 |
Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2001, 21(20):7881-7888
Therapeutic Efficacy in Experimental Polyarthritis of
Viral-Driven Enkephalin Overproduction in Sensory Neurons
Joao
Braz1,
Caroline
Beaufour1,
Anne
Coutaux2,
Alberto L.
Epstein3,
François
Cesselin1,
Michel
Hamon1, and
Michel
Pohl1
1 Institut National de la Santé et de la
Recherche Médicale U288, NeuroPsychoPharmacologie
Moléculaire, Cellulaire, et Fonctionnelle and
2 Service de Rhumatologie, Hôpital
Pitié-Salpêtrière, 75013 Paris, France, and
3 Centre de Génétique Moléculaire et
Cellulaire, Centre National de la Recherche Scientifique, Unité
Mixte de Recherche 106, Université Claude Bernard Lyon 1, 69622 Villeurbanne, France
 |
ABSTRACT |
Rheumatoid arthritis is characterized by erosive inflammation of
the joints, new bone proliferation, and ankylosis, leading to severely
reduced locomotion and intense chronic pain. In a model of this
disease, adjuvant-induced polyarthritis in the rat, neurons involved in
pain transmission and control undergo plastic changes, especially at
the spinal level. These changes affect notably neurons that contain
opioids, such as enkephalins deriving from preproenkephalin A (PA)
precursor protein. Using recombinant herpes simplex virus containing
rat PA cDNA, we enhanced enkephalin synthesis in sensory neurons of
polyarthritic rats. This treatment markedly improved locomotion and
reduced hyperalgesia. Furthermore, the progression of bone destruction
slowed down, which is the most difficult target to reach in the
treatment of patients suffering from arthritis. These data demonstrate
the therapeutic efficacy of enkephalin overproduction in a model of
systemic inflammatory and painful chronic disorder.
Key words:
proenkephalin A overproduction; dorsal root sensory
ganglia neurons; polyarthritic rats; reduced hyperalgesia; improved
polyarthritis-related disability; limited joint destruction
 |
INTRODUCTION |
Rheumatoid arthritis is a systemic
autoimmune disease primarily manifested by chronic erosive inflammation
of the joints associated with intense pain (Pearson, 1956 ; Colpaert,
1987 ; Harris, 1990 ). Its etiology is still unknown, but significant
insights into its physiopathology have been obtained from experimental
animal models. Although none of these models has all of the
characteristics of the human disease, adjuvant-induced polyarthritis in
the rat shares numerous behavioral and biochemical characteristics with
rheumatoid arthritis (Pearson, 1956 ; Calvino et al., 1987 ; Colpaert,
1987 ).
Proenkephalin A (PA)-derived peptides are involved in the control of
pain, and an antihyperalgesic action of overexpressed PA was reported
recently in experimentally induced acute inflammatory pain in the mouse
(Wilson et al., 1999 ). Numerous data indicate that opioids, in addition
to acting at central sites, modulate pain and inflammatory processes by
acting at peripheral sites (Stein and Yassouridis, 1997 ; Houghton et
al., 1998 ). At the periphery, opioid peptides are thought to originate
mainly from inflammatory cells (Schäfer et al., 1994 ); however,
although PA is expressed in a relatively slight proportion of cell
bodies of sensory neurons (Pohl et al., 1994 ), which are located in
dorsal root ganglia (DRG), enkephalin-containing axons and terminals
present within glabrous skin (Carlton and Coggeshall, 1997 ) and soft
tissue of joints (El Hassan et al., 1998 ) might represent an additional source of peripheral opioids. Interestingly, in polyarthritic rats, PA
expression drops in lumbar DRG that contain cell bodies of sensory
nerves from hindlimbs (especially affected by the disease) (Pohl et
al., 1997 ), and the levels of the main PA-derived peptide, met-enkephalin (ME), are reduced in the soft tissue of ankle joints (El
Hassan et al., 1998 ).
Altogether, these findings led us to assess whether PA overexpression
in sensory neurons of the hindlimbs could have a beneficial effect in
chronically suffering polyarthritic rats. We used herpes simplex virus
type 1 (HSV-1)-derived vectors, particularly suitable for transgene
transfer into sensory neurons (Geller and Breakefield 1988 ; Davar et
al., 1994 ; Smith et al., 1995 ; Goins et al., 1999 ). We demonstrated
recently these vectors to be highly efficient to drive PA gene
expression in DRG neurons of healthy rats (Antunes-Bras et al., 1998 ,
2001 ). Here, we generated recombinant, rat PA cDNA containing thymidine
kinase-defective HSV-1 vectors (HSVLatEnk) to prevent possible viral
replication and spread.
 |
MATERIALS AND METHODS |
HSV-derived vector construction. The pLatEnk plasmid
was constructed by subcloning under the Lat-long terminal repeat
(LTR) promoter (Lokensgard et al., 1994 ) the rat PA coding
region (derived from pYSEAI; Yoshikawa et al., 1984 ) into the
HindIII-Eco47III-linearized pLat-LTR-LacZ vector
(Antunes-Bras et al., 1998 ). Thymidine kinase gene
(UL23) in KOS HSV-1 DNA, bearing the
Lat-LTR-LacZ transcriptional units in gC locus
(Tk+HSVLat -gal; Antunes-Bras et al.,
1998 ), was disrupted by homologous recombination with p23d plasmid
containing deleted UL23 gene (520 bp
NsiI to SacI fragment).
Tk HSVLat -gal was generated by
cotransfecting 5 µg of linearized p23d DNA, using the calcium
phosphate precipitation method, with 5 µg of HSVLat -gal
into Vero cells grown in 1× DMEM (Life Technologies, Gaithersburg,
MD) containing 10 U/ml of penicillin and streptomycin, 7.5 mM sodium bicarbonate, 2 mM
glutamine, and 10% fetal calf serum. Cell cultures were treated 4 hr
later with 15% glycerol (v/v) and incubated for 4 d at 37°C in
M199 medium (Life Technologies) until the cytopathic effect had spread
throughout the cellular monolayer. Cellular debris were spun down, and
new confluent Vero cells were infected with the resulting supernatant
and incubated at 37°C in the presence of 10 µM acyclovir. Lysis plaques resistant to
acyclovir were picked and separated in two aliquots. One aliquot was
saved, and DNA was extracted from the second one and screened for the
presence of deleted UL23 gene using PCR analysis.
Thirty PCR cycles (96°C 1 min; 60°C 0.5 min; and 72°C 2 min) were
made with 40 pmol of primers (primer A, 5'GCGCTCCTCGTACCAGCGAAG3'; primer B, 5'CCAGCGTCTTGTCAT TGGCG3') (Fig.
