Previous Article | Next Article 
The Journal of Neuroscience, November 1, 2001, 21(21):8572-8585
Transforming Growth Factor
(TGF
) Mediates Schwann Cell
Death In Vitro and In Vivo: Examination of
c-Jun Activation, Interactions with Survival Signals, and the
Relationship of TGF
-Mediated Death to Schwann Cell
Differentiation
David B.
Parkinson1,
Ziping
Dong4,
Howard
Bunting1,
Jonathan
Whitfield3,
Carola
Meier5,
Hélène
Marie2,
Rhona
Mirsky1, and
Kristjan R.
Jessen1
1 Departments of Anatomy and Developmental Biology and
2 Physiology, and 3 Eisai London Research,
University College London, London WC1E 6BT, United Kingdom,
4 Reneuron Ltd., Denmark Hill, London SE5 8AF, United
Kingdom, and 5 Institut für Neuroanatomie,
Med. Einrichtungen der Ruhr-Universität, 44780 Bochum,
Germany
 |
ABSTRACT |
In some situations, cell death in the nervous system is controlled
by an interplay between survival factors and negative survival signals
that actively induce apoptosis. The present work indicates that the
survival of Schwann cells is regulated by such a dual mechanism
involving the negative survival signal transforming growth factor
(TGF
), a family of growth factors that is present in the Schwann
cells themselves. We analyze the interactions between this putative
autocrine death signal and previously defined paracrine and autocrine
survival signals and show that expression of a dominant negative c-Jun
inhibits TGF
-induced apoptosis. This and other findings pinpoint
activation of c-Jun as a key downstream event in TGF
-induced Schwann
cell death. The ability of TGF
to kill Schwann cells, like normal
Schwann cell death in vivo, is under a strong
developmental regulation, and we show that the decreasing ability of
TGF
to kill older cells is attributable to a decreasing ability of
TGF
to phosphorylate c-Jun in more differentiated cells.
Key words:
autocrine signals; apoptosis; nerve development; peripheral nerve; nerve injury; nerve regeneration
 |
INTRODUCTION |
It is likely that two sets of
signals play a major role in promoting the survival of developing
Schwann cells. These are
-neuregulins (NRG
s) (Dong et al.,
1995
; Grinspan et al., 1996
; Syroid et al., 1996
; Trachtenberg and
Thompson, 1996
) and autocrine Schwann cell signals, which include a
synergistic combination of insulin-like growth factor 2 (IGF-2),
neurotrophin-3 (NT3), and platelet-derived growth factor-BB (PDGF-BB)
(Meier et al., 1999
) in addition to leukemia-inhibitory factor (LIF)
(Dowsing et al., 1999
; Jessen and Mirsky, 1999
). NRG
is provided
mainly by axons and is probably of paramount importance in embryonic
and early postnatal nerves, whereas the autocrine circuits are active
in postnatal cells and likely to be especially significant after injury
and consequent loss of axonal NRG
. It is possible to envisage that
Schwann cell survival is regulated exclusively by these and other
positive survival factors, a view that would imply that Schwann cell
death, seen for example in normal and, especially, injured neonatal
nerves, is caused by a limited availability of such signals, in line
with the classical neurotrophic theory. More recently, an alternative view of why cells die has emerged (Cassacia-Bonnefil et al., 1999
; Raoul et al., 2000
). These experiments indicate that cell death can be
caused not only by the absence of survival signals but also by the
advent of active cell killing mediated by factors that trigger
apoptosis. In the nervous system, nerve growth factor (NGF) is one of
the factors that may act in this way, both in retinal development and
in Schwann cells (Xia et al., 1995
; Frade et al., 1996
;
Cassacia-Bonnefil et al., 1999
; Frade and Barde, 1999
; Soilu-Hanninen
et al., 1999
; Raoul et al., 2000
).
Transforming growth factor
s (TGF
s) are expressed by Schwann
cells and have various proliferative and phenotypic effects on these
cells (for review, see Mirsky and Jessen, 1996
; Scherer and Salzer,
1996
). In the present work we have explored the idea that TGF
might
act as a death signal for Schwann cells. We find that TGF
induces
Schwann cell apoptosis under a number of different conditions in
vitro. This effect is blocked by the combined presence of NRG
and autocrine signals, and, in line with this, TGF
kills Schwann
cells in the distal stump of cut neonatal nerves but not in normal
nerves. We provide evidence that TGF
induces apoptosis by activating
c-Jun in Schwann cells and that overexpression of a dominant negative
c-Jun inhibits TGF
-induced apoptosis in Schwann cells. A resistance
to TGF
killing emerges in tandem with Schwann cell differentiation,
and this is related to a failure of TGF
to activate c-Jun in
differentiated cells. We show that nerve transection leads to elevation
of TGF
1 mRNA and protein in the distal stump of neonatal animals, in
line with observations in the adult which suggest that this factor is
involved in events that follow nerve damage. Taken together, this
information builds a case for TGF
as a negative Schwann cell
survival signal in perinatal nerves.
 |
MATERIALS AND METHODS |
Materials. OX7 hybridoma cell line secreting Ig
recognizing Thy1.1 was from the European Collection of Animal Cell
Cultures (DERA, Wiltshire, UK). Rabbit polyclonal antibody to S-100 was from Dakopatts (Copenhagen, Denmark), mouse monoclonal antibody to
myelin basic protein was from Roche Diagnostics (Lewes, UK), and goat
anti-mouse Ig and anti-rabbit Ig conjugated to fluorescein were from
Cappel Labs (Durham, NC). Rabbit polyclonal antibody to c-Jun was a
gift from G. Evan (University of California San Francisco). Antibody to
LexA was from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal
anti-FLAG antibody was from Sigma (Poole, UK). Recombinant human
TGF
1, pan-specific TGF
, and TGF
1 antibodies were from R & D
Systems (Minneapolis, MN). Purified TGF
2 (porcine) was from British
Biotechnology, IGF-1 was from PeproTech EC Ltd (London, UK), neuregulin
1 was from Amgen (Thousand Oaks, CA), and puromycin was from
Sigma. Monoclonal antibody SM 1.2 was from the Developmental Studies
Hybridoma Bank (Iowa City, IA). Polyclonal antibody CM1 specific for
active cleaved caspase-3 was from BD PharMingen (Oxford, UK). Sources
of other reagents used in immunocytochemistry, RT-PCR, Western
blotting, and cell cultures have been detailed in previous papers
(Jessen et al., 1994
; Morgan et al., 1994
; Dong et al., 1995
, 1999
;
Stewart, 1995
; Blanchard et al., 1996
).
