 |
Previous Article | Next Article 
The Journal of Neuroscience, November 1, 2001, 21(21):8572-8585
Transforming Growth Factor (TGF ) Mediates Schwann Cell
Death In Vitro and In Vivo: Examination of
c-Jun Activation, Interactions with Survival Signals, and the
Relationship of TGF -Mediated Death to Schwann Cell
Differentiation
David B.
Parkinson1,
Ziping
Dong4,
Howard
Bunting1,
Jonathan
Whitfield3,
Carola
Meier5,
Hélène
Marie2,
Rhona
Mirsky1, and
Kristjan R.
Jessen1
1 Departments of Anatomy and Developmental Biology and
2 Physiology, and 3 Eisai London Research,
University College London, London WC1E 6BT, United Kingdom,
4 Reneuron Ltd., Denmark Hill, London SE5 8AF, United
Kingdom, and 5 Institut für Neuroanatomie,
Med. Einrichtungen der Ruhr-Universität, 44780 Bochum,
Germany
 |
ABSTRACT |
In some situations, cell death in the nervous system is controlled
by an interplay between survival factors and negative survival signals
that actively induce apoptosis. The present work indicates that the
survival of Schwann cells is regulated by such a dual mechanism
involving the negative survival signal transforming growth factor (TGF ), a family of growth factors that is present in the Schwann
cells themselves. We analyze the interactions between this putative
autocrine death signal and previously defined paracrine and autocrine
survival signals and show that expression of a dominant negative c-Jun
inhibits TGF -induced apoptosis. This and other findings pinpoint
activation of c-Jun as a key downstream event in TGF -induced Schwann
cell death. The ability of TGF to kill Schwann cells, like normal
Schwann cell death in vivo, is under a strong
developmental regulation, and we show that the decreasing ability of
TGF to kill older cells is attributable to a decreasing ability of
TGF to phosphorylate c-Jun in more differentiated cells.
Key words:
autocrine signals; apoptosis; nerve development; peripheral nerve; nerve injury; nerve regeneration
 |
INTRODUCTION |
It is likely that two sets of
signals play a major role in promoting the survival of developing
Schwann cells. These are -neuregulins (NRG s) (Dong et al.,
1995 ; Grinspan et al., 1996 ; Syroid et al., 1996 ; Trachtenberg and
Thompson, 1996 ) and autocrine Schwann cell signals, which include a
synergistic combination of insulin-like growth factor 2 (IGF-2),
neurotrophin-3 (NT3), and platelet-derived growth factor-BB (PDGF-BB)
(Meier et al., 1999 ) in addition to leukemia-inhibitory factor (LIF)
(Dowsing et al., 1999 ; Jessen and Mirsky, 1999 ). NRG is provided
mainly by axons and is probably of paramount importance in embryonic
and early postnatal nerves, whereas the autocrine circuits are active
in postnatal cells and likely to be especially significant after injury
and consequent loss of axonal NRG . It is possible to envisage that
Schwann cell survival is regulated exclusively by these and other
positive survival factors, a view that would imply that Schwann cell
death, seen for example in normal and, especially, injured neonatal
nerves, is caused by a limited availability of such signals, in line
with the classical neurotrophic theory. More recently, an alternative view of why cells die has emerged (Cassacia-Bonnefil et al., 1999 ; Raoul et al., 2000 ). These experiments indicate that cell death can be
caused not only by the absence of survival signals but also by the
advent of active cell killing mediated by factors that trigger
apoptosis. In the nervous system, nerve growth factor (NGF) is one of
the factors that may act in this way, both in retinal development and
in Schwann cells (Xia et al., 1995 ; Frade et al., 1996 ;
Cassacia-Bonnefil et al., 1999 ; Frade and Barde, 1999 ; Soilu-Hanninen
et al., 1999 ; Raoul et al., 2000 ).
Transforming growth factor s (TGF s) are expressed by Schwann
cells and have various proliferative and phenotypic effects on these
cells (for review, see Mirsky and Jessen, 1996 ; Scherer and Salzer,
1996 ). In the present work we have explored the idea that TGF might
act as a death signal for Schwann cells. We find that TGF induces
Schwann cell apoptosis under a number of different conditions in
vitro. This effect is blocked by the combined presence of NRG
and autocrine signals, and, in line with this, TGF kills Schwann
cells in the distal stump of cut neonatal nerves but not in normal
nerves. We provide evidence that TGF induces apoptosis by activating
c-Jun in Schwann cells and that overexpression of a dominant negative
c-Jun inhibits TGF -induced apoptosis in Schwann cells. A resistance
to TGF killing emerges in tandem with Schwann cell differentiation,
and this is related to a failure of TGF to activate c-Jun in
differentiated cells. We show that nerve transection leads to elevation
of TGF 1 mRNA and protein in the distal stump of neonatal animals, in
line with observations in the adult which suggest that this factor is
involved in events that follow nerve damage. Taken together, this
information builds a case for TGF as a negative Schwann cell
survival signal in perinatal nerves.
