 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 2001, 21(18):7203-7214
Isolation and Expression Pattern of Human Unc-33-Like
Phosphoprotein 6/Collapsin Response Mediator Protein 5 (Ulip6/CRMP5): Coexistence with Ulip2/CRMP2 in Sema3A- Sensitive
Oligodendrocytes
Damien
Ricard,
Véronique
Rogemond,
Emmanuelle
Charrier,
Michèle
Aguera,
Dominique
Bagnard,
Marie-Françoise
Belin,
Nicole
Thomasset, and
Jérôme
Honnorat
Institut National de la Santé et de la Recherche
Médicale U 433, Institut Fédératif des Neurosciences
de Lyon, Hôpital Neurologique, 69003 Lyon, France
 |
ABSTRACT |
The Unc-33-like phosphoprotein/collapsin response mediator protein
(Ulip/CRMP) family consists of four homologous phosphoproteins considered crucial for brain development. Autoantibodies produced against member(s) of this family by patients with paraneoplastic neurological diseases have made it possible to clone a fifth human Ulip/CRMP and characterize its cellular and anatomical
distribution in developing brain. This protein, referred to as
Ulip6/CRMP5, is highly expressed during rat brain development in
postmitotic neural precursors and in the fasciculi of fibers,
suggesting its involvement in neuronal migration/differentiation and
axonal growth. In the adult, Ulip6/CRMP5 is still expressed in some
neurons, namely in areas that retain neurogenesis and in
oligodendrocytes in the midbrain, hindbrain, and spinal cord.
Ulip2/CRMP2 and Ulip6/CRMP5 are coexpressed in postmitotic neural
precursors at certain times during development and in oligodendrocytes
in the adult. Because Ulip2/CRMP2 has been reported to mediate
semaphorin-3A (Sema3A) signal in developing neurons, in studies to
understand the function of Ulip6/CRMP5 and Ulip2/CRMP2 in the adult,
purified adult rat brain oligodendrocytes were cultured in a
Sema3A-conditioned medium. Oligodendrocytes were found to have Sema3A
binding sites and to express neuropilin-1, the major Sema3A receptor
component. In the presence of Sema3A, these oligodendrocytes displayed
a dramatic reduction in process extension, which was reversed by
removal of Sema3A and prevented by anti-neuropilin-1, anti-Ulip6/CRMP5, anti-Ulip2/CRMP2 antibodies, or VEGF-165, another neuropilin-1 ligand.
These results indicate the existence in the adult brain of a Sema3A
signaling pathway that modulates oligodendrocyte process extension
mediated by neuropilin-1, Ulip6/CRMP5, and Ulip2/CRMP2, and they open
new fields of investigation of neuron/oligodendrocyte interactions in
the normal and pathological brain.
Key words:
Ulip/CRMP; oligodendrocyte; Sema3A; process extension; anatomical expression; neurodegenerative disorders
 |
INTRODUCTION |
The Unc-33-like
phosphoprotein/collapsin response mediator protein (Ulip/CRMP)
family consists of four homologous cytosolic phosphoproteins (Minturn
et al., 1995 ; Byk et al., 1996 ; Hamajima et al., 1996 ; Wang and
Strittmatter, 1996 ; Quach et al., 1997 ) that are highly expressed in
the developing brain and have unique and as yet poorly understood
molecular mechanisms of action. Ulip2/CRMP2, the most widely studied
member, is reported to mediate semaphorin-3A (Sema3A)-induced growth
cone collapse through a signal transduction cascade
involving heterotrimeric G-proteins (Goshima et al., 1995 ), growth cone collapse induced by lysophosphatidic acid acting via Rho-associated protein kinase (Arimura et al., 2000 ), and neuronal apoptotic death (Shirvan et al., 1999 ). Although dramatically downregulated in the adult, Ulip/CRMPs are still expressed in structures that retain neurogenesis (Wang and Strittmatter, 1996 ; Kamata et al., 1998 ; Pasterkamp et al., 1998a ; Nacher et al., 2000 ).
Interestingly, members of the Ulip/CRMP family have been implicated in human neurodegenerative disorders. In
Alzheimer's disease, increased levels of highly phosphorylated
Ulip2/CRMP2 are associated with neurofibrillary tangles (Yoshida et
al., 1998 ; Gu et al., 2000 ). In paraneoplastic neurological diseases
(PNDs), autoimmune neurodegenerative disorders involving the cerebellum and dentate gyrus, some patients develop autoantibodies (anti-CV2 antibodies) that recognize Ulip/CRMP proteins (Honnorat et
al., 1999 ). Intriguingly, although all anti-CV2 sera tested recognized the same protein (Honnorat et al., 1996 ) and immunolabeled the same
postmitotic neural precursors in the developing brain and the same
population of oligodendrocytes (Honnorat et al., 1998 ), a few failed to
recognize any of the four known Ulip/CRMPs, suggesting the existence of
another member that was the main target for these antibodies. In the present study, we used one of these
anti-CV2 sera to clone a fifth human Ulip/CRMP member, referred to as
Ulip6/CRMP5. This protein displays 50% homology with the other human
Ulip/CRMPs and is the human equivalent of the recently identified CRAM
and CRMP5 proteins, respectively, in the rat and mouse (Fukada et al.,
2000 ; Inatome et al., 2000 ). The distribution pattern of Ulip6/CRMP5
mRNA and protein was studied in the developing and adult rat brain.
Because we observed an expression in adult oligodendrocytes as
described for Ulip2/CRMP2 (Ricard et al., 2000 ), we compared the
distribution of these two proteins and found that they were coexpressed
at certain times during development and in oligodendrocytes. In studies
to understand the function of Ulip6/CRMP5 and Ulip2/CRMP2 in adult,
purified adult rat brain oligodendrocytes were submitted to Sema3A, a
semaphorin known for its attractive/repulsive properties on growing
axons (Püschel, 1999 ; Bagnard et al., 1998 , 2000 ). These
oligodendrocytes were found to have Sema3A binding sites and to express
neuropilin-1, the major component of the Sema3A receptor
complex (He and Tessier-Lavigne, 1997 ; Kolodkin et al., 1997 ). In the
presence of Sema3A, the oligodendrocyte process extensions displayed a
dramatic decrease that was reversed by removing the Sema3A or prevented
by anti-neuropilin-1, anti-Ulip6/CRMP5, or anti-Ulip2/CRMP2 antibodies
or VEGF-165, another ligand for neuropilin-1 (Miao et al., 1999 ). These
results indicate the existence of a Sema3A signaling pathway
controlling oligodendrocyte process extension in adult brain via
neuropilin-1, Ulip6/CRMP5, or Ulip2/CRMP2.
 |
MATERIALS AND METHODS |
Reagents. Unless specified otherwise, all reagents
were purchased from Sigma (L'Isle d'Abeau, France).
Production of recombinant proteins. cDNAs coding for mouse
Ulip1/CRMP4 (GenBank accession number X87817), Ulip2/CRMP2
(GenBank accession number Y10339), Ulip3/CRMP1 (GenBank accession
number Y09080), and Ulip4/CRMP3 (GenBank accession number Y09079), kindly provided by A. Sobel (Institut National de la Santé et de
la Recherche Médicale U440, Paris), were cloned in-frame with a
flag sequence (Sigma) in the pSG5 vector (Stratagene, Amsterdam, The
Netherlands) and used to produce recombinant proteins in HeLa cells as
described previously (Ricard et al., 2000 ). Human Ulip6/CRMP5 cDNA
(GenBank accession number AF264015), cloned in-frame with the
Lac-Z gene in pBluescript KS, was used to produce bacterial recombinant protein. Briefly, Escherichia coli cells were
grown for 1 hr at 37°C, then Ulip6/CRMP5 expression was induced with isopropyl-1-thio- -D-galactopyranoside (0.1 mM). After 3 hr at 37°C, the cells were lysed
by sonication, and the soluble extract containing the Ulip6/CRMP5
recombinant protein was obtained by centrifugation for 10 min at
2000 × g.
Antibodies. The peptides chosen to generate specific
antisera were KEMGTPLADTPTRPVTRHGG (amino acids 505-524) for
anti-Ulip6/CRMP5, LEDGTLHVTEGS and ITGPEGHVLSRPEEVE (amino acids
454-465 and 217-232, respectively) for anti-Ulip2/CRMP2,
LTSFEKWHEAADTKS (amino acids 117-131) for anti-Ulip3/CRMP1, and
EHDSHAQLRWRVL (amino acids 664-676) for anti-neuropilin-1. The
synthetic peptides were conjugated to keyhole limpet hemocyanin and
used to immunize rabbits or rats as described previously (Honnorat et
al., 1999 ). The antibodies were purified from anti-Ulip6/CRMP5,
anti-Ulip3/CRMP1, and anti-neuropilin-1 antisera using the
corresponding immobilized peptide.
Protein samples. Male rats (OFA; Iffa-Credo, L'Arbresle,
France) were anesthetized with pentobarbital. Tissues were sonicated in
10 mM Tris-HCl, pH 7.4, 0.02% sodium azide, 1 mM EDTA, 0.2% Triton X-100, 10 µg/ml of
leupeptin, 5 µg/ml of pepstatin, and 10 µg/ml of aprotinin, then
centrifuged for 10 min at 2000 × g at 4°C. The
proteins in the supernatant were quantified (Coomassie Plus Protein
Assay Reagent, Pierce, Interbiotech, Montluçon, France), diluted
in the homogenization buffer to a concentration of 2 mg/ml for neural
tissues or 4 mg/ml for non-neural tissues, and stored at 20°C until required.
