgrowth
induced by cooperative collagen and growth factor signaling
(Ivankovic-Dikic et al., 2000 ). An alternative mechanism, unlinked to
phosphorylation of these tyrosines, by which paxillin might regulate
neurite outgrowth is suggested by a recent study showing that deletion
of a highly conserved leucine-rich domain (LD4) reduces neurite
outgrowth stimulated by cooperative integrin-growth factor signals
(Ivankovic-Dikic et al., 2000 ). This region of paxillin binds PKL,
which links paxillin with a protein complex including PIX, PAK, and Nck
(Turner et al., 1999 ). This complex has been implicated in Rho-family
GTPase signaling and could therefore regulate the cytoskeletal
interactions associated with growth cone motility and neurite extension.
Although the mechanisms remain unclear, these different studies do show
a role for paxillin in neurite extension. We propose, therefore, that
the tight association of 4 and paxillin ensures the immediate
recruitment of this adapter protein to the adhesion complex, bypassing
any need for a diffusion-based mechanism to relocate critical signaling
molecules within the membrane (Teruel and Meyer, 2000 ). The association
of 4 with a multidomain adapter protein also provides a mechanism
for integrating 4 1 integrin signaling and that from other
adhesion receptors. In a recent study using retinal neurons, Treubert
and Brummendorf (1998) observed that FN-mediated neurite outgrowth was
enhanced by the IgSF molecule F11 and that this enhanced outgrowth
could not be blocked by RGD peptides. Based on the lack of effect of
the RGD peptides, they proposed that the 4 1 integrin might be
responsible for a FN-mediated signal that could be amplified by
additional interaction of the cell with F11. Our results support such a
role for 4 1 and suggest coassociated paxillin as one potential
integrator of the FN and F11 signaling pathways.
In conclusion, our results add significantly to our knowledge of the
function of FN splicing by providing support for a model in which the
increased inclusion of V25 that follows injury in peripheral nerve
results in enhanced outgrowth of sensory neurons expressing 4 1
integrin. The splicing pattern of the V25 region in human FN resembles
that of the rat and the LDV sequence is conserved. The identification
of the 4 cytoplasmic domain and coassociated paxillin as important
signaling components therefore suggests these molecules as therapeutic
targets for drugs to enhance peripheral nerve repair in humans, and
further studies on the molecular signaling complexes associated with
these molecules are required.
 |
FOOTNOTES |
Received Feb. 1, 2001; revised May 18, 2001; accepted May 31, 2001.
This work was supported by Action Research (Horsham, UK) (M.G.V.,
C.ff.-C.), a fellowship (BPD 11785) from the Programa Praxis XXI of the
Fundacão para a Ciência é Tecnologia
(Portugal) (J.B.R.), and by Deutsche Forschungsgemeinschaft RA486/3-2
and RA486/8-2 (G.R.). We are extremely grateful to Monique
Jouet and Andreas Faissner for help with the production of the
recombinant fibronectins and Dr. Paul Mould for advice concerning the
LAV mutations.
Correspondence should be addressed to Dr. Charles ffrench-Constant,
Department of Medical Genetics, University of Cambridge and Cambridge
Centre for Brain Repair, University Forvie Site, Robinson Way,
Cambridge, CB2 2PY, UK. E-mail: cfc{at}mole.bio.cam.ac.uk.
G. Raivich's present address: Department of Obstetrics and Gynecology
and Department of Anatomy, University College London, Gower Street,
London WC2, UK.
 |
REFERENCES |
-
Agius E,
Cochard P
(1998)
Comparison of neurite outgrowth induced by intact and injured sciatic nerves: a confocal and functional analysis.
J Neurosci
18:328-338[Abstract/Free Full Text].
-
Bailey S,
Eichler M,
Villadiego A,
Rich K
(1993)
The influence of fibronectin and laminin during Schwann cell migration and peripheral nerve regeneration through silicon chambers.
J Neurocytol
22:176-184[Web of Science][Medline].
-
Bixby J,
Jhavbala P
(1992)
Inhibition of tyrosine phosphorylation potentiates substrate-induced neurite growth.
J Neurobiol
23:468-480[Medline].
-
Brezinschek RI,
Brezinschek HP,
Lazarovits AI,
Lipsky PE,
Oppenheimer-Marks N
(1996)
Expression of the beta 7 integrin by human endothelial cells.
Am J Pathol
149:1651-1660[Abstract].
-
Chan B,
Kassner P,
Schiro J,
Byers H,
Kupper T,
Hemler M
(1992b)
Distinct cellular functions mediated by different VLA integrin alpha subunit cytoplasmic domains.