 |
MATERIALS AND METHODS |
Materials. OX7 hybridoma cell line secreting Ig
recognizing Thy1.1 was from the European Collection of Animal Cell
Cultures (DERA, Wiltshire, UK). Rabbit polyclonal antibody to S-100 was from Dakopatts (Copenhagen, Denmark), mouse monoclonal antibody to
myelin basic protein was from Roche Diagnostics (Lewes, UK), and goat
anti-mouse Ig and anti-rabbit Ig conjugated to fluorescein were from
Cappel Labs (Durham, NC). Rabbit polyclonal antibody to c-Jun was a
gift from G. Evan (University of California San Francisco). Antibody to
LexA was from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal
anti-FLAG antibody was from Sigma (Poole, UK). Recombinant human
TGF 1, pan-specific TGF , and TGF 1 antibodies were from R & D
Systems (Minneapolis, MN). Purified TGF 2 (porcine) was from British
Biotechnology, IGF-1 was from PeproTech EC Ltd (London, UK), neuregulin
1 was from Amgen (Thousand Oaks, CA), and puromycin was from
Sigma. Monoclonal antibody SM 1.2 was from the Developmental Studies
Hybridoma Bank (Iowa City, IA). Polyclonal antibody CM1 specific for
active cleaved caspase-3 was from BD PharMingen (Oxford, UK). Sources
of other reagents used in immunocytochemistry, RT-PCR, Western
blotting, and cell cultures have been detailed in previous papers
(Jessen et al., 1994 ; Morgan et al., 1994 ; Dong et al., 1995 , 1999 ;
Stewart, 1995 ; Blanchard et al., 1996 ).
Cell culture. Cultures of Schwann cells were prepared
essentially as described previously (Jessen et al., 1994 ; Gavrilovic et
al., 1995 ; Meier et al., 1999 ). Sciatic nerves and brachial plexuses
were removed from newborn, postnatal day (P) 4 and P8 and adult Sprague
Dawley rats, desheathed, and treated either with a mixture of
collagenase (4 mg/ml), hyaluronidase (1.2 mg/ml), and trypsin inhibitor
(0.5 mg/ml) in calcium and magnesium-free DMEM at 37°C for
70-80 min or alternatively with a mixture of collagenase (2 mg/ml) and
trypsin 1.25 mg/ml for 35 min (newborn, P4, P8) or twice for 1.5-2 hr
in total (adult). The tissue was then gently dissociated through a
plastic pipette tip, and cells were centrifuged and then purified by
negative immunopanning on dishes coated with Thy1.1 antibodies as
described previously (Dong et al., 1997 ).
For the survival assays and tests of TGF 1-induced apoptosis, freshly
immunopanned rat Schwann cells were plated on polyornithine or
poly-L-lysine (PLL)/laminin-coated coverslips (Meier et
al., 1999 ) as indicated in Results. To test survival in the
absence of autocrine signals, cells were plated at low density (300 cells per 20 µl per coverslip). To test survival in the presence of autocrine survival support, cells were plated at high density (3000 cells per 10 µl per coverslip).
In most survival assays, the culture medium was a simple medium
containing only a 1:1 mixture of DMEM and Ham's F12 plus BSA (0.3 mg/ml final). In these experiments TGF or NRG was added 3 hr
after plating. In other experiments we used a supplemented defined
medium identical to that used in previous work (Jessen et al., 1994 ),
except that dexamethasone and IGF-1 were left out. TGF was added
16-18 hr after plating. These experiments are specially indicated in
the text. Nearly all the survival assays lasted for 24 hr, timed
from the addition of growth factors. Experiments using longer survival
times are indicated in the text. At 3 hr and at specified times, cells
were fixed in 2% paraformaldehyde in PBS for 20 min, immunolabeled
with S100 antibodies, and mounted in Citifluor mounting medium
containing 4 µg/ml Hoechst dye. The number of living cells in this
assay is expressed as survival percentage. Survival percentage is the
number of living cells present at the end of the experiment as a
percentage of the number of cells that had plated successfully at the
beginning of the experiment, i.e., the number of cells that had
attached and begun to flatten on the substrate 3 hr after plating.
Routinely, dead cells were identified by observing Hoechst nuclear
staining and obvious morphological changes associated with death. Thus
cells classified as dead showed either clearly elevated intensity of Hoechst nuclear labeling or nuclei that had fragmented, showing two or
more Hoechst-labeled bodies per cell, and in addition had retracted
processes and cytoplasm that by phase contrast appeared granulated and
most often also vacuolated; the nucleus of these cells appeared
condensed and/or fragmented by phase contrast. To validate the
classification of these cells as dead, we examined cultures of dying
cells that had been labeled with the terminal deoxynucleotidyl
transferase-mediated biotinylated UTP nick end labeling (TUNEL)
method. In addition, apoptosis in cells was confirmed using an antibody
(CM1) specific for the activated cleaved form of caspase 3. For the
assay of cell death and measurement of TGF mRNA or protein after
axotomy, newborn rats were anesthetized, the left sciatic nerve was
transected, and the proximal stump was dissected and sutured to the
muscle. For experiments measuring cell death, the growth factor,
TGF 1, control, or anti-TGF antibodies or PBS were applied three
times at 8 hourly intervals during 24 hr. TGF 1 or antibodies diluted
in PBS were injected into the relatively large intermuscular space that
surrounds the sciatic nerve in the mid-thigh region. For the first
injection, a volume of 10 µl was used, followed by the two further
injections in 10 µl. After the times indicated, the control or
transected sciatic nerves were removed, and cryostat sections were
prepared for immunohistochemistry.
