Previous Article | Next Article 
The Journal of Neuroscience, October 15, 2001, 21(20):7909-7918
Gating Properties of Nav1.7 and Nav1.8
Peripheral Nerve Sodium Channels
Kausalia
Vijayaragavan1, 2,
Michael E.
O'Leary3, and
Mohamed
Chahine1, 2
1 Laval University, Faculty of Medicine, Sainte-Foy,
Québec, Canada G1K 7P4, 2 Québec Heart
Institute, Laval Hospital, Research Center, Sainte-Foy, Québec,
Canada G1V 4G5, and 3 Department of Pathology, Anatomy and
Cell Biology, Thomas Jefferson Medical College, Philadelphia,
Pennsylvania 19107
 |
ABSTRACT |
Several distinct components of voltage-gated sodium current have
been recorded from native dorsal root ganglion (DRG) neurons that
display differences in gating and pharmacology. This study compares the
electrophysiological properties of two peripheral nerve sodium channels
that are expressed selectively in DRG neurons (Nav1.7 and Nav1.8). Recombinant
Nav1.7 and Nav1.8 sodium channels were
coexpressed with the auxiliary
1 subunit in
Xenopus oocytes. In this system coexpression of the
1 subunit with Nav1.7 and Nav1.8
channels results in more rapid inactivation, a shift in midpoints of
steady-state activation and inactivation to more hyperpolarizing
potentials, and an acceleration of recovery from inactivation. The
coinjection of
1 subunit also significantly increases
the expression of Nav1.8 by sixfold but has no effect on
the expression of Nav1.7. In addition, a great percentage
of Nav1.8+
1 channels is observed to enter
rapidly into the slow inactivated states, in contrast to
Nav1.7+
1 channels. Consequently, the rapid entry into
slow inactivation is believed to cause a frequency-dependent reduction
of Nav1.8+
1 channel amplitudes, seen during
repetitive pulsing between 1 and 2 Hz. However, at higher frequencies
(>20 Hz) Nav1.8+
1 channels reach a steady state to ~42% of total current. The presence of this steady-state sodium channel activity, coupled with the high activation threshold (V0.5 =
3.3 mV) of
Nav1.8+
1, could enable the
nociceptive fibers to fire spontaneously after nerve injury.
Key words:
Nav1.7; Nav1.8; peripheral nerve
sodium channels; expression; dorsal root ganglion; nociception; Xenopus oocytes
 |
INTRODUCTION |
Voltage-gated sodium channels play
an important role in the generation and propagation of action
potentials in excitable tissues. At least 10 distinct isoforms of the
sodium channel have been identified in brain and neuronal and striated
muscle that differ in primary structure, pharmacology, permeation, and
gating (Goldin et al., 2000
). A major determinant of the functional
difference among these isoforms is inherent in the
subunit that
determines the selectivity and gating properties of these channels
(Goldin et al., 1986
). However, in vivo, most sodium
channels are associated with auxiliary subunits
(
1-
3) that are known
to modulate gating and levels of expression (Isom et al., 1992
; Morgan
et al., 2000
). For instance, the inactivation of rat brain sodium
channels (Nav1.2) is accelerated and the gating
is shifted toward more hyperpolarized voltages when coexpressed with
the
1 subunit (O'Leary, 1998
). Similar
findings have been reported for the skeletal muscle sodium channels,
indicating that these auxiliary subunits play an important role in
determining the gating properties of these tetrodotoxin-sensitive sodium channels (Bennett et al., 1993
; Wallner et al., 1993
; Yang et
al., 1993
). In contrast, the tetrodotoxin-resistant cardiac sodium
channels display only subtle changes in gating when coexpressed with
the
1 subunit (Makita et al., 1994
; Nuss et
al., 1995
; Makielski et al., 1996
).
In addition to changes in gating, the
1
subunit is known to enhance the expression of many sodium channels
(Chahine et al., 1994
; Nuss et al., 1995
). The expression of functional
Nav1.2 brain sodium channels increases by
2.5-fold when coexpressed with the
1 subunit
(Isom et al., 1992
). The
1 subunit also is
believed to contribute to clustering and remodeling of sodium channels at the neuromuscular junction (Blackburn-Munro and Fleetwood-Walker, 1999
; Caldwell, 2000
). Such regulations may have important consequences for neuronal tissues such as dorsal root ganglion cells (DRG) in which
multiple isoforms of the sodium channels are expressed in the same cell
(Akopian et al., 1996
; Black et al., 1996
; Sangameswaran et al., 1996
,
1997
; Toledo-Aral et al., 1997
).
At least five distinct components of voltage-gated sodium channels have
been recorded from DRG neurons (Rush et al., 1998
). Two components
predominate in the small nociceptive neurons: a rapidly inactivating
TTX-S current and a slowly inactivating TTX-R current (Kostyuk et al.,
1981
; Roy and Narahashi, 1992
; Elliott and Elliott, 1993
; Black et al.,
1996
). Recently, two peripheral nerve sodium channels have been
isolated from the human and rat DRG (Sangameswaran et al., 1996
;
Toledo-Aral et al., 1997
). Nav1.7 (PN1) is a
TTX-S rapidly inactivating channel that is expressed widely in DRG
neurons (Sangameswaran et al., 1997
; Toledo-Aral et al., 1997
).
Nav1.8 (PN3) is a TTX-R slowly inactivating
channel that is expressed predominantly in the small nociceptive C-type pain fibers (Akopian et al., 1996
; Sangameswaran et al., 1996
). Recently, a novel sodium channel Nav1.9 (NaN) was
cloned and also may contribute to the TTX-R current of small DRG
neurons (Dib-Hajj et al., 1998
). Differential expression of the
Nav1.7, Nav1.8, Nav1.9, and several of the brain sodium channels
(Nav1.1, Nav1.2, Nav1.3) contributes to the unique electrical
excitability of nociceptive neurons (Porreca et al., 1999
). Changes in
the expression levels of these channels have been implicated in the
alterations of neuronal excitability associated with acute and chronic
pain syndromes (Rizzo et al., 1995
; Gold et al., 1996
).