Cell
68:1051-1060[Medline].
-
Cheng S,
Mao J,
Rehder V
(2000)
Filopodial behavior is dependent on the phosphorylation state of neuronal growth cones.
Cell Motil Cytoskel
47:337-350[Medline].
-
Curtis ID,
Malanchini B
(1997)
Integrin-mediated tyrosine phosphorylation and redistribution of paxillin during neuronal adhesion.
Exp Cell Res
230:233-243[Web of Science][Medline].
-
Desai CJ,
Sun Q,
Zinn K
(1997)
Tyrosine phosphorylation and axon guidance: of mice and flies.
Curr Opin Neurobiol
7:70-74[Web of Science][Medline].
-
Dufour S,
Duband J-L,
Humphries M,
Obara M,
Yamada K,
Thiery J
(1988)
Attachement, spreading and locomotion of avian neural crest cells are mediated by multiple adhesion sites on fibronectin molecules.
EMBO J
7:2661-2671[Web of Science][Medline].
-
Dumoulin FL,
Raivich G,
Streit WJ,
Kreutzberg GW
(1991)
Differential regulation of calcitonin gene-related peptide (CGRP) in regenerating facial nucleus and dorsal root ganglion.
Eur J Neurosci
3:338-342[Web of Science][Medline].
-
Escalante M,
Courtney J,
Chin W,
Teng K,
Kim J-I,
Fajardo J,
Mayer B,
Hempstead B,
Birge R
(2000)
Phosphorylation of c-Crk II on the negative regulatory Tyr 222 mediates nerve growth factor-induced cell spreading and morphogenesis.
J Biol Chem
275:24787-24797[Abstract/Free Full Text].
-
ffrench-Constant C
(1995)
Alternative splicing of fibronectin-Many different proteins, but few different functions.
Exp Cell Res
221:261-271[Web of Science][Medline].
-
Goldberg D,
Wu D
(1996)
Tyrosine phosphorylation and protrusive structures of the growth cone.
Perspect Dev Neurobiol
4:183-192[Medline].
-
Guan J-L,
Hynes R
(1990)
Lymphoid cells recognize an alternatively spliced segment of fibronectin via the integrin receptor
4 1.
Cell
60:53-61[Web of Science][Medline]. -
Gutman A,
Kornblihtt A
(1987)
Identification of a third region of cell-specific alternative splicing in human fibronectin mRNA.
Proc Natl Acad Sci USA
84:7179-7182[Abstract/Free Full Text].
-
Humphries M,
Akiyama S,
Komoriya A,
Olden K,
Yamada K
(1988)
Neurite extension of chicken peripheral neurons on fibronectin: relative importance of specific adhesion sites in the central-binding domain and the alternatively spliced type III connecting segment.
J Cell Biol
106:1289-1297[Abstract/Free Full Text].
-
Ivankovic-Dikic I,
Gronroos E,
Blaukat A,
Barth B-U,
Dikic I
(2000)
Pyk2 and FAK regulate neurite outgrowth induced by growth factors and integrins.
Nat Cell Biol
2:574-581[Web of Science][Medline].
-
Kassner P,
Alon R,
Springer T,
Hemler M
(1995)
Specialized functional properties of the integrin alpha 4 cytoplasmic domain.
Mol Biol Cell
6:661-674[Abstract].
-
Khan MA,
Okumura N,
Okada M,
Kobayashi S,
Nakagawa H
(1995)
Nerve growth factor stimulates tyrosine phosphorylation of paxillin in PC12h cells.
FEBS Lett
362:201-204[Web of Science][Medline].; 207.
-
Kil S,
Krull C,
Cann G,
Clegg D,
Bronner-Fraser M
(1998)
The
4 subunit of integrin is important for neural crest cell migration.
Dev Biol
202:29-42[Web of Science][Medline]. -
Kloss C,
Werner A,
Klein M,
Shen J,
Menuz K,
Probst J,
Kreuzberg G,
Raivich G
(1999)
Integrin family of cell adhesion molecules in the injured brain: regulation and cellular localization in the normal and regenerating mouse facial motor nucleus.
J Comp Neurol
411:162-178[Web of Science][Medline].
-
Kloss C, Bohatschek M, Kreutzberg GW, Raivich G (2001) Effect
of lipopolysaccharide on the morphology and integrin immunoreactivity
of ramified microglia in the mouse brain and in cell culture. Exp
Neurol, in press.
