Previous Article | Next Article 
The Journal of Neuroscience, November 1, 2001, 21(21):8456-8463
Sodium Channel mRNAs at the Neuromuscular Junction: Distinct
Patterns of Accumulation and Effects of Muscle Activity
Suad S.
Awad1,
Robert
N.
Lightowlers1,
Carol
Young1,
Zofia M. A.
Chrzanowska-Lightowlers1,
Terje
Lømo2, and
Clarke R.
Slater1
1 Department of Neuroscience, University of Newcastle
upon Tyne, NE2 4HH, Newcastle upon Tyne, United Kingdom, and
2 Department of Physiology, University of Oslo, 0317 Oslo,
Norway
 |
ABSTRACT |
Voltage-gated sodium channels (VGSCs) are highly
concentrated at the neuromuscular junction (NMJ) in mammalian skeletal
muscle. Here we test the hypothesis that local upregulation of mRNA
contributes to this accumulation. We designed radiolabeled antisense
RNA probes, specific for the "adult" NaV1.4 and
"fetal" NaV1.5 isoforms of VGSC in mammalian skeletal
muscle, and used them in in situ hybridization studies
of rat soleus muscles. NaV1.4 mRNA is present throughout normal adult muscles but is highly concentrated at the NMJ, in which
the amount per myonucleus is more than eightfold greater than away from
the NMJ. NaV1.5 mRNA is undetectable in innervated muscles
but is dramatically upregulated by denervation. In muscles denervated
for 1 week, both NaV1.4 and NaV1.5 mRNAs are
present throughout the muscle, and both are concentrated at the NMJ. No NaV1.5 mRNA was detectable in denervated muscles stimulated
electrically for 1 week in vivo. Neither denervation nor
stimulation had any significant effect on the level or distribution of
NaV1.4 mRNA. We conclude that factors, probably derived
from the nerve, lead to the increased concentration of VGSC mRNAs at
the NMJ. In addition, the expression of NaV1.5 mRNA is
downregulated by muscle activity, both at the NMJ and away from it.
Key words:
neuromuscular junction; sodium channels; denervation; electrical activity; rat; in situ hybridization
 |
INTRODUCTION |
Voltage-gated sodium channels
(VGSCs) play a central role in action potential generation and
propagation in mammalian nerve and muscle. In neurons, they are
concentrated at sites in which action potentials are initiated: the
axon hillock and the initial segments (Wollner and Catterall,
1986
). In skeletal muscle, VGSCs are concentrated at
neuromuscular junctions (NMJs), in the depths of the postsynaptic
folds, alternating with acetylcholine receptor (AChR)-rich domains at
the crests of the folds (Flucher and Daniels, 1989
; Boudier et al.,
1992
; Lupa et al., 1993
; Wood and Slater, 1998
). This juxtaposition of
ligand- and voltage-gated ion channels at the NMJ increases the
reliability of neuromuscular transmission (Martin, 1994
; Wood and
Slater, 1997
, 2001
). VGSCs are also present in lower concentrations in
extrajunctional (XJ) regions of muscle fibers in which they mediate
action potential propagation (Lupa et al., 1993
; Wood and Slater,
1998
).
Little is known about how the distribution of VGSCs in muscle fibers is
controlled. Previous studies of a number of other proteins that are
concentrated in the postsynaptic region [e.g., AChRs,
acetylcholinesterase (AChE), rapsyn, utrophin, and neural cell adhesion
molecule (N-CAM)] have revealed that the mRNAs encoding them are also
concentrated near the NMJ (for review, see Hall and Sanes, 1993
;
Burden, 1998
; Sanes and Lichtman, 1999
). However, in contrast to most
of these other proteins, VGSCs have a well defined role away from the
NMJ, as well as in the junctional (J) region. This raises the
possibility that the mechanisms that determine the distribution of
VGSCs may differ from those for other postsynaptic proteins. Previous
studies have described the presence of mRNA encoding VGSCs in whole
muscle fibers (Kallen et al., 1990
; Yang et al., 1991
; Lupa et al.,
1993
, 1995
), but the question of whether there is an additional
increase in mRNA at the NMJ, and if so how it is regulated, has not
been addressed.
In this study, we used in situ hybridization (ISH) to
determine whether mRNA species encoding VGSCs are concentrated at NMJs in adult rat muscle. Two isoforms of VGSCs,
NaV1.4 and NaV1.5, encoded
by two separate genes, are expressed in mammalian skeletal muscle
(Trimmer et al., 1989
; Kallen et al., 1990
). The
NaV1.4 isoform, which is relatively sensitive to
tetrodotoxin, predominates in the adult. It is present throughout the
muscle fiber but is concentrated at the NMJ and perijunctional regions
(Flucher and Daniels, 1989
; Lupa et al., 1993
; Wood and Slater, 1998
).
The NaV1.5 isoform, which is relatively resistant
to tetrodotoxin, predominates in immature muscle and is reexpressed in
denervated and paralyzed muscle (Harris and Thesleff, 1971
; Kallen et
al., 1990
; Lupa et al., 1995
; Pasino et al., 1996
). It seems likely that muscle activity is an important determinant of the global expression of the NaV1.5 gene in muscle fibers,
although this has not been demonstrated directly. We therefore studied
the effect of denervation, and of subsequent direct muscle stimulation,
on the distribution and abundance of both species of
NaV1 mRNA.
 |
MATERIALS AND METHODS |
Muscle denervation and stimulation. Experiments were
performed on soleus muscles from adult female Wistar rats weighing
200-300 gm. Muscles were denervated under halothane anesthesia (2.5%) by unilateral removal of ~5 mm of the sciatic nerve at midthigh level. Soleus muscles were removed at different times after
denervation. All animals were treated in accordance with local animal
care regulations in the United Kingdom.
Electrical stimulation was performed in Norway on muscles that had been
denervated for 5 d. Electrodes were implanted on each side of the
soleus muscle as described previously (Windisch et al., 1998
). The
muscle was stimulated for 1 week with trains of 60 pulses at 100 Hz
every 60 sec. Muscles were removed using RNase-free instruments and
reagents, and the midbelly portion was frozen in isopentane cooled to
150°C with liquid nitrogen for ISH experiments (see below). Soleus
muscles from unoperated rats of the same age were used as controls. The
experiments were conducted in conformity with regulations for
experiments on live animals in Norway and overseen by the veterinarian
responsible for the animal house.
Synthetic oligonucleotide primers. The
NaV1.4-specific probe was designed from the
published cDNA sequence of the
-subunit of the rat
NaV1.4 sodium channel (Trimmer et al., 1989
;
GenBank accession number M26643). Specific oligonucleotide primers were
designed from an area of low homology with NaV1.5
in the cytoplasmic loop between the transmembrane domains DII and DIII (Fig. 1A): sense
primer, 5' AATACTCAGCCTCGGTGAGC 3' [nucleotide (nt) 2993-3012];
antisense primer, 5' CTTGTAGTCAGCTGTGCTGC 3' (nt 3341-3322).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1.