Purified oligodendrocyte cultures. Oligodendrocytes were
isolated from six 4-week-old Sprague Dawley male rats (Iffa-Credo) using the procedure of Lisak et al. (1981) , as modified by Lubetzki et
al. (1988) . Freshly isolated cells were plated on
poly-L-lysine-coated glass coverslips (OSI,
Maurepas, France) in 24-well plates (Costar Corporation, Cambridge, MA)
at a density of 5 × 104 cells per
well, initially for 1 hr in DMEM (Life Technologies, Cergy-Pontoise, France) containing 10% fetal calf serum (FCS; Eurobio,
Les Ulis, France) to facilitate attachment, and then in standard
culture medium consisting of Bottenstein and Sato medium (BS)
(Bottenstein and Sato, 1979 ) supplemented with 5 U/ml of penicillin and
5 µg/ml of streptomycin (Life Technologies).
cDNA cloning. The cDNA library used in this study was a
human spinal cord cDNA library in gt11 phage (Clontech, Palo Alto, CA). Recombinant phages were screened at a density of 2 × 104 PFU per 150 mm plate of E. coli Y1090r . The library was first
screened using serum from a patient with anti-CV2 antibodies (number
94-799) (Rogemond and Honnorat, 2000 ); primary antibody binding was
visualized using peroxidase-labeled anti-human IgG antibody and
colorimetric detection with diaminobenzidine. Positive clones
were purified by several rounds of antibody screening until 100% of
the plaques gave positive signals. Four positive clones were obtained,
PCR-amplified, and sequenced. The longest (C97, 1.6 kb) was subcloned
into the EcoRI sites of pBluescript KS (Stratagene) and
resequenced. To isolate the full-length cDNA, the human spinal cord
cDNA library was screened using a
32P-labeled 270 bp fragment of clone C97,
obtained by PCR using primers chosen on the basis of the sequence of
the partial cDNA clone (C97). Hybridization was performed using
ExpressHyb hybridization solution (Clontech), and positive clones were
purified and sequenced. One of these, containing the complete coding
region, was subcloned into pBluescript KS (Stratagene) and resequenced.
Northern blot analysis. Northern blot analysis of
Ulip6/CRMP5 expression was performed on a human adult multiple-tissue
RNA blot (MTN, Clontech) containing 2 µg of purified
poly(A+) RNA using the full-length cDNA (2 kb) labeled with 32P-dCTP by random
priming (Life Technologies). Hybridization was performed in ExpressHyb
hybridization solution (Clontech) following the manufacturer's
instructions, and the blot was exposed to x-ray film at 80°C.
Western blot analysis. Proteins were separated by SDS-PAGE
and transferred to polyvinylidene difluoride membranes (Millipore, St.
Quentin-en-Yvelines, France) using a semidry electroblotting system
with a continuous buffer (Tris 25 mM, glycine 192 mM, methanol 20%, pH 8.5). The membranes were
saturated with 2% nonfat dry milk in PBS, then probed with primary
antibodies. Bound antibodies were detected using peroxidase-coupled
anti-IgG antibodies and diaminobenzidine oxidation.
Immunohistochemistry. Four adult male, four 2-week-old
[postnatal day 15 (P15)], four 5-d-old (P5), and four pregnant female rats (OFA; Iffa-Credo) were used. The adult male and P15 rats were
anesthetized with pentobarbital and perfused intracardially with
4% paraformaldehyde in 0.1 M phosphate buffer
(PB), pH 7.4, then the brains were removed and post-fixed in 4%
paraformaldehyde for 12 hr. The brains of anesthetized P5 rats were
fixed by immersion for 12 hr in 4% paraformaldehyde in PB. After three
rinses and overnight incubation in PB/20% sucrose, the brains were
frozen at 60°C in methyl-butane. Embryos [embryonic day 16 (E16)
and E19, respectively] were removed from the anesthetized pregnant females and fixed by immersion for 12 hr in 4% paraformaldehyde, then
treated in the same way as the adult tissues. Sagittal cryostat sections (14 µm thick) were collected on Superfrost Plus slides (Polylabo, Strasbourg, France) and stored at 20°C until required. Immunohistochemistry was performed as described previously (Honnorat et
al., 1998 ). Briefly, the tissue sections were incubated overnight at
room temperature with anti-Ulip6/CRMP5 antibodies (1:100 dilution) or
anti-Ulip2/CRMP2 antibodies (1:50 dilution), and bound antibodies were
detected using fluorescein-conjugated anti-rabbit IgG antibodies.
In situ hybridization. Sense or antisense
digoxigenin-labeled riboprobes were generated by transcription of mouse
Ulip2/CRMP2 cDNA (GenBank accession number Y10339; generously provided by Dr. A. Sobel) and human Ulip6/CRMP5 cDNA (GenBank accession number
AF264015) in pBluescript SK, using the T3 or T7 promoters and labeling
with digoxigenin-UTP (Roche, Meylan, France), following the
manufacturer's instructions. The human Ulip6/CRMP5 cDNA-derived riboprobe was suitable for hybridization with rat tissue sections because the sequence of this human riboprobe displays >90% homology with the corresponding rat sequence. Tissue sections were prepared as
described above for immunohistochemistry, then treated with the sense
and antisense riboprobes as described previously (Ricard et al., 2000 ).
For neuropilin-1, after 48 hr of culture, purified oligodendrocytes
were fixed in 4% paraformaldehyde, then subjected to in
situ hybridization with digoxigenin-labeled oligonucleotide probes
(antisense: CAGACATGTGATACCAGAAGGTCATGCAGT from the neuropilin-1 sequence; GenBank accession number D50086) as described previously (Bagnard et al.,2001 ).
Receptor affinity probes. Alkaline phosphatase (AP) was
fused to the amino terminus of Sema3A as described previously (Bagnard et al., 1998 ). To characterize Sema3A binding sites in highly purified
oligodendrocytes in culture, the cells were incubated for 90 min with
the AP-Sema3A recombinant protein in HBSS supplemented with 20% FCS,
washed three times in PBS, then fixed for 1 hr in 4% paraformaldehyde.
After one wash in PBS, endogenous phosphatases were heat-inactivated at
65°C for 50 min, then the preparations were equilibrated for 20 min
with AP buffer (100 mM Tris, 100 mM NaCl, and 5 mM MgCl2, pH
9.5), and the bound AP-Sema3A was visualized using a staining solution
containing 34 mg/ml of Nitro-blue-tetrazolium and 18 mg/ml of
5-bromo-4-chloro-3-indolylphosphate (Roche) in AP buffer.
Immunostaining with monoclonal Rip antibody, an oligodendrocyte marker
(Friedman et al., 1989 ), was then used to visualize oligodendrocytes. The controls performed consisted of oligodendrocytes incubated in
culture medium without recombinant protein or in the presence of an
excess of untagged Sema3A.
Oligodendrocyte process extension assay. Highly purified
mature oligodendrocytes were obtained and grown for 48 hr in BS medium (see above); then the BS medium was replaced with either
Sema3A-conditioned medium (Sema3A medium) obtained from human embryonic
kidney (HEK 293) cells transfected with Sema3A expression vector, as
described previously (Bagnard et al., 1998 ), or control medium from
untransfected HEK 293 cells. Purified oligodendrocytes were also
incubated for 48 hr in Sema3A medium containing either 50 ng/ml of
VEGF-165 (Miao et al., 1999 ) or various concentrations of antibodies
(2, 4, or 8 µg/ml of immunopurified anti-neuropilin-1,
anti-Ulip6/CRMP5, or anti-Ulip3/CRMP1 antibodies or 4, 8, or 20 µg/ml
of IgG purified from anti-Ulip2/CRMP2 antisera and preimmune sera).
Incubation with the different anti-Ulip/CRMP antibodies at 8 µg/ml
was also performed without Sema3A. We added the antibodies to the
culture medium because the oligodendrocytes internalize IgG (see
below), as described for other neural cells (Fishman et al., 1990 ,
1991 ; Greenlee et al., 1993 ). The cultures were then fixed in 4%
paraformaldehyde and analyzed. They were first immunostained using the
Rip monoclonal antibody and microphotographed using a 40× objective
(Zeiss). Processes were quantified on the photographs using a grid
composed of concentric circles separated by 10 µm and centered on the
cell body (see Fig. 9). The number of intersections between the circles and processes was counted for each cell, defining a branching index
(BI); 20 cells were counted in each test sample to determine the mean
BI. The results were confirmed in at least two independent experiments.
Effects of treatments were quantified using the percentage extension
compared with that under control conditions calculated as [(BI in
control medium BI in Sema3A medium)/BI in control medium] × 100. The statistical significance of the results was evaluated using
the unpaired Student's t test.
Oligodendrocyte viability assay. Viability of the
oligodendrocytes cultured for 48 hr with or without Sema3A was
estimated by propidium iodide and trypan blue staining. Cells adhering
on the glass coverslides or recovered in the culture medium were quantified.
Antibody penetration in living oligodendrocytes. Highly
purified oligodendrocytes, grown for 48 hr in BS medium, were incubated for 1 hr with rabbit anti-Ulip2/CRMP2 or anti-Ulip6/CRMP5 IgG (30 µg/ml) either at 37°C or at 4°C for control. Cells were then washed twice in PBS and fixed for 20 min in 4% paraformaldehyde. After
two washes in PBS, cells were incubated for 10 min in PBS containing
0.2% gelatin and 0.1% Triton X-100 and then with Alexa 488-conjugated
anti-rabbit IgG (Molecular Probes, Interchim, Montluçon, France)
for 45 min. Rabbit IgGs were clearly detected in the cytoplasm of 70%
of the oligodendocytes when antibody incubation was performed at 37°C
(see Fig. 10E). No labeling was observed when
antibodies were incubated at 4°C (see Fig. 10G),
indicating that IgG penetration in living oligodendrocytes is a
physiologic mechanism.
All animal experiments were performed in accordance with French legal
requirements (decree 87-848) and with the European Community Council
Directive of November 24, 1986 (86/609/EEC).
 |
RESULTS |
Molecular characterization and tissue distribution of
human Ulip6/CRMP5
A human spinal cord cDNA library was screened using an anti-CV2
serum from a patient with PND and small-cell lung carcinoma that
recognized a 66 kDa protein on Western blots of newborn rat brain
protein extracts, but did not recognize any of the four previously
known Ulip/CRMP recombinant proteins. This led to the identification of
one partial-length clone (C97) containing a 1.6 kb cDNA insert yielding
a 90 amino acid open reading frame that showed 35% homology with the
C-terminal region of the four known human Ulip/CRMP proteins. The cDNA
containing the full-length coding region was obtained by screening the
same library with a radioactive probe corresponding to the coding
region of C97 (270 bp). A 2 kb cDNA, referred to as Ulip6/CRMP5, which
contains an open reading frame coding for 564 amino acids, was
isolated. The C-terminal region of this protein was identical to the 90 amino acids encoded by C97. On Western blots, the Ulip6/CRMP5 recombinant protein was recognized by all 20 anti-CV2 sera tested (Fig.