-
Kornblihtt A,
Umezawa K,
Vibe-Pedersen K,
Baralle F
(1985)
Primary structure of human fibronectin: differential splicing generate at least 10 polypeptides from a single gene.
EMBO J
4:1755-1759[Web of Science][Medline].
-
Lefcort F,
Venstrom K,
McDonald JA,
Reichardt LF
(1992)
Regulation of expression of fibronectin and its receptor,
5 1, during development and regeneration of peripheral nerve.
Development
116:767-782[Abstract]. -
Leventhal P,
Feldman E
(1996)
Tyrosine phosphorylation and enhanced expression of paxillin during neuronal differentiation in vitro.
J Biol Chem
271:5957-5960[Abstract/Free Full Text].
-
Liu S,
Ginsberg M
(2000)
Paxillin binding to a conserved sequence motif in the
4 integrin cytoplasmic domain.
J Biol Chem
275:22736-22742[Abstract/Free Full Text]. -
Liu S,
Thomas S,
Woodside D,
Rose D,
Kiosses W,
Pfaff M,
Ginsberg M
(1999)
Binding of paxillin to
4 integrins modifies integrin-dependent biological responses.
Nature
402:676-681[Medline]. -
Magnuson V,
Young M,
Schattenberg D,
Mancini M,
Chen D,
Steffensen B,
Klebe R
(1991)
The alternative splicing of fibronectin is altered during aging and in response to growth factors.
J Biol Chem
266:14654-14662[Abstract/Free Full Text].
-
Martini R
(1994)
Expression and functional roles of neural cell surface molecules and extracellular matrix components during development and regeneration of peripheral nerves.
J Neurocytol
23:1-28[Web of Science][Medline].
-
Mathews GA,
ffrench-Constant C
(1995)
Embryonic fibronectins are up-regulated following peripheral nerve injury in rats.
J Neurobiol
26:171-188[Web of Science][Medline].
-
Moller JC,
Klein MA,
Haas S,
Jones LL,
Kreutzberg GW,
Raivich G
(1996)
Regulation of thrombospondin in the regenerating mouse motor facial nucleus.
Glia
17:121-132[Web of Science][Medline].
-
Peters J,
Chen G,
Hynes R
(1996)
Fibronectin isoform distribution in the mouse. II. Differential distribution of the alternatively spliced EIIIB, EIIIA, and V segments in the adult mouse.
Cell Adhes Commun
4:127-148[Web of Science][Medline].
-
Petit V,
Boyer B,
Lentz D,
Turner C,
Thiery J-P,
Valles A
(2000)
Phophorylation of tyrosine residues 31 and 118 on paxillin regulates cell migration through an association with CRK in NBT-II cells.
J Cell Biol
148:957-969[Abstract/Free Full Text].
-
Relvas JB,
Setzu A,
Baron W,
Buttery P,
LaFlamme S,
Franklin RJM,
ffrench-Constant C
(2001)
Expression of dominant negative and chimeric subunits reveals an essential role for beta 1 integrin during myelination.
Curr Biol
11:1039-1043[Web of Science][Medline].
-
Reichardt LF,
Tomaselli KJ
(1991)
Extracellular matrix molecules and their receptors: functions in neural development.
Annu Rev Neurosci
14:531-570[Web of Science][Medline].
-
Ruoslahti E
(1996)
RGD and other recognition sequences for integrins.
Annu Rev Cell Dev Biol
12:697-715[Web of Science][Medline].
-
Scherer S,
Salzer J
(1996)
Axon-Schwann cell interactions during peripheral nerve degeneration and regeneration.
In: Glial cell development: basic principles and clinical relevance (Jessen K,
Richardson W,
eds), pp 165-196. Oxford, UK: BIOS Scientific.
-
Schwarzbauer J,
Tamkun J,
Lemischka I,
Hynes R
(1983)
Three different fibronectin mRNA arise by alternative splicing of the rat fibronectin gene transcript.
Cell
35:421-431[Web of Science][Medline].
-
Schwarzbauer J,
Patel R,
Fonda D,
Hynes R
(1987)
Multiple sites of alternative splicing of the rat fibronectin gene transcript.
EMBO J
6:2573-2580[Web of Science][Medline].
-
Sheppard A,
Onken M,
Rosen G,
Noakes P,
Dean D
(1994)
Expanding roles for
4 integrin and its ligands in development.
Cell Adhes Commun
2:27-43[Web of Science][Medline]. -
Stepp M,
Urry L,
Hynes R
(1994)
Expression of alpha 4 mRNA and protein and fibronectin in the early chicken embryo.