1) in a mixture containing 10 mM each dNTP, 25 mM
MgSO4, and 0.5 U of Taq DNA polymerase (Eurobio, Les Ulis, France), in 1× reaction buffer containing 2.5%
formamide. Single plaque-isolated
Tk HSVLat -gal (HSVLat -gal) were
then amplified on Vero cells. HSVLatEnk was generated by pLatEnk DNA
homologous recombination with HSVLat -gal DNA in Vero cells as
indicated above. Recombinant HSVLatEnk were isolated by PCR analysis
and purified by successive limiting dilutions. The presence of both the
disrupted TK gene and the Lat-LTR-pEnk transcriptional unit (primer 1, 5'CTGACTGTGTTTCTGTAT- TTG3'; primer 2, 5'TAGCCAAGAAGTATGGAGGG3';
primer 3, 5'TGATAGTCCATC CACCACTCG3') was confirmed by PCR analysis
(using the same experimental protocol as above) on purified HSVLatEnk
DNA obtained from plaque isolates (Fig. 1). Finally, HSVLatEnk DNA was
further analyzed by Southern blot hybridization with
[32P]-labeled cDNA probe corresponding
to the entire coding region of rat PA mRNA (Fig. 1). Briefly, 10 µg
of purified HSVLatEnk DNA, 10 µg of HSVLat -gal, and 0.1 µg of
pLatEnk plasmid DNA were BamHI digested and separated on
0.8% agarose gel. After DNA denaturation and gel neutralization, DNA
was electrically transferred onto Hybond N nylon membrane (Amersham
Pharmacia Biotech, Uppsala, Sweden). After
prehybridization (3 hr, 42°C) in 50 mM sodium
phosphate buffer, pH 6.5, containing 50% formamide, 0.5% SDS, 5×
SSC, 5× Denhardt's solution, and 0.2 mg/ml denatured herring
sperm DNA, the blot was hybridized overnight at 42°C in the same
solution with ~1.5 × 106 cpm/ml
[32P]-labeled cDNA probe. Membrane was
gradually washed with 2× SSC containing 0.5% SDS at room temperature
and then at 45°C, followed by 0.1% SSC at 65°C. The blot was
finally exposed to x-ray film (Hyperfilm MP; Amersham Pharmacia
Biotech) for 3-5 hr at room temperature.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 1.
Schematic representation of recombinant HSVLatEnk
vector and its molecular characterization. Thymidine kinase gene
(UL23) in KOS-derived
Tk+HSVLat -gal DNA [bearing -galactosidase
reporter gene downstream of the Lat-LTR promoter inserted into the gC
locus (Antunes-Bras et al., 1998 )] was disrupted by homologous
recombination with p23d plasmid DNA containing NsiI to
SacI deleted HSV TK gene to generate TK-negative
HSVLat -gal vector (HSVLat -gal). HSVLatEnk recombinant was then
created as described previously (Antunes-Bras et al., 1998 ), by
inserting Lat-LTR-pEnk transcriptional unit into the gC gene of
HSVLat -gal by homologous recombination. Purified HSVLatEnk DNA was
analyzed by PCR, and subsequent PCR products were separated on
ethidium bromide-stained 1.2% agarose gel for the presence of both the
TK-deleted gene and the Enk transgene. Positions of respective primers
used are indicated on the diagram. Lanes 1 and
6 show the Lambda
DNA/HindIII-EcoRI and 100 bp molecular
weight standards (given in kilobases), respectively. Lane
2, Approximately 1.8 kb PCR product generated by amplification,
using primers A/B, of wild-type HSV DNA; lane 3, ~1.3
kb PCR product generated using the same primers A/B on HSVLatEnk DNA.
Lanes 4 and 5 show the PCR amplification
products obtained with the set of primers 1/3 and 2/3 on HSVLatEnk DNA,
respectively. HSVLatEnk DNA was further analyzed by Southern
hybridization. Ten micrograms of HSVLat -gal DNA (lane
7), 10 µg of HSVLatEnk DNA (lane 8),
and 0.1 µg of pLatEnk DNA (lane 9) were digested with
BamHI, applied on 0.8% agarose gel, electrotransferred
on nylon membrane, and hybridized with a
[32P]-labeled cDNA probe corresponding to the rat
pEnk coding region. Whereas no hybridization signal was apparent on
HSVLat -gal (lane 7), positively labeled DNA
fragments of ~1.35 kb were generated on HSVLatEnk DNA (lane
8) and pLatEnk DNA (lane 9). This size
corresponds to the expected size of DNA fragment resulting from the
BamHI digestion of both HSVLatEnk and pLatEnk DNA.
|
|
HSVLatEnk and HSVLat -gal were concentrated by ultracentrifugation
(50,000 × g; 4°C; 1 hr). Viruses were resuspended in
10% sucrose, and their titers were determined using standard plaque assay on Vero cells. The HSVLatEnk and HSVLat -gal titers were of
5 × 108 pfu/ml and 2 × 109 pfu/ml, respectively. Functional
efficacy of HSVLatEnk was characterized in vitro on either
Vero cells or human neuroblastoma cells (SK-N-MC) by searching for the
presence of PA encoding mRNA and ME-like material (MELM) in both
infected (with either HSVLatEnk or HSVLat -gal) and uninfected cells.
Briefly, 48 hr after infection of cells at a multiplicity of infection
of 1, total RNA was extracted using the acid-guanidinium method
(Chomczynski and Sacchi, 1987 ) and treated with DNase. RNA was then
recovered by phenol-chloroform extraction and ethanol precipitation.
Proenkephalin A mRNA was detected by reverse transcription (RT)-PCR on
0.5 µg of total RNA according to the Access RT-PCR system
instructions (Promega, Madison, WI) using 40 pmol of each PA-specific
primer (5'TAGCCAAGAAGTATGGAGGG3'; and 5'GACTATCAGGTAGGTGGTGAGC3').
Synthesis of ME-like material was revealed using immunohistochemistry
with a monoclonal anti-ME antibody (1:1000; Valbiotech, Paris, France).
Forty-eight hours after infection, cells on
poly-D-lysine-coated coverslips were fixed with 4% paraformaldehyde in PBS at room temperature.
After washing, cells were preincubated in PBS containing 0.1% Triton X-100 and 6% normal donkey serum (Jackson ImmunoResearch, West Grove,
PA) and then processed as described in the protocol for immunohistochemistry (see below).
Animals and treatments. All experiments were performed in
accordance with institutional guidelines that are in compliance with
national and international law and policies for use of animals in
neuroscience research (Council directive number 87848, Ministère de l'Agriculture et de la Forêt, Service Vétérinaire
de la Santé et de la Protection Animale). All animals were
maintained under the same conditions (22 ± 1°C; 60 ± 10%
relative humidity; 12 hr light/dark cycle; food and water available
ad libitum). Polyarthritis was induced by an intradermal
injection at the base of the tail of 0.05 ml of Freund's adjuvant
(Gouret et al., 1976 ) in 6-week-old male Sprague Dawley rats. In
addition to healthy animals, three homogeneous groups of polyarthritic
rats were constituted and deeply anesthetized with chloral hydrate (400 mg/kg, i.p.) for virus or vehicle administration. The first and second
group of polyarthritic rats were infected bilaterally on slightly
scarified hind footpads with ~5 × 106 pfu of either HSVLatEnk or
HSVLat -gal, respectively. Treatment of sham-infected polyarthritic
rats in the third group consisted of vehicle (10 µl of 10% sucrose
in 0.9% NaCl) application onto scarified footpads.
Previous studies showed that the resulting increase in the
concentrations of MELM in rat lumbar DRG is maximum 3 weeks after infection with HSVLatEnk (Antunes-Bras et al., 1998 ). Because most of
the polyarthritis-associated symptoms peak 3-5 weeks after induction
of the disease (Calvino et al., 1987 ), rats were infected 2 weeks after
polyarthritis induction, and subsequent experiments were generally
performed 3 weeks later. In particular, animals used for
radioimmunoassay, immunohistochemical, or in situ
hybridization procedures were killed by decapitation 3 weeks after
infection, i.e., 5 weeks after polyarthritis induction. The lumbar
enlargement of the spinal cord and adjacent DRG (L1-L6) were dissected
at 0-4°C. The spinal cord was divided into its ventral and dorsal parts (except when used for in situ hybridization
experiments), and left and right ganglia were pooled. Tissue pieces for
RNA analyses were frozen in liquid nitrogen and stored at 80°C.