Generation of isoform-specific probes for VGSCs.
A, Primary structure of -subunit of VGSC (adapted
from Catterall, 1992 ). The location of sequences used to make probes
for NaV1.4 and NaV1.5 isoforms are indicated by
broken lines in cytoplasmic domains I and II.
B, Agarose gel electrophoresis (1%) of RT-PCR products
from skeletal (Sk) and cardiac (C)
muscles using isoform-specific oligonucleotide primers. The
NaV1.4-specific primer set (Materials and Methods)
amplified the correct 349 bp product from skeletal but not from cardiac
cDNA (left panel). The
NaV1.5-specific fragment (410 bp) is amplified from both
skeletal cardiac muscle cDNAs (right panel). No
products are detected in the absence of reverse transcriptase using
either primer set ( RT lanes). The first lane in each panel contains a
molecular size marker (Life Technologies). C, RPA using
isoform-specific antisense RNA probes. The NaV1.4-specific
(top panel) and NaV1.5-specific
(bottom panel) probes were labeled with
[ -32P]UTP and hybridized with 10 µg of total RNA
from brain, liver, heart, and innervated (Sol+N)
and denervated (Sol-N) soleus muscles (see
Materials and Methods). The NaV1.4 probe protected a
fragment of expected size from both innervated and denervated soleus
but none from brain, liver, or cardiac RNA. Hybridization with the
NaV1.5-specific probe resulted in protection of two
fragments from cardiac and denervated soleus RNA, one smaller than the
expected size. No protected fragments are detected from liver, brain,
or innervated soleus muscle RNA (middle panel).
Digested (Dig) and undigested (Undig)
probe controls were run in adjacent lanes in each gel. The
bottom panel shows a denaturing agarose gel
electrophoresis (1%) of an aliquot total cytosolic RNA used for RPA,
demonstrating intact 28 S and 18 S ribosomal RNA bands and 5 S RNA at
the bottom of the ethidium bromide-stained gel.
|
|
The NaV1.5-specific probe is contained in the
cytoplasmic loop between DI and DII and includes an insertion in this
region (Fig. 1A). Specific oligonucleotide primers
were designed from the published rat cardiac
-subunit cDNA sequence
[sense primer, 5' AGCTCTCTGGAGATGTCTCC 3' (nt 1575-1594); antisense
primer, 5' ACGGTGCTGTTCCTTTTGCC 3' (nt 1984-1965)] and were used in
reverse transcription (RT)-PCR to amplify a 410 bp fragment (Rogart et al., 1989
; GenBank accession number M27902). All synthetic oligonucleotide primers were obtained from MWG Biotech (Milton Keynes, UK).
RNA isolation, first-strand cDNA synthesis, and PCR. Total
RNA was isolated from liver, brain, soleus, and cardiac muscles using
TRIZOL reagent and used for cDNA synthesis with
oligo-dT12-18 primer following the
recommendations of the manufacturer (Life Technologies, Paisley, UK).
Negative controls were performed in the absence of reverse transcription.
Ten percent of the first-strand cDNA from soleus and cardiac muscle was
used in a PCR reaction with 50 pmol of each of the isoform-specific
oligonucleotide primers. Amplification conditions for the
NaV1.4-specific primer set were as follows: first
step of denaturation at 94°C for 3 min, followed by 35 cycles of
94°C for 1 min, 59°C for 1 min, and 72°C for 1 min, followed by
extension at 72°C for 3 min. A product of 349 bp was generated from
skeletal muscle, but no product was amplified from cardiac cDNA (Fig.
1B).
Amplification conditions with the NaV1.5-specific
primer set were as for NaV1.4, except that primer
annealing was performed at 54°C. A 410 bp product was generated from
both skeletal and cardiac cDNA. A low level of tetrodotoxin-resistant
sodium current has been reported in adult skeletal muscle (Lupa et al.,
1993
), and this may explain PCR amplification of the
NaV1.5-specific fragment from skeletal muscle
cDNA in our experiments.
PCR-generated fragments were subcloned into pGEM-T easy vector
(Promega, Southampton, UK) following the recommendations of the
manufacturer, and the identity of the cloned fragments was verified by
DNA sequence analysis (Molecular Biology Service Unit, University of
Newcastle upon Tyne).
RNase protection assays. Vector constructs containing
NaV1.4- or NaV1.5-specific
fragments were linearized (Spe1 or Apa1, respectively) and used as in vitro transcription (IVT)
templates in the presence of
[
-32P]UTP (800 Ci/mmol; Amersham
Pharmacia Biotech, Bucks, UK) to synthesize the antisense
NaV1.4 (T7 RNA polymerase-driven) or NaV1.5 (SP6 RNA polymerase-driven; Roche
Diagnostics, Lewes, UK) probes. IVT was performed. Labeled probe
(6 × 104 cpm) was hybridized for 48 hr with 10 µg of total cytosolic RNA at 42°C. Samples were then
digested for 30 min with RNase A/T1 mix at 37°C (RPAIII kit; Ambion,
Austin, TX) and electrophoresed on 5% denaturing polyacrylamide urea
gels in 1× Tris-borate-EDTA buffer, together with the digested and
undigested probe-alone controls. These controls indicate the efficiency
of digestion, because the NaV1.4- and
NaV1.5-specific probes contained noncomplementary sequence of 64 and 129 nucleotides derived from polylinker sequences, respectively. The protected RNA fragments were visualized using a
PhosphorImager and Image Quant software (Molecular Dynamics, Kent, UK).
The NaV1.4-specific probe protected the correct
size fragment from innervated and denervated adult skeletal muscle but
not from heart, liver, or brain RNA (Fig. 1C). The
NaV1.5-specific probe protected the correct size
RNA and a smaller fragment from cardiac and denervated soleus muscle
(Fig. 1C). No detectable products were identified from
innervated soleus, liver, or brain RNA.
In situ hybridization. ISH was performed on 6-µm-thick
frozen sections of adult rat soleus muscles as described previously (Vater et al., 1998
; Young et al., 1998
).
pGEM-T easy plasmids were linearized with Nco1 and
Spe1 (NaV1.4) or Pst1 and
Apa1 (NaV1.5) restriction enzymes and
used as templates for phage T7 and SP6-driven IVT to produce either
sense- or antisense-specific probes, depending on the orientation of the insert. Transcripts were double-labeled with
35S-CTP and
35S-UTP (>1000 Ci/mmol; Amersham
Pharmacia Biotech). Sections were hybridized overnight with
104-105
cpm/µl 35S-labeled probes in 40 µl of
hybridization buffer and washed as described previously (Young et al.,
1998
). NMJs were identified in the same fiber cross sections by the
reddish-brown AChE reaction product (Young et al., 1998
).