Immunocytochemistry. Immunolabeling for S100 and myelin
basic protein (MBP) was performed as follows. Cells were fixed in 2%
paraformaldehyde for 10 min (MBP) and 20 min (S100), washed in PBS, and
then treated with methanol ( 20°C) for 10 min. After rinsing in PBS,
cells were incubated in S100 (1:100) antibody or MBP (1:100) antibody
for 30 min, washed, and incubated in anti-rabbit Ig fluorescein (S100)
or anti-mouse Ig fluorescein (MBP) for 30 min, washed, and mounted in
Citifluor anti-fade mounting medium. All antibodies were diluted in PBS
containing 0.1 M lysine, 0.2% sodium azide, and
10% calf serum. Immunolabeling with c-Jun antibody was performed
exactly as described previously (Stewart, 1995 ). For immunolabeling
with antibodies to LexA, FLAG, or ser-63 phospho c-Jun,
cells were fixed in 4% paraformaldehyde in PBS for 15 min, then
permeabilized in 0.5% Triton X-100/PBS for 5 min. After a block of
50% goat serum/1% BSA in PBS, primary and secondary antibodies were
then applied in block solution for LexA, FLAG, or 1% BSA/PBS for
ser-63 phospho-Jun. For labeling of cells with CM1 antibody for
active caspase 3, cells were fixed in 4% paraformaldehyde for 20 min,
followed by a block of 20% goat serum/0.4% Triton X-100/PBS for 30 min; primary and secondary antibodies were applied in this block
solution. For immunolabeling of sections with TGF 1 antibody,
sections were fixed in 4% paraformaldehyde for 20 min followed by a
10% goat serum/0.1% Tween 20/PBS block for 1 hr. Primary and
secondary antibodies were applied in this block solution.
Adenoviral infection of Schwann cells. Adenoviral
supernatants for recombinant adenoviral constructs expressing either
LacZ or the dominant negative c-Jun molecule FLAG 169-Jun in the
adenoviral vector pAdCMVpoly A were prepared and titered as described
previously (Garnier et al., 1994 ; Berkner, 1998 ; J. Whitfield,
unpublished observations). Immunopanned Schwann cells from newborn rats
were plated at a density of 3000 cells per 10 µl drop on
laminin-coated glass coverslips in supplemented defined medium.
Approximately 16 hr after plating, adenoviral supernatant corresponding
to a multiplicity of infection of ~1500 was added to the cells.
Twenty-four hours later the adenoviral supernatant was removed, and the
medium of the cells was changed into fresh supplemented defined medium. No toxic effects of addition of the adenoviral supernatant on the
Schwann cells were observed. After an additional 24 hr to allow
expression of the lacZ or FLAG 169-Jun, the time 0 controls were
fixed, and the Schwann cells were changed to fresh supplemented defined
medium alone or with increasing amounts of TGF 1. Twenty-four hours
later, the cells were fixed and stained with Hoechst dye, and survival
was assessed as described previously.
Infection of Schwann cells with retroviral constructs. For
retroviral infection experiments, Schwann cells from newborn nerves were purified by culture in DMEM and 10% calf serum containing 10 5
M cytosine arabinoside for 3 d as described
previously (Morgan et al., 1991 ). The cDNAs for the LexA and LexA-vJun
(Struhl, 1988 ) were cloned into the retroviral plasmid vector
pBABEpuro, and the GP+E ecotropic packaging cell line
(Morgenstern and Land, 1990 ) was then stably transfected with the
plasmid DNA. Retroviral supernatant from the GP+E cells was then used
to infect rat Schwann cells, and puromycin-selected pools of infected
Schwann cells were cultured and used for all experiments. Antibodies
against the LexA portion of the fusion protein were used to confirm
LexA-vJun protein expression (data not shown).
Transient transfection of Schwann cells. Schwann cells for
transfection were grown to semi-confluency on PLL-coated 90 mm tissue
culture dishes in DMEM/10% FCS/4 µM forskolin.
Just before transfection, the medium of the cells was changed into
supplemented defined medium containing 0.5% FCS. Schwann cells
were transfected using 3 µg of the AP1-responsive collagenase I gene
promoter, Coll(-514)-CAT (Bossy-Wetzel et al., 1997 ), together with 3 µg of the SV40-driven LacZ plasmid pCH110 (Amersham Pharmacia, St. Albans, UK) together with 18 µl of Fugene 6 transfection reagent (Roche Diagnostics) in 600 µl of DMEM per the manufacturer's
instructions and added to the Schwann cells. Twenty-four hours after
addition of the transfection mix to the cells, TGF 1 was added to a
final concentration of 5 ng/ml. After 30 hr, lysates were prepared from the cells and assayed for CAT activity; assay of LacZ activity was used to correct for transfection efficiency. The relative CAT
activities shown represent data from duplicate transfections.
Western blotting. Protein extracts were prepared from
control and transected newborn rat nerves. Thirty micrograms of protein were electrophoresed on 12% SDS-polyacrylamide gels. Protein was transferred onto nitrocellulose membrane, blocked with 5% fat-free milk in PBS/0.1% Tween 20, and incubated with primary and secondary antibodies diluted in PBS/Tween 20. After washing, specific protein complexes were revealed using ECL Plus chemiluminescent reagent (Amersham Pharmacia).
Preparation of RNA, cDNA synthesis, and semiquantitative PCR
analysis. Total RNA was isolated from freshly dissected tissue (sciatic nerve and brachial plexus) or cultured Schwann cells using
Ultraspec RNA reagent (Biotecx Laboratories, Houston, TX) according to
the manufacturer's instructions. For the preparation of RNA from
transected nerve, newborn rats were anesthetized, the left sciatic
nerve was transected, and the proximal stump was dissected and sutured
to the muscle. cDNA was prepared from 500 ng of total RNA with random
hexamer primers using Superscript II reverse transcriptase (Life
Technologies) in a 50 µl reaction containing (in
mM): 50 Tris-Cl, pH 7.3, 75 KCl, 3 MgCl2, 10 DTT, and 0.5 dNTPs. One microliter of
cDNA, equivalent to 10 ng of total RNA, was used for quantification of
cDNA species using semiquantitative PCR analysis. The following primer
pairs were used: c-Jun sense 5'-CTGATCATCCAGTCCAGC-3', antisense
5'-CGTAGAC CGGAGGCTCAC-3'; ALK1 sense 5'-TTCTCCTCACGAGATGAGCAGTC-3',
antisense 5'-TCCCAGGTCTGCAATGCAAC-3'; ALK2 sense
5'-GCAGGGGAAGATGACGTGTAAGAC-3', antisense
5'-CGACACA- CTCCAACAGGGTTATCTG-3'; ALK5 sense
5'-AGCTGTCAT- TGCTGGTCCAGTC-3', antisense
5'-TCTGCCTCTCGGAACCATGAAC-3'; TGF 1 sense 5'-ACCTGCAAGACCATCGACATGG, antisense 3'-CGTCAAAAGACAGCCACTCAGG; TGF 2 sense
5'-GAA- TCTGGTGAAGGCAGAGTTCAG, antisense 3'-GCAACAACATTAGCAGGAGATGTG;
TGF 3 sense 5'-GAGTTGCTGGAA- GAGATGCACG, antisense
3'-CAGAGTGGCTGTCCTTCGATGT; cyclin D1 sense 5'-GAAGTTGTGCATCTACACTGACAAC-3', antisense
5'-CCGGGTCACACTTGATGACTCTGG-3'. 18S rRNA primers were as described by
Owens and Boyd (1991) .