Radioimmunological determinations of tissue levels of ME, calcitonin
gene-related peptide (CGRP), and substance P were performed as
described previously (Cesselin et al., 1980 ; Pohl et al., 1990 ).
Hindpaw diameter measurements and radiological analyses.
Animals were anesthetized with chloral hydrate (300 mg/kg, i.p.) 2 weeks (i.e., just before infection with either HSVLat -gal or HSVLatEnk) and 5 weeks after polyarthritis induction. The diameter of
their hindpaws was measured using a digital micrometer (Mitutoyo). The
presence and severity of lesions were evaluated on radiographs (made 2, 3, and 5 weeks after polyarthritis induction) by an expert rheumatologist, who was unaware of the treatments. A four-degree rating
scale was used for the bilateral evaluation of ankle and metatarsus toe
joints: 0, no obvious lesions; 1, doubtful or mild lesions; 2, medium
lesions with joint space narrowing or disappearance; and 3, severe
lesions with joint destruction and mild periostitis. To take into
account as precisely as possible the development of periostitis, which
is an important variable in joint lesions (and can be widely developed
despite relatively medium joint destruction), each score value was
raised by one if extensive periostitis was present. Accordingly, the
maximum rate was 16. Because no differences in hindpaw diameters or
severity scores of lesions were observed between sham-infected and
HSVLat -gal-infected polyarthritic rats, animals in these two groups
are referred to as control polyarthritic rats.
Behavioral studies. Pain-related behavior was
assessed by measuring the latency of foot withdrawal elicited by
noxious radiant heat (Ugo Basile Plantar test, intensity 7; Ugo Basile,
Comerio, Italy) applied to hindpaw plantar surface (Galbraith et al.,
1993 ). Three measures at 1 hr intervals were performed bilaterally, and the mean was considered as one value for each animal.
Spontaneous locomotor activity was measured in an open field, the floor
of which was divided into five compartments with black lines. The open
field was in a red-lighted room in which animals were introduced 12 hr
before the beginning of the experiments. Each animal was placed into
the open field, and 1 min later its locomotor activity was video
monitored and tape recorded. The number of line crosses and rearings
were counted for a 7 min period by two independent observers in a
distant room.
Performances of the different groups of polyarthritic rats were first
assessed 3 weeks after infection and compared with those of healthy
controls. The next day, animals were anesthetized with chloral hydrate
(300 mg/kg, i.p.). The skin was incised at the level of the scapula, an
Alzet osmotic minipump (delivery rate of 1 µl/hr; 2001 model; Alza
Scientific Products, Palo Alto, CA) was implanted
subcutaneously, and the incision was then sutured. Following the
instructions of the manufacturer, osmotic minipumps were filled with
either naloxone or naloxone methiodide to administer each of these
drugs at the dose of 3 mg · kg 1 · d 1.
"Sham-"treated animals were implanted with saline-delivering minipumps. Behavioral studies were performed on the fourth day after
minipump implantation. Observers were blinded to the group of
polyarthritic rats (either controls or HSVLatEnk-infected rats) and to
the drug delivered. Similar conditions were used to assess the
performances of animals 5 and 8 weeks after infection. Behavioral experiments did not reveal any differences between sham-infected and
HSVLat -gal-infected polyarthritic rats.
In situ hybridization. Deeply anesthetized animals (chloral
hydrate; 400 mg/kg, i.p.), were perfused transcardially with 100 ml of
saline (0.9% NaCl) supplemented with 0.1% sodium nitrite, followed by
600 ml of 4% paraformaldehyde in PBS, at room temperature. Spinal cord
and L1-L6 dorsal root ganglia were removed, post-fixed for 2 hr in the
same solution at 4°C, cryoprotected in 10% sucrose-PBS, frozen, and
stored at 80°C until used. Ten micrometer cryostat sections were
fixed for 1 hr with 4% paraformaldehyde in PBS at 4°C, rinsed in
PBS, and dehydrated through a graded series of ethanol concentrations
(30-100%). Slides with tissue sections were incubated in the presence
of a cRNA probe of latency-associated transcripts (LATs) labeled with
digoxygenin-11-UTP according to the instructions of the manufacturer
(Promega, Madison, WI). This probe (188-621 bases PCR amplified
segment of HSV-1 LAT sequence; Wagner et al., 1988 ) allows the
detection of all viral particles, independent of their ability to
express the PA transgene. Hybridization was performed overnight at
65°C in 1× SSC, 50% formamide, 10% dextran sulfate, 1 mg/ml rRNA,
and 1× Denhardt's solution. On the following day, sections were
washed twice with 1× SSC, 50% formamide, and 0.1% Tween 20, at
65°C, and twice with 100 mM maleic acid, 150 mM NaCl, and 1% Tween 20, at room temperature.
The digoxygenin-labeled hybrids were detected with an alkaline
phosphatase-conjugated anti-digoxygenin antibody following the
instructions of the manufacturer (Roche Products, Hertforshire, UK). PA
mRNA was detected by hybridizing tissue sections with ~3.3 × 106 cpm/µl antisense
[35S]cRNA (corresponding to the entire
coding region of the rat preproenkephalin A cDNA) as described in
detail previously (Pohl et al., 1994 ).
Quantitative RT-PCR. Total RNA, extracted as described
above, was quantified using as reference a scale of total RNA prepared on cesium chloride gradient and estimated from the optical density at
260 nm. RT-PCR was performed, as described previously (Antunes-Bras et
al., 1998 ), with 0.5 µg of each RNA sample in the presence of various
amounts (0.5-16 fg) of internal synthetic standard prepared according
to the PCR MIMIC construction kit (Clontech, Cambridge, UK). This 241 bp standard fragment, flanked with PA sequences (21 bp), was amplified
with the same set of rat PA-specific primers as the cDNA.
Reverse-transcribed RNA was amplified with 30 cycles (96, 58, and
72°C; 1 min each) according to the Access RT-PCR system instructions
(Promega) using 40 pmol of primers in a mixture containing 10 mM of each dNTP, 25 mM MgSO4, 2.5 U of avian
myeloblastosis virus reverse transcriptase, 2.5 U of thermus
flavus DNA polymerase, and 6.5 U of RNase inhibitor (RNasin) in
1× reaction buffer. The RT-PCR products were electrophoresed on 1.2%
ethidium bromide-stained agarose gel and quantified with the gel
analyzer GDS 5000 (Ultra-Violet Products Ltd., Cambridge, UK).
Immunohistochemistry. Animals were anesthetized and perfused
as described in the protocol for in situ hybridization.
Segments of sciatic nerve, L4-L5 dorsal roots, and L4 L5 DRG were
dissected out and cryoprotected in 10% sucrose (24 hr, 4°C). Fifteen
micrometer cryostat sections were preincubated (30 min, room
temperature) in PBS containing 0.3% Triton X-100 and 3% normal donkey
serum (Jackson ImmunoResearch) and then incubated overnight at 4°C in the same buffer supplemented with a monoclonal anti-ME antibody (1:1000; Valbiotech). After washing in PBS, sections were incubated for
1 hr with rhodamine (Cy3)-conjugated anti-mouse Ig (1:800; Interchim,
Montlucon, France), rinsed in PBS, mounted in fluoromount-G (CliniSciences, Montrouge, France), and examined using a Leica (Nussloch, Germany) confocal microscope. Both labeled and unlabeled neurons were counted in every fourth sections of a total of ~30 sections for each DRG (L4-L5, unilaterally), in three animals per
group. A total of 712-852 neurons were analyzed in each group.