Autoradiography and analysis. Hybridized sections were
air-dried, dipped in Kodak NTB2 emulsion (Anachem Scotlab, Luton, UK), exposed at 4°C for 7-10 d, developed for 3 min at 17°C in Kodak Dektol developer, and counterstained with 0.25% toluidine blue in 1% borax.
Labeled sections were viewed with a Leica (Nussloch, Germany) DMRA
microscope, and images were recorded, using both bright- and dark-field
optics, with a cooled CCD camera with 12 bit intensity resolution (SPOT
2; Diagnostic Instruments, Sterling Heights, MI). The distribution and
intensity of labeling were determined from dark-field images,
substantially as described by Vater et al. (1998)
, using NIH Image
software. The spatial distribution of labeling was determined from the
mean signal intensity, expressed as gray levels per second exposure
time per square micrometer (gl/sec/µm2),
in concentric annuli centered on the cluster being analyzed. At most
clusters, both at the NMJ and in XJ regions, the intensity of labeling
declined to 30% of maximum at ~12 µm from the center of the grain
cluster, as reported previously for utrophin mRNA (Vater et al., 1998
).
For subsequent comparisons of the intensity of labeling at different
grain clusters, we used the total signal intensity within a circle of
12 µm radius, centered on the cluster.
The signal intensity of grain clusters at NMJs depended on the
concentration of the radioactive probe used in the hybridization reactions. At 20 × 103 cpm/µl, the
labeling intensity with the NaV1.4 probe was well above background but still only approximately two-thirds of that with
100 × 103 cpm/µl (data not shown).
Thus, at the lower concentration, the emulsion and detection system
were not saturated. A concentration of 20 × 103 cpm/µl was therefore used in all
subsequent experiments with the NaV1.4 probe.
Similarly, optimum labeling with the NaV1.5 probe
was obtained at 30 × 103 cpm/µl,
and this concentration was used in all experiments described.
Immunohistochemical staining and nuclear counting. We
counted nuclei in cross sections of muscle fibers, using a method
similar to that described previously by Zhang and McLennan (1994)
and Vater et al. (1998)
, that allowed us to distinguish between true myonuclei (within labeled sarcolemma) and the nuclei of myosatellite cells, which are particularly abundant near the NMJ (Kelly and Zacks
1969
).
Cryostat sections of adult soleus muscle were thaw mounted on
chrome-alum gelatin-coated slides and labeled with a cocktail of a
monoclonal antibody that recognizes the C-terminal domain of
dystrophin, Dy8/6C5 (1:100 dilution; kind gift from Dr. Louise Anderson, University of Newcastle upon Tyne), and a monoclonal antibody
that recognizes all forms of syntrophin (1351; 1:1000; a kind gift from
Prof. Stanley C. Froehner, University of Washington, Seattle, WA).
Antibodies were diluted in PBS containing 3% serum albumin and 0.1 M lysine. Antibody binding was visualized using horseradish
peroxidase-conjugated rabbit anti-mouse Ig (P0260; Dako, High
Wycombe, UK) and 3,3'diaminobenzidine. Counterstaining with hematoxylin
was used to visualize nuclei.
To analyze the distribution of nuclei, we used a crossed eyepiece
graticule, centered on the muscle fiber section to be studied, dividing
it into four quadrants numbered 1-4. Quadrant 1 included the NMJ if
present. Myonuclei clearly inside the labeled surface of the muscle
fiber were counted in each quadrant, in both sections containing NMJs
and sections at least 100 µm away from the NMJ in the same cross
section (XJ). Nuclei that appeared to straddle the muscle fiber
boundary, defined by immunolabeling, were not counted. These
represented fewer than 5% of the true myonuclei counted.
Statistics. Data are expressed as mean ± SEM. When
appropriate, data were analyzed using either a two-way ANOVA (with
Bonferroni correction) for multiple comparisons (Instat, version 1.11;
Graph Pad, San Diego, CA) or Student's t test (two-tailed)
for paired comparisons.
 |
RESULTS |
NaV1.4 mRNA of VGSCs is concentrated at the NMJ
Probes specific for NaV1.4 and
NaV1.5 were designed from the cytoplasmic loops
of the
-subunit between transmembrane domains DII-DIII and DI-DII,
respectively (Fig. 1A). RNase protection assays (RPA)
(Fig. 1C) confirmed that the two probes were isoform specific. These probes were then used to analyze the spatiotemporal distribution of mRNA encoding the two NaV1 isoforms.
After hybridization of sections of adult muscle with the
35S-labeled NaV1.4
probe, dense accumulations of silver grains were present at >80% (39 of 47) of NMJs examined [identified by AChE reaction product
(Fig. 2A,
arrow)]. Labeling intensity in a 12 µm radius test circle
centered on at the NMJ (see Materials and Methods) was nearly 20 times
greater than the average intensity of labeling in XJ regions
(99.65 ± 3.93 vs 5.14 ± 0.18 gl/sec/µm2; 49 J clusters and 43 XJ
fiber cross sections were examined). There is generally more label near
the surface than elsewhere in the muscle fiber.

View larger version (123K):
[in this window]
[in a new window]
|
Figure 2.
NaV1.4, but not
NaV1.5, mRNA is concentrated at the NMJ in normal rat
soleus muscle. NaV1.4 mRNA visualized after in
situ hybridization and autoradiography as silver grains
(A) is densely accumulated at the NMJ
(arrow), identified by the reddish-brown
cholinestrase reaction product. Accumulation of NaV1.4 mRNA
is also visible in XJ regions (arrowheads) as occasional
smaller clusters. No such accumulation is seen after hybridization with
the NaV1.5-specific antisense (C) or
the sense transcripts of either NaV1.4 or
NaV1.5 probes (B and D,
respectively). Scale bar, 50 µm.
|
|
After ISH, less dense accumulations were present in ~30% of fiber
cross sections (46 of 142) through XJ regions (Fig.
2A, arrowheads), and these were often
clearly associated with myonuclei. Labeling intensity within a circle
of 12 µm radius centered on these XJ clusters was ~30% of that at
J clusters (27.9 ± 0.99 gl/sec/µm2; 46 XJ clusters were analyzed).
No hybridization above background was seen with the
NaV1.5 probe (Fig. 2C). This lack of
cross hybridization provides additional evidence of the specificity of
our probes, as does the absence of detectable labeling in control
experiments with sense probes (Fig.
2B,D) or with no probe controls
(data not shown). These results were reproducible in experiments with
soleus muscles from each of five individual rats.
Labeling per nucleus
Numerous factors might contribute to the accumulation of
NaV1.4 mRNA at the NMJ. One of these is the well
known clustering of myonuclei in the subsynaptic myoplasm (Tello, 1907
,
1917
; Ramon y Cajal, 1960
; Kelly and Zacks, 1969
; Couteaux, 1973
),
which might give rise to a local increase in the concentration of mRNA
near the NMJ even if the amount of mRNA per nucleus was the same as elsewhere in the muscle fiber. To assess the importance of this factor,
we estimated the relative amounts of NaV1.4 mRNA
per nucleus at the NMJ and in XJ regions.