Cell culture. Cultures of Schwann cells were prepared
essentially as described previously (Jessen et al., 1994
; Gavrilovic et
al., 1995
; Meier et al., 1999
). Sciatic nerves and brachial plexuses
were removed from newborn, postnatal day (P) 4 and P8 and adult Sprague
Dawley rats, desheathed, and treated either with a mixture of
collagenase (4 mg/ml), hyaluronidase (1.2 mg/ml), and trypsin inhibitor
(0.5 mg/ml) in calcium and magnesium-free DMEM at 37°C for
70-80 min or alternatively with a mixture of collagenase (2 mg/ml) and
trypsin 1.25 mg/ml for 35 min (newborn, P4, P8) or twice for 1.5-2 hr
in total (adult). The tissue was then gently dissociated through a
plastic pipette tip, and cells were centrifuged and then purified by
negative immunopanning on dishes coated with Thy1.1 antibodies as
described previously (Dong et al., 1997
).
For the survival assays and tests of TGF
1-induced apoptosis, freshly
immunopanned rat Schwann cells were plated on polyornithine or
poly-L-lysine (PLL)/laminin-coated coverslips (Meier et
al., 1999
) as indicated in Results. To test survival in the
absence of autocrine signals, cells were plated at low density (300 cells per 20 µl per coverslip). To test survival in the presence of autocrine survival support, cells were plated at high density (3000 cells per 10 µl per coverslip).
In most survival assays, the culture medium was a simple medium
containing only a 1:1 mixture of DMEM and Ham's F12 plus BSA (0.3 mg/ml final). In these experiments TGF
or NRG
was added 3 hr
after plating. In other experiments we used a supplemented defined
medium identical to that used in previous work (Jessen et al., 1994
),
except that dexamethasone and IGF-1 were left out. TGF
was added
16-18 hr after plating. These experiments are specially indicated in
the text. Nearly all the survival assays lasted for 24 hr, timed
from the addition of growth factors. Experiments using longer survival
times are indicated in the text. At 3 hr and at specified times, cells
were fixed in 2% paraformaldehyde in PBS for 20 min, immunolabeled
with S100 antibodies, and mounted in Citifluor mounting medium
containing 4 µg/ml Hoechst dye. The number of living cells in this
assay is expressed as survival percentage. Survival percentage is the
number of living cells present at the end of the experiment as a
percentage of the number of cells that had plated successfully at the
beginning of the experiment, i.e., the number of cells that had
attached and begun to flatten on the substrate 3 hr after plating.
Routinely, dead cells were identified by observing Hoechst nuclear
staining and obvious morphological changes associated with death. Thus
cells classified as dead showed either clearly elevated intensity of Hoechst nuclear labeling or nuclei that had fragmented, showing two or
more Hoechst-labeled bodies per cell, and in addition had retracted
processes and cytoplasm that by phase contrast appeared granulated and
most often also vacuolated; the nucleus of these cells appeared
condensed and/or fragmented by phase contrast. To validate the
classification of these cells as dead, we examined cultures of dying
cells that had been labeled with the terminal deoxynucleotidyl
transferase-mediated biotinylated UTP nick end labeling (TUNEL)
method. In addition, apoptosis in cells was confirmed using an antibody
(CM1) specific for the activated cleaved form of caspase 3. For the
assay of cell death and measurement of TGF
mRNA or protein after
axotomy, newborn rats were anesthetized, the left sciatic nerve was
transected, and the proximal stump was dissected and sutured to the
muscle. For experiments measuring cell death, the growth factor,
TGF
1, control, or anti-TGF
antibodies or PBS were applied three
times at 8 hourly intervals during 24 hr. TGF
1 or antibodies diluted
in PBS were injected into the relatively large intermuscular space that
surrounds the sciatic nerve in the mid-thigh region. For the first
injection, a volume of 10 µl was used, followed by the two further
injections in 10 µl. After the times indicated, the control or
transected sciatic nerves were removed, and cryostat sections were
prepared for immunohistochemistry.
Immunocytochemistry. Immunolabeling for S100 and myelin
basic protein (MBP) was performed as follows. Cells were fixed in 2%
paraformaldehyde for 10 min (MBP) and 20 min (S100), washed in PBS, and
then treated with methanol (
20°C) for 10 min. After rinsing in PBS,
cells were incubated in S100 (1:100) antibody or MBP (1:100) antibody
for 30 min, washed, and incubated in anti-rabbit Ig fluorescein (S100)
or anti-mouse Ig fluorescein (MBP) for 30 min, washed, and mounted in
Citifluor anti-fade mounting medium. All antibodies were diluted in PBS
containing 0.1 M lysine, 0.2% sodium azide, and
10% calf serum. Immunolabeling with c-Jun antibody was performed
exactly as described previously (Stewart, 1995
). For immunolabeling
with antibodies to LexA, FLAG, or ser-63 phospho c-Jun,
cells were fixed in 4% paraformaldehyde in PBS for 15 min, then
permeabilized in 0.5% Triton X-100/PBS for 5 min. After a block of
50% goat serum/1% BSA in PBS, primary and secondary antibodies were
then applied in block solution for LexA, FLAG, or 1% BSA/PBS for
ser-63 phospho-Jun. For labeling of cells with CM1 antibody for
active caspase 3, cells were fixed in 4% paraformaldehyde for 20 min,
followed by a block of 20% goat serum/0.4% Triton X-100/PBS for 30 min; primary and secondary antibodies were applied in this block
solution. For immunolabeling of sections with TGF
1 antibody,
sections were fixed in 4% paraformaldehyde for 20 min followed by a
10% goat serum/0.1% Tween 20/PBS block for 1 hr. Primary and
secondary antibodies were applied in this block solution.
Adenoviral infection of Schwann cells. Adenoviral
supernatants for recombinant adenoviral constructs expressing either
LacZ or the dominant negative c-Jun molecule FLAG
169-Jun in the
adenoviral vector pAdCMVpoly A were prepared and titered as described
previously (Garnier et al., 1994
; Berkner, 1998
; J. Whitfield,
unpublished observations). Immunopanned Schwann cells from newborn rats
were plated at a density of 3000 cells per 10 µl drop on
laminin-coated glass coverslips in supplemented defined medium.
Approximately 16 hr after plating, adenoviral supernatant corresponding
to a multiplicity of infection of ~1500 was added to the cells.
Twenty-four hours later the adenoviral supernatant was removed, and the
medium of the cells was changed into fresh supplemented defined medium. No toxic effects of addition of the adenoviral supernatant on the
Schwann cells were observed. After an additional 24 hr to allow
expression of the lacZ or FLAG
169-Jun, the time 0 controls were
fixed, and the Schwann cells were changed to fresh supplemented defined
medium alone or with increasing amounts of TGF
1. Twenty-four hours
later, the cells were fixed and stained with Hoechst dye, and survival
was assessed as described previously.