 |
RESULTS |
TGF induces cell death of Schwann cells
in vitro
Because our preliminary observations in vitro suggested
that TGF adversely affected Schwann cell numbers [our unpublished results; see also Cheng and Mudge (1996) ; Stewart et al. (1995a ,b ); Skoff et al. (1998) ], we set out to analyze the effects of TGF on
Schwann cell survival using immunopurified primary Schwann cells.
First, we examined the effect of TGF on cells plated on polyornithine under conditions similar to those that we have used previously to demonstrate the existence of autocrine survival loops in
Schwann cells (Meier et al., 1999 ). Cell death in these cultures was
assayed in three ways: first by cell morphology, second by nuclear
condensation as viewed by Hoechst stain, and third by TUNEL analysis.
In comparing these three methods for assessing cell death (Fig.
1A-C), we
found an essentially complete overlap between cells judged to be dead
by morphology and cells with condensed, strongly Hoechst-stained
nuclei. Furthermore, combined Hoechst/TUNEL analysis showed that all
cells considered to be alive on the basis of Hoechst staining were
TUNEL negative, whereas >95% of the cells judged to be dead by
Hoechst staining were TUNEL positive. In control experiments for the
TUNEL analysis in which the terminal transferase enzyme was omitted
from the reaction, no labeling of nuclei was observed (data not shown). Thus all three methods for assessing Schwann cell death gave similar results. Hoechst staining/morphological analysis was used in most of
the following experiments, whereas in a number of instances, TUNEL
staining or active caspase-3 immunolabeling was used as well. These are
indicated in the text.

View larger version (94K):
[in this window]
[in a new window]
|
Figure 1.
TGF induces apoptosis in Schwann cells
in vitro. A-C, Death of
Schwann cells at high density on polyornithine induced by TGF (2 ng/ml) as measured by criteria of cell morphology
(A), nuclear condensation viewed by Hoechst stain
(B), and TUNEL labeling
(C). Arrows indicate live cells
with extended processes with nuclei that are round and TUNEL negative.
Arrowheads show dying or dead cells that are rounded up,
have condensed nuclei, and are TUNEL positive. D, Counts
of live and dead cells in control ( ) and TGF 1 (2 ng/ml)-treated
(+) cultures of Schwann cells at low density (LD/PO) and
high density (HD/PO) on polyornithine, and high density
on laminin substrate (HD/LAM). E,
F, Activation of caspase 3 in dying Schwann cells
treated with TGF 1 (2 ng/ml). Arrows indicate live
cells as viewed by phase contrast (E) that
are not labeled for active caspase 3 (F).
Examples of dying/dead cells, which are labeled for active caspase-3,
are indicated with arrowheads.
|
|
In an initial set of experiments, immunopurified Schwann cells from the
sciatic nerve of newborn rats were exposed to TGF (2 ng/ml) for
1 d under three experimental conditions: high (3000 cells per
coverslip) density and low (300 cells per coverslip) density on a
polyornithine substrate and high density on a laminin substrate. High
and low cell density cultures were compared because Schwann cell
survival in vitro is subject to autocrine, density-dependent regulation, and polyornithine and laminin were compared because laminin
can support Schwann cell survival (Meier et al., 1999 ). At the end of
the experiment, the TGF -treated cells and control untreated cultures
were fixed, Hoechst stained, and TUNEL labeled. In addition, sister
coverslips were fixed and immunolabeled with antibodies to active
caspase-3, because caspase-3 activation is associated with apoptotic
cell death (Nicholson and Thornberry, 1997 ; Cryns and Yuan, 1998 ).
Under all three conditions TGF caused significant Schwann cell death
(Fig. 1D). On polyornithine, >90% of the cells
could be accounted for throughout the assay because even the dead cells
remained attached to the coverslip at the end of the experiment, as
seen previously (Meier et al., 1999 ). Because of this it could be seen
unambiguously that TGF killed Schwann cells, rather than causing
living cells to detach from the coverslips. Even on laminin substrate,
although there was slightly more loss of cells from the coverslips with
TGF treatment (24%), analysis of the supernatant of the tissue
culture revealed cells with condensed nuclei or just cellular debris,
thereby excluding the possibility that TGF 1 was causing a
significant number of live cells to detach under these conditions. To
further characterize the cell death caused by TGF , we immunolabeled
Schwann cells with an antibody specific for the active cleaved form of
caspase-3. We observed that ~80% of cells judged to be dead by
morphological criteria in TGF -treated cultures were labeled for
active caspase 3 (Fig.