We determined the number of myonuclei in sections of muscle fibers,
both those containing NMJs and those in XJ regions. The average number
of myonuclei per muscle fiber section did not differ between J and XJ
regions (3.25 ± 0.07 vs 3.16 ± 0.09; 150 J and 132 XJ fiber
cross sections were examined). However, the mean number of nuclei in
quadrants of fiber sections containing NMJs (Materials and Methods) was
approximately twice the average value for quadrants in XJ regions
(1.59 ± 0.04 vs 0.83 ± 0.09; 150 NMJs and 132 XJ fiber
cross sections were examined). The clusters of grains from mRNA
labeling at the NMJ were approximately the same size as the individual
quadrants used to analyze nuclear distribution. To estimate the
intensity of labeling per nucleus at the NMJ, we divided the total
signal intensity in the area of a circle of 12 µm radius centered on
the grain clusters (99.6 gl/sec/µm2 × 453 µm2) by the mean number of myonuclei
in the quadrants containing NMJs (1.59) and compared that with the
total signal intensity of XJ fiber cross sections (5.14 ± 2130 µm2) divided by mean number of nuclei
within them (3.16). This was more than eight times
greater at the NMJ than away from it (28,363 vs 3402 gl/sec/nucleus).
Denervation increases the levels of NaV1.5 mRNA
Denervation resulted in a dramatic increase in labeling of mRNA
encoding NaV1.5, both at the NMJ and in XJ
regions (Fig. 3C). This
increase was detectable by the second day after denervation and reached
a peak at 3-5 d, which was then sustained for at least 4 weeks (Fig.
3E). At all times, the intensity of labeling was much
greater at the NMJs than in the XJ region. One week after denervation,
intense clusters of silver grains were present at ~85% of NMJs
examined (34 of 40), and the intensity of labeling at these clusters
NMJs was approximately nine times greater than the mean intensity in XJ
regions (90.4 ± 2.46 vs 10.3 ± 0.82 gl/sec; similar results
obtained from four rats).

View larger version (84K):
[in this window]
[in a new window]
|
Figure 3.
NaV1.5 mRNA is increased
after denervation of adult muscle. Accumulation of silver grains is
visible at the NMJ and in XJ regions after ISH with NaV1.5
antisense transcript in 7 d denervated soleus
(C) but not in control muscle
(A). NaV1.4 mRNA is concentrated at
the majority of NMJs and XJ regions in both control
(B) and denervated (D) rat
soleus. Scale bar, 50 µm. Time course of NaV1.5 mRNA
accumulation after denervation of adult rat muscle
(E). Mean intensity of labeling within a circle
of 12 µm radius centered on J clusters starts to increase by the
second day, reaching a peak at the third day and is sustained for up to
4 weeks after denervation of adult soleus muscles ( ). The same
temporal pattern is seen for fiber cross sections ( ) and clusters
( ) in XJ regions (40-50 J and 30-40 XJ clusters and 45 XJ fibers
were analyzed for each time point).
|
|
Denervation resulted in no significant change in the number or
distribution of myonuclei, at or away from the NMJ (3.03 ± 0.09 per cross section of denervated fibers; 1.66 ± 0.04 in quadrants containing NMJs compared with 0.75 ± 0.05 in XJ quadrants).
Accordingly, the mean labeling intensity per nucleus at the NMJ was
nearly fourfold greater than in XJ regions (24,646 vs 6288 gl/sec/nucleus).
Occasional weaker clusters of NaV1.5 mRNA
labeling were present in XJ regions. Approximately 30% of muscle fiber
sections in the XJ region contained obvious grain clusters at times >4 d after denervation (55 of 150). Because each section contains approximately three myonuclei, this indicates that not >10% of myonuclei in XJ regions are associated with grain clusters. The mean
intensity of labeling at these XJ clusters was 52.0 ± 1.9 gl/sec/µm2, approximately half of that
at NMJs. The intensity and pattern of labeling with the
NaV1.4 probe (Fig. 3D) was similar to
that in innervated controls (Fig. 3B).
In summary, denervation results in a substantial increase in the
concentration of NaV1.5 mRNA, particularly near
the NMJs, but has no effect on the level of
NaV1.4 mRNA.
Electrical stimulation downregulates NaV1.5 but not
NaV1.4 mRNA
To test the hypothesis that the increase in the amount of
NaV1.5 mRNA after denervation is a result of the
absence of electrical activity, we stimulated some of the denervated
muscles in vivo with implanted electrodes (Windisch et al.,
1998
). These muscles were denervated for 5 d, long enough to
induce maximal NaV1.5 expression (Fig.
3E). They were then stimulated for 1 week, using a pattern
of stimulation that is highly effective in preventing or reversing the
accumulation of AChRs and their mRNA in XJ regions and preventing the
loss of AChRs at the NMJs (Witzemann et al., 1991
; Andreose et al.,
1995
).
Stimulation abolished the increase in NaV1.5
mRNA, both at NMJs and in XJ regions (Fig.
4A,C;
results reproducible from three individual rats). The level of labeling
of these sections was similar to that of control innervated fibers
(Fig. 2C). The levels at the NMJ of
NaV1.4 mRNA were not affected by either
denervation or stimulation of adult muscle fibers (Fig.
4B,D).

View larger version (135K):
[in this window]
[in a new window]
|
Figure 4.
Electrical stimulation reverses
NaV1.5 mRNA accumulation in denervated adult muscle.
NaV1.5 mRNA clustering at the NMJ and XJ regions in 7 d denervated soleus (A) is abolished by chronic
electrical stimulation in vivo (C)
for 1 week as outlined in Materials and Methods. NaV1.4
mRNA is accumulated at the NMJ and XJ regions in both denervated
(B) and stimulated (D)
soleus muscle. Scale bar, 50 µm.
|
|
In Figure 5, we compare the levels of
NaV1.4 and NaV1.5 mRNA per
nucleus at NMJs and in XJ regions of control, denervated, and
denervated-stimulated muscles. This comparison makes clear that the
level of NaV1.5 mRNA is strongly suppressed by
muscle activity, both in the muscle fiber generally and at the NMJ,
although activity has no detectable effect on the levels of
NaV1.4 mRNA.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 5.