Infection of Schwann cells with retroviral constructs. For
retroviral infection experiments, Schwann cells from newborn nerves were purified by culture in DMEM and 10% calf serum containing 10
5
M cytosine arabinoside for 3 d as described
previously (Morgan et al., 1991
). The cDNAs for the LexA and LexA-vJun
(Struhl, 1988
) were cloned into the retroviral plasmid vector
pBABEpuro, and the GP+E ecotropic packaging cell line
(Morgenstern and Land, 1990
) was then stably transfected with the
plasmid DNA. Retroviral supernatant from the GP+E cells was then used
to infect rat Schwann cells, and puromycin-selected pools of infected
Schwann cells were cultured and used for all experiments. Antibodies
against the LexA portion of the fusion protein were used to confirm
LexA-vJun protein expression (data not shown).
Transient transfection of Schwann cells. Schwann cells for
transfection were grown to semi-confluency on PLL-coated 90 mm tissue
culture dishes in DMEM/10% FCS/4 µM forskolin.
Just before transfection, the medium of the cells was changed into
supplemented defined medium containing 0.5% FCS. Schwann cells
were transfected using 3 µg of the AP1-responsive collagenase I gene
promoter, Coll(-514)-CAT (Bossy-Wetzel et al., 1997
), together with 3 µg of the SV40-driven LacZ plasmid pCH110 (Amersham Pharmacia, St. Albans, UK) together with 18 µl of Fugene 6 transfection reagent (Roche Diagnostics) in 600 µl of DMEM per the manufacturer's
instructions and added to the Schwann cells. Twenty-four hours after
addition of the transfection mix to the cells, TGF
1 was added to a
final concentration of 5 ng/ml. After 30 hr, lysates were prepared from the cells and assayed for CAT activity; assay of LacZ activity was used to correct for transfection efficiency. The relative CAT
activities shown represent data from duplicate transfections.
Western blotting. Protein extracts were prepared from
control and transected newborn rat nerves. Thirty micrograms of protein were electrophoresed on 12% SDS-polyacrylamide gels. Protein was transferred onto nitrocellulose membrane, blocked with 5% fat-free milk in PBS/0.1% Tween 20, and incubated with primary and secondary antibodies diluted in PBS/Tween 20. After washing, specific protein complexes were revealed using ECL Plus chemiluminescent reagent (Amersham Pharmacia).
Preparation of RNA, cDNA synthesis, and semiquantitative PCR
analysis. Total RNA was isolated from freshly dissected tissue (sciatic nerve and brachial plexus) or cultured Schwann cells using
Ultraspec RNA reagent (Biotecx Laboratories, Houston, TX) according to
the manufacturer's instructions. For the preparation of RNA from
transected nerve, newborn rats were anesthetized, the left sciatic
nerve was transected, and the proximal stump was dissected and sutured
to the muscle. cDNA was prepared from 500 ng of total RNA with random
hexamer primers using Superscript II reverse transcriptase (Life
Technologies) in a 50 µl reaction containing (in
mM): 50 Tris-Cl, pH 7.3, 75 KCl, 3 MgCl2, 10 DTT, and 0.5 dNTPs. One microliter of
cDNA, equivalent to 10 ng of total RNA, was used for quantification of
cDNA species using semiquantitative PCR analysis. The following primer
pairs were used: c-Jun sense 5'-CTGATCATCCAGTCCAGC-3', antisense
5'-CGTAGAC CGGAGGCTCAC-3'; ALK1 sense 5'-TTCTCCTCACGAGATGAGCAGTC-3',
antisense 5'-TCCCAGGTCTGCAATGCAAC-3'; ALK2 sense
5'-GCAGGGGAAGATGACGTGTAAGAC-3', antisense
5'-CGACACA- CTCCAACAGGGTTATCTG-3'; ALK5 sense
5'-AGCTGTCAT- TGCTGGTCCAGTC-3', antisense
5'-TCTGCCTCTCGGAACCATGAAC-3'; TGF
1 sense 5'-ACCTGCAAGACCATCGACATGG, antisense 3'-CGTCAAAAGACAGCCACTCAGG; TGF
2 sense
5'-GAA- TCTGGTGAAGGCAGAGTTCAG, antisense 3'-GCAACAACATTAGCAGGAGATGTG;
TGF
3 sense 5'-GAGTTGCTGGAA- GAGATGCACG, antisense
3'-CAGAGTGGCTGTCCTTCGATGT; cyclin D1 sense 5'-GAAGTTGTGCATCTACACTGACAAC-3', antisense
5'-CCGGGTCACACTTGATGACTCTGG-3'. 18S rRNA primers were as described by
Owens and Boyd (1991)
.
 |
RESULTS |
TGF
induces cell death of Schwann cells
in vitro
Because our preliminary observations in vitro suggested
that TGF
adversely affected Schwann cell numbers [our unpublished results; see also Cheng and Mudge (1996)
; Stewart et al. (1995a
,b
); Skoff et al. (1998)
], we set out to analyze the effects of TGF
on
Schwann cell survival using immunopurified primary Schwann cells.
First, we examined the effect of TGF
on cells plated on polyornithine under conditions similar to those that we have used previously to demonstrate the existence of autocrine survival loops in
Schwann cells (Meier et al., 1999
). Cell death in these cultures was
assayed in three ways: first by cell morphology, second by nuclear
condensation as viewed by Hoechst stain, and third by TUNEL analysis.
In comparing these three methods for assessing cell death (Fig.
1A-C), we
found an essentially complete overlap between cells judged to be dead
by morphology and cells with condensed, strongly Hoechst-stained
nuclei. Furthermore, combined Hoechst/TUNEL analysis showed that all
cells considered to be alive on the basis of Hoechst staining were
TUNEL negative, whereas >95% of the cells judged to be dead by
Hoechst staining were TUNEL positive. In control experiments for the
TUNEL analysis in which the terminal transferase enzyme was omitted
from the reaction, no labeling of nuclei was observed (data not shown). Thus all three methods for assessing Schwann cell death gave similar results. Hoechst staining/morphological analysis was used in most of
the following experiments, whereas in a number of instances, TUNEL
staining or active caspase-3 immunolabeling was used as well. These are
indicated in the text.

View larger version (94K):
[in this window]
[in a new window]
|
Figure 1.
TGF induces apoptosis in Schwann cells
in vitro. A-C, Death of
Schwann cells at high density on polyornithine induced by TGF (2 ng/ml) as measured by criteria of cell morphology
(A), nuclear condensation viewed by Hoechst stain
(B), and TUNEL labeling
(C). Arrows indicate live cells
with extended processes with nuclei that are round and TUNEL negative.
Arrowheads show dying or dead cells that are rounded up,
have condensed nuclei, and are TUNEL positive. D, Counts
of live and dead cells in control ( ) and TGF 1 (2 ng/ml)-treated
(+) cultures of Schwann cells at low density (LD/PO) and
high density (HD/PO) on polyornithine, and high density
on laminin substrate (HD/LAM). E,
F, Activation of caspase 3 in dying Schwann cells
treated with TGF 1 (2 ng/ml). Arrows indicate live
cells as viewed by phase contrast (E) that
are not labeled for active caspase 3 (F).