Statistical analyses. All data, including those from
behavioral experiments, were subjected to the unpaired Student's
t test. The performances of rats after versus before
treatment with opioid receptor antagonists were compared using the
paired Student's t test. The Kolmogorov-Smirnov test was
used for statistical analysis of the data derived from clinical
evaluation of the joint lesions. When p > 0.05, the
corresponding difference was considered to be not significant.
 |
RESULTS |
Morphological aspects and osseous lesions of hindpaws in
HSVLatEnk-infected polyarthritic rats
In agreement with previous reports (Pearson, 1956 ; De Castro Costa
et al., 1981 ), soft tissue swelling and increased joint diameter of
hindpaws were apparent in nearly 100% of animals 2 weeks after
polyarthritis induction (bilateral hindpaw joint diameter in control
polyarthritic rats, 13.3 ± 1.2 mm, mean ± SEM,
n = 18; versus 9.0 ± 0.1 mm in healthy rats,
n = 8; p < 0.01). In control
polyarthritic rats, these signs of inflammation worsened for the
following weeks, with larger hindpaw swelling and joint diameter
(17.4 ± 1.0 mm; n = 8; p < 0.02)
at the end of the fifth week. In contrast, in paired HSVLatEnk-infected
polyarthritic rats, the hindpaw joint diameter did not enlarge from the
second to the fifth week (13.1 ± 1.0 mm; n = 8)
after polyarthritis induction. Just before infection by either
HSVLat -gal or HSVLatEnk, i.e., 2 weeks after polyarthritis
induction, radiogram analysis yielded scores of hindpaw joint lesions
ranging from 6 to 10 (Fig.
2A-C). Three weeks
later, marked lesions, including extensive erosion of bone extremities,
narrowing or disappearance of joint spaces, calcification, and new bone
proliferation, were observed in control animals (13 lesion
scores 16) (Fig. 2A'). Radiogram analysis of
HSVLatEnk-infected rats (Fig. 2B',C')
revealed that the mean scores of their hindpaw joint lesions were
significantly lower (p < 0.001;
n = 10) than those in control polyarthritic rats (Fig. 2A'). Despite inter-individual variability in
polyarthritis development, 6 of the 10 HSVLatEnk-infected rats examined
presented only medium lesions of the hindpaw joints (lesions
scores 9) (Fig. 2B'). The other four
HSVLatEnk-infected animals had extensive lesions (9 < lesions
scores 11) (Fig. 2C'), which never reached the severity of joint destruction regularly observed in control
polyarthritic rats. Treatment with naloxone methiodide (3 mg · kg 1 · d 1)
for 3 d did not affect the radiological lesion scores in
HSVLatEnk-infected polyarthritic rats (data not shown).

View larger version (103K):
[in this window]
[in a new window]
|
Figure 2.
Presence and severity of hindpaw joint lesions in
control (representing both sham-infected or HSVLat -gal-infected
polyarthritic rats) (A') and HSVLatEnk-infected
(B', C') polyarthritic rats. Individual
evolution of polyarthritis-associated joint destruction was assessed by
comparing radiograms made 2 weeks after polyarthritis induction
(A, B, C), i.e., just
before infection with either HSVLat -gal or HSVLatEnk, and then 3 weeks later (A', B', C').
Osseous lesions of tarsus and metatarsus toe were evaluated bilaterally
in both groups of rats (n = 8-10) using a
four-degree rating scale. Radiographs were examined by an expert
observer, without knowledge of the treatments. The Kolmogorov-Smirnov
test was used for statistical analysis of the data. Six of 10 HSVLatEnk-infected rats presented mild lesions (B'), and
the remaining four animals had more extensive lesions
(C'), which were, however, less important than those of
control polyarthritic rats (A').
|
|
Effects of HSVLatEnk infection on pain-related behavior in
polyarthritic rats
Compared with healthy rats (latency of foot withdrawal to radiant
heat, 5.7 ± 0.3 sec; mean ± SEM; n = 7),
polyarthritic control rats had slightly reduced latency 5 weeks after
polyarthritis induction (4.8 ± 0.2 sec; p < 0.02; n = 15). At the same time (i.e., 3 weeks after
injection), the paw withdrawal latencies of HSVLatEnk-infected animals
were significantly higher than those of control polyarthritic rats
(5.5 ± 0.2 sec; p < 0.001; n = 15) (Fig. 2A). Measurement of spontaneous locomotor
activity of healthy rats indicated that they performed 48 ± 7 (mean ± SEM; n = 6) crosses of the lines and
30 ± 4 (mean ± SEM; n = 6) rearings for the
7 min recording period. Five weeks after induction of the disease, both
the horizontal locomotor activity (7 ± 2 crosses; mean ± SEM; n = 11) and rearings (0.2 ± 0.1; mean ± SEM; n = 11) were dramatically reduced in control
polyarthritic rats (Fig. 3B,C).
Compared with the latter animals, paired HSVLatEnk-infected rats showed
a remarkable improvement in both rearings (by eightfold; p < 0.001; n = 12) (Fig.
3B) and horizontal displacements (by 4.2-fold;
p < 0.001; n = 15) (Fig.
3C) 3 weeks after infection. This amelioration persisted
during the whole observation period, i.e., for at least 8 weeks after
HSVLatEnk infection (Fig. 3D).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3.
HSVLatEnk-infected polyarthritic rats exhibited
reduced thermal hyperalgesia and improved spontaneous locomotor
activity. Response (paw withdrawal) latencies (A)
of controls (n = 9) and HSVLatEnk-infected
(n = 15) polyarthritic rats to radiant heating
(intensity 7; Ugo Basile) were measured 3 weeks after infection.
Rearings (B) and horizontal locomotor activity
(C) of control (sham- or HSVLat -gal-infected)
(n = 12) and HSVLatEnk-infected
(n = 15) polyarthritic rats in a red-lighted open
field were video monitored and assessed every minute during a 7 min
period. Animals were then implanted subcutaneously for 3 d with an
Alzet osmotic minipump delivering 3 mg · kg 1 · d 1 of
either naloxone ( ) or naloxone methiodide ( )
(antago), and thermal hyperalgesia and locomotor
activity were assessed. Performances of normal healthy rats are
indicated by the horizontal dashed line and gray
band in the three behavioral tests (mean ± SEM;
n = 6-7). *p < 0.05;
**p < 0.01; ***p < 0.001 for
control versus HSVLatEnk-infected polyarthritic rats, two-tailed
unpaired t test; and for untreated versus
naloxone-naloxone methiodide-treated animals, two-tailed paired
t test. Long-term improvement of functional ability
(D) in HSVLatEnk-infected polyarthritic rats was
evaluated by comparing the locomotor activity in normal healthy rats
(n = 5) and in both control (n = 8) and HSVLatEnk-infected (n = 10) polyarthritic
rats 3, 5, and 8 weeks after infection. **p < 0.01; ***p < 0.001 for control versus
HSVLatEnk-infected rats; two-tailed unpaired t
test.
|
|
Behaviors were not significantly changed in both control and
HSVLatEnk-infected polyarthritic rats implanted with saline-containing minipumps. Similarly, naloxone or naloxone methiodide, administered at
the dose of 3 mg · kg 1 · d 1
for 3 d, were without any significant effect in control
polyarthritic rats. In contrast, both compounds reversed with a similar
efficacy both the antihyperalgesic response (p < 0.001; n = 15) (Fig. 3A) and the improved
locomotor activity (p < 0.05; n = 12-15) (Fig. 3B,C) in
HSVLatEnk-infected animals.