NaV1.5 mRNA accumulation in adult
muscle is controlled by activity. Intensity of NaV1.5
labeling per nucleus is nearly fourfold greater at J than XJ nuclei
(top panel) in denervated muscle, which is
reduced to control levels after electrical stimulation
(p < 0.001). Labeling intensity with
NaV1.4 probe at J and XJ nuclei is not affected by either
denervation or stimulation of adult soleus muscle (bottom
panel). Thirty to 40 J clusters and XJ fibers were
analyzed for each category.
|
|
 |
DISCUSSION |
In this study, we have taken advantage of the spatial resolution
of in situ hybridization to show for the first time that mRNA encoding muscle-specific forms of NaV1
channels is concentrated at the NMJ. The hybridization signal from
NaV1.4 mRNA is ~20 times stronger at normal
NMJs than away from them. This implies a local increase in synthesis of
NaV1.4 channels at the NMJ that is likely to
contribute to the high density of these channels in the postsynaptic membrane (Lupa et al., 1993
, 1995
) and thus to the reliability of
neuromuscular transmission (Wood and Slater, 2001
).
The persistence of NaV1.4 mRNA away from the NMJ
in normally active muscle fibers is consistent with an essential role
of NaV1.4 channels in action potential
propagation and distinguishes the regulation of
NaV1.4 mRNA from that of most other mRNA species that are concentrated at the NMJ. In contrast,
NaV1.5 mRNA was not detectable in normal
muscle. However, after denervation, it increased throughout the muscle
and particularly at the NMJ. This increase was completely abolished by
electrical stimulation. Thus, unlike a number of other
"postsynaptic" mRNA species (see below), the accumulation of
NaV1.5 mRNA at the NMJ is completely suppressed by muscle activity.
A number of features of the distribution of NaV1
mRNAs closely parallel the distribution of the proteins they encode. In
normal adult muscle, NaV1.4 is the dominant
NaV1 species present and is highly concentrated
at the NMJ (Caldwell and Milton, 1988
; Lupa et al., 1993
).
NaV1.5 is upregulated by denervation and
inactivity (Harris and Thesleff, 1971
; Caldwell and Milton, 1988
;
Kallen et al., 1990
; Lupa et al., 1995
; Pasino et al., 1996
) and, when upregulated, is concentrated at NMJ (Caldwell and Milton, 1988
, Lupa et
al., 1995
). Furthermore, the time course of the denervation-induced upregulation of NaV1.5 protein (Grampp et al.,
1972
) is similar to that of the mRNA reported here. Thus, our data
suggest that regulation of the local levels of mRNA species plays an
important part in determining physiologically relevant aspects of the
distribution of NaV1 proteins.
The patterns of NaV 1 mRNA expression differ from those
for other postsynaptic mRNAs
Our observations suggest that the distribution and abundance of
NaV1 mRNAs, like those encoding other
postsynaptic proteins, are influenced by a balance between the effects
of activity, which acts throughout the muscle fiber, and local
nerve-derived factors, which are concentrated the NMJ (Fischbach and
Rosen, 1997
; Burden, 1998
; Sanes and Lichtman, 1999
). However, the
patterns of expression of NaV1 mRNAs differ in
important ways from those reported for other postsynaptic mRNAs.
NaV1.4 mRNA is highly concentrated at the NMJ but
is also present away from it. Changes in activity have little effect on its abundance in either region. mRNAs for several AChR subunits are
concentrated at the NMJ (Merlie and Sanes, 1985
; Fontaine et al., 1988
;
Goldman and Staple, 1989
; Brenner et al., 1990
; Klarsfeld et al., 1991
;
Sanes et al., 1991
; Simon et al., 1992
), but their presence away from
the NMJ is suppressed by activity (Goldman et al., 1988
, Neville et
al., 1991
). This has led to models of AChR regulation in which muscle
activity normally suppresses the expression of mRNAs away from NMJ, but
a "dominant" effect of the nerve overcomes that suppression to
enable a high concentration of AChR mRNA and protein to persist at the
NMJ. NaV1.4 differs from those AChR subunits and
from muscle-specific receptor tyrosine kinase, N-CAM, and AChE
(Covault and Sanes, 1985
; Bowen et al., 1998
; Jasmin et al., 1998
), in
that the abundance of its mRNA away from the NMJ is not markedly
influenced by activity. Lack of sensitivity to activity is also a
feature of
-subunit of AchR; however, its gene expression is
restricted to the NMJ.
In contrast, activity suppresses the abundance of
NaV1.5 mRNA both at the NMJ and away from it.
This distinguishes it from most postsynaptic mRNA species, which
remain concentrated at the NMJ in active muscle fibers. For
NaV1.5, the downregulating effects of activity
dominate the upregulating effects of the nerve at the NMJ. The details
of activity-dependent regulation of expression are not fully understood
for any gene (Buonanno et al., 1998
; Buonanno and Fields, 1999
). E box
motifs that bind myogenic factors of the myoD family confer
activity-dependent expression on AChR
-,
-, and
-subunits
(Bessereau et al., 1994
; Tang et al., 1994
; Gilmour et al., 1995
; Walke
et al., 1996
). Whereas E box motifs have been identified in the 5'
flanking region of both NaV1.4 (Kraner et al.,
1998
) and NaV1.5 genes (Sheng et al., 1994
), no direct link of these sequences to activity-dependent expression of the
NaV1.5 gene has been demonstrated.
The mRNA species encoding
-AChR is also downregulated by activity,
both at and away from NMJs. After denervation, its mRNA initially
increases in abundance to an approximately similar extent all along the
muscle fiber. After 5-7 d, the region of high mRNA abundance becomes
limited to the NMJ, but this seems to be a result of a decrease in
abundance in the perijunctional region rather than an increase at the
NMJ (Kues et al., 1995
). In contrast, NaV1.5 mRNA
is highly concentrated at the NMJ within 2-3 d of denervation, and
that situation is maintained with little change for up to 4 weeks. This
suggests that different mechanisms may control the accumulation of
these two mRNA species.
What controls increased concentration of NaV 1 mRNAs at
the NMJ?
It is clear that, for NaV1.4and 1.5, the
increased concentration of mRNA is not simply a result of nuclear
accumulation. It is generally believed that increased mRNA
concentration results from action of nerve-derived signaling molecules
on gene transcription in postsynaptic myonuclei. Although other
mechanisms are possible, including regulation of mRNA stability and
directed translocation of mRNA species to the postsynaptic region,
there is little evidence concerning their possible involvement at the NMJ.
The best candidate for a mediator of nerve-derived transcriptional
regulation of AChR subunits is neuregulin (Fischbach and Rosen, 1997
;
Burden, 1998
; Sanes and Lichtman, 1999
). Neuregulin has also been shown
to increase the amount of NaV1.4 in muscle cells
(Corfas and Fischbach, 1993
), but its effects on mRNA have not been
investigated. A class of regulatory sequences that mediate the effects
of neuregulin on the abundance of AChR mRNA species at the NMJ has been
identified (Chu et al., 1995
; Jo et al., 1995
; Si et al., 1997
). A 6 bp
"N box" within the neuregulin response sequence can direct
synapse-specific expression of a number of proteins (Koike et al.,
1995
; Duclert et al., 1996
; Gramolini et al., 1999
). Response to
neuregulin involves binding of Ets family transcription factors to N
box sequences (Fromm and Burden, 1998
; Sapru et al., 1998
; Schaeffer et
al., 1998
; Gramolini et al., 1999
). We searched the published 5'
flanking region sequences of the NaV1.4 gene
(Kraner et al., 1998
; GenBank accession number AF042092) and
found no N boxes. However, we identified an N box (TTCCGG) within the
first intron of the genomic sequence of NaV1.5
(Sheng et al., 1994
; GenBank accession number L11243). It is possible
that this sequence could influence the accumulation of
NaV1.5 mRNA at the NMJ after denervation.
