 |
Previous Article | Next Article 
The Journal of Neuroscience, January 15, 2001, 21(2):541-549
Defects in Sensory Axon Growth Precede Neuronal Death
in Brn3a-Deficient Mice
S. Raisa
Eng1,
Kevin
Gratwick1,
Jerry M.
Rhee1,
Natalia
Fedtsova1,
Lin
Gan3, and
Eric E.
Turner1, 2
1 Department of Psychiatry and 2 Program in
Neuroscience, University of California, San Diego and San Diego
Veterans Affairs Medical Center, La Jolla, California 92093 and
3 Center for Aging and Developmental Biology, University of
Rochester, Rochester, New York 14642
 |
ABSTRACT |
Brn3a/Brn-3.0 is a POU-domain transcription factor expressed in
primary sensory neurons of the cranial and dorsal root ganglia and in
specific neurons in the caudal CNS. Mice lacking Brn3a undergo
extensive sensory neural death late in gestation and die at birth. To
further examine Brn3a expression and the abnormalities that accompany
its absence, we constructed a transgene containing 11 kb of Brn3a
upstream regulatory sequence linked to a LacZ reporter. Here we show
that these regulatory sequences direct transgene expression
specifically to Brn3a peripheral sensory neurons of the cranial and
dorsal root ganglia. Furthermore, expression of the 11 kb/LacZ reporter
in the sensory neurons of the mesencephalic trigeminal, but not other
Brn3a midbrain neurons, demonstrates that cell-specific transgene
expression is targeted to a functional class of neurons rather than to
an anatomical region. We then interbred the 11 kb/LacZ reporter strain
with mice carrying a null mutant allele of Brn3a to generate 11 kb/LacZ, Brn3a knock-out mice. -Galactosidase expression in these
mice reveals significant axonal growth defects, including excessive and
premature branching of the major divisions of the trigeminal nerve and
a failure to correctly innervate whisker follicles, all of which
precede sensory neural death in these mice. These defects in
Brn3a / mice resemble strongly those seen in mice
lacking the mediators of sensory pathfinding semaphorin 3A and
neuropilin-1. Here we show, however, that sensory neurons are able to
express neuropilin-1 in the absence of Brn3a.
Key words:
POU-domain; homeodomain; Brn3; TrkC; trigeminal ganglion; sensory ganglion; axon guidance
 |
INTRODUCTION |
The vertebrate nervous system
contains a large number of specific cell types, and how this neuronal
diversity is generated is a central question in the study of brain
development. Many neurons in the developing brain can be recognized by
the expression of specific "neural identity" genes that are first
detectable at approximately the time of exit from cell division and may
persist throughout embryogenesis. Most such genes discovered to date
have been transcription factors, often but not always containing a homeodomain motif (Rubenstein and Puelles, 1994 ). A specific neural identity gene may be expressed in a recognizable class of neurons, such
as the motor neurons of the brainstem and spinal cord, or it may
characterize a group of cells that have no other known features in
common. Accordingly, they are good candidates for establishing
the neuronal phenotypes characterized by, among others, the
cell-specific expression of neurotransmitters and their receptors, axonal guidance to selected targets, and synaptic specificity. However,
the neuronal properties that are actually regulated by these factors,
and how this regulation is accomplished, remain primarily undiscovered.
The "Brn3" or POU-IV class of transcription factors is
comprised of three members in vertebrates that share very similar DNA recognition properties to their invertebrate counterparts (Gruber et
al., 1997 ). The three vertebrate Brn3 genes, Brn3a/Brn-3.0, Brn3b/Brn-3.2, and Brn3c/Brn-3.1, are expressed primarily in the nervous system, in somewhat overlapping yet distinctive patterns. Null
mutants of Brn3b are viable but exhibit defects in retinal ganglion
cell development (Erkman et al., 1996 ; Gan et al., 1996 ). Brn3c / mice also survive but show a
loss of vestibular and auditory hair cells and the associated sensory
ganglia (Erkman et al., 1996 ; Xiang et al., 1997a ).
Brn3a is the most widely expressed member of this class, and mice
lacking this factor die at birth. In these mice, the majority of
neurons comprising the trigeminal and dorsal root ganglia (DRG) undergo apoptosis in late embryogenesis, and the neurons of some Brn3a-expressing CNS nuclei, such as the red nucleus, also fail to
survive (McEvilly et al., 1996 ; Xiang et al., 1996 ). In the trigeminal
ganglion, neuronal death is preceded by the loss of expression of the
Trk family of neurotrophin receptors (Huang et al., 1999 ). It is not
surprising that Brn3a neurons initially develop normally in Brn3a
knock-out animals but die at subsequent developmental stages, because
Brn3a expression is initiated just before (sensory system) or after
(CNS) neurons exit the cell cycle (Fedtsova and Turner, 1995 ).
Here we show that a transgene containing 11 kb of Brn3a
5'-flanking sequence targets reporter expression specifically to the sensory neurons of the PNS and mesencephalic trigeminal nucleus but not
to the other CNS sites of Brn3a expression. This 11 kb/LacZ reporter
was then used to trace the development of sensory neurons and their
axons in Brn3a knock-out and heterozygous control mice. These studies
reveal a marked defect in sensory axon growth in the absence of Brn3a
and thus suggest an explanation for the extensive sensory neural death
that occurs in these mice.
 |
MATERIALS AND METHODS |
Transgenic mice. Transgene constructs were generated
by inserting a series of genomic subclones of the mouse Brn3a locus
into the vector pSDKLacZpA (Logan et al., 1993 ), which contains a Kozak consensus translational start site, the Escherichia coli
LacZ gene, and an SV-40 intron/splice/polyadenylation site. Brn3a
genomic sequences were derived form a parent P1 clone that has been
described previously (Trieu et al., 1999 ). To generate the transgene
constructs, we used PCR to produce a fragment extending from a
NotI site located at 140 bp relative to the start of
transcription to an inserted HindII site immediately 5' to
the Brn3a initiator methionine codon, thus including the native Brn3a
transcriptional start site and 5'-UTR within the PCR product, which was
then ligated into pSDKLacZpA. Genomic fragments extending from the
NotI site to the SpeI site at 6 kb, and the
XhoI site at 11 kb upstream from the start of translation
were then inserted into this promoter construct in native orientation
to complete the 6 kb/LacZ and 11 kb/LacZ transgenes (Fig.
1A).

View larger version (60K):
[in this window]
[in a new window]
|
Figure 1.
Brn3a 5'-flanking sequences target reporter gene
expression to the sensory nervous system. A, Structure
of the 5'-regulatory region of the mouse brn3a locus.