Examples of dying/dead cells, which are labeled for active caspase-3,
are indicated with arrowheads.
|
|
In an initial set of experiments, immunopurified Schwann cells from the
sciatic nerve of newborn rats were exposed to TGF
(2 ng/ml) for
1 d under three experimental conditions: high (3000 cells per
coverslip) density and low (300 cells per coverslip) density on a
polyornithine substrate and high density on a laminin substrate. High
and low cell density cultures were compared because Schwann cell
survival in vitro is subject to autocrine, density-dependent regulation, and polyornithine and laminin were compared because laminin
can support Schwann cell survival (Meier et al., 1999
). At the end of
the experiment, the TGF
-treated cells and control untreated cultures
were fixed, Hoechst stained, and TUNEL labeled. In addition, sister
coverslips were fixed and immunolabeled with antibodies to active
caspase-3, because caspase-3 activation is associated with apoptotic
cell death (Nicholson and Thornberry, 1997
; Cryns and Yuan, 1998
).
Under all three conditions TGF
caused significant Schwann cell death
(Fig. 1D). On polyornithine, >90% of the cells
could be accounted for throughout the assay because even the dead cells
remained attached to the coverslip at the end of the experiment, as
seen previously (Meier et al., 1999
). Because of this it could be seen
unambiguously that TGF
killed Schwann cells, rather than causing
living cells to detach from the coverslips. Even on laminin substrate,
although there was slightly more loss of cells from the coverslips with
TGF
treatment (24%), analysis of the supernatant of the tissue
culture revealed cells with condensed nuclei or just cellular debris,
thereby excluding the possibility that TGF
1 was causing a
significant number of live cells to detach under these conditions. To
further characterize the cell death caused by TGF
, we immunolabeled
Schwann cells with an antibody specific for the active cleaved form of
caspase-3. We observed that ~80% of cells judged to be dead by
morphological criteria in TGF
-treated cultures were labeled for
active caspase 3 (Fig.
1E,F), indicating that
TGF
is causing apoptotic death of Schwann cells. Having shown that
TGF
will cause cell death in Schwann cells, we next performed a
series of experiments to further characterize this effect and the
relationship between TGF
and positive survival signals for Schwann cells.
In a 24 hr survival assay of Schwann cells at low density on
polyornithine, TGF
1 induced dose-dependent cell death in newborn rat
Schwann cells over and above that which occurs because of the absence
of positive survival signals under these conditions (Meier et al.,
1999
) (Fig. 2A). At 2 ng/ml, as observed previously, TGF
1 reduced survival to
approximately half that seen in control cultures and correspondingly
increased the number of TUNEL-positive cells (from 35 ± 7% in
control to 62 ± 3% in TGF
-treated cultures; p < 0.001). To examine whether the remaining cells represented a
TGF
-resistant subpopulation, cells were counted after an additional 24 hr in one experiment using TGF
1 at 5 ng/ml. At this time point (48 hr) <2% of the cells remained alive in the presence of TGF
, indicating that all cells can be killed in this assay (data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2.
In vitro survival assays.
TGF -induced cell death is not blocked by high cell density or by
NRG alone. A, TGF 1 causes death of Schwann cells
in a dose-dependent manner. Schwann cells plated at low density (300 cells per coverslip) on polyornithine-coated coverslips were treated
with increasing concentrations of TGF 1, and survival was assessed
after 24 hr. B, Cell death caused by TGF 1 is density
independent. Survival of Schwann cells plated on polyornithine at
different densities as indicated and treated with TGF 1 (2 ng/ml) for
24 hr is shown. C, Dose-dependent TGF 1-induced death
occurs even in high-density cultures (3000 cells per coverslip) on a
laminin substrate. D, In low-density cultures (300 cells
per coverslip), NRG is relatively ineffective at inhibiting
TGF 1-induced death. Schwann cells were treated with TGF 1 (2 ng/ml) in the presence of increasing concentrations of NRG ; survival
was assessed after 24 hr. Compare this curve with that shown in Figure
3A.
|
|
To further test whether the death induced by TGF
in these sparse
cultures could be blocked by the autocrine signals that support Schwann
cell survival at high cell densities (Meier et al., 1999
), we tested
the effect of TGF
1 (2 ng/ml) in high-density cultures using
polyornithine substrate as before (Fig. 2B). TGF
still induced cell death: at very low density (100 cells per
coverslip), survival of cells in TGF
-treated cultures was 59% of
that in the control cultures, whereas at very high density (8100 cells per coverslip) the same statistic was 57%, indicating that the proportion of cells killed in the TGF
1-treated cultures was just as
striking at high density as at low density. This suggests that autocrine factors alone cannot block TGF
-induced death of Schwann cells (see below) (Fig. 3).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3.
In vitro survival assays.
TGF -induced cell death is blocked by a combination of NRG and
autocrine signals. A, In high-density Schwann cell
cultures (3000 cells per coverslip), NRG inhibits TGF 1 (2 ng/ml)-induced apoptosis in a dose-dependent manner. B,
In sister cultures, application of NRG at 10 ng/ml in the presence
of increasing amounts of TGF 1 (TGFB+NRG) inhibits
apoptosis. Shown also are data for TGF 1 alone (TGFB).
C, In the presence of TGF 1 (2 ng/ml) in low-density
cultures (300 cells per coverslip), NRG (NRG, 10 ng/ml) alone, or a combination of IGF-2 (1.6 ng/ml), NT3 (0.8 ng/ml),
and PDGF-BB (0.8 ng/ml) (Auto) alone, inhibits
TGF 1-induced apoptosis only partially, whereas application of both
(NRG+Auto.) blocks TGF 1-induced death.
|
|
We have shown previously that autocrine signals alone are insufficient
for maintaining Schwann cell survival for a long time and that longer
term survival of Schwann cells requires both laminin and autocrine
signals (Meier et al., 1999
). We therefore tested the effect of TGF
on Schwann cells plated at high density on a laminin substrate (Fig.
2C). TGF
1 was equally effective in inducing death in
these cultures after 24 hr as in cultures plated on polyornithine. In
cell death assays of Schwann cells on laminin substrate treated with
TGF
1, a higher proportion of dead cells (24% for 2 ng/ml TGF
1
after 24 hr) detached from coverslips. Analysis of cells still attached
to the coverslip also revealed increased apoptosis with TGF
1
treatment as measured by combined Hoechst/TUNEL staining (data not shown).