Cell Adhes Commun
2:359-375[Web of Science][Medline].
-
Tamkun J,
Schwarzbauer J,
Hynes R
(1984)
A single rat fibronectin gene generates three different mRNAs by alternative splicing of a complex exon.
Proc Natl Acad Sci USA
81:5140-5144[Abstract/Free Full Text].
-
Teruel MN,
Meyer T
(2000)
Translocation and reversible localization of signaling proteins: a dynamic future for signal transduction
Cell
103:181-184[Web of Science][Medline].
-
Tomaselli K,
Damsky C,
Reichardt L
(1987)
Interactions of a neuronal cell line (PC12) with laminin, collagen IV, and fibronectin: identification of integrin-related glycoproteins involved in attachment and process outgrowth.
J Cell Biol
105:2347-2358[Abstract/Free Full Text].
-
Tomaselli K,
Hall D,
Flier L,
Gehlsen K,
Turner D,
Carbonetto S,
Reichardt L
(1990)
A neuronal cell line (PC12) expresses two
1-class integrins- 1 1 and 3 1-that recognize different neurite outgrowth-promoting domains in laminin.
Neuron
5:651-662[Web of Science][Medline]. -
Toyota B,
Carbonetto S,
David S
(1990)
A dual laminin/collagen receptor acts in peripheral nerve regeneration.
Proc Natl Acad Sci USA
87:1319-1322[Abstract/Free Full Text].
-
Treubert U,
Bruemmendorf T
(1998)
Functional cooperation of
1-integrins and members of the Ig superfamily in neurite outgrowth induction.
J Neurosci
18:1795-1805[Abstract/Free Full Text]. -
Turner C
(2000)
Paxillin and focal adhesion signalling.
Nat Cell Biol
2:E231-236[Web of Science][Medline].
-
Turner C,
Brown M,
Perrotta J,
Riedy M,
Nikopoulos S,
McDonald A,
Bagrodia S,
Thomas S,
Leventhal P
(1999)
Paxillin LD4 motif binds PAK and PIX through a novel 95-kD ankyrin repeat, ARF-GAP protein: a role in cytoskeletal remodeling.
J Cell Biol
145:851-863[Abstract/Free Full Text].
-
Vogelezang M,
Scherer S,
Fawcett J,
ffrench-Constant C
(1999)
Regulation of fibronectin alternative splicing during peripheral nerve repair.
J Neurosci Res
56:323-333[Web of Science][Medline].
-
Wagner N,
Loehler J,
Kunkel E,
Ley K,
Leung E,
Krissansen G,
Rajewski K,
Mueller W
(1996)
Critical role for
7 integrins in formation of the gut-associated lymphoid tissue.
Nature
382:366-370[Medline]. -
Wang GY,
Hirai KI,
Shimada H,
Taji S,
Zhong SZ
(1992)
Behavior of axons, Schwann cells and perineurial cells in nerve regeneration within transplanted nerve grafts - effects of anti-laminin and anti-fibronectin antisera.
Brain Res
583:216-226[Web of Science][Medline].
-
Wayner E,
Garcia P,
Humphries M,
McDonald J,
Carter W
(1989)
Identification and characterization of the T lymphocyte adhesion receptor for an alternative cell attachment domain (CS-1) in plasma fibronectin.
J Cell Biol
109:1321-1330[Abstract/Free Full Text].
-
Werner A,
Willem M,
Jones L,
Kreutzberg G,
Mayer U,
Raivich G
(2000)
Impaired axonal regeneration in
7 integrin-deficient mice.
J Neurosci
20:1822-1830[Abstract/Free Full Text]. -
Yang JT,
Rayburn H,
Hynes RO
(1995)
Cell adhesion events mediated by alpha 4 integrins are essential in placental and cardiac development.
Development
121:549-560[Abstract].
-
Zardi L,
Carnemolla B,
Siri A,
Petersen T,
Paolella G,
Sebastio G,
Baralle F
(1987)
Transformed human cells produce a new fibronectin isoform by preferential alternative splicing of a previously unobserved exon.
EMBO J
6:2337-2342[Web of Science][Medline].
-
Zhang X,
Xu ZO,
Shi TJ,
Landry M,
Holmberg K,
Ju G,
Tong YG,
Bao L,
Cheng XP,
Wiesenfeld-Hallin Z,
Lozano A,
Dostrovsky J,
Hokfelt T
(1998)
Regulation of expression of galanin and galanin receptors in dorsal root ganglia and spinal cord after axotomy and inflammation.