Transcription is initiated from multiple closely spaced sites ~300 bp
upstream from the start of Brn3a translation. The positions of the
previously identified distal and proximal autoregulatory sites are
indicated (Trieu et al., 1999 ). Transgene constructs were produced by
linking 6 or 11 kb of 5'-flanking sequence to the LacZ expression
cassette at the Brn3a translational start site. B-D,
The 11 kb/Brn3a transgenic construct targets LacZ expression
specifically to the sensory system in E11.5, E12.5, and E14 mice,
respectively. B and C show one of three
transgenic lines that targeted LacZ specifically, and D
shows a second independent line. A third line is used for the
experiments shown in subsequent figures. Arrows in
D indicate areas of ectopic expression in the
neuroepithelium of the forebrain and tegmentum that varied between
transgenic lines.
|
|
Transgene DNA was injected into CB6F2 oocytes, and the founder animals
were genotyped by PCR for integration of the LacZ transgene, as
described below. Founders were bred with C57BL/6J mice, and transgenic
lines were carried in a C57BL/6J genetic background. Mice analyzed for
transgene expression were at least two generations removed from the
founder animals, and analysis of F1 11 kb/LacZ mice by Southern
blotting indicated integration of the transgenes at a single locus. The
mice carrying null alleles for Brn3a (Xiang et al., 1996 ) and TrkC
(Klein et al., 1994 ) have been described previously.
Mice were genotyped by PCR using tail DNA samples from 4-week-old mice
or from embryonic hind limb, tail, or amnion tissue. The LacZ reporter
transgene was assayed using PCR primers within the LacZ cassette
(CACAGATGTGGATTGGCGAT and CATAATTCAATTCGCGCGTCCC). Brn3a wild-type and
null alleles were assayed using primers within the Brn3a coding
sequence (GGCGTCCATCTGCGACTCGGACAG and CAGGATAACGGACAGTCTAAATGA) and in
the inserted neomycin resistance cassette (GGAGAGGCTATTCGGCTATGACTG and
CTCTTCGTCCAGATCATCCTGATC). The TrkC wild-type and null alleles were
assayed using one primer common to both the wild-type and targeted
alleles (GTCCCATCTTGCTTACCCTGAGG) and a second wild-type-specific primer (CTGAAGTCACTGGCTAGAGTCTGGG) or a knock-out-specific primer (CCAG-CCTCTGAGCCCAGAAAGC).
Staged embryos were generated for analysis by interbreeding mice of the
appropriate genetic background, with the assignment of noon on the day
after the appearance of a mucous plug in mated animals as embryonic day
0.5 (E0.5). Embryos were further staged by size and developmental
landmarks as described by Theiler (1989) .
-Galactosidase staining and
immunohistochemistry. For whole-mount staining for
-galactosidase ( gal) activity, embryos were fixed in 3.7%
formaldehyde in PBS for 30 min (up to 2 hr for E16.5 embryos)
and then rinsed in 100 mM potassium phosphate, pH
7.4, containing 5 mM EGTA, 2 mM MgCl2, 0.02% Nonidet
P-40, and 0.01% sodium deoxycholate. Staining was performed in the
rinse solution to which was added 0.5 mg/ml X-gal, 5 mM potassium ferricyanide, and 5 mM potassium ferrocyanide. Embryos were stained
several hours to overnight at 37°C, rinsed in the same buffer,
dehydrated in graded ethanols, and then cleared in 1:2 benzyl
alcohol/benzyl benzoate. Intact newborn brains were also fixed and
stained using this procedure, sectioned in a vibratome at intervals of
100 µM, and then cleared in 50%
glycerol-PBS.
For immunohistochemistry of Brn3a in tissue sections, harvested embryos
were fixed in 4% formaldehyde in 60% ethanol for 30 min to 2 hr
depending on the embryonic stage, washed with 70% ethanol, dehydrated,
embedded in histoplast, and sectioned at 5 µm as in previous work
(Fedtsova and Turner, 1995 ). The rabbit anti-Brn3a/Brn3.0 antiserum
used has been described previously (Fedtsova and Turner, 1995 ).
Immunohistochemistry for -gal and neuropilin-1 (Npn1) was performed
in frozen sections. Embryos were fixed in 4% paraformaldehyde in PBS,
rinsed in PBS, frozen at 20°C in OCT solution, and cryostat
sectioned at intervals of 20 µm. Rabbit anti- -gal was
obtained from 5 Prime 3 Prime, Inc. (Boulder, CO), and
rabbit anti-Npn1 antiserum was a gift of Dr. David Ginty (The
Johns Hopkins University School of Medicine, Baltimore, MD) (Kolodkin
et al., 1997 ). Secondary anti-rabbit antiserum conjugated with Alexa
Fluor 488 was obtained from Molecular Probes (Eugene, OR).
 |
RESULTS |
The Brn3a locus contains regulatory sequences specific for
sensory neurons
Brn3a is expressed in a complex but highly specific pattern in the
sensory peripheral nervous system and in CNS nuclei, including the
medial and lateral habenula, specific tectal lamina, red nucleus, interpeduncular nucleus, mesencephalic trigeminal nucleus (mes5), and
inferior olive (Gerrero et al., 1993 ; Fedtsova and Turner, 1995 ; Turner
et al., 1996 ; Xiang et al., 1997b ; Trieu et al., 1999 ). To identify the
regulatory sequences determining all or part of this expression
pattern, we produced a series of transgene constructs linking fragments
of the Brn3a locus to a LacZ reporter (Logan et al., 1993 ) and examined
the resulting patterns of -galactosidase expression.
Brn3a transcription is initiated from a cluster of sites that do not
contain a "TATA" sequence and reside ~300 bp upstream from the
Brn3a initiator methionine (Trieu et al., 1999 ). The first transgene
construct tested contained ~6 kb of Brn3a 5'-flanking sequence, the
native transcriptional start site, and ~300 bp corresponding to the
5'-untranslated part of the Brn3a mRNA (Fig. 1A).
This transgene yielded specific but very weak expression in the
trigeminal and DRG of E13.5 mice (data not shown). Extension of the
targeting construct to include ~11 kb of 5'-flanking sequence (11 kb/LacZ reporter) strongly enhanced transgene expression (Fig.
1B-D). Three of the four 11 kb/LacZ lines that were
examined showed specific expression in the trigeminal (fifth) ganglion,
vestibulocochlear (eighth) ganglion, superior (ninth) ganglion, and
DRG, whereas one of the four lines showed weak -gal expression not
associated with the expression pattern of Brn3a. None of the 11 kb/LacZ
transgenic lines showed -gal expression in the Brn3a-expressing
neurons in the habenula, superior colliculus, or midbrain tegmentum.
However, expression in small regions of the forebrain and tegmental
neuroepithelium was observed in one line (Fig. 1D) in
a pattern not associated with Brn3a and was presumably
attributable to insertion site-dependent regulatory elements.
The scattered neurons of the mes5, concentrated near the aqueduct in
the caudal midbrain, provide sensory innervation of the masticatory
muscles and teeth and constitute the only sensory neurons (exclusive of
special senses) located within the CNS (Rokx et al., 1986 ). Thus, these
neurons provide a test of whether the Brn3a regulatory sequences
contained in the 11 kb/LacZ reporter direct expression to the sensory
ganglia based on anatomical location in the PNS or to a functionally
similar class of neurons independent of location. Examination of the
midbrain by immunohistochemistry for Brn3a protein in the newborn
[postnatal day 0 (P0)] mouse (Fig.