In addition to autocrine signals, NRG
s are likely to be a major
regulator of the survival of developing Schwann cells in vivo, and they act as potent survival factors for cultured Schwann cells (Grinspan et al., 1996
; Syroid et al., 1996
; Trachtenberg and
Thompson, 1996
). We therefore tested whether NRG
alone (i.e., in
low-density cultures and the consequent absence of autocrine signals)
could block the death-promoting effects of TGF
. Sparse cultures were
prepared on either polyornithine- or laminin-coated coverslips and
exposed to 2 ng/ml TGF
1 and varying concentrations of NRG
. Under
these conditions, NRG
was relatively ineffective at promoting
Schwann cell survival except at very high doses (Fig. 2D, compare with 3A).
TGF
1 and TGF
2 were equipotent in their ability to induce Schwann
cell death, consistent with their indistinguishable effects observed in
other in vitro assays (Ten Dijke et al., 1990
). At 2 ng/ml,
a dose used frequently in this study, Schwann cell survival averaged
25 ± 1.29% for TGF
1 (n = 6) and 28 ± 3.77% for TGF
2 (n = 3) in an assay identical to
that described in Figure 2A. Each isoform was
reconstituted in an acid-BSA mix. When TGF
was omitted from this
mix and cells were treated with the appropriate volume of carrier
solution, the percentage survival was not reduced from the level
observed in control cultures, indicating that TGF
is the active
killing ingredient. Although Schwann cells in culture make TGF
, this
is secreted in an inactive from (Stewart et al., 1995b
). It is also
important to note that expansion of newborn Schwann cells with cAMP
elevating agents and growth factors is accompanied by a reduction in
TGF
-mediated cell death (data not shown).
Together these experiments show that TGF
kills primary Schwann cells
from nerves of newborn rats under various conditions in culture.
Individually, neither of the two major signals likely to totally
regulate the survival of these cells in vivo, NRG
or
autocrine signals, prevents TGF
-induced death.
TGF
-induced cell death is blocked by a combination of NRG
and
autocrine signals
Having shown that neither NRG
nor autocrine survival signals
could completely prevent TGF
-induced death when present separately (above), we now tested, in three different ways, whether the
combination of these survival factors could block the effect of
TGF
.
First, immunopurified cells from newborn animals were plated at high
density (and therefore exposed to autocrine signals) on a laminin
substrate. All cells were maintained with a constant concentration (2 ng/ml) of TGF
1, whereas the concentration of NRG
varied from 0.01 to 50 ng/ml. Under these conditions, NRG
prevented Schwann cell
death in a dose-dependent manner (Fig. 3A, compare with
2D). Conversely, in other experiments also performed at high density, the concentration of NRG
was held constant at 10 ng/ml whereas the TGF
1 concentration varied: almost complete survival was seen even at TGF
concentrations of 10 ng/ml (Fig. 3B).
Second, Schwann cells were plated at low density on a laminin substrate
and maintained with 10 ng/ml NRG
and autocrine factors in the form
of 1:10 dilution of medium conditioned by dense Schwann cell cultures
as described previously (Meier et al., 1999
). Addition of 2 ng/ml
TGF
to these cultures did not induce cell death (data not shown).
Third, we took advantage of our previous finding that IGF-2, NT3, and
PDGF-BB are important components of the autocrine Schwann cell signal.
This predicts that the minimal combination of IGF-2 (1.6 ng/ml), NT3
(0.8 ng/ml), and PDGF-BB (0.8 ng/ml), a mixture that mimics the
autocrine activity in a number of tests (Meier et al., 1999
), should
block TGF
-induced death, provided NRG
is also present. When this
was tested, using sparse Schwann cell cultures on a laminin substrate,
we found as expected that the combination of IGF-2, NT3, and PDGF-BB
was relatively ineffective on its own but that cell death in TGF
(2 ng/ml) was completely prevented if NRG
(10 ng/ml) was also present
(Fig. 3C).
These results show that in the combined presence of NRG
and
autocrine signals, Schwann cells from newborn nerves are resistant to
the killing effects of TGF
.
Endogenous TGF
might contribute to Schwann cell death
in vivo
TGF
is present in Schwann cell precursors and embryonic and
neonatal Schwann cells, and the results above show that TGF
can kill
Schwann cells in vitro. This raised the possibility that the
increase in cell death triggered by transection of neonatal nerves
might be attributable in part to the action of endogenous TGF
. A
number of in vivo experiments were performed to explore this idea.
First, expression of TGF
s in nerves of newborn animals was examined.
The previous observation that TGF
is present in Schwann cells and
that TGF
1 mRNA and protein are elevated in distal nerve stumps after
nerve cut is one of the findings that suggests that TGF
might be
involved in events that follow nerve damage (Scherer et al., 1993
;
Rufer et al., 1994
). Because this has been tested only in the adult, we
monitored TGF
1 and TGF
3 mRNAs in the distal stump of transected
nerves in newborn rats using RT-PCR (Fig. 4A). Levels of TGF
1
and TGF
3 mRNAs by semiquantitative PCR showed that there is no
significant change in levels among newborn, P1, and P3 in normal intact
rat sciatic nerve during development (Fig. 4A) (data
not shown). After nerve cut, TGF
1 mRNA was strongly elevated at
1 d and, to a lesser extent, at 3 d, whereas levels of
TGF
3 mRNA were reduced in the distal stump as reported in the adult.
This indicates that the TGF
mRNAs expression profile after nerve cut
is similar in newborn and adult nerves. We also measured levels of
TGF
1 protein in newborn, P2 contralateral control, and newborn nerve
2 d after transection by Western blot analysis. TGF
1 protein is
present in newborn and P2 nerve and is slightly elevated in newborn
nerve 2 d after transection (Fig. 4B).
Immunolabeling of sections prepared from transected nerves (4 d after
transection) and contralateral control nerves with a different TGF
1
antibody also showed an elevation of TGF
1 protein with transection
(data not shown). Thus TGF
1 protein is present in the distal stump
of transected nerves in newborn rats in agreement with the idea that it
acts as a death signal under these circumstances.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 4.
A, Nerve transection in newborn rat
causes an upregulation of TGF 1 mRNA and downregulation of TGF 3
mRNA. Shown is semiquantitative PCR measurement of levels of mRNA for
TGF 1 and TGF 3 in newborn rat sciatic nerve (NB),
1 d (1d NB-TS), and 3 d (3d
NB-TS) after transection, and from postnatal day 3 (P3) rat. B, Measurement of TGF 1
protein levels in intact and transected newborn nerve. Shown is Western
blot of protein from newborn (NB), P2, and newborn rat
sciatic nerve 2 d after transection (2d
NB-TS).
|
|
Further tests of TGF
involvement in vivo were performed
by injecting TGF
into nerves of newborn rats. Schwann cells in
normal neonatal nerves can be presumed to be exposed to axon-associated NRG
and to autocrine signals in the confined environment of the nerves, and we have suggested previously that Schwann cell survival at
this stage of development depends on the combined input from these two
sources (Meier et al., 1999
). A simple prediction from the culture
experiments (Fig. 3) was that such cells would be resistant to TGF
.