1E,F), indicating that
TGF is causing apoptotic death of Schwann cells. Having shown that
TGF will cause cell death in Schwann cells, we next performed a
series of experiments to further characterize this effect and the
relationship between TGF and positive survival signals for Schwann cells.
In a 24 hr survival assay of Schwann cells at low density on
polyornithine, TGF 1 induced dose-dependent cell death in newborn rat
Schwann cells over and above that which occurs because of the absence
of positive survival signals under these conditions (Meier et al.,
1999 ) (Fig. 2A). At 2 ng/ml, as observed previously, TGF 1 reduced survival to
approximately half that seen in control cultures and correspondingly
increased the number of TUNEL-positive cells (from 35 ± 7% in
control to 62 ± 3% in TGF -treated cultures; p < 0.001). To examine whether the remaining cells represented a
TGF -resistant subpopulation, cells were counted after an additional 24 hr in one experiment using TGF 1 at 5 ng/ml. At this time point (48 hr) <2% of the cells remained alive in the presence of TGF , indicating that all cells can be killed in this assay (data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2.
In vitro survival assays.
TGF -induced cell death is not blocked by high cell density or by
NRG alone. A, TGF 1 causes death of Schwann cells
in a dose-dependent manner. Schwann cells plated at low density (300 cells per coverslip) on polyornithine-coated coverslips were treated
with increasing concentrations of TGF 1, and survival was assessed
after 24 hr. B, Cell death caused by TGF 1 is density
independent. Survival of Schwann cells plated on polyornithine at
different densities as indicated and treated with TGF 1 (2 ng/ml) for
24 hr is shown. C, Dose-dependent TGF 1-induced death
occurs even in high-density cultures (3000 cells per coverslip) on a
laminin substrate. D, In low-density cultures (300 cells
per coverslip), NRG is relatively ineffective at inhibiting
TGF 1-induced death. Schwann cells were treated with TGF 1 (2 ng/ml) in the presence of increasing concentrations of NRG ; survival
was assessed after 24 hr. Compare this curve with that shown in Figure
3A.
|
|
To further test whether the death induced by TGF in these sparse
cultures could be blocked by the autocrine signals that support Schwann
cell survival at high cell densities (Meier et al., 1999 ), we tested
the effect of TGF 1 (2 ng/ml) in high-density cultures using
polyornithine substrate as before (Fig. 2B). TGF still induced cell death: at very low density (100 cells per
coverslip), survival of cells in TGF -treated cultures was 59% of
that in the control cultures, whereas at very high density (8100 cells per coverslip) the same statistic was 57%, indicating that the proportion of cells killed in the TGF 1-treated cultures was just as
striking at high density as at low density. This suggests that autocrine factors alone cannot block TGF -induced death of Schwann cells (see below) (Fig. 3).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3.
In vitro survival assays.
TGF -induced cell death is blocked by a combination of NRG and
autocrine signals. A, In high-density Schwann cell
cultures (3000 cells per coverslip), NRG inhibits TGF 1 (2 ng/ml)-induced apoptosis in a dose-dependent manner. B,
In sister cultures, application of NRG at 10 ng/ml in the presence
of increasing amounts of TGF 1 (TGFB+NRG) inhibits
apoptosis. Shown also are data for TGF 1 alone (TGFB).
C, In the presence of TGF 1 (2 ng/ml) in low-density
cultures (300 cells per coverslip), NRG (NRG, 10 ng/ml) alone, or a combination of IGF-2 (1.6 ng/ml), NT3 (0.8 ng/ml),
and PDGF-BB (0.8 ng/ml) (Auto) alone, inhibits
TGF 1-induced apoptosis only partially, whereas application of both
(NRG+Auto.) blocks TGF 1-induced death.
|
|
We have shown previously that autocrine signals alone are insufficient
for maintaining Schwann cell survival for a long time and that longer
term survival of Schwann cells requires both laminin and autocrine
signals (Meier et al., 1999 ). We therefore tested the effect of TGF
on Schwann cells plated at high density on a laminin substrate (Fig.
2C). TGF 1 was equally effective in inducing death in
these cultures after 24 hr as in cultures plated on polyornithine. In
cell death assays of Schwann cells on laminin substrate treated with
TGF 1, a higher proportion of dead cells (24% for 2 ng/ml TGF 1
after 24 hr) detached from coverslips. Analysis of cells still attached
to the coverslip also revealed increased apoptosis with TGF 1
treatment as measured by combined Hoechst/TUNEL staining (data not shown).
In addition to autocrine signals, NRG s are likely to be a major
regulator of the survival of developing Schwann cells in vivo, and they act as potent survival factors for cultured Schwann cells (Grinspan et al., 1996 ; Syroid et al., 1996 ; Trachtenberg and
Thompson, 1996 ). We therefore tested whether NRG alone (i.e., in
low-density cultures and the consequent absence of autocrine signals)
could block the death-promoting effects of TGF . Sparse cultures were
prepared on either polyornithine- or laminin-coated coverslips and
exposed to 2 ng/ml TGF 1 and varying concentrations of NRG . Under
these conditions, NRG was relatively ineffective at promoting
Schwann cell survival except at very high doses (Fig. 2D, compare with 3A).
TGF 1 and TGF 2 were equipotent in their ability to induce Schwann
cell death, consistent with their indistinguishable effects observed in
other in vitro assays (Ten Dijke et al., 1990 ). At 2 ng/ml,
a dose used frequently in this study, Schwann cell survival averaged
25 ± 1.29% for TGF 1 (n = 6) and 28 ± 3.77% for TGF 2 (n = 3) in an assay identical to
that described in Figure 2A. Each isoform was
reconstituted in an acid-BSA mix. When TGF was omitted from this
mix and cells were treated with the appropriate volume of carrier
solution, the percentage survival was not reduced from the level
observed in control cultures, indicating that TGF is the active
killing ingredient. Although Schwann cells in culture make TGF , this
is secreted in an inactive from (Stewart et al., 1995b ). It is also
important to note that expansion of newborn Schwann cells with cAMP
elevating agents and growth factors is accompanied by a reduction in
TGF -mediated cell death (data not shown).