1C) but not by 100 sera from
patients without PND (half of them having small-cell lung carcinoma),
suggesting that Ulip6/CRMP5 was the major antigen recognized by
anti-CV2 antibodies. The overall sequence of the Ulip6/CRMP5 cDNA
(GenBank accession number AF 264015) consists of 3074 bp made up of a
162 bp 5'-noncoding region, a 1692 bp protein coding region, and a 1220 bp 3'-noncoding region. The initiation codon was assigned to the Met
codon at position 163-165. The deduced protein sequence predicted a
protein with a molecular mass of 61.424 kDa and an isoelectric point of
7.46.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 1.
Ulip6/CRMP5 mRNA and protein expression and
specificities of anti-CV2, anti-Ulip6/CRMP5, anti-Ulip2/CRMP2, and
anti-Ulip3/CRMP1 antibodies. A, Northern blot of adult
human tissue showing specific expression of Ulip6/CRMP5 mRNA in the
brain (5.5 kb) (pbl, peripheral blood
leukocytes). B, Western blot showing Ulip6/CRMP5 protein
expression in cerebellum extracts (cerebellum) with a
maximal expression at E19, lower at P5, and weak in the adult
(Ad). In 1-d-old rat tissue extract (P1),
Ulip6/CRMP5 protein is expressed at a high level in brain and at a
lower level in muscle. In adult rat tissue extracts
(Adult), Ulip6/CRMP5 is found in brain and testis.
C, Western blot with Ulip6/CRMP5 recombinant protein
showing that anti-CV2 sera from 12 PND patients recognized this protein
(lanes 1-12). Lane 13 shows the lack of
binding of a representative control serum. D, Western
blot showing specific binding of anti-Ulip6/CRMP5, anti-Ulip2/CRMP2, or
anti-Ulip3/CRMP1 antibodies to the corresponding Ulip/CRMP recombinant
protein. Rat brain extract (rat brain) was used as a
positive control for Ulip2/CRMP2, Ulip6/CRMP5, and Ulip3/CRMP1
expression in brain. U1/C4, Ulip1/CRMP4;
U2/C2, Ulip2/CRMP2; U3/C1, Ulip3/CRMP1;
U4/C3, Ulip4/CRMP3; U6/C5,
Ulip6/CRMP5.
|
|
Alignment of the sequence of the Ulip6/CRMP5 protein with those for the
four known human Ulip/CRMP proteins showed 48-50% identity.
Ulip6/CRMP5 and the other members of the family share the same degree
of identity (~33%) with the Caenorhabditis elegans gene
product, unc-33 (Byk et al., 1998 ), a gene required for neurite outgrowth and axonal guidance (Li et al., 1992 ). The Ulip6/CRMP5 sequence contains consensus sites for several protein kinases, such as
casein kinase II (eight sites), tyrosine kinase (two sites), protein
kinase A (one site), and protein kinase C (eight sites). Alignment of
the sequence of the human Ulip6/CRMP5 protein with those of rat CRAM
(GenBank accession number AB029432) and mouse CRMP5 (GenBank accession
number AF249295) showed 97% identity, and comparison of the cDNA
sequences showed >80% identity.
Northern blot analysis using a Ulip6/CRMP5 RNA probe identified a 5.5 kb band in human brain mRNA, whereas mRNAs prepared from various adult
human peripheral tissues gave no hybridization signal (Fig.
1A), indicating preferential expression of
Ulip6/CRMP5 mRNA in neural tissue. Expression of Ulip6/CRMP5 protein
was analyzed by Western blotting using a rabbit polyclonal antiserum
that, as shown in Figure 1D, recognized the
Ulip6/CRMP5 recombinant protein but not the other four Ulip/CRMPs. As
for the other Ulip/CRMPs (Hamajima et al., 1996 ; Wang and Strittmatter,
1996 ; Byk et al., 1998 ), Ulip6/CRMP5 protein was highly expressed in
the embryonic brain and showed a dramatic downregulation during
ontogenesis, as illustrated in the cerebellum (Fig.
1B). During development, Ulip6/CRMP5 was detected
mainly in brain and lightly in muscle (Fig. 1B, P1). In
adult rat tissue extracts, expression of Ulip6/CRMP5 was seen in brain
and, at a lower level, in testis but not in muscle (Fig.
1B).
Distribution of Ulip6/CRMP5 in the developing and adult
rat brain
To investigate the function of Ulip6/CRMP5, we determined the
distribution pattern of the mRNA and protein using in situ
hybridization or immunohistochemistry, respectively, on sections of E16
and E19 rat embryo and postnatal rat brain (P5, P15, and adult). Sense probes and preimmune serum, used as controls, gave no signal (data not
shown). Ulip6/CRMP5 mRNA and protein were found to be highly expressed
in the embryonic (E16 and E19) and postnatal (P5 and P15) brain and
downregulated in the adult. The distribution of the protein was studied
using anti-Ulip6/CRMP5 antibodies, which specifically recognized
recombinant Ulip6/CRMP5 protein (Fig. 1D). The
results are summarized in Table 1 and
described in detail below. The observed distribution was identical to
that described previously with anti-CV2 sera (Honnorat et al., 1996 ,
1998 , 1999 ). In addition, the distribution of Ulip6/CRMP5 mRNA and
protein in the adult brain was similar to that described for
Ulip2/CRMP2 (Ricard et al., 2000 ), so Ulip6/CRMP5 and Ulip2/CRMP2
expression patterns were compared in detail in embryonic and postnatal
rat brain.
Distribution of Ulip6/CRMP5 mRNA and protein in the
developing brain
In the embryo and during the first postnatal days (P5),
immunolabeling and in situ hybridization gave globally
similar results (Fig. 2), indicating
expression of Ulip6/CRMP5 protein in cells expressing mRNAs. All
ventricular regions, such as in the cortex (Fig.
2A,B) and spinal cord (Fig.
2C,D), in which mitosis occurs were always
negative, suggesting that expression of Ulip6/CRMP5 mRNA and protein
was restricted to postmitotic neural cells. At E16, E19, P5, and P15,
Ulip6/CRMP5 expression was prominent in the neocortex, hippocampus, and
spinal cord (Fig. 2, Table 1) and was also seen in the retina,
hypothalamus, thalamus, midbrain, cerebellum, olfactory epithelium,
olfactory bulb, and dorsal root ganglia (Table 1). Several neuronal
fibers, such as those in the fimbria (Fig. 2B),
spinal tracts, or peripheral nerves (Fig. 2D) were
also immunostained. The intensity of labeling of cell bodies and fibers
decreased during the first 2 weeks after birth.

View larger version (163K):
[in this window]
[in a new window]
|
Figure 2.
Expression of Ulip6/CRMP5 mRNA and protein in the
embryonic rat brain. Sagittal sections (14 µm) of E19 dorsal
telencephalon (A, B) or frontal sections
(14 µm) of E16 spinal cord (C, D) were
hybridized with the Ulip6/CRMP5 ripobrobe (A,
C) or immunolabeled with anti-Ulip6/CRMP5 antibodies
(B, D). Expression of Ulip6/CRMP5 mRNA
(A, C) or protein (B,
D) was never detected in the neuroepithelium zone of the
cerebral neocortex and spinal cord (large asterisk).
Ulip6/CRMP5 mRNA and protein were highly expressed in the
differentiating field of the neocortex (nc), hippocampus
(hc) (A,
B), spinal cord (sc), and dorsal root
ganglia (drg) (C, D).
Ulip6/CRMP5 protein was especially strongly expressed in the
hippocampal fimbria (arrowhead)
(B), spinal tracts, and peripheral
nerves (arrows) (D). No Ulip6/CRMP5 mRNA
or protein was detected in the basal ganglia (bg)
(A, B). Scale bar, 330 µm.
|
|
Temporal expression of Ulip6/CRMP5 and Ulip2/CRMP2 was compared in the
developing cerebellum, chosen as a model structure characterized by
postnatal directional migration, differentiation, and synaptogenesis
with precise spatiotemporal order of positioning (Altman, 1972a ,b ,c ).
At E19, Ulip6/CRMP5 mRNA and protein were expressed in all cerebellar
layers, except the external granular layer (EGL) in which mitosis
occurs (Figs. 3A,
4A), whereas Ulip2/CRMP2 mRNA and protein were highly
expressed in the EGL and to a lesser extent in the inner part of the
cerebellum (Figs. 3D, 4B). At P5 and P15,
Ulip6/CRMP5 was not expressed in the external part of the EGL but was
expressed in the internal part (Figs. 3B, 4C) in
which future granular neurons start migrating toward the internal granular layer (IGL), suggesting that Ulip6/CRMP5 is expressed by
postmitotic granular neurons that are starting to migrate. At these
stages, the neural progenitors in the external part of the EGL
expressed high levels of Ulip2/CRMP2 but not Ulip6/CRMP5 (Figs.
3E, 4D). Double-labeling showed that in
the internal part of the EGL, Ulip2/CRMP2 and Ulip6/CRMP5 proteins were
coexpressed in granular neurons (Fig.
4C,D,
insets). At P15, Ulip6/CRMP5 mRNA and protein were also
expressed by granular neurons in the IGL, but not by Purkinje cells
(Figs. 3B, 4C), whereas Ulip2/CRMP2 mRNA and
protein were highly expressed in Purkinje cells, but only weakly
detectable in the granular neurons of the IGL (Figs. 3E,
4D). At P15, Ulip2/CRMP2 and Ulip6/CRMP5 proteins
were both highly expressed in growing fibers of the molecular layer and white matter (Fig. 4C,D).

View larger version (179K):
[in this window]
[in a new window]
|
Figure 3.
Expression of Ulip6/CRMP5 and Ulip2/CRMP2
mRNAs in the developing rat cerebellum. Sagittal sections (14 µm) of
E19 (A, D), P15 (B,
E), and adult (C,
F) rat cerebellum were hybridized with the
Ulip6/CRMP5 (A-C) or Ulip2/CRMP2
(D-F) riboprobes. At E19,
Ulip6/CRMP5 (A) and Ulip2/CRMP2
(D) mRNAs were detected in the migrating cells
under the EGL (white arrows) and in the deep nuclei
(white arrowhead). Only Ulip2/CRMP2 mRNA
(D) was expressed in the EGL
(egl). At P15, both Ulip6/CRMP5
(B) and Ulip2/CRMP2 (E)
mRNAs were expressed in the internal part of the EGL (white
arrowhead). Expression of Ulip6/CRMP5 mRNA and to a lesser
extent Ulip2/CRMP2 mRNA was seen in the molecular layer
(ml) and IGL (igl). Only
Ulip2/CRMP2 mRNA was detected in the external part of the EGL
(thin black arrow), the Purkinje cells layer
(pl), and oligodendrocytes of the white
matter (thick black arrow). In the adult cerebellum,
expression of Ulip6/CRMP5 mRNA (C) was detected
in the Purkinje cells layer (pl),
oligodendrocytes of the white matter (wm, black
arrow), and to a lesser extent in the molecular layer
(ml) and internal granular layer
(igl). Ulip2/CRMP2 mRNA (F)
was still expressed in the Purkinje cell layer
(pl), oligodendrocytes of the white matter
(wm, black arrow), and to a lesser extent
in the molecular layer (ml) and internal granular
layer (igl). Scale bar: A,
D, C, F, 120 µm;
B, E, 90 µm.
|
|

View larger version (203K):
[in this window]
[in a new window]
|
Figure 4.