A different set of conditions exists in transected nerves. In the
distal stump, transection is presumably accompanied by a loss of and
reduction in exposure to axonal NRG
distal to the cut while
the cells continue to be exposed to autocrine signals. This situation
leads to increased cell death, although most cells survive (Grinspan et
al., 1996
). The culture experiments (Fig. 2) predict that, under these
conditions, Schwann cells in vivo would be sensitive to
TGF
killing. As outlined below, both of these expectations were
fulfilled. We first confirmed that in normal newborn sciatic nerve
there is a low level of cell death, as measured by the TUNEL assay
(0.175 ± 0.02% of total cells; 12,000 nuclei per section were
counted) and that at 24 hr after transection this is increased 10.7×
(1.88 ± 0.15%) in the distal stump in agreement with previous
results (Grinspan et al., 1996
; Syroid et al., 1996
) (Fig.
5, Table
1). Double immunolabeling of sections
with S-100 antibody confirmed that dying cells were Schwann cells (data
not shown). When three injections of TGF
1 (each injection was 10 µl of a 400 ng/ml solution) were made into the relatively large
intermuscular space that surrounds the sciatic nerve in the mid-thigh
region of a newborn rat over 24 hr, no effect was seen; the number of
TUNEL-positive nuclei remained at 0.l8%. In contrast, when identical
TGF
injections were performed during the 24 hr after nerve
transection, the number of TUNEL-positive nuclei in the TGF
-injected
transected nerves was ~1.5 times higher (2.92 ± 0.09% vs
1.88 ± 0.15%) than in transected nerves injected with the
control carrier solution only.

View larger version (95K):
[in this window]
[in a new window]
|
Figure 5.
TUNEL analysis of newborn rat sciatic nerve after
transection. Shown are representative fields from sections stained with
Hoechst dye to reveal nuclei (A, C,
E) and TUNEL stained to reveal apoptotic nuclei
(B, D, F).
A and B show control untransected nerve,
C and D show sciatic nerve 24 hr after
transection, and E and F show transected
nerve 24 hr after transection with injection of pan-TGF blocking
antibody. Arrows point to examples of individual
TUNEL-labeled nuclei.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
The effects of TGF , blocking TGF antibody, and nerve
transection on Schwann cell death in neonatal nerves in
vivo
|
|
Last, a blocking pan-TGF
antibody was injected into the area of the
distal stump after nerve cut in newborn rats in two experiments (Fig.
5, Table 1). The antibody (250-500 ng/ml) was injected three times
during a 24 hr period after nerve cut as described above. Averaging the
two experiments (two rats in each experiment) reveals that the blocking
antibody reduced the number of apoptotic nuclei in the nerve by 62%.
Identical injections of a control antibody SM 1.2 (280 ng/ml; see
Materials and Methods) resulted in an insignificant (5%) reduction in
the number of apoptotic nuclei (Table 1).
All of the above data are consistent with the possibility that Schwann
cell death in transected neonatal nerves is not caused solely by loss
of axon-associated NRG
but is caused also by TGF
present in the nerve.
Schwann cells acquire resistance to TGF
killing as
they differentiate
Two previously reported features of Schwann cell death in
vivo gave us the opportunity to test further whether TGF
acted in a manner expected of a death signal in transected nerves. The first
of these is that the amount of cell death induced by cutting a nerve
diminishes gradually after birth so that a point is reached some time
between P5 and P20 after which transection no longer leads to the
appearance of apoptotic nuclei in the distal stump (Grinspan et al.,
1996
). We therefore tested whether this loss of vulnerability to death
in vivo was mirrored by loss of sensitivity to
TGF
-induced death in the cell culture assay. Schwann cells from rats
of different ages were exposed to TGF
for 24 hr using the same
protocols as those used for newborn cells as described above. Under
both low-density and high-density culture conditions on a polyornithine
substrate, the death response to TGF
decreased markedly with age,
and by P8, Schwann cells were almost impervious to even a high dose of
TGF
(5 ng/ml; p > 0.05) (Fig.
6A). Using laminin-coated coverslips and Schwann cells from embryo day (E) 18, newborn, P8, and adult animals plated at 3000 cells, similar results
were obtained (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
In vitro survival assays. The
ability of TGF 1 to cause apoptosis of Schwann cells is
developmentally regulated. A, Survival of Schwann cells
from newborn (NB), postnatal day 4 (P4), and P8 rats plated at high density (3000 cells per coverslip) with increasing concentrations of TGF 1. Note
that the ability of TGF to kill Schwann cells decreases as the cells
get older. B, Survival assay for Schwann cells showing
percentage of MBP-positive cells (MBP+) and MBP-negative
cells (MBP ) from P4 animals in cultures treated with
TGF 1 (5 ng/ml) in a 24 hr assay. Note that the percentage survival
of MBP-positive cells (cells that were myelinating in
vivo) is relatively unaffected by TGF 1.
|
|
The second in vivo finding that we explored in
vitro is that transection-induced cell death in early postnatal
nerves (P5) is to a large extent restricted to cells not involved in
myelination (Grinspan et al., 1996
). We tested whether this selective
resistance of early myelinating cells to death in the nerve was
reflected in selective resistance of such cells to TGF
-induced cell
death in vitro. Essentially, this involved repeating the
experiment shown in Figure 6A using cells from P4
animals and one dose (5 ng/ml) of TGF
1 only, but in this case
analyzing the results for myelinating cells, and cells not involved in
myelination, separately. Cells from P4 nerves were plated sparsely on
polyornithine substrate, and at 3 hr (the reference point for the
survival assay; see Materials and Methods), some cultures were
immunolabeled with antibodies to MBP to identify cells that had started
to myelinate. The MBP-negative cells were taken to be cells not yet
engaged in myelination or cells destined to become nonmyelinating
cells. Sister cultures were maintained with or without TGF
(5 ng/ml)
for 24 hr, fixed, and immunolabeled with MBP antibodies. It was
striking that TGF
had no effect on the number of MBP-positive cells
in this assay, whereas it killed approximately two-thirds of the
MBP-negative cells (Fig. 6B). Repetition of this
experiment with nerves from P8 animals also revealed that no
MBP-positive cells were killed by TGF
(data not shown). Because
TGF
kills only a minimal number of P8 cells (Fig.
6A) and the percentage of MBP-positive cells at P8
was 52%, it follows that resistance to TGF
spreads in this period
to the whole Schwann cell population regardless of whether they are myelinating.
To test whether this was true in vivo for cells in the
nerves of P8 rats, we transected nerves in P8 animals, and in other experiments we injected TGF
, as described previously, in the area of
the normal P8 sciatic nerve. No cell death was noted in normal P8
nerves, and neither injection of TGF
nor transection led to the
appearance of apoptotic nuclei in these experiments (data not shown). A
single experiment was performed to determine whether the
differentiation-related resistance to TGF
killing was reversible.