NaV 1 mRNA distribution in extrajunctional regions
The use of in situ hybridization has revealed
previously undetected details of local variations in
NaV1 mRNA abundance in XJ regions. Clusters of
NaV1 mRNAs are present in approximately one-third
of muscle fiber sections, corresponding to approximately one cluster
for every 10 myonuclei. A qualitatively similar pattern has been
reported for the AChR
-subunit in chick muscle cells (Fontaine et
al., 1988
; Bursztajn et al., 1989
) and for utrophin (Vater et al.,
1998
).
One possible explanation for this clustering of mRNA is that individual
myonuclei alternate between periods of transcriptional activity and
inactivity, as has been proposed for other genes in muscle (Newlands et
al., 1998
). In the case of NaV1 mRNAs, the
intensity of the XJ clusters is approximately one-third to one-half of
that of the clusters present at the NMJ. Given the number of myonuclei
at the NMJ, this suggests that the amount of mRNA near an "active"
nucleus is similar in J and XJ regions. In the context of a model of
"pulsatile" gene expression, this suggests that XJ myonuclei
express NaV1 genes at a similar rate to those
away from the NMJ but for a smaller fraction of the time.
Interaction between nerve and activity
In contrast to other proteins that are specifically concentrated
in the postsynaptic region, NaV1s are also
required throughout the muscle fiber surface. Our studies using
in situ hybridization have revealed similarly distinctive
patterns of NaV1 mRNA distribution. Whichever
species of NaV1 mRNA is present, it is highly
concentrated at the NMJ. However, NaV1.4 mRNA,
unlike the mRNAs encoding most postsynaptic proteins, persists in
significant concentration away from the NMJ in fully active muscles. On
the other hand, NaV1.5 mRNA, although highly
concentrated at the NMJ when expressed, is downregulated by muscle
activity. Thus, the factors that induce upregulation of
NaV1.5 at the NMJ do not confer resistance to suppressive effects of muscle activity. In conclusion, although a local
effect of nerve and a more "global" effect of muscle activity act
to regulate the abundance and distribution of
NaV1 mRNAs, the balance between those factors
differs from that acting to control other postsynaptic proteins.
 |
FOOTNOTES |
Received April 24, 2001; revised June 20, 2001; accepted Aug. 13, 2001.
This work was supported by grants from the European Union Biotechnology
Program (Contract BIO4-CT96.0216) and The Wellcome Trust (Z.M.A.C.-L.
is a Wellcome Trust Career Development Fellow).
Correspondence should be addressed to Dr. S. S. Awad, Department
of Neuroscience, School of Neurosciences and Psychiatry, The Medical
School, University of Newcastle upon Tyne, Newcastle upon Tyne, NE2
4HH, UK. E-mail: s.s.awad{at}ncl.ac.uk.
 |
REFERENCES |
-
Andreose JS,
Fumagalli G,
Lømo T
(1995)
Number of junctional receptors: control by neural and muscular influence in the rat.
J Physiol (Lond)
483:397-406.
-
Bessereau J-L,
Stratford-Perricaudet LD,
Piette J,
Poupon CL,
Changeux J-P
(1994)
In vivo and in vitro analysis of electrical activity-dependent expression of muscle acetylcholine receptor genes using adenovirus.
Proc Natl Acad Sci USA
91:1304-1308[Abstract/Free Full Text].
-
Boudier JL,
Le Treut T,
Jover E
(1992)
Autoradiographic localization of voltage-dependent sodium channels on the mouse neuromuscular junction using 125I-
scorpion toxin. II. Sodium channel distribution on postsynaptic membranes.
J Neurosci
12:454-466[Abstract]. -
Bowen DC,
Park SJ,
Bodine S,
Stark JL,
Valenzuela DM,
Stitt TN,
Yancopoulos GD,
Lindsay RM,
Glass DJ,
DiStefano PS
(1998)
Localization and regulation of Musk at the neuromuscular junction.
Dev Biol
199:309-319[ISI][Medline].
-
Buonanno A,
Fields RD
(1999)
Gene regulation by patterned electrical activity during neural and skeletal muscle development.
Curr Opin Neurobiol
9:110-120[ISI][Medline].
-
Buonanno A,
Cheng J,
Venepally P,
Weis J,
Calvo S
(1998)
Activity-dependent regulation of muscle genes: repressive and stimulatory effect of innervation.
Acta Physiol Scand
163:S17-S26[Medline].
-
Brenner HR,
Witzemann V,
Sakmann B
(1990)
Imprinting of acetylcholine receptor messenger RNA accumulation in mammalian neuromuscular synapses.
Nature
344:544-547[Medline].
-
Burden SJ
(1998)
The formation of neuromuscular synapses.
Genes Dev
12:133-148[Free Full Text].
-
Bursztajn S,
Berman SA,
Gilbert W
(1989)
Differential expression of acetylcholine receptor mRNA in nuclei of cultured muscle cells.
Proc Natl Acad Sci USA
86:2923-2932[Abstract/Free Full Text].
-
Caldwell JH,
Milton RL
(1988)
Sodium channel distribution in normal and denervated rodent and snake skeletal muscle.
J Physiol (Lond)
401:145-161[Abstract/Free Full Text].
-
Catterall WA
(1992)
Cellular and molecular biology of voltage-gated sodium channels.
Physiol Rev
72 [Suppl 4]:S15-S48.
-
Chu GC,
Moscoso LM,
Sliwkowski MX,
Merlie JP
(1995)
Regualtion of acetylcholine receptor epsilon subunit gene by recombinant ARIA: an in vitro model for transynaptic gene regulation.
Neuron
14:329-339[ISI][Medline].
-
Corfas G,
Fischbach GD
(1993)
The number of Na channels in cultured chick muscle is increased by ARIA, an acetylcholine receptor-inducing activity.
J Neurosci
13:2118-2125[Abstract].
-
Couteaux R
(1973)
Motor end plate structure.
In: Structure and function of muscle (Bourne GH,
ed), pp 483-530. New York: Academic.
-
Covault J,
Sanes JR
(1985)
Neural cell adhesion molecule (N-CAM) accumulates in denervated and paralyzed skeletal muscle.
Proc Natl Acad Sci USA
82:4544-4548[Abstract/Free Full Text].