The transcript encoding for the
1 subunit is
present in both large and small DRG neurons (Oh et al., 1995
; Coward et
al., 2001
). However, previous studies indicate that the
1 subunit does not alter the gating of
Nav1.7 and Nav1.8 sodium
channels (Sangameswaran et al., 1996
, 1997
). This finding is
inconsistent with studies showing that many, if not all, sodium
channels are modulated by the
1 subunit
(Chahine et al., 1994
; Isom et al., 1995
). In addition, a recent study
has shown that the inactivation of heterologously expressed
Nav1.7 channels is accelerated when coexpressed
with the
1 subunit (Shcherbatko et al., 1999
).
Currently, little is known about the modulatory effects of the
1 subunit on Nav1.8
channels. In this study the
subunits of
Nav1.7 and Nav1.8 sodium
channels were expressed in Xenopus oocytes, and the kinetics
and voltage sensitivity were compared with and without the coexpressed
1 subunit. The Xenopus oocyte
system of expression was used in this study especially because the
Nav1.8 sodium channels expressed, with or without
the
1 subunit, poorly in the mammalian cell
systems (tsA201 and CHO cell line). Coexpression of
Nav1.7 with the
1
subunit in Xenopus oocytes causes a hyperpolarizing shift in
gating and increases the rates of inactivation and recovery from
inactivation. For Nav1.8 channels the
1 subunit produces similar changes in the
voltage sensitivity and kinetics of gating but, in addition,
significantly increases the expression levels of these channels. The
1 subunit modulates the gating of both the
Nav1.7 and Nav1.8 sodium
channels. Differences in the gating and expression of these sodium
channels are likely to have important consequences for the generation
and propagation of action potentials in nociceptive neurons.
 |
MATERIALS AND METHODS |
Molecular biology: Construction of full-length rat
subunit Nav1.8 cDNA. Total RNA
was isolated from Sprague Dawley rat DRG by using the Trizol reagent
(Life Technologies, Burlington, Ontario, Canada). Rat DRG RNA was
reverse transcribed (RT) with the use of Superscript (Life
Technologies) and random primers to create a cDNA library. Total DRG
RNA (5 µg) was heat denatured at 70°C for 10 min, followed by rapid
cooling on ice. Reverse transcription was performed with 10 mM deoxynucleotide triphosphate (dNTPs), 0.1 M dithiothreitol, and 50 ng/µl random primers
in a total volume of 20 µl. The mixture was added to the denatured
total RNA and incubated at 25°C for 5 min. Superscript (1 U; Life
Technologies) was added, and the reactions were incubated at 25°C for
10 min and then at 42°C for 1 hr. Incubating the sample at 70°C for
15 min then terminated the reaction. Finally, the sample was incubated at 37°C with RNaseH for 20 min to remove the total RNA. The RT product was used directly for PCR.
Rat Nav1.8
subunit-specific primers were
designed to amplify 2-4 kb segments within the coding region of the
gene. Primer sequences were based on the published sequence (ACC number
U53833). The rat Nav1.8
subunit gene was
amplified from the first ATG start codon; the 5' untranslated region
(UTR) sequence was not included in the clone.
Primer set 1 (1-4247 bp) consisted of the following: primer position
1, sense, GAAGAATGAGAAGATGGAGCTCCCC; primer position 4247, antisense, GAGATTCAGCGTGAAGAAGCCACC. Primer set 2 (3875-5940 bp)
consisted of the following: primer position 3875, sense,
GTCCTCCTCGTCTGCCTCATCTTC; primer position 5940, antisense, GCCTGAGTGCCTTCACTGAGGTCCAG.
PCR was performed in a 50 µl reaction mixture containing PCR buffer,
10 mM dNTPs, 100 ng/µl of the specific set of primers, 2 µl of the rat DRG cDNA, and 1 U of Pfu-turbo Polymerase (Stratagene, La Jolla, CA). Amplification was performed with the following cycling:
3 min at 94°C, 1 min at 94°C, 1 min at 60°C, and then 2 min/kb at
55°C repeated for a total of 30 cycles. PCR amplicons were subcloned,
and the full-length Nav1.8 was constructed in the
pCRII-Topo vector (Life Technologies). Full-length
Nav1.8 coding sequence was confirmed by
fluorescent dideoxy terminator sequencing at the automated sequencing
facility of Laval University, Sainte-Foy, Québec. The final
Nav1.8 construct was subcloned into pSP64T
(
-globin), suitable for high-yield transcription of complementary
RNA (cRNA).
The rat Nav1.7
subunit voltage-gated sodium
channel, cloned into the pCDNA3a vector, was kindly donated by Gail
Mandel (Department of Neurobiology, State University of New York, NY).
cRNA was prepared by the T7 (pCDNA3a) or SP6 (pSP64T) mMessage mMachine
kit (Ambion, TX).
Expression and electrophysiology in Xenopus
oocytes. Xenopus laevis females were anesthetized
with 1.5 mg/ml tricaine (Sigma, Oakville, Ontario, Canada), and two or
three ovarian lobes were removed surgically. Follicular cells
surrounding the oocytes were removed by incubation at 22°C for 2.5 hr
in calcium-free oocyte medium [containing (in
mM) 82.5 NaCl, 2.5 KCl, 1 MgCl2, and 5 HEPES, pH 7.6] containing 2 mg/ml
collagenase (Sigma). The oocytes were washed first in calcium-free
medium and then with a 50% Leibovitz's L-15 medium (Life
Technologies) enriched with 15 mM HEPES and 5 mM L-glutamine,
supplemented with 10 mg/ml gentamycin, pH 7.6. The oocytes were stored
in this medium until further use. Stage VI-V oocytes were selected and
microinjected with 50 nl of cRNA encoding for the
subunit of
Nav1.7 or Nav1.8. The
amounts of Nav1.7 cRNA injected in the oocytes
were lesser compared with the amounts injected for
Nav1.8 channels. This is because the Nav1.7 channels express more readily compared
with Nav1.8 channels. Sets of oocytes also were
coinjected in parallel with equal ratios of
Nav1.7 and
1 subunit or
Nav1.8
subunit and
1 subunit.
Oocytes were stored at 18°C and used for experiments depending on the
level of expression of each channel type. Parallel sets of experiments
with the rat skeletal muscle sodium channel (µ1) were used to confirm
the functional association of the
and
1 subunits in oocytes (data not shown).