Together these experiments show that TGF kills primary Schwann cells
from nerves of newborn rats under various conditions in culture.
Individually, neither of the two major signals likely to totally
regulate the survival of these cells in vivo, NRG or
autocrine signals, prevents TGF -induced death.
TGF -induced cell death is blocked by a combination of NRG and
autocrine signals
Having shown that neither NRG nor autocrine survival signals
could completely prevent TGF -induced death when present separately (above), we now tested, in three different ways, whether the
combination of these survival factors could block the effect of
TGF .
First, immunopurified cells from newborn animals were plated at high
density (and therefore exposed to autocrine signals) on a laminin
substrate. All cells were maintained with a constant concentration (2 ng/ml) of TGF 1, whereas the concentration of NRG varied from 0.01 to 50 ng/ml. Under these conditions, NRG prevented Schwann cell
death in a dose-dependent manner (Fig. 3A, compare with
2D). Conversely, in other experiments also performed at high density, the concentration of NRG was held constant at 10 ng/ml whereas the TGF 1 concentration varied: almost complete survival was seen even at TGF concentrations of 10 ng/ml (Fig. 3B).
Second, Schwann cells were plated at low density on a laminin substrate
and maintained with 10 ng/ml NRG and autocrine factors in the form
of 1:10 dilution of medium conditioned by dense Schwann cell cultures
as described previously (Meier et al., 1999 ). Addition of 2 ng/ml
TGF to these cultures did not induce cell death (data not shown).
Third, we took advantage of our previous finding that IGF-2, NT3, and
PDGF-BB are important components of the autocrine Schwann cell signal.
This predicts that the minimal combination of IGF-2 (1.6 ng/ml), NT3
(0.8 ng/ml), and PDGF-BB (0.8 ng/ml), a mixture that mimics the
autocrine activity in a number of tests (Meier et al., 1999 ), should
block TGF -induced death, provided NRG is also present. When this
was tested, using sparse Schwann cell cultures on a laminin substrate,
we found as expected that the combination of IGF-2, NT3, and PDGF-BB
was relatively ineffective on its own but that cell death in TGF (2 ng/ml) was completely prevented if NRG (10 ng/ml) was also present
(Fig. 3C).
These results show that in the combined presence of NRG and
autocrine signals, Schwann cells from newborn nerves are resistant to
the killing effects of TGF .
Endogenous TGF might contribute to Schwann cell death
in vivo
TGF is present in Schwann cell precursors and embryonic and
neonatal Schwann cells, and the results above show that TGF can kill
Schwann cells in vitro. This raised the possibility that the
increase in cell death triggered by transection of neonatal nerves
might be attributable in part to the action of endogenous TGF . A
number of in vivo experiments were performed to explore this idea.
First, expression of TGF s in nerves of newborn animals was examined.
The previous observation that TGF is present in Schwann cells and
that TGF 1 mRNA and protein are elevated in distal nerve stumps after
nerve cut is one of the findings that suggests that TGF might be
involved in events that follow nerve damage (Scherer et al., 1993 ;
Rufer et al., 1994 ). Because this has been tested only in the adult, we
monitored TGF 1 and TGF 3 mRNAs in the distal stump of transected
nerves in newborn rats using RT-PCR (Fig. 4A). Levels of TGF 1
and TGF 3 mRNAs by semiquantitative PCR showed that there is no
significant change in levels among newborn, P1, and P3 in normal intact
rat sciatic nerve during development (Fig. 4A) (data
not shown). After nerve cut, TGF 1 mRNA was strongly elevated at
1 d and, to a lesser extent, at 3 d, whereas levels of
TGF 3 mRNA were reduced in the distal stump as reported in the adult.
This indicates that the TGF mRNAs expression profile after nerve cut
is similar in newborn and adult nerves. We also measured levels of
TGF 1 protein in newborn, P2 contralateral control, and newborn nerve
2 d after transection by Western blot analysis. TGF 1 protein is
present in newborn and P2 nerve and is slightly elevated in newborn
nerve 2 d after transection (Fig. 4B).
Immunolabeling of sections prepared from transected nerves (4 d after
transection) and contralateral control nerves with a different TGF 1
antibody also showed an elevation of TGF 1 protein with transection
(data not shown). Thus TGF 1 protein is present in the distal stump
of transected nerves in newborn rats in agreement with the idea that it
acts as a death signal under these circumstances.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 4.
A, Nerve transection in newborn rat
causes an upregulation of TGF 1 mRNA and downregulation of TGF 3
mRNA. Shown is semiquantitative PCR measurement of levels of mRNA for
TGF 1 and TGF 3 in newborn rat sciatic nerve (NB),
1 d (1d NB-TS), and 3 d (3d
NB-TS) after transection, and from postnatal day 3 (P3) rat. B, Measurement of TGF 1
protein levels in intact and transected newborn nerve. Shown is Western
blot of protein from newborn (NB), P2, and newborn rat
sciatic nerve 2 d after transection (2d
NB-TS).
|
|
Further tests of TGF involvement in vivo were performed
by injecting TGF into nerves of newborn rats. Schwann cells in
normal neonatal nerves can be presumed to be exposed to axon-associated NRG and to autocrine signals in the confined environment of the nerves, and we have suggested previously that Schwann cell survival at
this stage of development depends on the combined input from these two
sources (Meier et al., 1999 ). A simple prediction from the culture
experiments (Fig. 3) was that such cells would be resistant to TGF .