Ann NY Acad Sci
863:402-413[Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21176732-13$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. R. Andrews, S. Czvitkovich, E. Dassie, C. F. Vogelaar, A. Faissner, B. Blits, F. H. Gage, C. ffrench-Constant, and J. W. Fawcett
{alpha}9 Integrin Promotes Neurite Outgrowth on Tenascin-C and Enhances Sensory Axon Regeneration
J. Neurosci.,
April 29, 2009;
29(17):
5546 - 5557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. E. M. Van der Zee, M. Kreft, G. Beckers, A. Kuipers, and A. Sonnenberg
Conditional Deletion of the Itgb4 Integrin Gene in Schwann Cells Leads to Delayed Peripheral Nerve Regeneration
J. Neurosci.,
October 29, 2008;
28(44):
11292 - 11303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Tebar, S. M. Geranton, C. Parsons-Perez, A. S. Fisher, R. Bayne, A. J. H. Smith, M. Turmaine, S. Perez-Luz, A. Sheasby, C. De Felipe, et al.
Deletion of the mouse RegIII{beta} (Reg2) gene disrupts ciliary neurotrophic factor signaling and delays myelination of mouse cranial motor neurons
PNAS,
August 12, 2008;
105(32):
11400 - 11405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Hermann, J. J. Nicol, A. G. M. Bulloch, and W. C. Wildering
RGD-dependent mechanisms in the endoneurial phagocyte response and axonal regeneration in the nervous system of the snail Lymnaea stagnalis
J. Exp. Biol.,
February 15, 2008;
211(4):
491 - 501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Hu and S. M. Strittmatter
The N-Terminal Domain of Nogo-A Inhibits Cell Adhesion and Axonal Outgrowth by an Integrin-Specific Mechanism
J. Neurosci.,
January 30, 2008;
28(5):
1262 - 1269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Swetman Andersen, M. Handley, G. Pollara, A. J. Ridley, D. R. Katz, and B. M. Chain
{beta}1-Integrins determine the dendritic morphology which enhances DC-SIGN-mediated particle capture by dendritic cells
Int. Immunol.,
August 1, 2006;
18(8):
1295 - 1303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Perez-Martinez and D. M. Jaworski
Tissue Inhibitor of Metalloproteinase-2 Promotes Neuronal Differentiation by Acting as an Anti-Mitogenic Signal
J. Neurosci.,
May 18, 2005;
25(20):
4917 - 4929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. J. Tom, C. M. Doller, A. T. Malouf, and J. Silver
Astrocyte-Associated Fibronectin Is Critical for Axonal Regeneration in Adult White Matter
J. Neurosci.,
October 20, 2004;
24(42):
9282 - 9290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Pietri, O. Eder, M. A. Breau, P. Topilko, M. Blanche, C. Brakebusch, R. Fassler, J.-P. Thiery, and S. Dufour
Conditional {beta}1-integrin gene deletion in neural crest cells causes severe developmental alterations of the peripheral nervous system
Development,
August 15, 2004;
131(16):
3871 - 3883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Huang, C. H. Borchers, M. D. Schaller, and K. Jacobson
Phosphorylation of paxillin by p38MAPK is involved in the neurite extension of PC-12 cells
J. Cell Biol.,
February 16, 2004;
164(4):
593 - 602.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gu, Y. Zhao, T. Isaji, Y. Shibukawa, H. Ihara, M. Takahashi, Y. Ikeda, E. Miyoshi, K. Honke, and N. Taniguchi
{beta}1,4-N-Acetylglucosaminyltransferase III down-regulates neurite outgrowth induced by costimulation of epidermal growth factor and integrins through the Ras/ERK signaling pathway in PC12 cells
Glycobiology,
February 1, 2004;
14(2):
177 - 186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. T. Mercado, A. Nur-e-Kamal, H.-Y. Liu, S. R. Gross, R. Movahed, and S. Meiners
Neurite Outgrowth by the Alternatively Spliced Region of Human Tenascin-C Is Mediated by Neuronal {alpha}7{beta}1 Integrin
J. Neurosci.,
January 7, 2004;
24(1):
238 - 247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Wingerd, N. L. Goodman, J. W. Tresser, M. M. Smail, S. T. Leu, S. J. Rohan, J. L. Pring, D. Y. Jackson, and D. O. Clegg
alpha 4 Integrins and Vascular Cell Adhesion Molecule-1 Play a Role in Sympathetic Innervation of the Heart
J. Neurosci.,
December 15, 2002;
22(24):
10772 - 10780.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|