The whole-cell sodium current from cRNA-injected oocytes was measured
via two-microelectrode voltage clamp at room temperature
22°C. The
oocytes were impaled with <2 M
electrodes containing 3 M KCl and were voltage clamped with an OC-725 oocyte clamp
(Warner Instruments, Hamden, CT). The bath Ringer's solution contained (in mM) 90 NaCl, 2 KCl, 1.8 CaCl2, 2 MgCl2, and 5 HEPES, pH 7.6. Currents were
filtered at 1.5 kHz with an eight-pole Bessel filter and were sampled
at 10 kHz. Data were acquired and analyzed with pClamp software v7
(Axon Instruments, Foster City, CA).
The voltage dependence of activation was determined by eliciting
depolarizing pulses from a holding potential of
100 mV to potentials
ranging from
80 to +60 mV in 10 mV increments. Current activation
curves of the channels were plotted via the following Boltzmann
equation: GNa/GNa
max = 1/(1 + exp((V + V0.5)/k)), for which
the GNa (conductance) values for each
clamped oocyte were determined by dividing the peak sodium current by
the driving force (Vm
ENa). The reversal potential
(ENa) for each oocyte expressing the
channels was estimated by extrapolating the linear ascending segment of
decay gradient, between 0 and +20 mV for Nav1.7
and between +20 and +40 mV for Nav1.8, of an
I-V curve to the voltage axis. V is equal to the
test voltage, V0.5 is the voltage at
which the channels are half-maximally activated, and k is
the slope factor. Conductance versus voltage data were fit with a
two-state Boltzmann equation.
Statistical analysis. Results of representative measures
were expressed by means ± SEM. The currents of paired groups of
oocytes injected with the
subunit of Nav1.7
or Nav1.8 were compared directly with those of
oocytes coinjected with the
and
1
subunits; a repeated measurement ANOVA was performed. The
homogeneity of correlation between repeated measures was tested with
the sphericity test. The results were considered significant if
p values were
0.05. The data were analyzed by the
statistical package program SAS (SAS Institute, Cary, NC).
 |
RESULTS |
Effects of
1 subunit on the expression of
Nav1.7 and Nav1.8 sodium channels
The
subunit of the peripheral nerve sodium channel
Nav1.8 was cloned from the DRG of Sprague Dawley
rats via RT-PCR (see Materials and Methods). The fidelity of the
Nav1.8 clone was verified by comparing its
sequence with the published sequence (ACC number U53833). cRNA of
Nav1.7 and Nav1.8 clones
was microinjected into stage IV-V Xenopus oocytes. The
whole-cell sodium currents of oocytes injected with
Nav1.7 and Nav1.8 channels
were compared with and without the
1 subunit.
The currents were evoked by applying a series of depolarizing voltage
steps between
50 and +65 mV in 5 mV increments (Fig.
1). Nav1.7 and
Nav1.8 channels have distinct expression
behaviors in the Xenopus oocytes. The
Nav1.7 currents activate at
40 mV and peak at
20 mV, whereas Nav1.8 currents activate and
peak at
15 and +20 mV, respectively. For voltage pulses to
20 mV,
oocytes expressing the Nav1.7 channels displayed large sodium currents (
3087.8 ± 435.4 nA, n = 6) after <24 hr of incubation (Figs. 1A,
2A). In contrast, oocytes injected with Nav1.8 expressed small currents at +20 mV
(
557.8 ± 26.3 nA) after >5 d after injection (Figs.
1B, 2B), indicating that the
subunit of Nav1.8 is expressed inefficiently in
oocytes.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1.
Effects of the 1 subunit on
Nav1.7 and Nav1.8 sodium channels
heterologously expressed in Xenopus oocytes. The data
show the whole-cell sodium currents of oocytes expressing either the
Nav1.7 or Nav1.8 sodium channel with and
without the 1 subunit. Currents were elicited by
depolarizing steps between 50 and +65 mV in 5 mV increments from a
holding potential of 100 mV (see inset).
A, Whole-cell Nav1.7 currents measured in
the absence (left) and presence (right)
of the 1 subunit. B, Nav1.8
sodium currents expressed without (left) and with
(right) the 1 subunit. Dashed
lines are the zero current levels.
|
|
Figure 2 directly compares the currents
of paired groups of oocytes expressing either
Nav1.7 or Nav1.8 with and
without the
1 subunit. The sodium current of
oocytes injected with Nav1.8 substantially
increases when coexpressed with the
1 subunit
(Fig. 2B). At +20 mV, coexpression with the
1 subunit increases the sodium current of
oocytes expressing Nav1.8 by 5.7-fold
(
3183 ± 262 nA) (Fig. 2B). Although the
mechanism underlying this increase in current is not known, these data
are similar to those of previous studies showing that the
1 subunit increases the expression of a number
of sodium channel isoforms (Nuss et al., 1995
). In contrast, the
amplitude of currents of oocytes expressing
Nav1.7 is not altered by the
1 subunit (Fig. 2A). The
1 subunit selectively enhances the expression
of the Nav1.8 sodium channels. Both
Nav1.7 and Nav1.8 sodium
channels cDNAs also were transfected into different mammalian cell
expression systems (tsA201 and CHO) in the absence and presence of the
1 subunit. However, mammalian cells
transfected with Nav1.8 channels, in the absence
or presence of the
1 subunit, expressed small
to negligible amounts of current (
1 nA, n = 6; data
not shown). In contrast, tsA201 cells transfected with
Nav1.7 cDNA expressed ~10 nA of current
(n = 4; data not shown). Because of the poor expression
of Nav1.8 channels in the different mammalian systems, Xenopus oocytes were used preferentially in this
study.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2.
Effects of the 1 subunit on the
expression of Nav1.7 and Nav1.8 sodium
channels. Shown are the whole-cell sodium currents of paired groups of
oocytes expressing either the Nav1.7 or Nav1.8
channels with or without the 1 subunit.