Expression of Ulip6/CRMP5 and Ulip2/CRMP2 proteins
in the developing rat cerebellum. Sagittal sections (14 µm) of E19
(A, B), P15 (C,
D), or adult (E, F)
rat cerebellum were immunolabeled with anti-Ulip6/CRMP5
(A, C, E) or
anti-Ulip2/CRMP2 (B, D,
F) antibodies. At E19, Ulip6/CRMP5 protein
(A) was expressed in all layers of the cerebellum
except the EGL (egl), whereas Ulip2/CRMP2 protein
(B) was detected in the EGL
(egl) and to a lesser extent in the region under
the EGL (arrows). At P15, only Ulip2/CRMP2 protein
(D) was detected in the external part of the EGL
(thin arrow) and in the Purkinje cell layer
(pl), whereas both Ulip6/CRMP5
(C) and Ulip2/CRMP2 (D)
proteins were expressed in the internal part of the EGL
(arrowhead) and in the molecular layer
(ml). Double labeling showed coexpression of
Ulip6/CRMP5 (C) and Ulip2/CRMP2
(D) in neural precursors of the internal EGL
(inset, arrow). Ulip6/CRMP5 protein
(C) and to a lesser extent Ulip2/CRMP2 protein
(D) were detected in the IGL
(igl) and the white matter (thick
arrow). In the adult cerebellum, expression of Ulip6/CRMP5
(E) and Ulip2/CRMP2 (F)
proteins was detected only in the oligodendrocytes of the white matter
(wm, arrow). Scale bar: A,
B, 180 µm; C, D, 90 µm; C, D, inset, 15 µm; E, F, 40 µm.
|
|
Distribution of Ulip6/CRMP5 mRNA and protein in the
adult brain
Between P20 and the adult, the pattern of expression of
Ulip6/CRMP5 was constant. In the adult brain, neurons expressing
Ulip6/CRMP5 were identified by their anatomical localization, size, and
shape. Ulip6/CRMP5 mRNA and protein were expressed in migrating neurons in the rostral migratory stream of the olfactive bulb, scarce neurons
throughout the neocortex (Fig.
5A,B),
and granular neurons in the juxta-hilar portion of the granular cell
layer of the hippocampus (Fig. 5C,D). Moreover,
low expression of Ulip6/CRMP5 mRNA in the absence of detectable protein
was seen in a few neurons, namely the molecular and granular neurons of
the IGL and a few Purkinje cells in the cerebellum (Figs.
3C, 4E). Similarly, Ulip2/CRMP2 mRNA was
expressed in Purkinje cells and to a lesser extent in molecular and
granular neurons of the IGL (Fig. 3F), despite the absence of detectable Ulip2/CRMP2 protein in these neurons (Fig. 4F). The presence of Ulip6/CRMP5 and/or Ulip2/CRMP2
mRNAs in some neurons in the absence of detectable protein indicates
either rapid turnover of the protein or translational or
post-translational regulation of the protein. Phosphorylation,
glycosylation, or association of Ulip6/CRMP5 and Ulip2/CRMP2 with other
proteins (Bulliard et al., 1997 ; Wang and Strittmatter, 1997 ; Inatome
et al., 2000 ) could limit the recognition of the protein by the
antibodies.

View larger version (177K):
[in this window]
[in a new window]
|
Figure 5.
Expression of Ulip6/CRMP5 mRNA and protein in
adult rat brain. Sagittal sections (14 µm) of the frontal cortex
(A, B), hippocampus (C,
D), or spinal cord (E,
F) were hybridized with the Ulip6/CRMP5 riboprobe
(A, C, E) or immunolabeled
with anti-Ulip6/CRMP5 antibodies (B, D,
F). Both mRNA (A,
C) and protein (B, D) were
expressed in some neurons of the frontal cortex (A,
B) and hippocampus (C, D),
especially in the infragranular layer (arrow). Both mRNA
(E) and protein (F) were
also expressed in oligodendrocytes of the spinal cord
(arrowhead). Scale bar: A,
60 µm; B, 30 µm; C, 310 µm;
D, 50 µm; E, 40 µm; F,
25 µm.
|
|
In the adult brain, the strongest Ulip6/CRMP5 mRNA and protein
expression was seen in oligodendrocytes of the myelinated tracts of the
spinal cord, hindbrain, midbrain, and cerebellum (Figs. 3C,
4E, 5E,F).
Ulip6/CRMP5 mRNA and protein were detected in small cells distributed
in rows in the myelinated tracts and double labeled with the
oligodendrocyte-specific Rip monoclonal antibody (data not shown), as
described previously using anti-CV2 sera (Honnorat et al., 1996 , 1998 ).
Ulip6/CRMP5-expressing oligodendrocytes were detected according to an
increasing rostral to caudal gradient, starting in the anterior part of
the basal cerebral peduncle. In the brainstem, the highest number of
Ulip6/CRMP5-positive oligodendrocytes was found in the cerebellar
peduncles (Fig. 6A),
the spinal tract of the trigeminal nerve, the tractus pyramidalis, and
the ventrospinocerebellar tract. Within the nerve tracts, immunostained
cells were widespread and bore thin stained processes clinging to the
myelin sheath (Figs. 5F, 6A). The spinal
cord contained the greatest number of immunostained cells (Fig.
5F). All along the spinal cord, many Ulip6/CRMP5-positive oligodendrocytes were seen in all the tracts of
the white matter, except in the ventral part of the dorsal corticospinal tract (Fig. 6C), whereas no labeling was seen
in the gray matter. These immunostained cells defined a subset of oligodendrocytes that are estimated, using anti-CV2 sera, to account for one-third of spinal cord oligodendrocytes, with a rostrocaudal gradient (Honnorat et al., 1998 ). Ulip6/CRMP5-positive oligodendrocytes were rarely found in the forebrain: the gray matter or myelinated fiber
tracts, such as the corpus callosum or anterior commissure. Similarly,
Ulip2/CRMP2 has been shown to be expressed by a subpopulation of
oligodendrocytes in adult brain (Ricard et al., 2000 ). In spinal cord
and hindbrain and midbrain white matter, all oligodendrocytes stained
by anti-Ulip6/CRMP5 antibodies were double stained by anti-Ulip2/CRMP2
antibodies, demonstrating that these two Ulip/CRMP proteins were
coexpressed by certain oligodendrocytes (Fig.
6A,B). Interestingly, some
Ulip2/CRMP2-expressing oligodendrocytes in the midbrain (Fig.
6B) and spinal cord, i.e., the ventral part of the
dorsal corticospinal tracts (Fig. 6D), did not
express Ulip6/CRMP5 (Fig. 6A,C).
Because Ulip2/CRMP2 protein is expressed by only 40% of spinal cord
oligodendrocytes (Ricard et al., 2000 ), three different subsets of
oligodendrocytes can be distinguished in the spinal cord: one
expressing both Ulip6/CRMP5 and Ulip2/CRMP2, another expressing only
Ulip2/CRMP2, and a third expressing neither. On the other hand, it is
noteworthy that, during ontogenesis, Ulip2/CRMP2 was detectable in
oligodendrocytes at P15, whereas the earliest Ulip6/CRMP5-expressing
oligodendrocytes appeared at P18 (Fig.
3B,E).

View larger version (152K):
[in this window]
[in a new window]
|
Figure 6.
Expression of Ulip6/CRMP5 and Ulip2/CRMP2 mRNAs
and proteins in oligodendrocytes. Sections (14 µm) of adult rat
cerebellar peduncles were immunolabeled with both rabbit
anti-Ulip6/CRMP5 antibodies (A) and rat
anti-Ulip2/CRMP2 antibodies (B). All
oligodendrocytes labeled by anti-Ulip6/CRMP5 antibodies expressed
Ulip2/CRMP2 protein (arrow). A few oligodendrocytes
expressing Ulip2/CRMP2 protein were negative for Ulip6/CRMP5 protein
(arrowhead). Frontal sections (14 µm) of adult rat
spinal cord were hybridized with the Ulip6/CRMP5
(C) or Ulip2/CRMP2 (D)
riboprobes. Oligodendrocytes of the internal part of corticospinal
tract expressing Ulip2/CRMP2 mRNA were negative for Ulip6/CRMP5 mRNA
(arrows). Scale bar: A, B,
30 µm; C, D, 200 µm.
|
|
Inhibition of oligodendrocyte process extension by Sema3A:
involvement of Ulip6/CRMP5 and Ulip2/CRMP2
To investigate the role of Ulip6/CRMP5 and Ulip2/CRMP2 in
oligodendrocytes, we used highly purified adult rat brain
oligodendrocytes, previously shown to express Ulip2/CRMP2 protein
(Ricard et al., 2000 ) and shown, in the present study, to express
Ulip6/CRMP5 protein (see Fig.
8A,B).
Because the cultured oligodendrocytes had been shown to have Sema3A
binding sites (Fig.
7A-D) and to
express the neuropilin-1 receptor sites (Fig.
7E-H), we examined their response to
soluble Sema3A by incubating them for 24, 48, or 72 hr with or without Sema3A-conditioned medium. When cultured in the control medium, the
cells displayed the morphological characteristics of oligodendrocytes, having round or ovoid cell bodies with a radiating array of thin tapering and branching processes, and expressing the oligodendrocyte marker, Rip (Fig. 8C); under
these conditions, the oligodendrocytes could survive up to 20 d in
culture. After 48 hr incubation in a Sema3A-conditioned medium, the
oligodendrocytes showed significant loss of processes (Fig.
8D) compared with controls. Removal of Sema3A-conditioned medium led to oligodendrocyte process regrowth (Fig.