Cells from nerves of P8 rats were cultured in the presence or absence
of TGF
(5 ng/ml) for 5 d. At the end of this period, cell
counts revealed that although 43% of cells in control cultures
survived, <2% of TGF
-treated cells were still alive. This was
reminiscent of earlier findings that by 48 hr TGF
had killed
virtually all cells from nerves of newborn animals (above).
Thus, whatever the process involved in imparting TGF
resistance to
older cells, it appears that the changes involved are reversible in culture.
Together these experiments indicate that resistance to TGF
killing
develops as one component of the mature phenotype of myelin-forming and
nonmyelin-forming Schwann cells. The selective resistance of
myelinating cells in early postnatal nerves may reflect the fact that
differentiation along the myelin pathway starts before the maturation
of nonmyelin-forming cells (Jessen and Mirsky, 1992
). These
relationships between vulnerability to TGF
and Schwann cell
differentiation seen in culture are similar to those between Schwann
cell differentiation and death mechanisms in transected nerves.
TGF
receptors ALK1, ALK2, and ALK5 are detectable during
peripheral nerve development
Using semiquantitative RT-PCR we showed that the TGF
type I
receptors ALK1, ALK2, and ALK5 are expressed in E14 to adult nerve.
ALK5, the major type I receptor involved in TGF
signaling (Massague,
2000
), was expressed at the same level throughout development. ALK2 was
expressed at higher levels at early developmental stages and
downregulated postnatally, whereas ALK1 was detectable at lower levels
at E14 and E15, with higher levels at birth and postnatally (Fig.
7). To determine whether ALK5 protein was
detectable, we used immunocytochemistry on newborn rat Schwann cells.
All Schwann cells expressed the ALK5 receptor (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7.
Expression of type I TGF receptors ALK1, ALK2,
and ALK5 in sciatic nerve during development. Semiquantitative RT-PCR
measurement of ALK1, ALK2, and ALK5 from E14 through to adult
(Ad.) in rat sciatic nerve. Note marked downregulation
of ALK2 mRNA in postnatal nerves.
|
|
Treatment of Schwann cells with TGF
1 causes serine-63
phosphorylation of c-Jun and activation of AP1-dependent
transcription
We now examined the intracellular mechanisms by which TGF
induces cell death. Activation of the transcription factor c-Jun and
induction of AP1-dependent transcription has been shown to be involved
in apoptosis of several cell types, including fibroblasts (Bossy-Wetzel
et al., 1997
) and sympathetic neurons (Ham et al., 1995
). Activation of
c-Jun and AP1-dependent transcription requires phosphorylation of c-Jun
on two N-terminal serine residues, ser-63 and -73 (Smeal et al., 1991
).
We therefore examined whether activation of c-Jun occurred in response
to application of TGF
1 to freshly isolated Schwann cells using an
antibody that is specific for c-Jun when phosphorylated on the
serine-63 residue (Watson et al., 1998
). Schwann cells were plated at
high density on laminin-coated glass coverslips in supplemented defined
medium (see Materials and Methods). As a positive control, identical
cultures were exposed to ultraviolet (UV) light, a procedure that has
been shown previously to result in phosphorylation and activation of
c-Jun (Devary et al., 1991
; Derijard et al., 1994
). One hour after
addition of TGF
1 (2 ng/ml), strong nuclear labeling was seen (Fig.
8D), indicating phosphorylation of c-Jun at serine-63. Similar labeling was seen 1 hr
after UV irradiation (Fig. 8F). To determine whether
levels of c-Jun protein and mRNA were unchanged during this time, we immunolabeled Schwann cells treated with TGF
1 for 1 hr with
antibodies to c-Jun. Levels of c-Jun were unchanged during this time in
response to TGF
1 treatment using several different serial dilutions
of antibody (Fig. 8G,H) (data not shown).
These results were confirmed at the mRNA level by semiquantitative
RT-PCR of TGF
1-treated and control cells (Fig.
8I); however, induction of c-Jun mRNA was observed 8 hr after TGF
1 addition (data not shown), consistent with the
previously reported induction of c-Jun itself by activated AP1
complexes (Stein et al., 1992
; van Dam et al., 1995
; Eilers et al.,
1998
). In support of activation of c-Jun in Schwann cells, we found
that TGF
1 caused an increase in cyclin D1 mRNA (Fig. 8J), a known transcriptional target for
c-Jun-dependent transcription (Albanese et al., 1995
; Bakiri et al.,
2000
).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 8.
Addition of TGF 1 to newborn rat Schwann cells
in vitro causes serine-63 phosphorylation of c-Jun,
activation of AP1-dependent transcriptional activity, and induction of
cyclin D1 mRNA. A, C, and
E show immunopanned newborn rat Schwann cells stained
with Hoechst dye to reveal the nuclei, and B,
D, and F show Schwann cells immunolabeled
with antibody specific for the serine-63-phosphorylated form of c-Jun.
A and B show control untreated cells with
low levels of phosphorylated c-Jun. C and
D show Schwann cells treated for 1 hr with TGF 1 (2 ng/ml). Note substantial serine-63 phosphorylation of c-Jun.
E and F are
|
|
To test functionally whether TGF
1 activated c-Jun and stimulated the
corresponding AP1-dependent transcriptional activity, we performed
transient transfections into Schwann cells with an AP1-responsive CAT
reporter construct (Bossy-Wetzel et al., 1997
). Figure
8K shows that addition of TGF
1 to Schwann cells
resulted in a massive increase (~23-fold) in AP1-dependent
transcription in Schwann cells, further demonstrating the link between
TGF
1 and activation of c-Jun/AP1 in Schwann cells.
Overexpression of dominant negative c-Jun inhibits TGF
1-induced
cell death of Schwann cells
Having identified that there is activation of c-Jun and
AP1-dependent transcription in Schwann cells after TGF
1 addition, we
next investigated whether activity of c-Jun was required for induction
of cell death by TGF
1. These experiments were performed with Schwann
cells at high density at which TGF
1 will induce apoptosis as
measured by combined Hoechst/TUNEL analysis. Using an adenoviral
infection protocol (see Materials and Methods) we overexpressed a
FLAG-tagged dominant negative c-Jun protein, FLAG
169-Jun. This lacks
the transcriptional activation domain of the protein and inhibits
c-Jun-dependent transcription (Ham et al., 1995
). After infection of
immunopanned Schwann cells from newborn animals with FLAG
169-Jun
adenoviral supernatant, >90% of Schwann cells showed expression of
the dominant negative c-Jun protein at time 0 before TGF
1 addition
(Fig.
9A,B).