Nav1.7 peak currents at 20 mV were measured from oocytes
expressing Nav1.7 or Nav1.7+ 1
after 24 hr of incubation. There was no significant difference in the
peak amplitude of current between Nav1.7 and
Nav1.7+ 1 even at 3 d after injection
(data not shown). For Nav1.8 channels the peak currents
measured at +20 mV were compared 6 d after cRNA injection. Peak
amplitude recorded 3 d after injection for Nav1.8 channels was
small (38.1 ± 2.8 nA; n = 3), whereas the
coexpression increased expression by 17-fold (695 ± 117 nA;
n = 5; data not shown). The 1
subunit significantly increased (p < 0.05)
the currents of Nav1.8 (n = 7), but not
the Nav1.7 (n = 6), sodium channels
(p < 0.05). The holding potential was 100
mV.
|
|
Effects of the
1 subunit on kinetics of current
decay of Nav1.7 and Nav1.8 channels
In addition to changes in expression levels, the
1 subunit also alters the gating properties of
these channels. In the absence of the
1
subunit, the inactivation of Nav1.7 is slow,
resulting in considerable residual current near the end of the 20 msec
depolarizing pulse (Figs. 1A,
3A). When coexpressed with the
1 subunit, the inactivation is more rapid and
the currents are inactivated completely during the 20 msec
depolarization (Figs. 1A, 3A). The
1 subunit also accelerates the inactivation of
Nav1.8 but to a much lesser extent than that
observed for Nav1.7 (Fig. 3B). To
quantitate the changes in decay rate, we fit the currents with
single exponentials. At
20 mV the decay of
Nav1.7 currents has a time constant
(
h) of 19.8 ± 3.6 msec
(n = 6) and 1.8 ± 0.2 msec (n = 6) for Nav1.7+
1. Coexpression with the
1 subunit significantly accelerates the inactivation of Nav1.7 current
(p < 0.05). Coexpression of
Nav1.8 with the
1
subunit also significantly reduces
h
(p < 0.05). At +20 mV,
Nav1.8 and
Nav1.8+
1 currents decay
with time constants of 4.3 ± 0.2 msec (n = 6)
versus 2.6 ± 0.1 msec (n = 6), respectively (Fig.
3B). The
1 subunit reduces the
h of Nav1.7 and
Nav1.8 sodium currents over a wide range of
voltages (Fig. 4A,B).
Overall, the data indicate that coexpression with the
1 subunit accelerates the inactivation of both
Nav1.7 and Nav1.8 sodium
channels.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 3.
Effects of the 1 subunit on the
kinetics of Nav1.7 and Nav1.8 inactivation.
Whole-cell sodium currents of Nav1.7 and
Nav1.7+ 1 sodium channels were elicited by a
depolarizing step from 100 to 20 or +20 mV. Currents were
normalized to facilitate comparison of the kinetics. A,
At 20 mV the time constants of current decay were 19.8 ± 3.6 msec (n = 6) and 1.8 ± 0.2 msec
(n = 6) for Nav1.7 and
Nav1.7+ 1, respectively.
B, Nav1.8 and
Nav1.8+ 1 currents were elicited by a step
depolarization to +20 mV and had decay time constants of 4.3 ± 0.2 msec (n = 6) and 2.6 ± 0.1 msec
(n = 6), respectively. Dashed lines
are the zero current levels.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4.
The 1 subunit accelerates the
inactivation of Nav1.7 and Nav1.8 channels. The
decay of the Nav1.7 and Nav1.8 sodium currents
(Fig. 1) was fit to an exponential function, and the time constants
were plotted versus the test voltage: I = AI · exp
( t/ i) + C,
where I is the current,
Ai is the percentage of channels
inactivating with time constant i,
t is time, and C is the steady-state
asymptote. The data are the means ± SEM of n = 6 for Nav1.7 and Nav1.7+ 1 and
n = 6 for Nav1.8 and
Nav1.8+ 1 channels. A, The
inactivation time constants of Nav1.7 (filled
squares) and Nav1.7+ 1 (open
squares) plotted versus voltage. B, The time
constants of Nav1.8 (filled circles)
and Nav1.8+ 1 (open circles)
plotted versus voltage.
|
|
Effects of the
1 subunit on the gating of
Nav1.7 and Nav1.8 channels
The effect of the
1 subunit on the
voltage sensitivity of activation was investigated also. The relative
conductance was determined from families of sodium currents similar to
those shown in Figure 1 (see Materials and Methods). The normalized
conductance of Nav1.7 and
Nav1.8 channels with and without the
1 subunit was plotted versus voltage (Fig.
5A,B). The smooth curves are fits to a Boltzmann function with midpoints
(V0.5) and slope factors (k) of
22.4 ± 2.7 and 5.4 ± 0.4 mV
(n = 10) for Nav1.7 and of
27.7 ± 1.3 mV (V0.5) and
3.7 ± 0.2 mV (k; n = 11) for
Nav1.7+
1 (Fig.
5A). Coexpression with the
1
subunit causes a significant
5.3 mV shift in the midpoint of
steady-state activation (p < 0.05). For
Nav1.8 the V0.5
and k values are 4.7 ± 0.7 and 6.8 ± 0.1 mV
(n = 8) and
3.3 ± 0.9 mV
(V0.5) and 5.5 ± 0.1 mV
(k) for
Nav1.8+
1
(n = 9) (Fig. 5B). The coexpression with the
1 subunit causes a significant
8 mV shift in
midpoint (p < 0.05) and reduces the slope
factor, consistent with an increase in the voltage sensitivity of the
Nav1.8 sodium channels. Overall, the
1 subunit causes hyperpolarizing shifts in the
midpoints of activation and increases the voltage sensitivity of both
Nav1.7 and Nav1.8 channels.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 5.
Effects of the 1 subunit
on the activation, inactivation, and recovery of Nav1.7 and
Nav1.8 channels. Activation was measured by applying a
series of depolarizing voltage pulses between 80 and +60 mV from a
holding potential of 100 mV. The peak currents were measured, and the
relative conductance was calculated by using the standard procedures
(see Materials and Methods). Also plotted is the steady-state
availability curve that was determined by using 500 msec conditioning
pulses to voltages between 110 and +30 mV and a standard test pulse
to either 20 mV (Nav1.7 and
Nav1.7+ 1) or +20 mV
(Nav1.8 and Nav1.8+ 1).