2A) revealed extensive
nuclear staining within the tectal lamina and also in the scattered
mes5 neurons. In contrast, -gal activity in 11 kb/LacZ mice appeared
only in the mes5 (Fig. 2B).

View larger version (85K):
[in this window]
[in a new window]
|
Figure 2.
Brn3a regulatory sequences target gene expression
only to primary sensory neurons, regardless of anatomical location. A
cross-section of the midbrain of a newborn (P0) mouse stained for Brn3a
by immunohistochemistry (A) and a vibratome
section at a similar level stained for -gal activity
(B) show that -gal expression controlled by
Brn3a regulatory sequences is confined to primary sensory neurons of
the mes5 (arrows) in the midbrain and not the numerous
Brn3a-expressing tectal neurons. Comparison of Brn3a
immunohistochemistry (C, E) and -gal
activity (D, F) in the P0
hindbrain shows that the nuclear expression of Brn3a protein in
hindbrain reticular neurons and the inferior olivary nucleus is
distinct from -gal staining that corresponds to the projections of
sensory axons to the trigeminal nucleus. In G,
immunohistochemistry for -gal protein shows expression of the LacZ
transgene in a cervical dorsal root ganglion of a P0 mouse and in the
associated proximal and distal roots. Aq, Aqueduct;
Cb, cerebellum; d, distal root (of
ganglion); DH, dorsal horn (of spinal cord);
DRG, dorsal root ganglion; IC, principal
nucleus of inferior colliculus; IO, inferior olive;
mes5, mesencephalic trigeminal; p,
proximal root (of ganglion); Pr5, principal trigeminal
nucleus; pr5, principal tract of the trigeminal;
Sp5, spinal trigeminal nucleus; SC,
superior colliculus; VC, ventral cochlear nucleus.
|
|
We then compared Brn3a immunohistochemistry with -gal staining in
hindbrain sections of 11 kb/LacZ mice to determine whether the LacZ
expression observed in whole mounts originated in CNS neurons or in
sensory axons. In the hindbrain, scattered reticular neurons, the
nucleus ambiguus, and the inferior olivary nucleus stained for Brn3a
protein (Fig. 2C,E). -Gal activity showed a diffuse pattern characteristic of expression in axonal tracts rather
than cell bodies (Fig.
2D,F). Staining was confined
to the principal nucleus of the trigeminal (Pr5) and the spinal
trigeminal nucleus (Sp5), which did not contain Brn3a immunoreactivity,
except for a few adjacent reticular neurons. Similarly, in the spinal cord, immunofluorescent staining for -gal in 11 kb/LacZ mice was
strong in the DRG, its central and peripheral roots, and in white
matter adjacent to the dorsal horn (Fig. 2G). However, no staining was noted in the intermediate spinal gray, in which the Brn3a-expressing spinal neurons reside (Fedtsova and Turner, 1997 ). Together, these results show that -gal expression in the hindbrain and spinal cord originates entirely in peripheral sensory neurons, that
the 11 kb/LacZ transgene is specific for these neurons, and that
reporter expression is determined by functional neuronal class rather
than by anatomical location. Experiments are underway to determine
whether these Brn3a regulatory sequences function as a discrete sensory
enhancer and whether a similar independent regulatory region controls
expression of Brn3a in the CNS.
Sensory axon growth is defective in Brn3a null mice
Brn3a knock-out mice have been shown to exhibit profound defects
in the development of the sensory ganglia. The trigeminal ganglia of
these mice fail to express TrkC and show a significant secondary loss
of TrkA- and TrkB-expressing neurons by E15.5, followed by extensive
sensory apoptosis (Huang et al., 1999 ). To better understand sensory
neurogenesis in mice lacking Brn3a, we interbred 11 kb/LacZ reporter
mice with an existing mouse strain containing a Brn3a null allele
(Xiang et al., 1996 ). Unexpectedly, the 11 kb/LacZ,
Brn3a / mice exhibit a profound defect
in sensory axonal growth that precedes the period of Trk receptor loss
and sensory neural death.
Examination of 11 kb/LacZ, Brn3a /
embryos beginning at E11.5, when -gal expression can first be
detected, showed that the cranial sensory and dorsal root ganglia
condensed as expected. Initially, the ophthalmic, maxillary, and
mandibular branches of the trigeminal nerve also formed normally and
began to grow toward their peripheral targets. However, by E13.5,
Brn3a / mice exhibited numerous
abnormal axon bundles emerging directly from the trigeminal ganglion
(Fig.
3B,D).
In addition, premature branching of the nerve is observed, particularly
of the ophthalmic and maxillary divisions. Examination of the dorsal
aspect of 11 kb/LacZ, Brn3a / and
control embryos showed that the aberrant sensory axons did not cross
the midline of the embryo and also that the projections of the sensory
ganglia to the hindbrain and spinal cord continued to obey a midline
boundary (Fig. 3G,H).

View larger version (102K):
[in this window]
[in a new window]
|
Figure 3.
Sensory axon growth in Brn3a null mice.
Brn3a+/ control (A,
C, E, G) and
Brn3a / (B, D,
F, H) E13.5 embryos were stained
for -gal activity and (A-F) were hemisected
before clearing. The major axonal projections of the sensory ganglia
are present in Brn3a knock-out mice (A,
B), but there is extensive abnormal branching,
particularly in the ophthalmic and maxillary divisions of the
trigeminal (C, D, arrows).
Occipital sensory structures, which normally regress by this stage
(E), persist abnormally in Brn3a null mice
(F, arrows). Dorsal views of control and
Brn3a knock-out embryos show that the aberrant sensory axons do not
cross the midline in either the CNS or the periphery (G,
H). The patterns of axonal growth in 11 kb/LacZ,
Brn3a / and heterozygous controls were very
similar in specimens obtained from three different litters staged from
E13.5 to E14.5. In preliminary experiments, it was observed that
Brn3a / embryos stained more intensely than
Brn3a+/ littermates, consistent with negative
autoregulation by Brn3a. Because we wished to ensure that no axonal
projections would be overlooked in control embryos as a
result of lower reporter expression, controls were deliberately stained
two to four times longer than knock-out embryos. This overstaining
resulted in very intense signal in the sensory ganglia of controls
(A, C) and some diffusion of the -gal
reaction product into the surrounding tissue of the ganglia.
5g, Trigeminal ganglion; 8g,
vestibulocochlear ganglion; 9g, superior ganglion of
glossopharyngeal nerve; C2, dorsal root ganglion
corresponding to cervical segment C2; Mn, mandibular
division of trigeminal nerve; Mx, maxillary division of
trigeminal nerve; Op, ophthalmic division of trigeminal
nerve; Pr5, principal trigeminal nucleus.
|
|
Another striking finding in Brn3a /
mice was the intense expression of the -gal transgene in peripheral
structures associated with the most rostral sclerotomes in the early
embryo (Fig. 3F, arrows). In all avian and
mammalian species examined, neural crest precursors condense into
ganglia in this region and then regress (Lim et al., 1987 ; Geffen and
Goldstein, 1996 ; Rosen et al., 1996 ; Kant and Goldstein, 1999 ). In the
mouse, the most anterior permanent dorsal root ganglion is associated
with the spinal segment C2. The embryonic ganglia associated with C1
("Froriep's ganglion") and the occipital segments O1-O4
degenerate before E12 (Kessel and Gruss, 1991 ).