Localization and quantification of HSVLatEnk-mediated
ME overexpression.
In situ hybridization histochemistry with a
digoxygenin-labeled complementary probe of HSV LATs showed that, after
the peripheral infection of hindpaws in polyarthritic rats, viral
vectors were restricted to L4-L5 DRG (Fig.
4A). This indicated
rapid entry in latency and no spread of vectors to adjacent DRG or the
spinal cord (Fig. 4B,C,
respectively). In situ hybridization with
[35S]-labeled rat PA complementary probe
showed that only ~2-3% of neurons express PA mRNA in L4-L5 DRG of
healthy rats (Fig. 4D). In control polyarthritic
rats, no or only scarce PA mRNA-expressing cells were detected in
lumbar L4-L5 DRG (Fig. 4E). In contrast, peripheral
inoculation of polyarthritic rats with HSVLatEnk led to a significant
increase in the number of PA mRNA-expressing neurons in L4-L5 DRG
(Fig. 4F), reaching ~12% of the total neuron population. Quantitative RT-PCR allowed the demonstration that PA mRNA
levels in L4-L5 DRG of HSVLatEnk-infected rats were approximately eightfold higher (p < 0.001; n = 5) than in control polyarthritic animals (Fig.
5). In addition, MELM concentrations in
L4-L5 DRG were also significantly higher (+40%) in HSVLatEnk-infected
rats than in paired control polyarthritic animals (71.9 ± 7.1 vs
49.5 ± 5.2 pg/mg protein, respectively; means ± SEM;
n = 8 in each group; p < 0.01). On the
other hand, measurement of both substance P and CGRP concentrations in
L4-L5 DRG of control polyarthritic rats (1.6 ± 0.2 and 8.3 ± 0.2 ng/mg protein, respectively; means ± SEM;
n = 8) showed comparable levels with those in
HSVLatEnk-infected rats (1.4 ± 0.1 and 8.1 ± 0.4 ng/mg
protein; n = 8; respectively).

View larger version (185K):
[in this window]
[in a new window]
|
Figure 4.
LATs and PA mRNA expression were detected
by in situ hybridization histochemistry. Incubation of
10 µm sections of L4-L5 DRG with digoxygenin-labeled LAT cRNA
revealed numerous LAT-expressing neurons (arrowheads) in
HSVLatEnk-infected polyarthritic rats (A). In
contrast, no LAT-expressing nerve somas could be detected in adjacent
L1-L3 DRG (B) or in the spinal cord of the
lumbar region (C), suggesting no spread of the
vectors to these territories. Every fourth section of L4-L5 DRG from
normal healthy rats (D), control
(E), or HSVLatEnk-infected polyarthritic rats
(F) was incubated with
[35S]PA cRNA, and then both unlabeled and labeled
neurons were counted (in a total of 30 sections in each group).
Approximately 2% of neurons in L4-L5 DRG of healthy rats were labeled
with [35S]PA cRNA (D). In
contrast, no PA mRNA-expressing neurons were detected in L4-L5 DRG of
control (vehicle- or HSVLat -gal-infected) polyarthritic rats
(E). Infection with HSVLatEnk led to the
expression of PA mRNA in ~12% (110 of a total of 955 neuronal somas)
of neurons in L4-L5 DRG (F). The
photomicrographs are representative of three to four animals per group,
examined 5 weeks after polyarthritis induction (i.e., 3 weeks after
vehicle, HSVLat -gal, or HSVLatEnk infection). Scale bar:
A, B, D-F, 250 µm;
C, 390 µm.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
Figure 5.
Quantitative RT-PCR measurement of PA mRNA levels
in L4-L5 DRG of control ( ) or HSVLatEnk-infected ( )
polyarthritic rats. Total RNA was extracted from L4-L5 DRG in both
groups of animals (n = 5 for each group) 5 weeks
after polyarthritis induction. Five hundred nanograms of total RNA were
reverse-transcribed in the presence of six different dilutions of
synthetic fragment and amplified for 30 cycles. Measurement of optical
density of PCR amplification products of PA mRNA (402 bp) or of the
synthetic fragment (241 bp) allowed the drawing of the plot, as
described previously (Antunes-Bras et al., 1998 ). Representative gel
analyses of PCR products are shown.
|
|
Immunofluorescence investigations showed that no ME-immunoreactive
neurons could be detected in L4-L5 DRG and corresponding dorsal roots
of untreated polyarthritic rats (Fig.
6A,B).
Furthermore, neuronal processes stained for MELM were only rarely
detected in peripheral outputs of L4-L5 DRG in these animals (Fig.
6C). Infection of rats with HSVLatEnk resulted in the
appearance of numerous positively stained neuronal cell bodies in
L4-L5 DRG (Fig. 6D). Approximately 20% of
MELM-positively labeled cell bodies costained for CGRP-like material or
substance P-like material (data not shown). No or only scarce
MELM-positively labeled nerve fibers were visualized in dorsal roots of
infected animals (Fig. 6E). In contrast, a relatively
dense bundle of neuronal processes containing MELM was observed in the
peripheral output of L4-L5 DRG in HSVLatEnk-infected polyarthritic
rats (Fig. 6F).

View larger version (89K):
[in this window]
[in a new window]
|
Figure 6.
Immunofluorescent detection of Met-enkephalin-like
material. Fifteen micrometer sections were stained with monoclonal
anti-ME antibody (Valbiotech). No ME staining was detected in DRG
neuronal cell bodies (A) and dorsal roots
(B) of untreated polyarthritic rats. Only few
neuronal processes stained for ME could be visualized in sciatic nerves
of these animals (C). In HSVLatEnk-infected
polyarthritic rats, numerous ME-stained neuronal soma were present in
L4-L5 DRG (D). Scarce neuronal processes were
stained in dorsal roots (E), whereas numerous
nerve fibers positively labeled for ME were present in sciatic nerves
(F) of HSVLatEnk-infected rats. Scale bar:
A, D, 250 µm; B,
C, E, F, 70 µm.
|
|
 |
DISCUSSION |
Together with pain, erosive inflammation of the joints and new
bone proliferation represent prominent symptoms of polyarthritis in
both humans and animal models of the disease. This report shows that PA
overexpression in lumbar DRG neurons of polyarthritic rats induces
mainly peripherally mediated antihyperalgesic effects and reduces
disease-related functional disability in these animals. Furthermore,
our studies also demonstrate the beneficial effect of PA-derived
peptides on hindpaw joint lesions because overproduction of these
opioids limited the progression of bone erosion and periostitis.