8E). To quantify oligodendrocyte arborization, we
used a grid of concentric circles (Fig.
9) to define a BI (see Material and Methods). Freshly isolated purified oligodendrocytes initially had
a mean BI close to zero (data not shown), then started to spontaneously
send out processes with the time course shown in Figure
10A
(control), with a maximal mean BI of 21.5 at 72 hr of culture. In Sema3A-conditioned medium, the BI decreased by 72% at 24 hr, 81% at 48 hr, and 88% at 72 hr compared with controls (p < 0.0001) (Fig. 10A). The
Sema3A dose-response curve, determined using a range of dilutions of
Sema3A-conditioned medium (undiluted to 1:100) diluted in control
medium (Fig. 10B), showed a sigmoid shape consistent
with a specific biologic effect. The half-effect, corresponding to a BI
reduction of 50% (p < 0.005), was obtained at
a 1:20 dilution (25 ng/ml of Sema3A) (Bagnard et al., 1998 ). When
Sema3A-conditioned medium was added to oligodendrocytes grown 24 hr in
control medium and displaying processes (mean BI of 12.2), no process
alteration was observed at 2, 4, or 6 hr, but retraction of process
extension was seen after 24 hr and was still observed after 48 hr (mean
BI of 3.8) (Fig. 10I). The Sema3A effect was totally
reversed after removal of the Sema3A-conditioned medium and 72 hr
incubation in control medium, the mean BI increasing to 20.8 (Fig.
10I). It is noteworthy that oligodendrocytes cultured in Sema3A-conditioned medium expressed Rip, a marker of late stages of
oligodendrocytic differentiation (Friedman et al., 1989 ) (Fig. 8D).

View larger version (97K):
[in this window]
[in a new window]
|
Figure 7.
Sema3A binding and neuropilin-1 mRNA expression in
purified adult rat brain oligodendrocytes. A,
B, AP-Sema3A binding sites visualized on
oligodendrocytes using AP staining solution (A)
and labeling with Rip antibody (B).
C, D, AP-Sema3A binding was blocked by an
excess of Sema3A on purified oligodendrocytes (C)
immunolabeled with Rip antibody (D).
E, F, Expression of neuropilin-1 mRNA on
oligodendrocytes by in situ hybridization with antisense
probe (E) and labeled with Rip antibody
(F). G, H,
In situ hybridization using the neuropilin-1 sense probe
showed absence of signal (G) on oligodendrocytes
immunolabeled with Rip antibody (H). Scale
bar, 24 µm.
|
|

View larger version (91K):
[in this window]
[in a new window]
|
Figure 8.
Sema3A inhibition of process extension by
Ulip6/CRMP5-expressing adult rat brain oligodendrocytes.
A, B, Immunolabeling of Ulip6/CRMP5
protein on oligodendrocytes (A) double labeled
with Rip antibody (B). C, Purified
oligodendrocytes grown 48 hr in control medium, showing process
extension, immunolabeled with Rip antibody. D,
Oligodendrocytes cultured 48 hr in a Sema3A-conditioned medium, showing
a decrease of process extension, immunolabeled with Rip antibody.
E, Oligodendrocytes immunolabeled with Rip antibody
treated with Sema3A-conditioned medium as in D,
followed by removal of the Sema3A-conditioned medium and incubation for
72 hr in control medium showing restoration of process extension. Scale
bar, A, B, 40 µm;
C-E, 30 µm.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
Figure 9.
Quantitative evaluation of oligodendrocyte process
extension. Concentric circles separated by 10 µm were drawn around
the cell bodies of the microphotographed oligodendrocytes.
Intersections of the oligodendrocyte processes with the concentric
circles were counted to define a BI.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
Figure 10.
Quantitative effect of Sema3A on
purified adult rat brain oligodendrocytes. A, Time
course of the Sema3A effect on the oligodendrocyte branching index
(B.I). The cells were incubated for 24, 48, and 72 hr
with Sema3A-conditioned medium (Sema3A) or control
medium (control), and the branching index was
compared (*p < 0.0001). B,
Dose-response curve for the effect of Sema3A on the branching index.
Oligodendrocytes were cultured for 48 hr in control medium
(0) or different dilutions of Sema3A-conditioned
medium in control medium (100 and 1% represent, respectively,
undiluted and a 1:100 dilution of Sema3A-conditioned medium).
C, Effect of VEGF-165 or anti-neuropilin-1 antibodies on
the branching index (B.I) of purified oligodendrocytes
cultured in the presence of Sema3A. Cells were incubated with a 1:5
dilution of Sema3A-conditioned medium in control medium in the presence
of VEGF-165 (+VEGF) or anti-neuropilin-1 antibodies
(+anti-neurop) and with control medium
(control) (*p < 0.001).
D, Effect of anti-Ulip2/CRMP2 and anti-Ulip6/CRMP5
antibodies on the branching index (B.I) of purified
oligodendrocytes cultured in the presence of Sema3A. Purified
oligodendrocytes were cultured in Sema3A-conditioned medium in the
presence of anti-Ulip2/CRMP2 (anti-U2/C2,
4, 8, or 20
µg/ml), anti-Ulip6/CRMP5 (anti-U6/C5,
2, 4, or 8
µg/ml), or anti-Ulip3/CRMP1
(anti-U3/C1, 8 µg/ml) antibodies
or preimmune IgG (8 µg/ml) to block the Sema3A effect. Penetration of
antibodies in living oligodendrocytes was illustrated for
anti-Ulip2/CRMP2, after 1 hr incubation with the antibodies at 37°C
(E) or at 4°C (G)
(F and H show the oligodendrocytes in
Nomarski microscope). The antibodies were revealed after fixation
by immunofluorescent anti-rabbit IgG. I, Effect of
removal of Sema3A-conditioned medium on the branching index
(B.I) of purified oligodendrocytes cultured 48 hr in
Sema3A. Purified oligodendrocytes were cultured 24 hr in BS
(Sem-, D0) and were put into presence of
undiluted Sema3A-conditioned medium (Sem+) during 48 hr
(D2). The Sema3A-conditioned medium was then removed,
and oligodendrocytes were cultured for 72 hr in control medium
(Sem-, D5). The data are the mean ± SD (bars) values for 20 cells in each case. The
branching index for each condition was compared with the branching
index obtained in the presence of Sema3A alone (*p < 0.001).
|
|
Because it has been shown that Sema3A can induce apoptosis on
developing or mature neurons (Shirvan et al., 1999 ; Bagnard et al.,
2001 ), oligodendrocyte apoptosis was studied using propidium iodide
staining. By this method, we failed to detect any apoptotic cell.
Because oligodendrocytes seemed less numerous when cultured in
Sema3A-conditioned medium than in control medium, we quantified both
adherent and nonadherent cells. In Sema3A-conditioned medium, 22% of
the cells were recovered in the culture medium, versus 6% in control
medium (p < 0.01). By trypan blue staining, we
noted no significant difference in cell death among these detached
cells in Sema3A-conditioned medium (61%) versus control medium (44%). This decrease of adherent cells could be attributable to poorer adhesion of the Sema3A-treated oligodendrocytes caused by the absence
of process arborization.
The effect of Sema3A signal on oligodendrocyte process extension was
further investigated by blocking neuropilin-1 using antibodies directed
against the MAM part of the receptor (Chen et al., 1998 ), which have
been used successfully to block the effect of Sema3A on neurons
(Bagnard et al., 2001 ). After 48 hr incubation in Sema3A-conditioned medium in the presence of anti-neuropilin-1 antibodies (4 µg/ml), the
oligodendrocytes displayed a BI reduction of 25% compared with a
reduction of 81% in the absence of antibodies
(p < 0.001) (Fig. 10C). Furthermore,
when VEGF-165, which has been proposed to antagonize Sema3A binding to
neuropilin-1 (Miao et al., 1999 ), was added to Sema3A-conditioned
medium at a concentration of 50 ng/ml, the BI was reduced by only 40%
compared with 81% in the absence of VEGF-165 (p < 0.001) (Fig. 10C). These results indicated that the
effect of Sema3A on oligodendrocytes was mediated by neuropilin-1.
To assess the role of Ulip2/CRMP2 and Ulip6/CRMP5 in transducing the
Sema3A-induced inhibition of oligodendrocyte process extension, we used
anti-Ulip2/CRMP2 antibodies to block Ulip2/CRMP2, as described by
Goshima et al. (1995) , and anti-Ulip6/CRMP5 or anti-CV2 antibodies to
block Ulip6/CRMP5. After 48 hr incubation in Sema3A medium containing
anti-Ulip2/CRMP2 antibodies at different concentrations (4, 8, and 20 µg/ml), a dose-dependent increase in the mean BI (BI = 21.2 at 8 µg/ml) was seen compared with oligodendrocytes grown in
Sema3A-conditioned medium in the absence of antibodies (BI = 5;
p < 0.001) (Fig. 10D). A significant
block of the Sema3A effect on oligodendrocyte process extension was
also seen using anti-Ulip6/CRMP5 antibodies (2, 4, and 8 µg/ml) (Fig.
10D) and anti-CV2 antibodies (data not shown). In
contrast, anti-Ulip3/CRMP1 antibodies, recognizing specifically the
Ulip3/CRMP1 protein (Fig. 1D), which is not expressed
by oligodendrocytes, failed to block the Sema3A effect on
oligodendrocyte process extension (Fig. 10D). In
addition, oligodendrocytes cultured for 48 hr with anti-Ulip2/CRMP2 or
anti-Ulip6/CRMP5 or anti-Ulip3/CRMP1 antibodies in control medium
without Sema3A showed no morphological change. These results indicated
that Ulip2/CRMP2 and Ulip6/CRMP5 mediate the Sema3A effect on
oligodendrocyte process extension.
 |
DISCUSSION |
The four previously described Ulip/CRMPs are highly expressed in
the developing brain and are still expressed in the adult in some
neurons (Minturn et al., 1995 ; Hamajima et al., 1996 ; Wang and
Strittmatter, 1996 ; Byk et al., 1998 ) and oligodendrocytes (Kamata et
al., 1998 ; Nacher et al., 2000 ; Ricard et al., 2000 ). During the course
of this manuscript preparation, a fifth member with 50% homology with
other Ulip/CRMPs was described in rat (CRAM) (Inatome et al., 2000 ) and
mouse (CRMP5) (Fukada et al., 2000 ) brain. CRAM was discovered when
antibodies against Zap-70, a Syk tyrosine kinase essential for T
lymphocyte function, were found to cross-react with a protein kinase
interacting with CRAM, and CRMP5 was discovered while studying
molecules involved in regional specificity of the retina. Identifying
an antigenic target in PND, we have cloned the fifth human Ulip/CRMP,
characterized its cellular and anatomical distribution compared with
Ulip2/CRMP2, and demonstrated its potential role in mediating the
inhibitory effect of Sema3A on process extension of adult brain oligodendrocytes.