Test currents were normalized and plotted versus conditioning voltage.
A, The normalized conductance versus voltage and
steady-state inactivation plots of Nav1.7
(filled squares) and
Nav1.7+ 1 (open squares)
channels. The smooth curves are Boltzmann fits:
G = 1/(1 + exp ((V V0.5)/ k)),
with midpoints (V0.5) and slope
factors (k) of activation of 22 ± 2.7 and
5.4 ± 0.4 mV for Nav1.7 (n = 10)
and 27.7 ± 1.3 and 3.7 ± 0.2 mV for
Nav1.7+ 1 (n = 11). For inactivation
the V0.5 and k values are
68.2 ± 0.43 and 6.4 ± 0.45 mV for Nav1.7
(n = 4) and 69.8 ± 0.3 and 3.9 ± 0.2 mV for Nav1.7+ 1 (n = 4).
B, Steady-state activation and inactivation of
Nav1.8 channels. The smooth curves have
V0.5 and k values for
activation of 4.7 ± 0.7 and 6.8 ± 0.1 mV for
Nav1.8 (filled circles;
n = 8) and 3.3 ± 1.0 and 5.5 ± 0.1 mV
for Nav1.8+ 1 (open circles;
n = 9). The V0.5 and
k values for inactivation are 54.8 ± 1.7 and
8.4 ± 0.2 mV for Nav1.8 (n = 3)
and 62.6 ± 2.3 and 6.3 ± 0.7 mV for
Nav1.8+ 1 (n = 6).
C, D, The time course of recovery from
inactivation of Nav1.7 and Nav1.8 channels.
Inactivation was induced by depolarizing to 20 mV (Nav1.7
and Nav1.7+ 1) or +20 mV
(Nav1.8 and Nav1.8+ 1) for
50 msec before returning to 100 mV for intervals between 1 msec and 5 sec. A standard test pulse was used to monitor recovery, and the
normalized test currents were plotted versus the recovery interval.
C, Recovery from inactivation of Nav1.7
(filled squares) and
Nav1.7+ 1 (open squares)
channels. The smooth curves are fits to the sum of two exponentials:
I/IO = AF · (1 exp( t/ F)) + AS · (1 exp( t/ S)), with time
constants ( ) and weighting factors (A) of
19.6 ± 0.8 msec ( F;
AF = 0.46 ± 0.02) and 933.4 ± 54.6 msec ( S;
AS = 0.54 ± 0.02) for
Nav1.7 (n = 7) and 6.6 ± 0.6 msec
( F; AF = 0.89 ± 0.02) and 53.2 ± 12.7 msec ( S;
AS = 0.11 ± 0.02) for
Nav1.7+ 1 (n = 7).
D, The recovery of Nav1.8
(filled circles) and
Nav1.8+ 1 (open circles)
channels is described best by the sum of three exponentials:
I/IO = AF · (1 exp( t/ F)) + AI · (1 exp( t/ I)) + AS · (1 exp( t/ S)), where
F, I, and S
are the fast, intermediate, and slow recovery time constants, and
AF,
AI, and AS
are the relative weighting factors. t is the interpulse
duration, and I/Io is the
normalized current amplitude. Data are the means ± SEM. The time
constants of Nav1.8 are 9.9 ± 1.8 msec
( F; AF = 0.41 ± 0.04), 168.6 ± 52.2 msec ( I;
AI = 0.28 ± 0.04), and 787.6 ± 112.6 msec ( S;
AS = 0.28 ± 0.04)
(filled circles; n = 5).
Recovery time constants of Nav1.8+ 1 are
2.0 ± 0.3 msec ( F;
AF = 0.32 ± 0.05), 243.8 ± 85.4 msec ( I; AI = 0.34 ± 0.05), and 1070.1 ± 59.0 msec
( S; AS = 0.34 ± 0.02) (open circles; n = 4).
|
|
The effect of the
1 subunit on the
steady-state inactivation was investigated also. Steady-state
inactivation was measured by using 500 msec conditioning pulses to
voltages between
110 and +30 mV. The fraction of available current
was determined by using standard test pulses, and the normalized
currents were plotted versus the conditioning voltage (Fig.
5A,B). The smooth curves are Boltzmann fits with midpoints
(V0.5) and slope factors
(k) of
68.2 ± 0.4 and 6.4 ± 0.5 mV
(n = 4) for Nav1.7 and of
69.8 ± 0.3 mV (V0.5) and
3.9 ± 0.2 mV (k; n = 4) for
Nav1.7+
1 (Fig. 5A). The
1 subunit only slightly
alters the midpoint but significantly increases the voltage sensitivity
of Nav1.7 inactivation (p < 0.05). Steady-state inactivation of Nav1.8
sodium channels is shifted significantly toward hyperpolarizing
voltages, with V0.5 and k
values of
54.8 ± 1.7 and 8.5 ± 0.2 mV (n = 3) for Nav1.8 (p < 0.05) and
62.6 ± 2.3 mV (V0.5)
and 6.3 ± 0.7 mV (k; n = 6) for
Nav1.8+
1 (Fig.
5B). Coexpression of Nav1.8 with the
1 subunit significantly shifts the midpoint of
steady-state inactivation by
7.8 mV and increases the voltage
sensitivity. Hence coexpression with the
1
subunit also causes hyperpolarizing shifts in the midpoints and
increases the voltage sensitivity of steady-state inactivation of both
the Nav1.7 and Nav1.8
sodium channels.
Effects of
1 subunit on recovery from
fast inactivation
Effects of the
1 subunit on the recovery
from fast inactivation were examined with a standard two-pulse protocol
consisting of a depolarizing pulse to
20 mV
(Nav1.7) or +20 mV (Nav1.8) for 40 msec to inactivate the channels, followed by a variable duration
(1 msec to 5 sec) step to
100 mV to promote recovery. The
availability of the channels after the end of the recovery interval was
assessed with a standard test pulse, and the normalized currents were
plotted versus the recovery interval. Figure 5, C and
D, illustrates the time dependence of recovery from fast inactivation of Nav1.7 and
Nav1.8 channels. In the absence of the
1 subunit the recovery of
Nav1.7 is bi-exponential, with fast and slow time
constants of 19.6 ± 0.8 msec (
F) and
933.4 ± 54.6 msec (
S; n = 7) (Fig. 5C). Coexpression with the
1 subunit substantially increases the recovery
kinetics and causes the channels to recover fully from inactivation.