In Brn3a+/ mice, expression of the 11 kb/LacZ transgene adjacent to the occipital segments was discernable at
E12.5 (Fig. 1C) but was undetectable at later stages (Fig.
3E). In Brn3a knock-out mice examined at E13.5, intensely
staining neuronal structures were distributed between the ninth
ganglion and the first permanent DRG at C2 (Fig. 3F)
and were connected to the hindbrain at their corresponding axial
levels. Ultimately, these structures were observed to disappear with
the death of the rest of the Brn3a sensory neurons after E15.5.
Considering the extensive axonal defects in
Brn3a / mice, we wished to know whether
the trigeminal neurons in these mice could effectively innervate their
peripheral targets. One of the major targets of the maxillary division
of the trigeminal are the whisker follicles, or vibrissae. The
vibrissal follicles are complex sensory organs containing several kinds
of sensory nerve endings, including pain fibers and multiple types of
mechanoreceptors (Fundin et al., 1997 ). When stained for -gal
activity in E13.5 embryos, the maxillary axons of
Brn3a / embryos appeared to end
abruptly before reaching their targets (Fig.
4A,B).
Whisker follicles were then examined in serial sections using -gal
immunofluorescence (Fig. 4C,D). We examined
sections through the central portion of 29 follicles from two
Brn3a+/ embryos and 34 follicles from
two Brn-3a / littermates. Encirclement
of the follicle by sensory axons was scored in the section showing the
most complete circle as complete (>90%), partial (50-90%), or
incomplete (<50%). Among Brn3a+/
follicles, 19 showed complete, 7 partial, and 3 incomplete
encirclement. Among Brn3a / follicles,
7 showed complete, 6 partial, and 21 incomplete encirclement ( 2 test; p < 0.01 for
the difference between Brn3a+/ follicles
and all follicles examined; p < 0.02 for the
difference between Brn3a / and the
entire sample).

View larger version (83K):
[in this window]
[in a new window]
|
Figure 4.
Sensory axons fail to innervate whisker follicles
in Brn3a null mice. The whisker follicles of
Brn3a+/ (A, C,
E) and Brn3a / (B,
D, F) embryos were examined in
detail at E13.5 for the expression of -gal by activity staining
(A, B) and immunohistochemistry for
-gal protein (C, D). At this stage,
most of the follicles of Brn3a+/ mice (and
Brn3a+/+ mice; data not shown) were completely
encircled by -gal-containing sensory axons, whereas follicles of
Brn3a / mice were mostly not encircled. The
follicles of both embryos appeared normal by hemoxylin-eosin histology
(E, F).
|
|
We then examined 11 kb/LacZ, Brn3a /
mice to determine the fate of the sensory neurons and their axons later
in development. Beginning at approximately E15.5, sensory neurons have
been shown previously to undergo extensive apoptosis in
Brn3a / mice (McEvilly et al., 1996 ;
Xiang et al., 1996 ; Huang et al., 1999 ). However, ~30% of trigeminal
neurons survive until birth (Huang et al., 1999 ). From pervious
studies, it has not been clear whether the surviving cells are a subset
of neurons that normally express Brn3a but do not require its activity
for survival, or neurons that do not express this factor, because no
independent markers have been available to identify the
Brn3a-expressing neurons in Brn3a null mice. At E16.5 in 11 kb/LacZ,
Brn3a / mice, sensory cell bodies in
the trigeminal, eighth and ninth cranial ganglia, and DRG could no
longer be visualized by -gal staining except in the developmentally
youngest sacral ganglia (Fig.
5A,B).
This confirms that the loss of Brn3a-expressing neurons is complete or
nearly so at this stage and that all sensory neurons that express Brn3a
absolutely require it for survival. Because the surviving neurons in
the sensory ganglia do not express the 11 kb/LacZ transgene, they
probably represent a subclass of cells that are normally Brn3a-negative
at this developmental stage.

View larger version (115K):
[in this window]
[in a new window]
|
Figure 5.
Sensory neuronal death in late gestation in Brn3a
null mice. Brn3a+/ (A,
C) and Brn3a / (B,
D) embryos were examined by -gal activity staining at
E16.5, after the onset of sensory neural apoptosis. Although the
sensory ganglia can no longer be seen in the
Brn3a / embryo, -gal activity persists in the
sensory axons, and numerous defects in axonal guidance can be seen in
the mutant embryos (B). The defect in the
encirclement of the whisker follicles noted at E13.5 also persists at
this stage (D).
|
|
The 11 kb/LacZ, Brn3a / mice examined
at E16.5 also exhibited a loss of -gal activity in the proximal part
of the major divisions of the trigeminal nerve and in the CNS
trigeminal projections (Fig. 5B), consistent with axonal
degeneration after the death of these neurons. However, -gal
activity was still detectable in the distal parts of the sensory
nerves, and these appeared markedly overgrown compared with control
littermates, with abnormal dorsal and recurrent branches that violated
segmental boundaries (Fig. 5A,B).
Closer examination of the whisker pad at E16.5 (Fig. 5C,D) shows that the defect in encirclement of
whisker follicles noted at E13.5 persists and is not just a delay in
the innervation of these structures.
Loss of neurotrophin or semaphorin receptors does not account for
defective axonal guidance in Brn3a / mice
Loss of TrkA and TrkB expression from the majority of trigeminal
neurons in Brn3a / mice occurs after
E13.5 (Huang et al., 1999 ), suggesting that the loss of these receptors
cannot account for the abnormal axonal growth observed here. However,
TrkC expression is not detectable at any time in embryogenesis in
Brn3a / mice. For this reason, we
examined the expression of -gal under regulation of the 11 kb/LacZ
reporter in TrkC / mice to see whether
the loss of TrkC expression is sufficient to alter axonal growth in
Brn3a / -expressing neurons. In
TrkC knock-out embryos examined at E14, the principal divisions of the
trigeminal nerve did not exhibit the abnormal branching observed in the
absence of Brn3a (Fig. 6A,B),
and the encirclement of the whisker follicles appeared to be complete
(Fig. 6C,D).

View larger version (77K):
[in this window]
[in a new window]
|
Figure 6.