-
Duclert A,
Savatier N,
Schaeffer L,
Changeux J-P
(1996)
Identification of an element crucial for the subsynaptic expression of acetylcholine receptor
-subunit gene.
J Biol Chem
271:17433-17438[Abstract/Free Full Text]. -
Fischbach GD,
Rosen K
(1997)
ARIA: a neuromuscular junction neuregulin.
Annu Rev Neurosci
20:429-458[ISI][Medline].
-
Flucher BE,
Daniels MP
(1989)
Distribution of Na+ channels and ankyrin in neuromuscular junctions is complementary to that of acetylcholine receptors and the 43 kd protein.
Neuron
3:163-175[ISI][Medline].
-
Fontaine B,
Sassoon D,
Buckingham M,
Changeux J-P
(1988)
Detection of nicotinic acetylcholine receptor
-subunit mRNA by in situ hybridization at neuromuscular junctions of 15-day-old chick striated muscles.
EMBO J
7:603-609[ISI][Medline]. -
Fromm L,
Burden SJ
(1998)
Synapse-specific and neuregulin-induced transcription require an Ets site that binds GABP
/GABP
.
Genes Dev
12:3074-3083[Abstract/Free Full Text]. -
Gilmour BP,
Goldman D,
Chahine KG,
Gardner PD
(1995)
Electrical activity suppresses nicotinic acetylcholine receptor gamma subunit promoter activity.
Dev Biol
168:416-428[ISI][Medline].
-
Goldman D,
Staple J
(1989)
Spatial and temporal expression of acetylcholine receptor RNAs in innervated and denervated rat soleus muscle.
Neuron
3:219-228[ISI][Medline].
-
Goldman D,
Brenner HR,
Heinemann S
(1988)
Acetylcholine receptor
-,
-,
-, and
-subunit mRNA levels are regulated by muscle activity.
Neuron
1:329-333[ISI][Medline]. -
Gramolini AO,
Agnus LM,
Schaeffer L,
Burton EA,
Tinsley JM,
Davies KE,
Changeux J-P,
Jasmin BJ
(1999)
Induction of utrophin gene expression by heregulin in skeletal muscle cells: role of N-box motif and GA binding protein.
Proc Natl Acad Sci USA
96:3223-3227[Abstract/Free Full Text].
-
Grampp W,
Harris JB,
Thesleff S
(1972)
Inhibition of denervation changes in skeletal muscle by blockers of protein synthesis.
J Physiol (Lond)
221:734-754.
-
Hall WZ,
Sanes JR
(1993)
Synaptic structure and development: the neuromuscular junction.
Neuron [Suppl]
10:99-121.
-
Harris JB,
Thesleff S
(1971)
Studies on tetrodotoxin resistant action potentials in denervated skeletal muscle.
Acta Physiol Scand
83:383-388.
-
Jasmin BJ,
Boudreau-Lariviere C,
Adatia FA,
Angus L,
Chan RYY,
Kotlarewski M,
Krupa AM,
Mankal FA
(1998)
Molecular mechanisms controlling the synapse-specific expression and activity-linked regulation of acetylcholinesterase in skeletal muscle fibers.
In: Structure and function of cholinestrases and related proteins (Doctor BP,
ed), pp 45-50. New York: Plenum.
-
Jo SA,
Zhu X,
Marchionni MA,
Burden SJ
(1995)
Neuregulins are concentrated at nerve-muscle synapses and activate ACh-receptor gene expression.
Nature
373:158-161[Medline].
-
Kallen RG,
Sheng Z-H,
Yang J,
Chen L,
Rogart RB,
Barchi RL
(1990)
Primary structure and expression of a sodium channel characteristic of denervated and immature rat skeletal muscle.
Neuron
4:233-242[ISI][Medline].
-
Kelly AM,
Zacks SI
(1969)
The fine structure of motor end-plate myogenesis.
J Cell Biol
42:154-169[Abstract/Free Full Text].
-
Klarsfeld A,
Bessereau J-L,
Salmon A-M,
Triller A,
Babinet C,
Changeux J-P
(1991)
An acetylcholine receptor
-subunit promoter conferring preferential synaptic expression in muscle of transgenic mice.
EMBO J
10:625-632[ISI][Medline]. -
Koike S,
Schaeffer L,
Changeux J-P
(1995)
Identification of a DNA element determining synaptic expression of the mouse acetylcholine receptor
-subunit gene.
Proc Natl Acad Sci USA
92:10624-10628[Abstract/Free Full Text]. -
Kraner SD,
Rich MM,
Kallen RG,
Barchi RL
(1998)
Two E-boxes are the focal point of muscle-specific skeletal muscle type 1 Na+ channel gene expression.
J Biol Chem
273:11327-11334[Abstract/Free Full Text].
-
Kues WA,
Brenner HR,
Sakmann B,
Witzemann V
(1995)
Local neurotrophic repression of gene transcripts encoding fetal AchRs ar rat neuromuscular synapses.
J Cell Biol
130:949-957[Abstract/Free Full Text].
-
Lupa MT,
Krzemien DM,
Schaller KL,
Caldwell JH
(1993)
Aggregation of sodium channels during development and maturation of the neuromuscular junction.
J Neurosci
13:1326-1336[Abstract].
-
Lupa MT,
Krzemien DM,
Schaller KL,
Caldwell JH
(1995)
Expression and distribution of sodium channels in short- and long-term denervated rodent skeletal muscle.
J Physiol (Lond)
481:109-118.
-
Martin AR
(1994)
Amplification of neuromuscular transmission by postjunctional folds.
Proc R Soc Lond B Biol Sci
258:321-326.
-
Merlie JP,
Sanes JR
(1985)
Concentration of acetylcholine receptor mRNA in synaptic regions of adult muscle fibers.
Nature
317:66-68[Medline].
-
Neville C,
Schmidt M,
Schmidt J
(1991)
Kinetics of expression of ACh receptor alpha-subunit mRNA in denervated and stimulated muscle.
NeuroReport
2:655-657[Medline].
-
Newlands S,
Levitt LK,
Robinson CS,
Karpf ABC,
Hodgson VRM,
Wade RP,
Hardeman EC
(1998)
Transcription occurs in pulses in muscle fibers.
Genes Dev
12:2748-2758[Abstract/Free Full Text].
-
Pasino E,
Buffelli M,
Arancio O,
Busetto G,
Salviati A,
Cangiano A
(1996)
Effects of long-term conduction block on membrane properties of reinnervated and normally innervated rat skeletal muscle.
J Physiol (Lond)
497:457-472[ISI][Medline].
-
Ramon y Cajal SY
(1960)
Remarks on the motor plaques of the mammalian tongue.
In: Studies on vertebrate neurogenesis (Goth L, translator), pp 206-214 Springfield, IL: Thomas.
-
Rogart RB,
Cribbs LL,
Muglia LK,
Kephart DD,
Kaiser MW
(1989)
Molecular cloning of a putative tetrodotoxin-resistant rat heart Na+ channel isoform.