HSV type 1-derived vectors have been successfully used for transgene
delivery into sensory neurons, and we showed recently their potency to
drive PA expression in rat DRG neurons (Davar et al., 1994 ;
Antunes-Bras et al., 1998 , 2001 ; Goins et al., 1999 ; Wilson et al.,
1999 ). In our previous studies, peripheral infection of healthy rats
with replication-competent vectors resulted in vector expression
limited to L4-L5 DRG (Antunes-Bras et al., 1998 ); however, possibly
because of the peculiar immune status of polyarthritic rats, we
found in a first series of experiments that, in some of these animals,
recombinant vectors could spread from the DRG to the spinal cord. This
observation lead us to generate conditional defective TK-deleted HSV
vectors, severely impaired for the acute replication in ganglionic
neurons (Coen et al., 1989 ). To ensure long-term and relatively high
levels of PA-derived peptides synthesis, we placed the rat PA cDNA
sequence under the control of Lat-LTR promoter whose in
vivo activity is well documented (Lokensgard et al., 1994 ;
Antunes-Bras et al., 1998 ). To detect all viral vectors (even those
that eventually did not synthesize transgene-derived mRNA), we
performed in situ hybridization histochemistry not only with
an ME mRNA complementary probe but also with a probe complementary to
viral latency-associated transcripts. The results obtained with both
probes clearly showed that TK-negative recombinants remained restricted
to L4-L5 DRG of polyarthritic rats and did not spread to adjacent
ganglia or the spinal cord, as expected for this vector with reduced
replication in neurons (Coen et al., 1989 ). Despite the presence of
numerous neurons synthesizing MELM in L4-L5 DRG 3 weeks after
HSVLatEnk inoculation, only few nerve fibers endowed with MELM were
visualized in L4-L5 dorsal roots. In contrast, numerous neuronal
profiles containing MELM were present in sciatic nerves of
HSVLatEnk-infected polyarthritic rats. These results are consistent
with our previous studies in healthy rats showing that, in PA
overexpressing animals (as in controls), MELM is preferentially
transported to the peripheral terminals of primary afferents from which
it can be released by electrical stimulation of the sciatic nerve
(Antunes-Bras et al., 2001 ). Together, these data suggest that, in
HSVLatEnk-infected polyarthritic rats, overproduced MELM was also
mainly transported to the peripheral side of primary afferent fibers
and presumably released.
The concentrations of substance P and CGRP in DRG of polyarthritic
rats, which are increased compared those in control healthy rats (Kar
et al., 1991 ; Smith et al., 1992 ), were not modified in animals
infected with either HSVLat -gal or HSVLatEnk, suggesting that
neither the infection per se nor the ME overexpression affects the DRG
content in these major neuropeptides synthesized in sensory ganglia.
However, opioids are known to modulate the substance P and CGRP release
from primary afferent neurons (Mauborgne et al., 1987 ; Pohl et al.,
1989 ). Further investigations are thus needed to examine whether their
release, which is altered in polyarthritic rats (Cesselin et al.,
1999 ), could be modified in HSVLatEnk-infected rats, notably at the
periphery, at which both peptides exert proinflammatory effects.
An important finding is the reduction of hindpaw diameter associated
with reduced progression of joint lesions in HSVLatEnk-infected polyarthritic rats. Interestingly, radiological examination of hindpaws
revealed reduced osseous lesions and bone proliferation, particularly
at the tarsus and metatarsus joints, i.e., at the paw levels at which
primary afferents infected with HSVLatEnk project. Immunomodulatory
action of opioids is well documented (for review, see Stefano et al.,
1996 ). The existence of a dense network of sensory nerves innervating
the periosteum, the bone marrow, and the osteochondral junction
(Bjurholm et al., 1988 ; Hill and Elde, 1991 ; Hukkanen et al., 1992 ), as
well as the presence of opioid binding sites on osteoblasts and
chondrocytes (Castano et al., 1991 ), support the idea of a direct
action of peripherally released opioids on these tissues. Our data are
consistent with previous reports suggesting that opioids can modulate
inflammation and attenuate joint damage in polyarthritic rats (Levine
et al., 1986 ; Walker et al., 1996 ; Binder and Walker, 1998 ).
Overproduction of PA-derived opioid peptides in sensory nerves also
resulted in an antihyperalgesic activity. In particular, HSVLatEnk-infected rats exhibited an increased latency of foot withdrawal elicited by noxious radiant heat. However, an acute painful
stimulus does not actually reflect the dimension of persistent, spontaneous pain. This is particularly true in polyarthritic rats in
which the most prominent behavioral change is a marked reduction of
locomotion as a result of intense pain and joints alterations. Indeed,
horizontal and vertical mobility in polyarthritic rats were severely
reduced (rearings being almost absent), and measurement of locomotor
activity provides a sensitive evaluation of "functional disability"
in these animals (Larsen and Arnt, 1985 ; Cain et al., 1997 ; Lindner et
al., 1999 ). Of special interest in this study was the impressive
amelioration of the mobility of HSVLatEnk-infected polyarthritic rats
that recovered up to nearly 70% of that of healthy rats. With regard
to pain-related behavior, our data are in accordance with the recently
reported antihyperalgesic effects of overexpressed PA or -endorphin
at the spinal level in animals with experimentally induced pain
(Finegold et al., 1999 ; Wilson et al., 1999 ).
The involvement of central and/or peripheral opioid receptors in both
the antihyperalgesic response and the improved mobility of
HSVLatEnk-infected polyarthritic rats was assessed using naloxone, a
centrally and peripherally acting opioid receptor antagonist, and
naloxone methiodide, an antagonist acting exclusively at the periphery.
Taking into account that PA overexpression in sensory neurons of
HSVLatEnk-infected rats is a continuous, long-lasting (i.e., for
several weeks) process, we reasoned that prolonged delivery of opioid
receptor antagonists should be a valuable approach to inhibit the
effects of overproduced ME. Both naloxone and naloxone methiodide,
without significant effect in control polyarthritic rats, reversed with
a similar efficacy both the antihyperalgesic response and the improved
mobility in HSVLatEnk-infected polyarthritic rats. This finding is in
line with previous observations showing that naloxone [but at a
markedly higher dose (50 mg/kg, i.p.) than that used here] antagonized
the antihyperalgesic responses to capsaicin and dimethylsulfoxide as a
result of overexpression of human PA in recombinant virus-infected mice
(Wilson et al., 1999 ). In addition, the fact that naloxone methiodide
was as efficient as naloxone to suppress the antihyperalgesic response
further supports the idea that peripheral opioid receptors play a key role in opioid-induced reduction of inflammatory pain (Stein and Yassouridis, 1997 ; Binder and Walker, 1998 ) and related disability in
polyarthritic rats infected with HSVLatEnk. However, because sparse
MELM-containing nerve fibers were observed in dorsal roots of
HSVLatEnk-infected rats, it cannot be excluded that spinal opioid
receptors also contributed to the antihyperalgesic effects of PA
overexpression in DRG neurons.
Although HSV latency is an almost exclusive feature of nervous tissue
(Steiner and Kennedy, 1995 ), the possibility of latent infection of
non-neuronal cells at the site of HSVLatEnk inoculation could not be
ruled out. This possibility could account for the mainly peripherally
mediated affects observed in our study and, to some extent, also in
that of Wilson et al. (1999) . However, these authors found that
intrathecal administration of naloxone reversed the antihyperalgesic
effect in mice infected with proenkephalin encoding vector, thereby
suggesting that primary afferents represented the major supply of
overproduced opioid peptides. Our previous results also support this
idea. Indeed, we found in normal HSVLatEnk-infected rats that MELM was
released not only at the dorsal horn of the spinal cord by direct
electrical stimulation of dorsal roots but also and to a greater extent
at the periphery after electrical stimulation of the sciatic nerve
(Antunes-Bras et al., 2001 ). These results suggest that increased
peripheral MELM overflow triggered by stimulation of the sciatic nerve
in fact involved peripheral terminals of primary afferents rather than
some non-neuronal cells.
Naloxone methiodide treatment did not affect the radiological lesion
score in HSVLatEnk-infected polyarthritic rats, indicating that, under
such conditions, a 3 d blockade of peripheral opioid receptors was
probably too short to reverse the inhibitory action of PA
overexpression on the progression of the disease.