Sensory axon guidance in TrkC neurotrophin
receptor-deficient mouse embryos. Mice carrying the 11 kb/LacZ
transgene were interbred with TrkC+/ mice, and
then the resulting 11 kb/LacZ, TrkC+/ mice were
crossed with TrkC+/ mice to produce litters
containing the 11 kb/LacZ, TrkC+/ embryos
(A, C) and 11 kb/LacZ,
TrkC / (B, D)
littermates. Examined at E13.5, TrkC mutant embryos lack the ectopic
trigeminal branches noted in Brn3a null mice (A,
B) and show normal encirclement of the whisker follicles
by -gal-expressing sensory axons (C,
D). 5g, Trigeminal ganglion;
Mn, mandibular division, trigeminal nerve;
Mx, maxillary division, trigeminal nerve;
Op, ophthalmic division, trigeminal nerve;
Pr5, principal trigeminal nucleus.
|
|
Trigeminal axon guidance appears to be regulated in part by the ligand
semaphorin 3A (Sema3A) and by its receptor Npn-1, which together repel
sensory axons by inducing growth cone collapse (Kolodkin et al., 1997 ).
Npn-1 is expressed in the trigeminal ganglion, and
Npn-1 / mice exhibit abnormal branching
of the major divisions of the trigeminal nerve strongly resembling that
observed here in Brn3a / embryos
(Kitsukawa et al., 1997 ). We therefore wished to know whether Npn-1
expression was altered in the absence of Brn3a. However, for both the
trigeminal ganglion (Fig.
7A,B)
and the DRG (Fig. 7C,D), Npn-1 expression was
observed within the ganglia, in the peripheral sensory nerves, and in
the CNS areas innervated by the ganglia, in both control and Brn3a
knock-out mice. Thus, regulation of Npn-1 expression by Brn3a does not
appear to account for the similarity of the phenotypes observed in the
null mutants of these two genes.

View larger version (107K):
[in this window]
[in a new window]
|
Figure 7.
Neuropilin-1 expression in control and
Brn3a-deficient mice. Brn3a+/ (A,
C) and Brn3a / (B,
D) embryos were examined at E14 for Npn1
immunoreactivity. Sagittal sections through the trigeminal ganglion and
hindbrain (A, B) and cross-sections
through the cervical spinal cord and dorsal root ganglion
(C, D) show Npn1 expression in the
expected sensory structures in both the presence and absence of Brn3a.
5g, Trigeminal ganglion; d, distal root
(of ganglion); DH, dorsal horn (of spinal cord);
DRG, dorsal root ganglion; Mn, mandibular
division, trigeminal nerve; Mx, maxillary division,
trigeminal nerve; p, proximal root (of ganglion).
|
|
 |
DISCUSSION |
The POU-domain factor Brn3a is a neural identity gene expressed in
specific neurons in the caudal CNS and in cranial and spinal sensory
neurons. Previous studies have shown that this factor is required for
the survival of sensory neurons and some of the CNS neurons in which it
is expressed (McEvilly et al., 1996 ; Xiang et al., 1996 ; Huang et al.,
1999 ). Here we have demonstrated that Brn3a is also necessary for the
normal growth of sensory axons.
Before this study, little was known about the transcriptional
regulation of neural identity and axonal guidance in the sensory system. The basic helix-loop-helix factors neurogenin-1 (Ngn-1) and Ngn-2 have early roles in the development of the sensory ganglia (Perez et al., 1999 ). However, mutations of these genes lead to the
early loss of sensory precursors rather than the late death of normally
formed ganglia seen in Brn3a / mice
(Fode et al., 1998 ; Ma et al., 1998 ). Mice with mutations at the Pax-3
locus have diminished dorsal root ganglia attributable to defects in
neural crest migration but also show some defects in axonal projections
of the trigeminal ganglion (Tremblay et al., 1995 ). Interestingly,
Brn3a and the motor neuron marker Islet-1 are both expressed in the
differentiating trigeminal ganglion, DRG, and mes5, but have mutually
exclusive expression patterns in the rest of the nervous system
(Ericson et al., 1992 ; Fedtsova and Turner, 1997 ; Cui and Goldstein,
2000 ; N. Fedtsova, unpublished results). The embryonic death of mice
lacking Islet-1 (Pfaff et al., 1996 ) has thus far prevented a detailed
study of the role of Islet-1 in the sensory system. Finally, recent
work on the ETS gene Er81 has shown that this factor, expressed
in both proprioceptive sensory neurons and their motor neuron targets,
is necessary for the formation of correct connections between these
neuronal classes (Arber et al., 2000 ).
The death of the trigeminal and DRG neurons in
Brn3a / mice has been attributed to the
loss of several components of the neurotrophin signaling system,
including the low-affinity NGF receptor (LNGFR), BDNF, TrkA, TrkB, and
TrkC (McEvilly et al., 1996 ; Huang et al., 1999 ). Target-derived
neurotrophins have been shown to be essential for the survival of
sensory neurons, initially by surgical manipulation of their target
fields (Carr and Simpson, 1978 ) and the application of anti-NGF
antisera (Johnson et al., 1980 ). More recently, genetic methods have
shown each of the neurotrophins and their receptors to be necessary for
the survival of a subset of sensory neurons (Snider, 1994 ), and
the loss of all three Trk receptors would be likely to result in the
extensive sensory apoptosis observed in
Brn3a / embryos. However, two major
problems arise with the hypothesis that neurotrophins or their
receptors are the essential targets of Brn3a regulation in the sensory
system. First, although Brn3a is coexpressed with these receptors in
sensory neurons, the expression of Brn3a does not coincide well with
the expression of any of the Trk receptors, BDNF, or the LNGFR in the
autonomic system or CNS. Second, whereas TrkC is never significantly
expressed in Brn3a / trigeminal
neurons, TrkA and TrkB are coexpressed with Brn3a for several
developmental days (E10.5-E15.5) before Trk expression is lost and
apoptosis ensues. These findings suggest that the effect of Brn3a on
the expression of the neurotrophin receptors may be indirect.
Sensory neuronal death at approximately E15.5 in Brn3a knock-out mice
coincides with a period of naturally occurring apoptosis in the
developing trigeminal ganglion (E13-E18), which has been reported as
encompassing from a negligible number to nearly half of the neuronal
population of the ganglion (Davies and Lumsden, 1984 ; Pinon et al.,
1996 ; Huang et al., 1999 ) and also corresponds to the time during which
death is most increased by the deprivation of target-derived NGF (Pinon
et al., 1996 ). Furthermore, trigeminal neurons lacking Brn3a, taken
from before the onset of apoptosis, are supported by NGF in culture
(Huang et al., 1999 ). Thus, our data raise an alternate hypothesis for
the mechanism of sensory neural death in Brn3a knock-out mice. It is
possible that neuronal death in Brn3a /
mice may result from the failure of sensory axons to correctly innervate their targets and access target-derived factors rather than
the direct regulation of multiple components of the neurotrophin signaling system by Brn3a.
Here we have demonstrated two significant defects in sensory axon
guidance in mouse embryos deficient in Brn3a. First, the major
divisions of the trigeminal ganglion develop normally, but trigeminal
axons fail to correctly innervate their peripheral targets,
particularly the whisker follicles. Second, there are numerous abnormal
branches of the trigeminal, particularly of the ophthalmic and
maxillary divisions. It remains to be seen what regulatory targets of
Brn3a mediate these aspects of sensory guidance and whether the same
downstream genes account for both effects.