The fast and slow recovery time constants of
Nav1.7+
1 are 6.6 ± 0.6 msec (
F) and 53.2 ± 12.7 msec
(
S; n = 7). The more complete
recovery of Nav1.7+
1 channels can be attributed primarily to a 2.9-fold increase in the
fraction of channels recovering with the rapid time constant.
In contrast, the recovery from fast inactivation of
Nav1.8 is slow in comparison with
Nav1.7, and fitting the data required the sum of
three exponentials to describe the time course accurately. The recovery
time constants of Nav1.8 channels are 9.9 ± 1.8 msec (
F), 168.6 ± 52.2 msec
(
I), and 787.6 ± 112.6 msec
(
S; n = 5) (Fig.
5D). The recovery time constants of
Nav1.8+
1 are 2.0 ± 0.3 msec (
F), 243.8 ± 85.4 msec
(
I), and 1070.1 ± 59.0 msec (
S; n = 4) (Fig.
5D). The
1 subunit reduces
F but increases
S,
consistent with differential effects on the fast and slow components of
Nav1.8 recovery from inactivation. Interestingly, the slow component of recovery (
S) is observed
only with Nav1.8 channels and is enhanced with
the
1 subunit. This suggests that the
Nav1.8+
1 channels may enter readily into a
slow inactivated state during the short (40 msec) depolarizing
prepulses to +20 mV that are used to induce inactivation.
Development of slow inactivation of
Nav1.7+
1 and
Nav1.8+
1 channels
The recovery from inactivation of
Nav1.8+
1 displays a slow
component that is not observed with
Nav1.7+
1 (Fig.
5C,D). The data suggest that, in addition to the fast and
intermediate components of inactivation observed for both channels,
Nav1.8+
1 channels enter
into a slow inactivated state during the short depolarizing prepulses
used to inactivate the channels in these experiments. To test this
hypothesis, we compared the development of slow inactivation of
Nav1.7+
1 and
Nav1.8+
1 channels (Fig.
6). The onset of slow inactivation was
measured by depolarizing the oocytes to either
20 mV
(Nav1.7+
1) or +20 mV
(Nav1.8+
1) for a
variable interval (0 msec to 10 sec) to induce inactivation. Then the
voltage was returned to
100 mV for 20 msec to allow for the recovery
of fast-inactivated channels (
F = 6.6 msec for
Nav1.7+
1;
F = 2 msec for
Nav1.8+
1) before a
standard test pulse to assay availability was applied. The
amplitudes of the test currents were normalized to controls and
plotted versus the prepulse interval. In these experiments the
progressive decay of the currents observed with increasing prepulse
duration reflects the entry of the channels into slow inactivated
states from which the channels do not recover readily during the short
hyperpolarization (
100 mV for 20 msec) that precedes the test pulse
(Fig. 6). The onset of slow inactivation of the
Nav1.7+
1 channels is fit
with the sum of three exponentials with time constants of 32.6 ± 1.5 msec (
F), 556.5 ± 104.4 msec (
I), and 4071.9 ± 155.1 msec
(
S; n = 6) (Fig. 6). For
Nav1.8+
1 channels the
onset of slow inactivation has time constants of 8.4 ± 0.2 msec
(
F), 200.0 ± 30.0 msec
(
I), and 8880.0 ± 1150.0 msec
(
S; n = 5) (Fig. 6). These
data indicate that the onset of slow inactivation
(
F) is nearly fourfold faster for the
Nav1.8+
1 channels than
for Nav1.7+
1 channels.
The rapid development of slow inactivation of
Nav1.8+
1 may
account for the unusually slow component of recovery from inactivation
observed for this isoform. In contrast, the onset of slow inactivation
of Nav1.7+
1 channels is
delayed in comparison with
Nav1.8+
1, and these
channels consequently lack the slow component of recovery from
inactivation (Fig. 5C).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 6.
Development of slow inactivation of
Nav1.7+ 1 and
Nav1.8+ 1 sodium channels. Time course of
entry into the slow inactivated state was measured by using a
triple-pulse protocol consisting of a variable duration conditioning
pulse (2 msec to 10 sec) to 20 mV
(Nav1.7+ 1; open
squares) or to +20 mV
(Nav1.8+ 1; open
circles) to inactivate the channels. A 20 msec pulse to 100
mV was applied to promote the rapid recovery of inactivated channels,
and a standard test pulse was used to assay availability. The test
currents were normalized and plotted versus the conditioning pulse
interval. The decay of the currents is fit best by the sum of three
exponentials: I/IO = AF · (1 exp( t/ F)) + AI · (1 exp( t/ I)) + AS · (1 exp( t/ S)), where
F, I, and S
are the time constants, and AF,
AI, and AS
are the relative weighting factors. t is the
conditioning pulse duration, and
I/Io is the normalized
current. The data are the means ± SEM. The time constants of
Nav1.7+ 1 (open squares) are
F = 32.6 ± 1.5 msec
(AF = 0.25 ± 0.03),
I = 556.5 ± 104.4 msec
(AI = 0.33 ± 0.02), and
S = 4071.9 ± 155.1 msec
(AS = 0.42 ± 0.03)
(n = 6). For Nav1.8+ 1
(open circles) the time constants are
F = 8.4 ± 1.5 msec
(AF = 0.57 ± 0.07),
I = 200.0 ± 30.0 msec
(AI = 0.16 ± 0.07), and
S = 8880.0 ± 1150.0 msec
(AS = 0.27 ± 0.04)
(n = 5).
|
|
Frequency-dependent inhibition of
Nav1.7+
1 and
Nav1.8+
1 channels
The unusually rapid onset of slow inactivation of
Nav1.8+
1 suggests that
during short depolarizations (<10 msec) some of the channels are
likely to enter into a slow inactivated state. This could have
important consequences for the rapid cycling of channels during
episodes of repetitive stimulation. The effects of rapid pulsing were
tested by applying a series of 50 short (8 msec) depolarizing pulses
(
20 mV for Nav1.7+
1 or
+20 mV for Nav1.8+
1) at
frequencies of between 0.5 and 100 Hz (Fig.