Adenovirus expressing the LacZ gene was used as a control in these
experiments. Figure 9 shows that overexpression of the dominant
negative c-Jun (FLAG169-Jun) significantly (p < 0.01 at 10 ng/ml TGF
1) inhibits TGF
1-induced cell death in this
assay as compared with Schwann cells infected with the LacZ control.
TGF
1 (10 ng/ml) kills 46% of control cells (LacZ) over a 24 hr
period when compared with 15% in Schwann cells infected with the
dominant negative c-Jun construct (FLAG169-Jun). After 48 hr,
TGF
1-induced cell death in control cultures was further increased,
whereas dominant negative c-Jun expression still exerted an inhibitory
effect on death (data not shown). These experiments demonstrate a
requirement for c-Jun activity in TGF
1-induced cell death in Schwann
cells.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 9.
Overexpression of dominant negative c-Jun inhibits
TGF 1-induced apoptosis in Schwann cells. A,
B, Immunolabeling of Schwann cells with anti-FLAG
antibody 48 hr after addition of adenoviral supernatants before TGF 1
addition shows expression of FLAG-tagged dominant negative c-Jun
(FLAG 169-Jun) in >90% of Schwann cell nuclei. A
shows Hoechst stain of nuclei; B shows
immunofluorescence with FLAG antibody. C, In
vitro survival assays of Schwann cells infected with control
virus (Lac-Z) or with dominant negative c-Jun
(FLAG169-Jun). The cells were exposed to medium alone or
to medium containing 10 or 20 ng/ml TGF 1 for 24 hr. Schwann cells treated with UV light, a known activator of
c-Jun phosphorylation, as positive control. G and
H show immunolabeling in control
(G) and TGF 1-treated
(H) (2 ng/ml for 1 hr) Schwann cells to
show that c-Jun protein levels remain unaltered at this time point
after TGF 1 addition. c-Jun mRNA as assayed by semiquantitative
RT-PCR (I) also remains unaltered at this
time. J shows RT-PCR data demonstrating TGF 1 (2 ng/ml) induction of cyclin D1 mRNA; amplification using primers
specific for 18S rRNA indicates equal input of cDNA into PCR assays.
K shows that TGF 1 causes strong induction of
AP1-dependent transcription in Schwann cells. Schwann cells were
cotransfected with an AP1-dependent CAT reporter construct together
with pCH110 lac-Z plasmid. Thirty hours after transfection in the
absence (Control) or presence of 5 ng/ml of
TGF 1 (+TGFB1), lysates were assayed for CAT
activity.
|
|
To determine whether activation of c-Jun is sufficient to cause cell
death, we used a construct expressing v-Jun, a constitutively active
form of c-Jun. The transcriptional activity of v-Jun is independent of
stress-activated protein kinase/Jun N-terminal kinase (SAPK/JNK)
phosphorylation (Black et al., 1994
) and has been shown to act as a
strong transcriptional activator in a majority of systems (Bohmann and
Tjian, 1989
; Black et al., 1994
; Hartl and Bister, 1998
; Huguier et
al., 1998
; Bader et al., 2000
) (see however Gao et al., 1996
; Kilbey et
al., 1996
). We found that when Schwann cells expressing v-Jun were
cultured at high density in serum-free supplemented defined medium, the
amount of cell death was strongly increased compared with control cells
infected with vector alone (Fig. 10).
Combined TUNEL/Hoechst analysis of these cultures, together with
labeling with CM1 antibody for active caspase 3, established that cells
in these cultures are dying by apoptosis (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 10.
Overexpression of v-Jun causes apoptosis of
Schwann cells in serum-free medium. Schwann cells infected with either
LexA control (Control) or LexA-vJun
(v-Jun) were plated at high density (5000 cells per
coverslip). The medium of the cells was then changed to supplemented
defined medium, and the number of surviving cells was counted after 48 hr.
|
|
TGF
activation of c-Jun occurs predominantly in
MBP-negative cells
The previous experiment provided evidence that TGF
kills
Schwann cells from newborn nerves by activating the c-Jun pathway. We
now tested whether a failure to activate this pathway could provide an
explanation for the failure of TGF
to kill more differentiated Schwann cells.
Immunopanned rat Schwann cells from P4 animals were plated at high
density on laminin-coated coverslips in supplemented defined medium. As
discussed in a previous section, approximately half of the Schwann
cells in these cultures have started myelination as evidenced by
expression of MBP, whereas the other half is less differentiated. One
hour after TGF
1 (2 ng/ml) addition, the cells were immunolabeled
with antibodies against MBP and serine-63 phospho c-Jun. Figure
11 shows that TGF
1 stimulated
immunohistochemically detectable c-Jun phosphorylation in 31 ± 8.4% of MBP-negative cells but in only 5 ± 2.6% of MBP-positive
cells. Furthermore, the immunohistochemical labeling was consistently
stronger in the nuclei of the MBP-negative cells, indicating higher
levels of phosphorylated c-Jun. This correlates well with our
observation that MBP-positive Schwann cells are relatively resistant to
induction of cell death by TGF
1 and suggests that the inability of
TGF
to kill differentiating Schwann cells can be explained in part by a failure to activate c-Jun in these cells. Therefore, the molecular
mechanism responsible for the differentiation-related immunity to
TGF
killing may lie upstream of c-Jun activation.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 11.
Phosphorylation of c-Jun in Schwann cells by
TGF 1 occurs mostly in MBP-negative cells. Immunopanned Schwann cells
from P4 rats were treated for 1 hr with TGF 1 (2 ng/ml) and double
immunolabeled with antibodies to MBP (B) and
ser-63 phospho c-Jun (C). After addition of
TGF 1, cells indicated by arrowheads in the
phase-contrast micrograph (A) are shown to be
negative for MBP (B) but positive for ser-63-
phosphorylated c-Jun (C). The two MBP-positive
cells in this field (arrows) are negative for
phosphorylated c-Jun. Note the typical vesicular appearance of MBP in
Schwann cells in culture after loss of axonal contact. D
quantifies this effect, illustrating the percentage of MBP-negative
(MBP ) and MBP-positive (MBP+) Schwann
cells that are also positive for the phosphorylated serine-63 form of
c-Jun in this assay.
|
|
TGF
-activated death pathways involve the
interleukin-1
-converting enzyme-like protease pro-caspase 3
The interleukin-1
-converting enzyme (ICE) protease
inhibitor Z-VAD.fmk was used to investigate the role of ICE-like
proteases on Schwann cell death induced by TGF
and by the absence of
survival factors. This synthetic peptide inhibitor prevents other types of cell death by blocking irreversibly the activation of the ICE-like protease, pro-caspase-3 (Chow et al., 1995
; Zhu et al., 1995
; Slee et
al., 1996
). It is not clear that Z-VAD.fmk is specific for caspase-3
alone, and it might act similarly on the processing of other ICE-like
proteases. It was found that Z-VAD.fmk exerted d