The most economical explanation for the failure of sensory neurons to
innervate peripheral targets in Brn3 /
mice would be an effect mediated directly by neurotrophins.
Neurotrophins have been implicated in growth cone guidance by local
chemoattraction using in vitro assays (McFarlane and
Holt, 1997 ; Paves and Saarma, 1997 ), but in vivo axonal
guidance effects have been obscured by the requirement of neurotrophins
for sensory neural survival. Recently sensory axon development has been
examined in TrkA / mice in which the
sensory ganglia were rescued by the elimination of the mediator of
apoptosis BAX (Patel et al., 2000 ). Like Brn3a-deficient mice, the
sensory ganglia of these mice show intact projections to the CNS but
defective innervation of the periphery, including the whisker
follicles. However, it is difficult to explain the failure of
trigeminal axons in Brn3a knock-out mice by a TrkA-mediated mechanism,
because TrkA and TrkB continue to be expressed in
Brn3a / ganglia during the initial
sensory innervation of the skin, at least in the majority of neurons
that usually express these factors (Huang et al., 1999 ). TrkC is absent
in Brn3a / mice throughout sensory
neurogenesis, but as shown here, the Brn3a-expressing sensory neurons
in TrkC / mice do not exhibit similar
defects in cutaneous innervation. Furthermore, mice lacking
neurotrophin-3 and BDNF show normal early development of
trigeminal projections (O'Connor and Tessier-Lavigne, 1999 ). Thus,
loss of Trk expression may not be an adequate explanation for the
failure of the trigeminal ganglion to innervate the whisker follicles
in mice lacking Brn3a.
The sensory axons of Brn3a / mice also
exhibit growth of axon bundles into inappropriate cranial regions and
excessive and premature branching of the divisions of the trigeminal
nerve, suggestive of a deficit in repulsive guidance. This effect is
not likely to be mediated by a loss of Trk receptors, because most
studies of the effects of neurotrophins on axon growth suggest that the neurotrophins promote axon elongation, turning, and branching rather
than repulsive guidance (McFarlane and Holt, 1997 ; Lentz et al.,
1999 ). The best characterized mediator of sensory axon repulsion
is Sema3A, which is expressed in mesodermal and CNS tissues known to
repel sensory axons (Messersmith et al., 1995 ; Puschel et al., 1995 )
and acts through its receptor Npn-1 (He and Tessier-Lavigne, 1997 ;
Kolodkin et al., 1997 ). Like Brn3a /
embryos, mice deficient in Sema3A develop the major divisions of the
trigeminal nerve but show defasciculation and projection of trigeminal
axons into abnormal areas (Taniguchi et al., 1997 ). However, despite
these defects, encirclement of the whisker follicles by trigeminal
axons appears relatively normal in these mice (Ulupinar et al.,
1999 ).
Npn-1 is strongly expressed in the trigeminal and dorsal root ganglia
(Kolodkin et al., 1997 , and this paper). Mice lacking Npn-1 die
in utero at approximately E12.5, but before this, the developing trigeminal ganglia also extend aberrant axons similar to
those observed in Brn3a / mice
(Kitsukawa et al., 1997 ). However, our results show that Brn3a / mice express Npn-1 in the
trigeminal and dorsal root ganglia and in their central and peripheral
nerve roots. Still, defects in the Sema3A/Npn-1 signaling pathway
remain a feasible explanation for the abnormal axon pathfinding in mice
lacking Brn3a. One possible mechanism is a defect in the expression of
Npn-1 cofactors that may be necessary to form a functional receptor
complex, such as members of the plexin family, at least one of which is
highly expressed in sensory ganglia (Takahashi et al., 1999 ; Tamagone et al., 1999 ).
 |
FOOTNOTES |
Received Aug. 8, 2000; revised Oct. 10, 2000; accepted Oct. 25, 2000.
This work was supported in part by Department of Veterans Affairs MERIT
funding and VISN 22 Mental Illness Research Education and Clinical
Center (E.E.T.), National Institutes of Health Training Grant
5-T32-MH19934 (N.F.), and National Institutes of Health Awards HD33442,
MH58447, and MH01581. N.F. and E.E.T. are National Alliance for
Research on Schizophrenia and Depression Young Investigators. We thank
Dr. Martin Paulus for help with the statistical analysis, and Drs. Alun
Davies, Ronald S. Goldstein, and David Anderson for helpful
discussions. We also thank Drs. Louis Reichardt and Eric Huang for
providing the Trk mutant mouse strains and Dr. David Ginty for the
Npn-1 antiserum.
Correspondence should be addressed to Eric E. Turner, Department of
Psychiatry, 0603, University of California, San Diego, 9500 Gilman
Drive, La Jolla, CA 92093-0603. E-mail: eturner{at}ucsd.edu.
 |
REFERENCES |
-
Arber S,
Ladle DR,
Lin JH,
Frank E,
Jessell TM
(2000)
ETS gene Er81 controls the formation of functional connections between group 1a sensory afferents and motor neurons.
Cell
101:485-496[Web of Science][Medline].
-
Carr VM,
Simpson SB
(1978)
Proliferative and degenerative events in the early development of chick dorsal root ganglia. II. Responses to altered peripheral fields.
J Comp Neurol
182:741-756[Web of Science][Medline].
-
Cui S,
Goldstein RS
(2000)
Early markers of neuronal differentiation in DRG: Islet-1 expression precedes that of Hu.
Dev Brain Res
121:209-221[Medline].
-
Davies A,
Lumsden A
(1984)
Relation of target encounter and neuronal death to the nerve growth factor responsiveness in the developing mouse trigeminal ganglion.
J Comp Neurol
223:124-137[Web of Science][Medline].
-
Ericson J,
Thor S,
Edlund T,
Jessell TM,
Yamada T
(1992)
Early stages of motor neuron differentiation revealed by expression of homeobox gene Islet-1.
Science
256:1555-1560[Abstract/Free Full Text].
-
Erkman L,
McEvilly RJ,
Luo L,
Ryan AK,
Hooshmand F,
O'Connell SM,
Keithley EM,
Rapaport DH,
Ryan AF,
Rosenfeld MG
(1996)
Role of transcription factors Brn-3.1 and Brn-3.2 in auditory and visual system development.
Nature
381:603-606[Medline].
-
Fedtsova N,
Turner EE
(1995)
Brn3.0 expression identifies early post-mitotic CNS neurons and sensory neural precursors.
Mech Dev
53:291-304[Medline].
-
Fedtsova N,
Turner EE
(1997)
Inhibitory effects of ventral signals on the development of Brn-3.0-expressing neurons in the dorsal spinal cord.
Dev Biol
190:18-31[Web of Science][Medline].
-
Fode C,
Gradwohl G,
Morin X,
Dierich A,
LeMeur M,
Goridis C,
Guillemot F
(1998)
The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons.