7). The 8 msec depolarizing pulse used in
the experiments is close to the somatic action potential duration of C
fibers (0.6-7.4 msec) previously reported by Harper and Lawson (1985)
.
The currents elicited by the individual test pulses were normalized to
control currents and plotted versus the pulse number. For
Nav1.7+
1 channels, pulsing frequencies up to 20 Hz have small effects on the amplitude of
the currents (Fig. 7A,C; n = 10). The
majority of the channels is capable of efficiently cycling via the
open, closed, and inactivated conformations at these pulsing
frequencies. Increasing the stimulation frequency to 50 or 100 Hz
dramatically reduces the currents of Nav1.7+
1, indicating
that the channels no longer fully recover during the short intervals
between pulses. The decrease in amplitude for pulsing frequencies >25
Hz may reflect the trapping of some channels in slow inactivated states
(Fig. 5C).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 7.
Frequency-dependent inhibition of
Nav1.7+ 1 and
Nav1.8+ 1 sodium currents. A,
B, A train of 50 pulses was applied to 20 mV
(Nav1.7+ 1; n = 11) or +20 mV (Nav1.8+ 1;
n = 8) at frequencies between 0.5 and 100 Hz. The
peak currents elicited by each test pulse were normalized to the
current of the first pulse
(Pn/P1,
where n = 1-50) and were plotted versus pulse
number. The pulse duration was 8 msec for frequencies between 0.5 and
50 Hz but was reduced to 5 msec for the 100 Hz experiments. The holding
and interpulse potential was 100 mV. C, Plotted is the
ratio of the currents elicited by the 50th and first pulses
(P50/P1)
versus the pulsing frequency. Insets are representative
raw current traces of Nav1.7+ 1 (open
squares) and Nav1.8+ 1 (open
circles) stimulated at 20 Hz.
|
|
The response of Nav1.7+
1
channels to rapid repetitive stimulation sharply contrasts with that of
Nav1.8+
1 channels in
which the pulsing frequencies of 1-2 Hz cause a significant reduction in current amplitude (Fig. 7B,C; n = 8). At
frequencies >20 Hz the current amplitude reaches a steady-state level
of ~42% of the control current (Fig. 7B,C). The
dissimilarity of
Nav1.8+
1 and
Nav1.7+
1 channels in
their sensitivity to rapid repetitive stimulation could have important
consequences on the firing frequency of cells predominantly expressing
these types of sodium channels.
 |
DISCUSSION |
Despite a high degree of sequence homology, the
subunits of
voltage-gated sodium channels exhibit substantial heterogeneity in
their electrophysiological properties (Goldin et al., 2000
). Subtle
changes in the primary amino acid sequences can have significant effects in the gating and pharmacology of these channels. In addition to the functional differences encoded in the
subunits, most sodium
channels are multimeric proteins that are associated with accessory
subunits (
1,
2, and
3) (Isom et al., 1992
; McClatchey et al.,
1993
; Nuss et al., 1995
). The
1 subunit is
known to accelerate the kinetics of activation, inactivation, and
recovery from inactivation of brain and skeletal muscle sodium channels
(Auld et al., 1988
). Modulation of these channels by the
1 subunit also contributes to the functional
diversity of neuronal and muscle sodium channels.
In this study we examined the effects of the
1
subunit on the functional properties of the
Nav1.7 (PN1) and Nav1.8
(PN3) sodium channels heterologously expressed in Xenopus
oocytes. Our data indicate that the
1 subunit
alters the gating and voltage sensitivity of both channels and
selectively increases the expression of the
Nav1.8 channels.
The
1 subunit modulates levels of sodium currents of
Nav1.7 and Nav1.8
The
1 subunit selectively enhances the
expression of Nav1.8 channels, but not
Nav1.7 channels (Fig. 2). Comparing the average sodium current from paired groups of oocytes indicates that the expression of Nav1.8 increases by almost sixfold
in the presence of the
1 subunit versus
1.1-fold for Nav1.7. The selective regulation of
Nav1.8 sodium channel expression by the
1 subunit may play an important role in
regulating TTX-R current in vivo (Cummins and Waxman, 1997
;
Novakovic et al., 1998
; Gold, 1999
). A similar modulation of
Nav1.8 sodium channel expression was observed
recently with another auxiliary (
3) subunit
(Shah et al., 2000
).
The
1 subunit alters gating and voltage sensitivity
of Nav1.7 and Nav1.8 sodium channels
Coexpression with the
1 subunit
significantly alters the kinetics and voltage sensitivity of
Nav1.7 and Nav1.8 sodium
currents. In the absence of
1 the inactivation
of Nav1.7 is slow and incomplete. The
1 subunit accelerates the current decay
consistent with a more rapid rate of inactivation. At
20 mV the
inactivation of Nav1.7 increases nearly 10-fold
when the channels are coexpressed with the
1
subunit. The
1 subunit also alters the voltage
sensitivity of the channels, shifting the midpoints of steady-state
activation and inactivation by
5.3 and
1.6 mV, respectively.
Similar changes in current kinetics and voltage sensitivity are
observed when the Nav1.8 channels are coexpressed
with the
1 subunit. Coexpression with the
1 subunit decreases the time constant of
current decay at +20 mV by 1.6-fold, consistent with more
rapid inactivation. In the presence of the
1
subunit the midpoints of steady-state activation and inactivation of
Nav1.8 channels are shifted significantly by
8
and
7.8 mV, respectively.
The
1 subunit alters the recovery from
fast inactivation
The
1 subunit also significantly affects
the time course of recovery from inactivation of the
Nav1.7 and Nav1.8 sodium
channels (Fig. 5C,D). The recovery from inactivation of
Nav1.7 is well fit by two exponentials with time
constants of 19 and 933 msec for Nav1.7 and time
constants of 6.6 and 53 msec for
Nav1.7+
1. The recovery
of the Nav1.8 channels is also considerably
slower and requires three exponentials to describe the time
course adequately. Coexpression of Nav1.8 with
the
1 subunit accelerates the fast component
of recovery from inactivation but delays the intermediate and slow
components of recovery from fast inactivation. The mechanism underlying
this differential effect on the fast and slow components of
inactivation is currently under investigation.