Molecular and cellular characterization of Ulip6/CRMP5
PNDs are characterized by autoimmune neuronal degeneration
developing in patients with systemic cancer (Posner, 1997 ). Several autoantibodies associated with PND are directed against various nervous
system antigens, including a group of proteins with potential roles in
the signal transduction pathway (Darnell, 1996 ). The discovery of
anti-CV2 autoantibodies allowed us to identify Ulip/CRMP proteins as
potential targets for these autoantibodies (Honnorat et al., 1999 ).
Serum from one patient with anti-CV2 autoantibodies that did not
recognize the already known 4 Ulip/CRMP proteins allowed us to clone
the fifth human Ulip/CRMP, referred to as Ulip6/CRMP5. The recombinant
Ulip6/CRMP5 protein was recognized by all anti-CV2 sera tested, and the
distribution of Ulip6/CRMP5 in the developing and adult brain,
demonstrated using specific antibodies, was identical to that seen
using anti-CV2 sera (Honnorat et al., 1998 ), indicating that this
protein is probably the main antigen for these autoantibodies.
Ulip6/CRMP5 is 97% homologous to CRAM and CRMP5 and represents the
human counterpart of these rat and mouse proteins.
Ulip6/CRMP5 mRNA was found exclusively in brain, but the protein was
also transiently detected in neonatal muscle, suggesting that it may be
transiently expressed during onset of innervation at the neuromuscular
junction, as described for Ulip1/CRMP4 (Byk et al., 1996 ). Expression
of this protein in adult testis might also be related to the detection
of Ulip1/CRMP4 in postmeiotic germ cells (Taketo et al., 1997 ; Kato et
al., 1998 ).
In the brain, Ulip6/CRMP5 was highly expressed during development by
almost all postmitotic neural precursors and by fasciculi of fibers of
the white matter, suggesting a role in neuronal migration and axonal
growth. The continued expression of Ulip6/CRMP5 in the adult brain, as
seen with the other Ulip/CRMPs, in areas that retain postnatal
neurogenesis (dentate granular layer, olfactory bulb, and rostral
migratory stream), confirms the role of this member in neuronal
migration/differentiation. Ulip6/CRMP5 mRNA was also detected in
neurons of the hypothalamus, thalamus, cortex, amygdala, brainstem, and
cerebellum. Because the protein was detected only in a few neurons in
the cortex and amygdala, the neuronal expression of Ulip6/CRMP5 protein
might be transient and required for synaptic plasticity.
In the adult brain, the most intense Ulip6/CRMP5 mRNA and protein
expression was seen in oligodendrocytes in the pons, cerebellum, and
spinal cord, a distribution similar to that seen for Ulip2/CRMP2 (Ricard et al., 2000 ), suggesting the coexpression of these proteins. Our demonstration, by double labeling, of the coexpression of these two
Ulip/CRMPs in a subpopulation of oligodendrocytes corroborates previous
reports of specific interactions between Ulip/CRMP isoforms (Wang and
Strittmatter, 1997 ; Fukada et al., 2000 ; Inatome et al., 2000 ).
Expression of Ulip1/CRMP4 protein has also been described in adult
brain oligodendrocytes (Nacher et al., 2000 ). However, we have been
unable to detect oligodendrocytic expression of this member by either
in situ hybridization (Ricard et al., 2000 ) or immunohistochemistry with antibodies recognizing specifically recombinant Ulip1/CRMP4 (E. Charrier, unpublished data).
Interestingly, some Ulip2/CRMP2-positive oligodendrocytes, namely in
the corticospinal tracts, did not express detectable levels of
Ulip6/CRMP5, demonstrating the presence of subsets of
oligodendrocytes differing in terms of Ulip/CRMP expressions. The
presence of Ulip6/CRMP5and Ulip2/CRMP2 in oligodendrocytes might be
related to different functions of these cells, depending on their
localization or degree of maturation. In fact, some
Ulip/CRMP-expressing cells might be oligodendrocyte progenitors,
retaining the capacity of migration/differentiation in adult brain
(Zhang et al., 1999 ). However, differentiated oligodendrocytes expressed Ulip6/CRMP5, because loops around axons belonging to myelinating oligodendrocytes were labeled by anti-Ulip6/CRMP5 antibodies.
Interestingly, similar coexpression or lack of coexpression of
Ulip2/CRMP2 and Ulip6/CRMP5 was seen during development. In the
cerebellum, only Ulip2/CRMP2 was highly expressed in the external part
of EGL containing the mitotic neural precursors, whereas both
Ulip2/CRMP2 and Ulip6/CRMP5 were expressed in the internal part of the
EGL, which contains the postmitotic migrating neuronal precursors.
After migration, neuronal precursors in the IGL showed high expression
of Ulip6/CRMP5 but low expression of Ulip2/CRMP2. In addition, during
brain development, Ulip2/CRMP2 was expressed before Ulip6/CRMP5 in
oligodendrocytes. Taken together, these results indicate that
Ulip2/CRMP2 and Ulip6/CRMP5 either may have different roles in the
intracellular signal cascade pathway in response to the same signal or
may mediate different signals involved in the balance of positive and
negative growth cues required in the regulation of neuronal
migration/axonal growth and oligodendrocyte migration/process extension.
Effect of Sema3A on oligodendrocytes: involvement of Ulip2/CRMP2
and Ulip6/CRMP5
Ulip2/CRMP2 is reported to mediate Sema3A signaling axon guidance
and collapse during development (Goshima et al., 1995 ; Pasterkamp et
al., 1998a ). Several lines of evidence suggest that Sema3A can act on
oligodendrocytes in the adult brain: (1) neuropilin-1, a component of
the Sema3A receptor complex (He and Tessier-Lavigne, 1997 ; Kolodkin et
al., 1997 ), was shown to be expressed by oligodendrocytes, (2) addition
of Sema3A to the culture medium dramatically reduced oligodendrocyte
process extension, (3) removal of Sema3A resulted in restoration of
process extension, and (4) the effect of Sema3A was blocked by
anti-neuropilin-1 antibodies or VEGF-165, another neuropilin-1 ligand
(Miao et al., 1999 ). The blocking of the Sema3A effect by specific
anti-Ulip2/CRMP2 or anti-Ulip6/CRMP5 antibodies, as described for
Ulip2/CRMP2 in developing neurons (Goshima et al., 1995 ), and the lack
of effect of anti-Ulip3/CRMP1 antibodies and preimmune sera indicate
that Ulip2/CRMP2 and Ulip6/CRMP5 are involved in mediating the Sema3A
signal. Interestingly, the time course of the Sema3A effect on
oligodendrocytes differs from that on neuronal growth. Although growth
cone collapse is seen 10 min to 6 hr after Sema3A contact with neurons
(Bagnard et al., 1998 ), in oligodendrocytes the Sema3A effect was seen
after 24 hr. This time course is similar to that for the effect of
phorbol ester on oligodendrocyte process extension (Stariha et al.,
1997 ). Sema3A, via Ulip2/CRMP2 or Ulip6/CRMP5, may act on the dynamics
of microtubules, leading to the decrease in process extension. Several
results support this hypothesis: (1) microtubules are present in
oligodendrocytes and reflect oligodendrocyte function (Lunn et al.,
1997 ), (2) Ulip2/CRMP2 mediates the dynamics of microtubules (Gu and
Ihara, 2000 ), and (3) protein kinase, which could phosphorylate the
numerous phosphorylation sites of the Ulip/CRMPs, regulates
oligodendrocyte process extension (Stariha et al., 1997 ) and can affect
microtubule dynamics (Gotoh et al., 1991 ). Although these results show
that oligodendrocytes are sensitive to Sema3A, other signals might also
be mediated by Ulip/CRMPs (Wang and Strittmatter, 1997 ).
Functional significance of Ulip6/CRMP5 and Ulip2/CRMP2 expression
in the adult brain
Oligodendrocytic expression of Ulip6/CRMP5 and Ulip2/CRMP2 could
be crucial in mediating the signals involved in myelination, demyelination, and remyelination (at least in the pons, cerebellum, and
spinal cord) in the normal and pathological brain. In demyelinating disorders, such as multiple sclerosis, before oligodendrocytes can
remyelinate, they must extend and contact the demyelinated axons. The
role of Ulip2/CRMP2 and Ulip6/CRMP5 in the response to signals, such as
Sema3A, could be crucial in the reinitiation and regulation of process
extension by surviving oligodendrocytes. High levels of Sema3A are
expressed namely by fibroblasts in adult CNS scar tissue (Pasterkamp et
al., 1998a , 1999 ), and Sema3A and Ulip2/CRMP2 expression has been shown
to be upregulated in injured axons (Minturn et al., 1995 ; Pasterkamp et
al., 1998b ). Scar-derived Sema3A could thus affect both
oligodendrocytes process extension and migration and axonal regrowth
around the lesion in the injured brain. A physiologic role of Sema3A on
oligodendrocytes should be also consider and could be assessed in
Sema3A-deficient mice that are viable after birth (Taniguchi et al.,
1997 ). In these mice, it would be interesting to study neuronal
regeneration and myelination after brain injury.
The fact that neurons and oligodendrocytes may respond to similar
signals, mediated by Ulip/CRMPs, opens new fields of investigation into
the role of the neuron/oligodendrocyte interaction in axonal growth, in
addition to the myelin-derived axonal growth inhibitors, MAG and
NI35/250 (Shibata et al., 1998 ; Buffo et al., 2000 ; GrandPre et al.,
2000 ). On the other hand, the specific increase of Ulip2/CRMP2 in
Alzheimer's disease (Gu et al., 2000 ) and the involvement of Ulip6/CRMP5 in PND patients emphasize the role of these proteins in
neurological diseases. The tightly regulated spatial and temporal expression of the five Ulip/CRMPs is probably crucial in modulating the
signal cascade pathways of positive/negative cues in both the
developing and adult brain.
 |
FOOTNOTES |
Received Feb. 13, 2001; revised June 15, 2001; accepted June 28, 2001.