Proc Natl Acad Sci USA
86:8170-8174[Abstract/Free Full Text].
-
Sanes JR,
Lichtman J
(1999)
Development of the vertebrate neuromuscular junction.
Annu Rev Neurosci
22:389-442[ISI][Medline].
-
Sanes JR,
Johnson YR,
Kotzbauer PT,
Mudd J,
Hanley Th,
Martinou JC,
Merlie JP
(1991)
Selective expression of an acetylcholine receptor-lacZ transgene in synaptic nuclei of adult muscle fibers.
Development
113:1181-1191[Abstract].
-
Sapru MK,
Florance SK,
Kirk C,
Goldman D
(1998)
Identification of a neuregulin and protein-tyrosine phosphatase response element in the nicotinic acetylcholine receptor e subunit gene: regulatory role of an Ets transcription factor.
Proc Natl Acad Sci USA
95:1285-1294.
-
Schaeffer L,
Duclert N,
Huchet-Dymanus M,
Changeux J-P
(1998)
Implication of multisubunit Ets-related transcription factor in synaptic expression of the nicotinic acetylcholine receptor.
EMBO J
17:3078-3090[ISI][Medline].
-
Sheng Z-H,
Zhang H,
Barchi RL,
Kallen RG
(1994)
Molecular cloning and functional analysis of the promoter of rat skeletal muscle voltage-sensitive sodium channel subtype 2 (rSkM2): evidence for muscle-specific nuclear protein binding to the core promoter.
DNA Cell Biol
13:9-23[ISI][Medline].
-
Si J,
Miller DS,
Mei L
(1997)
Identification of an element required for acetylcholine receptor-inducing activity (ARIA)-induced expression of the acetylcholine receptor e subunit gene.
J Biol Chem
272:10367-10371[Abstract/Free Full Text].
-
Simon AM,
Hoppe P,
Burden SJ
(1992)
Spatial restriction of AChR gene expression to subsynaptic nuclei.
Development
114:545-553[Abstract].
-
Tang J,
Jo SA,
Burden SJ
(1994)
separate pathways for synaps-specific and electrical activity-dependent gene expression in skeletal muscle.
Development
120:1799-1804[Abstract].
-
Tello JF
(1907)
Dégénération et régénération des plaques motrices après la section des nerfs.
Trab Lab Invest Biol Univ Madr
5:117-149.
-
Tello JF
(1917)
Génesis de la terminaciones nerviosas motrics y sensitivas. I. En el sistema locomotor de los vertebrados superiosres. Histogénesis muscular.
Trab Lab Invest Biol Univ Madr
15:101-199.
-
Trimmer JS,
Cooperman SS,
Tomiko SA,
Zhou J,
Crean SM,
Boyle MB,
Kallen RG,
Sheng Z,
Barchi RL,
Sigworth FJ,
Goodman RH,
Agnew WS,
Mandel G
(1989)
Primary structure and functional expression of mammalian skeletal muscle sodium channel.
Neuron
3:33-49[ISI][Medline].
-
Vater R,
Young C,
Anderson LVB,
Lindsay S,
Blake DJ,
Davies KE,
Zuelling R,
Slater CR
(1998)
Utrophin mRNA expression in muscle is not restricted to the neuromuscular junction.
Mol Cell Neurosci
10:229-242.
-
Walke W,
Xiao G,
Goldman D
(1996)
Identification and characterization of a 47 base pair activity-dependent enhancer of the rat nicotinic acetylcholine receptor d-subunit promoter.
J Neurosci
16:3641-3651[Abstract/Free Full Text].
-
Windisch A,
Gunderson K,
Szabolcs MJ,
Gruber H,
Lømo T
(1998)
Fast to slow transformation of denervated and electrically stimulated rat muscle.
J Physiol (Lond)
510 2:623-632[Abstract/Free Full Text].
-
Witzemann V,
Brenner HR,
Sakmann B
(1991)
AChR subunit mRNA at rat neuromuscular synapse.
J Cell Biol
114:125-141[Abstract/Free Full Text].
-
Wollner DA,
Catterall WA
(1986)
Localization of sodium channels in axon hillocks and initial segments of retinal ganglion cells.
Proc Natl Acad Sci USA
83:8424-8428[Abstract/Free Full Text].
-
Wood SJ,
Slater CR
(1997)
The contribution of postsynaptic folds to the safety factor for neuromuscular transmission in rat fast- and slow-twitch muscles.
J Physiol (Lond)
500:165-176[ISI].
-
Wood SJ,
Slater CR
(1998)
-spectrin is colocalized with both voltage-gated sodium channels and ankyrinG at the adult rat neuromuscualr junction.
J Cell Biol
140:675-684[Abstract/Free Full Text]. -
Wood SJ,
Slater CR
(2001)
Safety factor at the neuromuscular junction.
Prog Neurobiol
64:327-429[ISI][Medline].
-
Yang J,
Sladky JT,
Kallen RG,
Barchi RL
(1991)
TTX-sensitive and TTX-insensitive sodium channel mRNA transcripts are independently regulated in adult skeletal muscle after denervation.
Neuron
7:421-427[ISI][Medline].
-
Young C,
Lindsay S,
Vater R,
Slater CR
(1998)
An improved method for the simultaneous demonstration of mRNA and estrase activity at the human neuromuscular junction.
Histochem J
30:7-11[ISI][Medline].
-
Zhang M,
McLennan IS
(1994)
Use of antibodies to identify satellite cells with a light microscope.
Muscle Nerve
17:987-994[ISI][Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21218456-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Prasarnpun, J. Walsh, S. S. Awad, and J. B. Harris
Envenoming bites by kraits: the biological basis of treatment-resistant neuromuscular paralysis
Brain,
December 1, 2005;
128(12):
2987 - 2996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Nissinen, T. Kaisto, P. Salmela, J. Peltonen, and K. Metsikko
Restricted Distribution of mRNAs Encoding a Sarcoplasmic Reticulum or Transverse Tubule Protein in Skeletal Myofibers
J. Histochem. Cytochem.,
February 1, 2005;
53(2):
217 - 227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Reid, V. N. Martinov, A. Nja, T. Lomo, and G. S. Bewick
Activity-Dependent Plasticity of Transmitter Release from Nerve Terminals in Rat Fast and Slow Muscles
J. Neurosci.,
October 15, 2003;
23(28):
9340 - 9348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Bailey, M. A. Stocksley, A. Buckel, C. Young, and C. R. Slater
Voltage-Gated Sodium Channels and AnkyrinG Occupy a Different Postsynaptic Domain from Acetylcholine Receptors from an Early Stage of Neuromuscular Junction Maturation in Rats
J. Neurosci.,
March 15, 2003;
23(6):
2102 - 2111.
[Abstract]
[Full Text]
[PDF]
|
 |
|