Neuron
20:483-494[Web of Science][Medline].
-
Fundin BT,
Silos-Santiago I,
Ernfors P,
Fagan AM,
Aldskogius H,
DeChiara TM,
Phillips HS,
Barbacid M,
Yancopoulos GD,
Rice FL
(1997)
Differential dependency of cutaneous mechanoreceptors on neurotrophins trk receptors and P75 LNGR.
Dev Biol
190:94-116[Web of Science][Medline].
-
Gan L,
Xiang M,
Zhou L,
Wagner DS,
Klein WH,
Nathans J
(1996)
POU-domain factor Brn-3b is required for the development of a large set of retinal ganglion cells.
Proc Natl Acad Sci USA
93:3920-3925[Abstract/Free Full Text].
-
Geffen R,
Goldstein RS
(1996)
Rescue of sensory ganglia that are programmed to degenerate in normal development: evidence that NGF modulates proliferation of DRG cells in vivo.
Dev Biol
178:51-62[Medline].
-
Gerrero MR,
McEvilly R,
Turner E,
Lin C,
O'Connell S,
Jenne K,
Hobbs MV,
Rosenfeld MG
(1993)
The mammalian POU Protein Brn-3 is linked to the pituitary B cells and sensory neuronal development.
Proc Natl Acad Sci USA
90:10841-10845[Abstract/Free Full Text].
-
Gruber CA,
Rhee JM,
Gleiberman A,
Turner EE
(1997)
POU-domain factors of the Brn-3 class recognize functional DNA elements which are distinctive, symmetrical, and highly conserved in evolution.
Mol Cell Biol
17:2391-2400[Abstract].
-
He Z,
Tessier-Lavigne M
(1997)
Neuropilin is a receptor for the axonal chemorepellent Semaphorin III.
Cell
90:739-751[Web of Science][Medline].
-
Huang EJ,
Zang K,
Schmidt A,
Saulys A,
Xiang M,
Reichardt LF
(1999)
POU domain factor Brn-3a controls the differentiation and survival of trigeminal neurons by regulating Trk receptor expression.
Development
126:2869-2882[Abstract].
-
Johnson EM,
Gorin PD,
Brandeis LD,
Pearson J
(1980)
Dorsal root ganglion neurons are destroyed by exposure in utero to maternal antibody to nerve growth factor.
Science
210:916-918[Abstract/Free Full Text].
-
Kant R,
Goldstein RS
(1999)
Plasticity of axial identity among somites: cranial somites can generate vertebrae without expressing hox genes appropriate to the trunk.
Dev Biol
216:507-520[Web of Science][Medline].
-
Kessel M,
Gruss P
(1991)
Homeotic transformations of murine vertebrae and concomitant alteration of hox codes induced by retinoic acid.
Cell
67:89-104[Web of Science][Medline].
-
Kitsukawa T,
Shimizu M,
Sanbo M,
Hirata T,
Taniguchi M,
Bekku Y,
Yagi T,
Fujisawa H
(1997)
Neuropilin-Semaphorin III/D mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice.
Neuron
19:995-1005[Web of Science][Medline].
-
Klein R,
Silos-Santiago I,
Smeyne RJ,
Lira SA,
Brambilla R,
Bryant S,
Zhang L,
Snider WD,
Barbacid M
(1994)
Disruption of the neurotrophin-3 receptor gene trkC eliminates Ia muscle afferents and results in abnormal movements.
Nature
368:249-251[Medline].
-
Kolodkin AL,
Levengood D,
Rowe EG,
Tai Y,
Giger RJ,
Ginty DD
(1997)
Neuropilin is a semaphorin III receptor.
Cell
90:753-762[Web of Science][Medline].
-
Lentz SI,
Knudson MC,
Korsmeyer SJ,
Snider WD
(1999)
Neurotrophins support the development of diverse sensory axon morphologies.
J Neurosci
19:1038-1048[Abstract/Free Full Text].
-
Lim TM,
Lunn ER,
Keynes RJ,
Stern CD
(1987)
The differing effect of occipital and trunk somites on neural development in the chick embryo.
Development
100:525-533[Abstract].
-
Logan C,
Khoo WK,
Cado D,
Joyner AL
(1993)
Two enhancer regions in the mouse En-2 locus direct expression to the mid/hindbrain region and mandibular myoblasts.
Development
117:905-916[Abstract].
-
Ma Q,
Chen Z,
Barrantes I,
de la Pompa JL,
Anderson DL
(1998)
Neurogenin1 is essential for the determination of neuronal precursors for proximal sensory ganglia.
Neuron
20:469-482[Web of Science][Medline].
-
McEvilly RJ,
Erkman L,
Luo L,
Sawchenko PE,
Ryan AF,
Rosenfeld MG
(1996)
Requirement for Brn-3.0 in differentiation and survival of sensory and motor neurons.
Nature
384:574-577[Medline].
-
McFarlane S,
Holt CE
(1997)
Growth factors: a role in guiding axons?
Trends Cell Biol
7:424-430[Medline].
-
Messersmith EK,
Leonardo ED,
Shatz CJ,
Tessier-Lavigne M,
Goodman CS,
Kolodkin AL
(1995)
Semaphorin III can function as a selective chemorepellant to pattern sensory projections in the spinal cord.
Neuron
14:949-959[Web of Science][Medline].
-
O'Connor R,
Tessier-Lavigne M
(1999)
Identification of maxillary factor, a maxillary process-derived chemoattractant for developing trigeminal sensory axons.
Neuron
24:165-178[Medline].
-
Patel TD,
Jackman A,
Rice FL,
Kucera J,
Snider WD
(2000)
Development of sensory neurons in the absence of NGF/TrkA signalling in vivo.
Neuron
25:345-357[Web of Science][Medline].
-
Paves H,
Saarma M
(1997)
Neurotrophins as in vitro growth cone guidance molecules for embryonic sensory neurons.
Cell Tissue Res
290:285-297[Web of Science][Medline].
-
Perez S,
Rebelo S,
Anderson DJ
(1999)
Early specification of sensory neuron fate revealed by expression and function of neurogenins in the chick embryo.
Development
126:1715-1728[Abstract].
-
Pfaff SL,
Mendelsohn M,
Stewart CL,
Edlund T,
Jessell TM
(1996)
Requirement for LIM homeobox gene Isl-1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation.
Cell
84:309-320[Web of Science][Medline].
-
Pinon LG,
Minichiello L,
Klein R,
Davies AM
(1996)
Timing of neuronal death in trkA, trkB and trkC mutant embryos reveals developmental changes in sensory neuron dependence on Trk signalling.
Development
122:3255-3261[Abstract].
-
Puschel AW,
Adams RH,
Betz H
(1995)
Murine semaphorinD/collapsin is a member of a diverse gene family and creates domains inhibitory for axonal extension.
Neuron
14:941-948[Web of Science][Medline].
-
Rokx JTM,
Juch PJW,
vanWillingen JD
(1986)
Arrangement and connections of mesencephalic trigeminal neurons in the rat.