This work was supported by Institut National de la Santé et de la
Recherche Médicale and grants from the Ligue contre le Cancer du
Rhône, the Association pour la Recherche contre le Cancer, and
the European Leucodystrophy Association. We thank A. Sobel and T. Byk
for providing the mouse Ulip/CRMP cDNAs, A. W. Püschel for
providing stable cell lines expressing Sema3A, and C. A. Vergoin
for technical assistance.
D.R., V.R., and E.C. contributed equally to this work.
Correspondence should be addressed to Dr. J. Honnorat,
Neurologie B, Hôpital Neurologique, 59 Boulevard Pinel, BP
Lyon Montchat, 69394 Lyon Cedex 03, France. E-mail:
honnorat{at}cismsun.univ-lyon1.fr.
 |
REFERENCES |
-
Altman J
(1972a)
Postnatal development of the cerebellar cortex in the rat. I. The external germinal layer and the transitional molecular layer.
J Comp Neurol
145:353-397[Web of Science][Medline].
-
Altman J
(1972b)
Postnatal development of the cerebellar cortex in the rat. II. Phases in the maturation of Purkinje cells and of the molecular layer.
J Comp Neurol
145:399-463[Web of Science][Medline].
-
Altman J
(1972c)
Postnatal development of the cerebellar cortex in the rat. III. Maturation of the components of the granular layer.
J Comp Neurol
145:465-513[Web of Science][Medline].
-
Arimura N,
Inagaki N,
Chihara K,
Menager C,
Nakamura N,
Amano M,
Iwamatsu A,
Goshima Y,
Kaibuchi K
(2000)
Phosphorylation of collapsin response mediator protein-2 by Rho-kinase. Evidence for two separate signaling pathways for growth cone collapse.
J Biol Chem
275:23973-23980[Abstract/Free Full Text].
-
Bagnard D,
Lohrum M,
Uziel D,
Püschel AW,
Bolz J
(1998)
Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections.
Development
125:5043-5053[Abstract].
-
Bagnard D,
Thomasset N,
Lohrum M,
Püschel AW,
Bolz J
(2000)
Spatial distributions of guidance molecules regulate chemorepulsion and chemoattraction of growth cones.
J Neurosci
20:1030-1035[Abstract/Free Full Text].
-
Bagnard D,
Vaillant C,
Khuth ST,
Dufay N,
Lohrum M,
Püschel AW,
Belin MF,
Bolz J,
Thomasset N
(2001)
Semaphorin 3A-vascular endothelial growth factor-165 balance mediates migration and apoptosis of neural progenitor cells by the recruitment of shared receptor.
J Neurosci
21:3332-3341[Abstract/Free Full Text].
-
Bottenstein JE,
Sato GH
(1979)
Growth of a rat neuroblastoma cell line in serum-free supplemented medium.
Proc Natl Acad Sci USA
76:514-517[Abstract/Free Full Text].
-
Buffo A,
Zagrebelsky M,
Huber AB,
Skerra A,
Schwab ME,
Strata P,
Rossi F
(2000)
Application of neutralizing antibodies against NI-35/250 myelin-associated neurite growth inhibitory proteins to the adult rat cerebellum induces sprouting of uninjured Purkinje cell axons.
J Neurosci
20:2275-2286[Abstract/Free Full Text].
-
Bulliard C,
Zurbriggen R,
Tornare J,
Faty M,
Dastoor Z,
Dreyer JL
(1997)
Purification of a dichlorophenol-indophenol oxidoreductase from rat and bovine synaptic membranes: tight complex association of a glyceraldehyde-3-phosphate dehydrogenase isoform, TOAD64, enolase-gamma and aldolase C.
Biochem J
324:555-563.
-
Byk T,
Dobransky T,
Cifuentes-Diaz C,
Sobel A
(1996)
Identification and molecular characterization of Unc-33-like phosphoprotein (Ulip), a putative mammalian homolog of the axonal guidance associated unc-33 gene product.
J Neurosci
16:668-701.
-
Byk T,
Ozon S,
Sobel A
(1998)
The Ulip family of phosphoproteins.
Eur J Biochem
254:14-24[Web of Science][Medline].
-
Chen H,
He Z,
Bagri A,
Tessier-Lavigne M
(1998)
Semaphorin-neuropilin interactions underlying sympathetic axon responses to class III semaphorins.
Neuron
21:1283-1290[Web of Science][Medline].
-
Darnell RB
(1996)
Onconeural antigens and the paraneoplastic neurologic disorders: at the intersection of cancer, immunity, and the brain.
Proc Natl Acad Sci USA
93:4529-4536[Abstract/Free Full Text].
-
Fishman PS,
Farrand DA,
Kristt DA
(1990)
Internalization of plasma proteins by cerebellar Purkinje cells.
J Neurol Sci
100:43-49[Medline].
-
Fishman PS,
Farrand DA,
Kristt DA
(1991)
Penetration and internalization of plasma proteins in the human spinal cord.
J Neurol Sci
104:166-175[Medline].
-
Friedman B,
Hockfield S,
Black JA,
Woodruff KA,
Waxman SG
(1989)
In situ demonstration of mature oligodendrocytes and their processes: an immunocytochemical study with a new monoclonal antibody, rip.
Glia
2:380-390[Web of Science][Medline].
-
Fukada M,
Watakabe I,
Yuasa-Kawada J,
Kawachi H,
Kuroiwa A,
Matsuda Y,
Noda M
(2000)
Molecular characterization of CRMP5, a novel member of the collapsin response mediator protein family.
J Biol Chem
275:37957-37965[Abstract/Free Full Text].
-
Goshima Y,
Nakamura F,
Strittmatter P,
Strittmatter SM
(1995)
Collapsin-induced growth cone collapse mediated by an intracellular protein related to UNC-33.
Nature
376:509-514[Medline].
-
Gotoh Y,
Nishida E,
Matsuda S,
Shiina N,
Kosako H,
Shiokawa K,
Akiyama T,
Otha K,
Sakai H
(1991)
In vitro effect on microtubule dynamics of purified Xenopus M phase-activated MAP kinase.
Nature
349:251-259[Medline].
-
GrandPre T,
Nakamura F,
Vartanian T,
Strittmatter SM
(2000)
Identification of the Nogo inhibitor of axon regeneration as a Reticulon protein.
Nature
403:439-444[Medline].
-
Greenlee JE,
Parks TN,
Jaeckle KA
(1993)
Type IIa ("anti-Hu") anti-neuronal antibodies produce destruction of rat cerebellar granule neurons in vitro.
Neurology
43:2049-2054[Abstract/Free Full Text].
-
Gu Y,
Ihara Y
(2000)
Evidence that collapsin response mediator protein-2 is involved in the dynamics of microtubules.
J Biol Chem
275:17917-17920[Abstract/Free Full Text].
-
Gu Y,
Hamajima N,
Ihara Y
(2000)
Neurofibrillary tangle-associated collapsin response mediator protein-2 (CRMP-2) is highly phosphorylated on Thr-509, Ser-518, and Ser-522.
Biochemistry
39:4267-4275[Medline].
-
Hamajima N,
Matsuda K,
Sakata S,
Tamaki M,
Nonaka M
(1996)
A novel gene family defined by human dihydropyrimidinase and three related proteins with differential tissue distribution.
Gene
180:157-163[Web of Science][Medline].
-
He Z,
Tessier-Lavigne M
(1997)
Neuropilin is a receptor for the axonal chemorepellent Semaphorin III.
Cell
90:739-751[Web of Science][Medline].
-
Honnorat J,
Antoine JC,
Derrington EA,
Aguera M,
Belin MF
(1996)
Antibodies to a subpopulation of glial cells and a 66 kD developmental protein in patients with paraneoplastic neurological syndromes.
J Neurol Neurosurg Psychiatry
61:270-278[Abstract/Free Full Text].
-
Honnorat J,
Aguera M,
Zalc B,
Goujet C,
Quach T,
Antoine JC,
Belin MF
(1998)
POP66, a paraneoplastic encephalomyelitis-related antigen, is a marker of adult oligodendrocytes.
J Neuropathol Exp Neurol
57:311-322[Web of Science][Medline].
-
Honnorat J,
Byk T,
Kuster I,
Aguera M,
Ricard D,
Rogemond V,
Quach T,
Aunis D,
Sobel A,
Mattei MG,
Kolattukudy P,
Belin MF,
Antoine JC
(1999)
Ulip/CRMP proteins are recognized by autoantibodies in paraneoplastic neurological syndromes.
Eur J Neurosci
11:4226-4232[Web of Science][Medline].
-
Inatome R,
Tsujimura T,
Hitomi T,
Mitsui N,
Hermann P,
Kuroda S,
Yamamura H,
Yanagi S
(2000)
Identification of CRAM, a novel unc-33 gene family protein that associates with CRMP3 and protein-tyrosine kinase(s) in the developing rat brain.
J Biol Chem
275:27291-27302[Abstract/Free Full Text].
-
Kamata T,
Subleski M,
Hara Y,
Yuhki N,
Kung H,
Copeland NG,
Jenkins NA,
Yoshimura T,
Modi W,
Copeland TD
(1998)
Isolation and characterization of a bovine neural specific protein (CRMP-2) cDNA homologous to unc-33, a C. elegans gene implicated in axonal outgrowth and guidance.
Mol Brain Res
54:219-236[Medline].
-
Kato Y,
Hamajima N,
Inagaki H,
Okumura N,
Koji T,
Sasaki M,
Nonaka M
(1998)
Post-meiotic expression of the mouse dihydropyrimidinase related protein 3 gene during spermiogenesis.
Mol Reprod Dev
51:105-111[Medline].
-
Kolodkin AL,
Levengood DV,
Rowe EG,
Tai YT,
Giger RJ,
Ginty DD
(1997)
Neuropilin is a semaphorin III receptor.
Cell
90:753-762[Web of Science][Medline].
-
Li W,
Herman RK,
Shaw E
(1992)
Analysis of the Caenorhabditis elegans axonal guidance and outgrowth gene unc-33.
Genetics
132:675-689[Abstract].
-
Lisak RP,
Pleasure DE,
Silberberg DH,
Manning MC,
Saida T
(1981)
Long term culture of bovine oligodendroglia isolated with a Percoll gradient.
Brain Res
223:107-122[Medline].