In any case, polyarthritis-associated disability in rats appears to be
the consequence of both chronic pain and mechanical affection of
joints. Accordingly, the long-term amelioration in polyarthritic rats
infected with HSVLatEnk probably reflects a synergic action of
PA-derived peptides on both aspects of the disease. Gene therapy for
rheumatoid arthritis is a rapidly growing field, and several relevant
approaches are currently tested in laboratory models of arthritis
(Junker and Böhnlein, 1999 ). Thus, association of proenkephalin A
(and perhaps of other opioid peptides precursors) gene with other
candidate genes in dicistronic vectors might open novel perspectives
for the management of both pain and osseous lesions that characterize
this disease.
 |
FOOTNOTES |
Received May 1, 2001; revised July 10, 2001; accepted July 13, 2001.
This work was supported by grants from Institut National de la
Santé et de la Recherche Médicale, Institut UPSA de
la Douleur, and Bristol-Myers Squibb Foundation (Unrestricted
Biomedical Research Grant). We are grateful to Drs. A. Bogdan, E. Borrelli, and D. Le Bars for critical reading of this manuscript and
helpful discussions. We thank Dr. Begon (Department of Radiology,
École Nationale Vétérinaire, Maisons-Alfort, France)
for her assistance with radiographs.
Correspondence should be addressed to Michel Pohl, Institut National de
la Santé et de la Recherche Médicale U288, Faculté de
Médecine Pitié-Salpêtrière, 91 boulevard de
l'Hôpital, 75634 Paris Cedex 13, France. E-mail:
pohl{at}ext.jussieu.fr.
 |
REFERENCES |
-
Antunes-Bras JM,
Epstein AL,
Bourgoin S,
Hamon M,
Cesselin F,
Pohl M
(1998)
Herpes simplex virus1-mediated transfer of preproenkephalin A in rat dorsal root ganglia.
J Neurochem
70:1299-1303[Medline].
-
Antunes-Bras JM,
Becker C,
Bourgoin S,
Lombard MC,
Cesselin F,
Hamon M,
Pohl M
(2001)
Met-enkephalin is preferentially transported to the peripheral processes of primary afferent fibres in both normal and proenkephalin A overexpressing rats.
Neuroscience
103:1073-1083[Medline].
-
Binder W,
Walker JS
(1998)
Effect of the peripherally selective kappa-opioid agonist, asimadoline, on adjuvant arthritis.
Br J Pharmacol
124:647-654[Web of Science][Medline].
-
Bjurholm A,
Kreibergs A,
Brodin E,
Schultzberg M
(1988)
Substance P- and CGRP-immunoreactive nerves in bone.
Peptides
9:165-171[Web of Science][Medline].
-
Cain CK,
Francis JM,
Plone MA,
Emerich DF,
Lindner MD
(1997)
Pain-related disability and effects of chronic morphine in the adjuvant-induced arthritis model of chronic pain.
Physiol Behav
62:199-205[Medline].
-
Calvino B,
Crepon-Bernard MO,
Le Bars D
(1987)
Parallel clinical and behavioural studies of adjuvant-induced arthritis in the rat: possible relationship with "chronic pain."
Behav Brain Res
24:11-29[Web of Science][Medline].
-
Carlton SM,
Coggeshall RE
(1997)
Immunohistochemical localization of enkephalin in peripheral sensory axons in the rat.
Neurosci Lett
221:121-124[Medline].
-
Castano MT,
Freire-Garabal M,
Giraldez M,
Nunez NJ,
Belmonte A,
Couceiro J,
Jorge J
(1991)
Autoradiographic evidence of 125I-beta-endorphin binding sites in the articular cartilage of the rat.
Life Sci
49:103-105.
-
Cesselin F,
Montastruc JL,
Gros C,
Bourgoin S,
Hamon M
(1980)
Met-enkephalin levels and opiate receptors in the spinal cord of chronic suffering rats.
Brain Res
191:289-293[Medline].
-
Cesselin F,
Benoliel JJ,
Bourgoin S,
Collin E,
Pohl M,
Hamon M
(1999)
Spinal mechanisms of opioid analgesia.
In: Opioids in pain control: basic and clinical aspects (Stein C,
ed), pp 70-95. Cambridge, UK: Cambridge UP.
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Coen DM,
Kosz-Vnenchak MN,
Jacobson JG,
Leib DA,
Bogard CL,
Schaffer PA,
Tyler KL,
Knipe DM
(1989)
Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate.
Proc Natl Acad Sci USA
86:4736-4740[Abstract/Free Full Text].
-
Colpaert FC
(1987)
Evidence that adjuvant arthritis in the rat is associated with chronic pain.
Pain
28:201-222[Web of Science][Medline].
-
Davar G,
Kramer MF,
Garber D,
Roca AL,
Andersen JK,
Bebrin W,
Coen DM,
Kosz-Vnenchak M,
Knipe DM,
Breakefield XO,
Isacson O
(1994)
Comparative efficacy of expression of genes delivered to mouse sensory neurons with herpes virus vectors.
J Comp Neurol
339:3-11[Web of Science][Medline].
-
De Castro Costa M,
De Sutter P,
Gybels J,
Van Hees J
(1981)
Adjuvant-induced arthritis in rats: a possible animal model of chronic pain.
Pain
10:173-185[Web of Science][Medline].
-
El Hassan AM,
Lindgren JU,
Hultenby K,
Bergstrom J,
Adem A
(1998)
Methionine-enkephalin in bone and joint tissues.
J Bone Miner Res
13:88-95[Web of Science][Medline].
-
Finegold AA,
Mannes AJ,
Iadarola MJ
(1999)
A paracrine paradigm for in vivo gene therapy in the central nervous system: treatment of chronic pain.
Hum Gene Ther
10:1251-1257[Medline].
-
Galbraith JA,
Mrosko BJ,
Myers RR
(1993)
A system to measure thermal nociception.
J Neurosci Methods
49:63-68[Medline].
-
Geller AI,
Breakefield XO
(1988)
A defective HSV-1 vector expresses Escherichia coli
-galactosidase in cultured peripheral neurons.
Science
241:1667-1669[Abstract/Free Full Text]. -
Goins WF,
Lee KA,
Cavalcoli JD,
O'Malley ME,
DeKosky ST,
Fink DJ,
Glorioso JC
(1999)
Herpes simplex virus type 1 vector-mediated expression of nerve growth factor protects dorsal root ganglion neurons from peroxide toxicity.
J Virol
73:519-532[Abstract/Free Full Text].
-
Gouret C,
Mocquet G,
Raynaud G
(1976)
Use of Freund's adjuvant arthritis test in anti-inflammatory drug screening in the rat: value of animal selection and preparation at the breeding center.
Lab Animal Sci
26:281-287.
-
Harris ED
(1990)
Rheumatoid arthritis. Pathophysiology and implications for therapy.
N Engl J Med
322:1277-1289[Web of Science][Medline].
-
Hill EL,
Elde R
(1991)
Distribution of CGRP-, VIP-, D beta H-, SP-, and NPY-immunoreactive nerves in the periosteum of the rat.
Cell Tissue Res
264:469-480[Web of Science][Medline].
-
Houghton AK,
Valdez JG,
Westlund KN
(1998)
Peripheral morphine administration blocks the development of hyperalgesia and allodynia after bone damage in the rat.
Anesthesiology
89:190-201[Medline].
-
Hukkanen M,
Konttinen YT,
Rees RG,
Santavirta S,
Terenghi G,
Polak JM
(1992)
Distribution of nerve endings and sensory neuropeptides in rat synovium, meniscus and bone.