A different set of conditions exists in transected nerves. In the
distal stump, transection is presumably accompanied by a loss of and
reduction in exposure to axonal NRG distal to the cut while
the cells continue to be exposed to autocrine signals. This situation
leads to increased cell death, although most cells survive (Grinspan et
al., 1996 ). The culture experiments (Fig. 2) predict that, under these
conditions, Schwann cells in vivo would be sensitive to
TGF killing. As outlined below, both of these expectations were
fulfilled. We first confirmed that in normal newborn sciatic nerve
there is a low level of cell death, as measured by the TUNEL assay
(0.175 ± 0.02% of total cells; 12,000 nuclei per section were
counted) and that at 24 hr after transection this is increased 10.7×
(1.88 ± 0.15%) in the distal stump in agreement with previous
results (Grinspan et al., 1996 ; Syroid et al., 1996 ) (Fig.
5, Table
1). Double immunolabeling of sections
with S-100 antibody confirmed that dying cells were Schwann cells (data
not shown). When three injections of TGF 1 (each injection was 10 µl of a 400 ng/ml solution) were made into the relatively large
intermuscular space that surrounds the sciatic nerve in the mid-thigh
region of a newborn rat over 24 hr, no effect was seen; the number of
TUNEL-positive nuclei remained at 0.l8%. In contrast, when identical
TGF injections were performed during the 24 hr after nerve
transection, the number of TUNEL-positive nuclei in the TGF -injected
transected nerves was ~1.5 times higher (2.92 ± 0.09% vs
1.88 ± 0.15%) than in transected nerves injected with the
control carrier solution only.

View larger version (95K):
[in this window]
[in a new window]
|
Figure 5.
TUNEL analysis of newborn rat sciatic nerve after
transection. Shown are representative fields from sections stained with
Hoechst dye to reveal nuclei (A, C,
E) and TUNEL stained to reveal apoptotic nuclei
(B, D, F).
A and B show control untransected nerve,
C and D show sciatic nerve 24 hr after
transection, and E and F show transected
nerve 24 hr after transection with injection of pan-TGF blocking
antibody. Arrows point to examples of individual
TUNEL-labeled nuclei.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
The effects of TGF , blocking TGF antibody, and nerve
transection on Schwann cell death in neonatal nerves in
vivo
|
|
Last, a blocking pan-TGF antibody was injected into the area of the
distal stump after nerve cut in newborn rats in two experiments (Fig.
5, Table 1). The antibody (250-500 ng/ml) was injected three times
during a 24 hr period after nerve cut as described above. Averaging the
two experiments (two rats in each experiment) reveals that the blocking
antibody reduced the number of apoptotic nuclei in the nerve by 62%.
Identical injections of a control antibody SM 1.2 (280 ng/ml; see
Materials and Methods) resulted in an insignificant (5%) reduction in
the number of apoptotic nuclei (Table 1).
All of the above data are consistent with the possibility that Schwann
cell death in transected neonatal nerves is not caused solely by loss
of axon-associated NRG but is caused also by TGF present in the nerve.
Schwann cells acquire resistance to TGF killing as
they differentiate
Two previously reported features of Schwann cell death in
vivo gave us the opportunity to test further whether TGF acted in a manner expected of a death signal in transected nerves. The first
of these is that the amount of cell death induced by cutting a nerve
diminishes gradually after birth so that a point is reached some time
between P5 and P20 after which transection no longer leads to the
appearance of apoptotic nuclei in the distal stump (Grinspan et al.,
1996 ). We therefore tested whether this loss of vulnerability to death
in vivo was mirrored by loss of sensitivity to
TGF -induced death in the cell culture assay. Schwann cells from rats
of different ages were exposed to TGF for 24 hr using the same
protocols as those used for newborn cells as described above. Under
both low-density and high-density culture conditions on a polyornithine
substrate, the death response to TGF decreased markedly with age,
and by P8, Schwann cells were almost impervious to even a high dose of
TGF (5 ng/ml; p > 0.05) (Fig.
6A). Using laminin-coated coverslips and Schwann cells from embryo day (E) 18, newborn, P8, and adult animals plated at 3000 cells, similar results
were obtained (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
In vitro survival assays. The
ability of TGF 1 to cause apoptosis of Schwann cells is
developmentally regulated. A, Survival of Schwann cells
from newborn (NB), postnatal day 4 (P4), and P8 rats plated at high density (3000 cells per coverslip) with increasing concentrations of TGF 1. Note
that the ability of TGF to kill Schwann cells decreases as the cells
get older. B, Survival assay for Schwann cells showing
percentage of MBP-positive cells (MBP+) and MBP-negative
cells (MBP ) from P4 animals in cultures treated with
TGF 1 (5 ng/ml) in a 24 hr assay. Note that the percentage survival
of MBP-positive cells (cells that were myelinating in
vivo) is relatively unaffected by TGF 1.
|
|
The second in vivo finding that we explored in
vitro is that transection-induced cell death in early postnatal
nerves (P5) is to a large extent restricted to cells not involved in
myelination (Grinspan et al., 1996 ). We tested whether this selective
resistance of early myelinating cells to death in the nerve was
reflected in selective resistance of such cells to TGF -induced cell
death in vitro. Essentially, this involved repeating the
experiment shown in Figure 6A using cells from P4
animals and one dose (5 ng/ml) of TGF 1 only, but in this case
analyzing the results for myelinating cells, and cells not involved in
myelination, separately. Cells from P4 nerves were plated sparsely on
polyornithine substrate, and at 3 hr (the reference point for the
survival assay; see Materials and Methods), some cultures were
immunolabeled with antibodies to MBP to identify cells that had started
to myelinate. The MBP-negative cells were taken to be cells not yet
engaged in myelination or cells destined to become nonmyelinating
cells. Sister cultures were maintained with or without TGF (5 ng/ml)
for 24 hr, fixed, and immunolabeled with MBP antibodies. It was
striking that TGF had no effect on the number of MBP-positive cells
in this assay, whereas it killed approximately two-thirds of the
MBP-negative cells (Fig. 6B). Repetition of this
experiment with nerves from P8 animals also revealed that no
MBP-positive cells were killed by TGF (data not shown). Because
TGF kills only a minimal number of P8 cells (Fig.