Our data indicate that the
1 subunit has
significant effects on both the Nav1.7 and
Nav1.8 channels, particularly on the kinetics of
inactivation. A similar increase in inactivation rate with
1 coexpression recently has been reported for
Nav1.7 channels (Shcherbatko et al., 1999
). These
findings are inconsistent with previous studies showing that the
functional properties of Nav1.7 and
Nav1.8 channels expressed in oocytes are not
altered by the
1 subunit (Sangameswaran et
al., 1996
, 1997
). Although we have no clear explanation for the
differences between our data and those of these previous investigators,
our data are consistent with studies showing that the
1 subunit modulates the gating and expression
of many neuronal sodium channels (Isom et al., 1995
; Shcherbatko et
al., 1999
).
Comparison with TTX-S and TTX-R sodium channels of DRG neurons
Multiple components of sodium current have been recorded from
native DRG neurons that exhibit significant differences in gating and
toxin sensitivity (Kostyuk et al., 1981
; Roy and Narahashi, 1992
; Ogata
and Tatebayashi, 1993
; Rush et al., 1998
). The kinetics of the TTX-S
currents are generally faster, and the steady-state activation and
inactivation are shifted toward more hyperpolarized voltages in
comparison with the TTX-R currents. These properties are qualitatively
consistent with those of the Nav1.7 (TTX-S) and
Nav1.8 (TTX-R) sodium channels observed in this
study. For the Nav1.7+
1
channels the midpoints of steady-state activation, inactivation, and
the kinetics of inactivation are in reasonable agreement with the
properties of TTX-S currents measured from acutely dissociated DRG
neurons (Kostyuk et al., 1981
; Roy and Narahashi, 1992
; Ogata and
Tatebayashi, 1993
; Rush et al., 1998
). The Nav1.7
channel, along with its associated
1 subunit,
is likely to contribute to TTX-S sodium currents of both large and
small DRG neurons (Ogata and Tatebayashi, 1993
; Rush et al., 1998
).
In contrast, the midpoint steady-state inactivation of
Nav1.8+
1 (
62.6 mV) is
more hyperpolarized than the native TTX-R sodium currents (
34 to
52
mV). The reasons for this discrepancy are unclear; however, a recent
study has shown that at least three distinct components of TTX-R sodium
current are present in the native cells (Rush et al., 1998
). Variation
in the relative expression levels of these different TTX-R sodium
channels may explain the wide range of electrophysiological properties
reported for the TTX-R currents of DRG neurons. In addition, the
presence of additional
subunits (
2,
3) or a variation in second messenger
regulation may contribute further to the differences in the
inactivation of heterologously expressed Nav1.8
and the TTX-R current of DRG neurons. In addition, our data show that
the development of slow inactivation of the
Nav1.8+
1 channels is
unusually rapid. This can influence the properties of steady-state
inactivation by shifting the midpoint toward more hyperpolarized
voltages (Ogata and Tatebayashi, 1992
). Interestingly, a TTX-R3
component of sodium current of type D DRG neurons has been identified
recently that has a midpoint of steady-state inactivation of
63 mV,
identical to what we observed for the
Nav1.8+
1 channels (Rush
et al., 1998
). Despite some quantitative differences the data indicate
that coexpression of Nav1.8 and the
1 subunits in oocytes produces currents that
have kinetics and voltage sensitivity similar to the TTX-R sodium
currents of small DRG neurons.
Several studies have shown that the amplitudes of DRG neuron sodium
currents are highly sensitive to the frequency of the applied voltage
pulses (Rush et al., 1998
; Scholz et al., 1998
). In general, the TTX-R
currents are reported to be more sensitive to rapid repetitive pulsing
than the TTX-S sodium currents. These data suggest important
differences in the repriming of these channels after a depolarizing
voltage pulse. In this study the
Nav1.8+
1 channels
display a significant reduction in current amplitude during repetitive
stimulation at frequencies between 1 and 2 Hz (Fig. 7). This contrasts
with Nav1.7+
1 channels,
which are considerably less sensitive to such low-frequency
stimulation. The data suggest that during low-frequency repetitive
stimulation (1-2 Hz) inactivated Nav1.8+
1 channels fail
to recover fully during the interval between pulses. At 2 Hz the rest
interval between pulses (492 msec) is sufficient to permit full
recovery of fast inactivated channels (
F = 2 msec). The entry and recovery from fast inactivation cannot account for
the observed frequency-dependent reduction of
Nav1.8+
1 currents.
Rather, the data suggest that a fraction of
Nav1.8+
1 channels may
enter into a slow inactivated state during the brief depolarizations.
The time course of entry into the slow inactivated state has been
measured directly by a double-pulse protocol (Fig. 6). The onset of
slow inactivation of
Nav1.8+
1 channels
(
F = 8.4 msec) is considerably faster than
that of the Nav1.7+
1
channels (
F = 33 msec). During the short
depolarizations used in the repetitive pulsing protocol (8 msec), a
significant fraction of the
Nav1.8+
1 channels, but
not Nav1.7+
1 channels,
is predicted to undergo slow inactivation. Few of these slow
inactivated channels recover (
S = 1070 msec)
during the short interval (492 msec) between pulses. The data indicate
that the high sensitivity of the
Nav1.8+
1 channels to
low-frequency repetitive stimulation results from the unusually rapid
entry of these channels into the slow inactivated state. A similar
mechanism has been proposed for the TTX-R sodium current of DRG neurons
(Scholz et al., 1998
).
Nav1.7+
1 channels are
more resistant to slow inactivation and are significantly less
sensitive to low-frequency repetitive stimulation.
Physiological relevance
Previous work suggests that the rapid repriming and high threshold
of TTX-R sodium currents may play an important role in the sustained
firing of C fibers after nerve injury (Elliott and Elliott, 1993
;
Jeftinija, 1994
; Schild and Kunze, 1997
). Although the majority of the
Nav1.8+
1 channels
rapidly recovers from inactivation, these channels are also more likely