-
Lubetzki C,
Gansmuller A,
Lachapelle F,
Lombrail P,
Gumpel M
(1988)
Myelination by oligodendrocytes isolated from 4-6-week-old rat central nervous system and transplanted into new-born shivered brain.
J Neurol Sci
88:161-175[Web of Science][Medline].
-
Lunn KF,
Baas PW,
Duncan ID
(1997)
Microtubule organization and stability in the oligodendrocyte.
J Neurosci
17:4921-4932[Abstract/Free Full Text].
-
Miao HQ,
Soker S,
Feiner L,
Alonso JL,
Raper JA,
Klagsbrun M
(1999)
Neuropilin-1 mediates collapsin-1/semaphorin III inhibition of endothelial cell motility: functional competition of collapsin-1 and vascular endothelial growth factor-165.
J Cell Biol
146:233-242[Abstract/Free Full Text].
-
Minturn JE,
Fryer HJL,
Geschwind DH,
Hockfield S
(1995)
TOAD-64, a gene expressed early in neuronal differentiation in the rat, is related to unc-33, a C. elegans gene involved in axon outgrowth.
J Neurosci
15:6757-6766[Abstract/Free Full Text].
-
Nacher J,
Rosell DR,
McEwen BS
(2000)
Widespread expression of rat collapsin response-mediated protein 4 in the telencephalon and other areas of the adult rat central nervous system.
J Comp Neurol
424:628-639[Web of Science][Medline].
-
Pasterkamp RJ,
De Winter F,
Holtmaat AJGD,
Verhaagen J
(1998a)
Evidence for a role of the chemorepellent semaphorin III and its receptor neuropilin-1 in the regeneration of primary olfactory axons.
J Neurosci
23:9962-9976.
-
Pasterkamp RJ,
Giger RJ,
Verhaagen J
(1998b)
Regulation of semaphorin III/collapsin-1 gene expression during peripheral nerve regeneration.
Exp Neurol
153:313-327[Web of Science][Medline].
-
Pasterkamp RJ,
Giger RJ,
Ruitenberg MJ,
Holtmaat AJ,
De Wit J,
De Winter F,
Verhaagen J
(1999)
Expression of the gene encoding the chemorepellent semaphorin III is induced in the fibroblast component of neural scar tissue formed after injuries of adult but not neonatal CNS.
Mol Cell Neurosci
13:143-166[Web of Science][Medline].
-
Posner JB
(1997)
Paraneoplastic syndromes: a brief review.
Ann NY Acad Sci
835:83-90[Medline].
-
Püschel AW
(1999)
Semaphorins: repulsive guidance molecules show their attractive side.
Nat Neurosci
2:777-778[Medline].
-
Quach TT,
Rong Y,
Belin MF,
Duchemin AM,
Akakoa H,
Ding S,
Baudry M,
Kollattukudy PE,
Honnorat J
(1997)
Molecular cloning and expression of a new unc-33 like cDNA from rat brain and its relation to paraneoplastic neurological syndromes.
Mol Brain Res
46:329-332[Medline].
-
Ricard D,
Stankoff B,
Bagnard D,
Aguera M,
Rogemond V,
Antoine JC,
Spassky N,
Zalc B,
Lubetzki C,
Belin MF,
Honnorat J
(2000)
Differential expression of collapsin response mediator proteins (CRMP/ULIP) in subsets of oligodendrocytes in the post-natal rodent brain.
Mol Cell Neurosci
16:324-337[Web of Science][Medline].
-
Rogemond V,
Honnorat J
(2000)
Anti-CV2 autoantibodies and paraneoplastic neurological syndromes.
Clin Rev Allergy Immunol
19:48-56.
-
Shibata A,
Wright MV,
David S,
McKerracher L,
Braun PE,
Kater SB
(1998)
Unique responses of differentiating neuronal growth cones to inhibitory cues presented by oligodendrocytes.
J Cell Biol
142:191-202[Abstract/Free Full Text].
-
Shirvan A,
Ziv I,
Flemminger G,
Shina R,
He Z,
Brudo I,
Melamed E,
Barzilai A
(1999)
Semaphorins as mediators of neuronal apoptosis.
J Neurochem
73:961-971[Web of Science][Medline].
-
Stariha RL,
Kikuchi S,
Siow YL,
Pelech SL,
Kim M,
Kim SU
(1997)
Role of extracellular signal-regulated protein kinases 1 and 2 in oligodendroglial process extension.
J Neurochem
68:945-953[Web of Science][Medline].
-
Taketo MM,
Araki Y,
Matsunaga A,
Yokoi A,
Tsuchida J,
Nishina Y,
Nosaki M,
Tanaka H,
Koga M,
Uchida K,
Matsumiya K,
Okuyama A,
Rochelle JM,
Nishimune Y,
Matsui M,
Seldin MF
(1997)
Mapping of eight testis specific genes to mouse chromosomes.
Genomics
46:138-142[Medline].
-
Taniguchi M,
Yuasa S,
Fujisawa H,
Naruse I,
Saga S,
Mishina M,
Takeshi Y
(1997)
Disruption of semaphorin III/D gene causes severe abnormality in peripheral nerve projection.
Neuron
19:519-530[Web of Science][Medline].
-
Wang LH,
Strittmatter SM
(1996)
A family of rat CRMP genes is differentially expressed in the nervous system.
J Neurosci
16:6197-6207[Abstract/Free Full Text].
-
Wang LH,
Strittmatter SM
(1997)
Brain CRMP forms heterotetramers similar to liver dihydropyrimidinase.
J Neurochem
69:2261-2269[Web of Science][Medline].
-
Yoshida H,
Watanabe A,
Ihara Y
(1998)
CRMP-2 is associated with neurofibrillary tangles in Alzheimer's disease.
J Biol Chem
273:9761-9768[Abstract/Free Full Text].
-
Zhang SC,
Ge B,
Duncan ID
(1999)
Adult brain retains the potential to generate oligodendroglial progenitors with extensive myelination capacity.
Proc Natl Acad Sci USA
9:4089-4094.
Copyright © 2001 Society for Neuroscience 0270-6474/01/21187203-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J Honnorat, S Cartalat-Carel, D Ricard, J P. Camdessanche, A F Carpentier, V Rogemond, F Chapuis, M Aguera, E Decullier, A M Duchemin, et al.
Onco-neural antibodies and tumour type determine survival and neurological symptoms in paraneoplastic neurological syndromes with Hu or CV2/CRMP5 antibodies
J. Neurol. Neurosurg. Psychiatry,
April 1, 2009;
80(4):
412 - 416.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rajasekharan, K. A. Baker, K. E. Horn, A. A. Jarjour, J. P. Antel, and T. E. Kennedy
Netrin 1 and Dcc regulate oligodendrocyte process branching and membrane extension via Fyn and RhoA
Development,
February 1, 2009;
136(3):
415 - 426.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Lovato, R. Cianti, B. Gini, S. Marconi, L. Bianchi, A. Armini, E. Anghileri, F. Locatelli, F. Paoletti, D. Franciotta, et al.
Transketolase and 2',3'-Cyclic-nucleotide 3'-Phosphodiesterase Type I Isoforms Are Specifically Recognized by IgG Autoantibodies in Multiple Sclerosis Patients
Mol. Cell. Proteomics,
December 1, 2008;
7(12):
2337 - 2349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Pittock and V. A. Lennon
Aquaporin-4 Autoantibodies in a Paraneoplastic Context
Arch Neurol,
May 1, 2008;
65(5):
629 - 632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Charrier, B. Mosinger, C. Meissirel, M. Aguera, V. Rogemond, S. Reibel, P. Salin, N. Chounlamountri, V. Perrot, M.-F. Belin, et al.
Transient alterations in granule cell proliferation, apoptosis and migration in postnatal developing cerebellum of CRMP1-/- mice
Genes Cells,
December 1, 2006;
11(12):
1337 - 1352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Pasterkamp and J. Verhaagen
Semaphorins in axon regeneration: developmental guidance molecules gone wrong?
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1499 - 1511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Vincent, Y. Collette, R. Marignier, C. Vuaillat, V. Rogemond, N. Davoust, C. Malcus, S. Cavagna, A. Gessain, I. Machuca-Gayet, et al.
A Role for the Neuronal Protein Collapsin Response Mediator Protein 2 in T Lymphocyte Polarization and Migration
J. Immunol.,
December 1, 2005;
175(11):
7650 - 7660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Jaster and J. Dalmau
Antibodies to Zic4 in paraneoplastic neurologic disorders and small-cell lung cancer
Neurology,
October 12, 2004;
63(7):
1339 - 1339.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J H Jaster and T W Smith
Demyelination in the brain as a paraneoplastic disorder
Br. J. Radiol.,
October 1, 2004;
77(922):
899 - 899.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Giraudon, P. Vincent, C. Vuaillat, O. Verlaeten, L. Cartier, A. Marie-Cardine, M. Mutin, A. Bensussan, M.-F. Belin, and L. Boumsell
Semaphorin CD100 from Activated T Lymphocytes Induces Process Extension Collapse in Oligodendrocytes and Death of Immature Neural Cells
J. Immunol.,
January 15, 2004;
172(2):
1246 - 1255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Moreau-Fauvarque, A. Kumanogoh, E. Camand, C. Jaillard, G. Barbin, I. Boquet, C. Love, E. Y. Jones, H. Kikutani, C. Lubetzki, et al.
The Transmembrane Semaphorin Sema4D/CD100, an Inhibitor of Axonal Growth, Is Expressed on Oligodendrocytes and Upregulated after CNS Lesion
J. Neurosci.,
October 8, 2003;
23(27):
9229 - 9239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-H. Tsai, M. Tessier-Lavigne, and R. H. Miller
Netrin 1 mediates spinal cord oligodendrocyte precursor dispersal
Development,
May 15, 2003;
130(10):
2095 - 2105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Spassky, F. de Castro, B. Le Bras, K. Heydon, F. Queraud-LeSaux, E. Bloch-Gallego, A. Chedotal, B. Zalc, and J.-L. Thomas
Directional Guidance of Oligodendroglial Migration by Class 3 Semaphorins and Netrin-1
J. Neurosci.,
July 15, 2002;
22(14):
5992 - 6004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rakic
Adult Neurogenesis in Mammals: An Identity Crisis
J. Neurosci.,
February 1, 2002;
22(3):
614 - 618.
[Full Text]
[PDF]
|
 |
|
|