Acta Anat
127:7-15[Web of Science][Medline].
-
Rosen O,
Geffen R,
Avivi C,
Goldstein RS
(1996)
Growth, proliferation, and cell death in the ontogeny of transient DRG (Froriep's ganglia) of chick embryos.
J Neurobiol
30:219-230[Medline].
-
Rubenstein JLR,
Puelles L
(1994)
Homeobox gene expression during development of the vertebrate brain.
Curr Top Dev Biol
29:1-63[Web of Science][Medline].
-
Snider WD
(1994)
Functions of the neurotrophins during nervous system development: What the knockouts are teaching us.
Cell
77:627-638[Web of Science][Medline].
-
Takahashi T,
Fournier A,
Nakamura F,
Wang L,
Murakami Y,
Kalb RG,
Fujisawa H,
Strittmatter SM
(1999)
Plexin-neuropilin-1 complexes form functional semaphorin-3A receptors.
Cell
99:59-69[Web of Science][Medline].
-
Tamagone L,
Aritgiani S,
Chen H,
He Z,
Ming G,
Song H,
Chedotal A,
Winberg ML,
Goodman CS,
Poo M,
Tessier-Lavigne M,
Comoglio PM
(1999)
Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates.
Cell
99:71-80[Web of Science][Medline].
-
Taniguchi M,
Yuasa S,
Fujisawa H,
Naruse I,
Saga S,
Mishina M,
Yagi T
(1997)
Disruption of semaphorin III/D gene causes severe abnormality of peripheral nerve projection.
Neuron
19:519-530[Web of Science][Medline].
-
Theiler K
(1989)
In: The house mouse: atlas of embryonic development. New York: Springer.
-
Tremblay P,
Kessel M,
Gruss P
(1995)
A transgenic neuroanatomical marker identifies cranial neural crest deficiencies associated with the Pax3 mutant Splotch.
Dev Biol
171:317-329[Web of Science][Medline].
-
Trieu M,
Rhee JM,
Fedtsova N,
Turner EE
(1999)
Autoregulatory sequences are revealed by complex stability screening of the mouse brn-3.0 locus.
J Neurosci
19:6549-6558[Abstract/Free Full Text].
-
Turner EE,
Fedtsova N,
Rosenfeld MG
(1996)
POU-domain factor expression in the trigeminal ganglion and implications for herpes virus regulation.
NeuroReport
7:2829-2832[Medline].
-
Ulupinar E,
Datwani ABehar O,
Fujisawa H,
Erzurmulu R
(1999)
Role of semaphorin III in the developing rodent trigeminal system.
Mol Cell Neurosci
13:281-292[Web of Science][Medline].
-
Xiang M,
Lin G,
Zhou L,
Klein WH,
Nathans J
(1996)
Targeted deletion of the mouse POU-domain gene Brn-3a causes a selective loss of neurons in the brainstem and trigeminal ganglion, uncoordinated limb movement, and impaired suckling.
Proc Natl Acad Sci USA
93:11950-11955[Abstract/Free Full Text].
-
Xiang M,
Gan L,
Zhou L,
Klein WH,
Nathans J
(1997a)
Essential role of POU-domain factor Brn-3c in auditory and vestibular hair cell development.
Proc Natl Acad Sci USA
93:1950-1955[Abstract/Free Full Text].
-
Xiang M,
Gan L,
Li D,
Zhou L,
Chen Y,
Wagner D,
O'Malley BW,
Klein W,
Nathans J
(1997b)
Role of the Brn-3 family of POU-domain genes in the development of the auditory/vestibular, somatosensory, and visual systems.
Cold Spring Harb Symp Quant Biol
52:325-336.
Copyright © 2001 Society for Neuroscience 0270-6474/01/212541-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. Hjerling-Leffler, F. Marmigere, M. Heglind, A. Cederberg, M. Koltzenburg, S. Enerback, and P. Ernfors
The boundary cap: a source of neural crest stem cells that generate multiple sensory neuron subtypes
Development,
June 1, 2005;
132(11):
2623 - 2632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Hudson, P. J. Morris, D. S. Latchman, and V. S. Budhram-Mahadeo
Brn-3a Transcription Factor Blocks p53-mediated Activation of Proapoptotic Target Genes Noxa and Bax in Vitro and in Vivo to Determine Cell Fate
J. Biol. Chem.,
March 25, 2005;
280(12):
11851 - 11858.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Pan, Z. Yang, L. Feng, and L. Gan
Functional equivalence of Brn3 POU-domain transcription factors in mouse retinal neurogenesis
Development,
February 15, 2005;
132(4):
703 - 712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Wiggins, G. Wei, E. Doxakis, C. Wong, A. A. Tang, K. Zang, E. J. Luo, R. L. Neve, L. F. Reichardt, and E. J. Huang
Interaction of Brn3a and HIPK2 mediates transcriptional repression of sensory neuron survival
J. Cell Biol.,
October 25, 2004;
167(2):
257 - 267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Eng, J. Lanier, N. Fedtsova, and E. E. Turner
Coordinated regulation of gene expression by Brn3a in developing sensory ganglia
Development,
August 15, 2004;
131(16):
3859 - 3870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Li, F. Qiu, A. Xu, S. M. Price, and M. Xiang
Barhl1 Regulates Migration and Survival of Cerebellar Granule Cells by Controlling Expression of the Neurotrophin-3 Gene
J. Neurosci.,
March 24, 2004;
24(12):
3104 - 3114.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Kimura-Yoshida, K. Kitajima, I. Oda-Ishii, E Tian, M. Suzuki, M. Yamamoto, T. Suzuki, M. Kobayashi, S. Aizawa, and I. Matsuo
Characterization of the pufferfish Otx2 cis-regulators reveals evolutionarily conserved genetic mechanisms for vertebrate head specification
Development,
January 1, 2004;
131(1):
57 - 71.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ma, L. Lei, S. R. Eng, E. Turner, and L. F. Parada
Brn3a regulation of TrkA/NGF receptor expression in developing sensory neurons
Development,
August 1, 2003;
130(15):
3525 - 3534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Wang, X. Mu, W. J. Bowers, D.-S. Kim, D. J. Plas, M. C. Crair, H. J. Federoff, L. Gan, and W. H. Klein
Brn3b/Brn3c double knockout mice reveal an unsuspected role for Brn3c in retinal ganglion cell axon outgrowth
Development,
March 3, 2003;
129(2):
467 - 477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Trieu, A. Ma, S. R. Eng, N. Fedtsova, and E. E. Turner
Direct autoregulation and gene dosage compensation by POU-domain transcription factor Brn3a
Development,
January 1, 2003;
130(1):
111 - 121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Perez-Sanchez, V. S. Budhram-Mahadeo, and D. S. Latchman
Distinct promoter elements mediate the co-operative effect of Brn-3a and p53 on the p21 promoter and their antagonism on the Bax promoter
Nucleic Acids Res.,
November 15, 2002;
30(22):
4872 - 4880.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|