Int J Tissue React
14:1-10[Web of Science][Medline].
-
Junker U,
Böhnlein E
(1999)
Gene therapy for arthritis 1996-1999.
Exp Opin Ther Patents
9:1491-1498.
-
Kar S,
Gibson SJ,
Rees RG,
Jura WG,
Brewerton DA,
Polak JM
(1991)
Increased calcitonin gene-related peptide (CGRP), substance P, and enkephalin immunoreactivities in dorsal spinal cord and loss of CGRP-immunoreactive motoneurons in arthritic rats depend on intact peripheral nerve supply.
J Mol Neurosci
3:7-18[Medline].
-
Larsen JJ,
Arnt J
(1985)
Reduction in locomotor activity of arthritic rats as parameter for chronic pain: effect of morphine, acetylsalicylic acid and citalopram.
Acta Pharmacol Toxicol
57:345-351[Medline].
-
Levine JD,
Dardick SJ,
Roizen MF,
Helms C,
Basbaum AI
(1986)
Contribution of sensory afferent and sympathetic efferents to joint injury in experimental arthritis.
J Neurosci
6:3423-3429[Abstract].
-
Lindner MD,
Plone MA,
Francis JM,
Cain CK
(1999)
Chronic morphine reduces pain-related disability in a rodent model of chronic, inflammatory pain.
Exp Clin Psychopharmacol
7:187-197[Medline].
-
Lokensgard JR,
Bloom DC,
Dobson AT,
Feldman LT
(1994)
Long-term promoter activity during herpes simplex virus latency.
J Virol
68:7148-7158[Abstract/Free Full Text].
-
Mauborgne A,
Lutz O,
Legrand JC,
Hamon M,
Cesselin F
(1987)
Opposite effects of µ and
opioid receptor agonists on the in vitro release of substance P-like material from the rat spinal cord.
J Neurochem
48:529-537[Medline]. -
Pearson CM
(1956)
Development of arthritis, periarthritis and periostitis in rats given adjuvant.
Proc Soc Exp Biol
91:95-101.
-
Pohl M,
Lombard MC,
Bourgoin S,
Carayon A,
Benoliel JJ,
Mauborgne A,
Besson JM,
Hamon M,
Cesselin F
(1989)
Opioid control of the in vitro release of calcitonin gene-related peptide from primary afferent fibres projecting in the rat cervical cord.
Neuropeptides
14:151-159[Medline].
-
Pohl M,
Benoliel JJ,
Bourgoin S,
Lombard MC,
Mauborgne A,
Taquet H,
Carayon A,
Besson MJ,
Cesselin F,
Hamon M
(1990)
Regional distribution of calcitonin gene-related peptide-, substance P-, cholecystokinin-, met5-enkephalin-, and dynorphin A(1-8)-like materials in the spinal cord and dorsal root ganglia of adult rats: effects of dorsal rhizotomy and neonatal capsaicin.
J Neurochem
55:1122-1130[Medline].
-
Pohl M,
Collin E,
Bourgoin S,
Conrath M,
Benoliel JJ,
Nevo I,
Hamon M,
Giraud P,
Cesselin F
(1994)
Expression of preproenkephalin A gene and presence of met-enkephalin in dorsal root ganglia of the adult rat.
J Neurochem
63:1226-1234[Medline].
-
Pohl M,
Ballet S,
Collin E,
Mauborgne A,
Bourgoin S,
Benoliel JJ,
Hamon M,
Cesselin F
(1997)
Enkephalinergic and dynorphinergic neurons in the spinal cord and dorsal root ganglia of the polyarthritic rat: in vivo release and cDNA hybridization studies.
Brain Res
749:18-28[Medline].
-
Schäfer M,
Carter L,
Stein C
(1994)
Interleukin 1
and corticotropin-releasing factor inhibit pain by releasing opioids from immune cells in inflamed tissue.
Proc Natl Acad Sci USA
91:4219-4223[Abstract/Free Full Text]. -
Smith GD,
Harmar AJ,
McQueen DS,
Seckl JR
(1992)
Increase in substance P and CGRP, but not somatostatin content of innervating dorsal root ganglia in adjuvant monoarthritis in the rat.
Neurosci Lett
137:257-260[Web of Science][Medline].
-
Smith RL,
Geller AI,
Ecudero KW,
Wilcox CL
(1995)
Long-term expression in sensory neurons in tissue culture from herpes simplex virus type 1 (HSV-1) promoters in an HSV-1-derived vector.
J Virol
69:4593-4599[Abstract].
-
Stefano GB,
Scharrer B,
Smith EM,
Hughes Jr TK,
Magazine HI,
Bilfinger TV,
Hartman AR,
Fricchione GL,
Liu Y,
Makman MH
(1996)
Opioid and opiate immunoregulatory processes.
Crit Rev Immunol
16:109-144[Web of Science][Medline].
-
Stein C,
Yassouridis A
(1997)
Peripheral morphine analgesia.
Pain
71:119-121[Web of Science][Medline].
-
Steiner I,
Kennedy PG
(1995)
Herpes simplex virus latent infection in the nervous system.
J Neurovirol
1:19-29[Web of Science][Medline].
-
Wagner EK,
Devi-Rao GB,
Feldman LT,
Dobson AT,
Zhang YK,
Flangan WM,
Stevens JG
(1988)
Physical characterization of the herpes simplex virus latency-associated transcript in neurons.
J Virol
62:1194-1202[Abstract/Free Full Text].
-
Walker JS,
Chandler AK,
Wilson JL,
Binder W,
Day RO
(1996)
Effect of mu-opioids morphine and buprenorphine on the development of adjuvant arthritis in rats.
Inflamm Res
45:557-563[Web of Science][Medline].
-
Wilson SP,
Yeomans DC,
Bender MA,
Lu Y,
Goins WF,
Glorioso JC
(1999)
Antihyperalgesic effects of infection with a preproenkephalin-encoding herpes virus.
Proc Natl Acad Sci USA
96:3211-3216[Abstract/Free Full Text].
-
Yoshikawa K,
Williams C,
Sabol SL
(1984)
Rat brain preproenkephalin mRNA. cDNA cloning, primary structure, and distribution in the central nervous system.
J Biol Chem
259:14301-14308[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21207881-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Chattopadhyay, M. Mata, and D. J. Fink
Continuous {delta}-Opioid Receptor Activation Reduces Neuronal Voltage-Gated Sodium Channel (NaV1.7) Levels through Activation of Protein Kinase C in Painful Diabetic Neuropathy
J. Neurosci.,
June 25, 2008;
28(26):
6652 - 6658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jiang, J. B. Wechuck, W. F. Goins, D. M. Krisky, D. Wolfe, M. M. Ataai, and J. C. Glorioso
Immobilized Cobalt Affinity Chromatography Provides a Novel, Efficient Method for Herpes Simplex Virus Type 1 Gene Vector Purification
J. Virol.,
September 1, 2004;
78(17):
8994 - 9006.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mata, J. C. Glorioso, and D. J. Fink
Gene Transfer to the Nervous System: Prospects for Novel Treatments Directed at Diseases of the Aging Nervous System
J. Gerontol. A Biol. Sci. Med. Sci.,
December 1, 2003;
58(12):
M1111 - 1118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Xu, Y. Gu, G.-Y. Xu, P. Wu, G.-W. Li, and L.-Y. M. Huang
Adeno-associated viral transfer of opioid receptor gene to primary sensory neurons: A strategy to increase opioid antinociception
PNAS,
May 13, 2003;
100(10):
6204 - 6209.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|