6A) and the percentage of MBP-positive cells at P8
was 52%, it follows that resistance to TGF spreads in this period
to the whole Schwann cell population regardless of whether they are myelinating.
To test whether this was true in vivo for cells in the
nerves of P8 rats, we transected nerves in P8 animals, and in other experiments we injected TGF , as described previously, in the area of
the normal P8 sciatic nerve. No cell death was noted in normal P8
nerves, and neither injection of TGF nor transection led to the
appearance of apoptotic nuclei in these experiments (data not shown). A
single experiment was performed to determine whether the
differentiation-related resistance to TGF killing was reversible.
Cells from nerves of P8 rats were cultured in the presence or absence
of TGF (5 ng/ml) for 5 d. At the end of this period, cell
counts revealed that although 43% of cells in control cultures
survived, <2% of TGF -treated cells were still alive. This was
reminiscent of earlier findings that by 48 hr TGF had killed
virtually all cells from nerves of newborn animals (above).
Thus, whatever the process involved in imparting TGF resistance to
older cells, it appears that the changes involved are reversible in culture.
Together these experiments indicate that resistance to TGF killing
develops as one component of the mature phenotype of myelin-forming and
nonmyelin-forming Schwann cells. The selective resistance of
myelinating cells in early postnatal nerves may reflect the fact that
differentiation along the myelin pathway starts before the maturation
of nonmyelin-forming cells (Jessen and Mirsky, 1992 ). These
relationships between vulnerability to TGF and Schwann cell
differentiation seen in culture are similar to those between Schwann
cell differentiation and death mechanisms in transected nerves.
TGF receptors ALK1, ALK2, and ALK5 are detectable during
peripheral nerve development
Using semiquantitative RT-PCR we showed that the TGF type I
receptors ALK1, ALK2, and ALK5 are expressed in E14 to adult nerve.
ALK5, the major type I receptor involved in TGF signaling (Massague,
2000 ), was expressed at the same level throughout development. ALK2 was
expressed at higher levels at early developmental stages and
downregulated postnatally, whereas ALK1 was detectable at lower levels
at E14 and E15, with higher levels at birth and postnatally (Fig.
7). To determine whether ALK5 protein was
detectable, we used immunocytochemistry on newborn rat Schwann cells.
All Schwann cells expressed the ALK5 receptor (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7.
Expression of type I TGF receptors ALK1, ALK2,
and ALK5 in sciatic nerve during development. Semiquantitative RT-PCR
measurement of ALK1, ALK2, and ALK5 from E14 through to adult
(Ad.) in rat sciatic nerve. Note marked downregulation
of ALK2 mRNA in postnatal nerves.
|
|
Treatment of Schwann cells with TGF 1 causes serine-63
phosphorylation of c-Jun and activation of AP1-dependent
transcription
We now examined the intracellular mechanisms by which TGF
induces cell death. Activation of the transcription factor c-Jun and
induction of AP1-dependent transcription has been shown to be involved
in apoptosis of several cell types, including fibroblasts (Bossy-Wetzel
et al., 1997 ) and sympathetic neurons (Ham et al., 1995 ). Activation of
c-Jun and AP1-dependent transcription requires phosphorylation of c-Jun
on two N-terminal serine residues, ser-63 and -73 (Smeal et al., 1991 ).
We therefore examined whether activation of c-Jun occurred in response
to application of TGF 1 to freshly isolated Schwann cells using an
antibody that is specific for c-Jun when phosphorylated on the
serine-63 residue (Watson et al., 1998 ). Schwann cells were plated at
high density on laminin-coated glass coverslips in supplemented defined
medium (see Materials and Methods). As a positive control, identical
cultures were exposed to ultraviolet (UV) light, a procedure that has
been shown previously to result in phosphorylation and activation of
c-Jun (Devary et al., 1991 ; Derijard et al., 1994 ). One hour after
addition of TGF 1 (2 ng/ml), strong nuclear labeling was seen (Fig.
8D), indicating phosphorylation of c-Jun at serine-63. Similar labeling was seen 1 hr
after UV irradiation (Fig. 8F). To determine whether
levels of c-Jun protein and mRNA were unchanged during this time, we immunolabeled Schwann cells treated with TGF 1 for 1 hr with
antibodies to c-Jun. Levels of c-Jun were unchanged during this time in
response to TGF 1 treatment using several different serial dilutions
of antibody (Fig. 8G,H) (data not shown).
These results were confirmed at the mRNA level by semiquantitative
RT-PCR of TGF 1-treated and control cells (Fig.
8I); however, induction of c-Jun mRNA was observed 8 hr after TGF 1 addition (data not shown), consistent with the
previously reported induction of c-Jun itself by activated AP1
complexes (Stein et al., 1992 ; van Dam et al., 1995 ; Eilers et al.,
1998 ). In support of activation of c-Jun in Schwann cells, we found
that TGF 1 caused an increase in cyclin D1 mRNA (Fig. 8J), a known transcriptional target for
c-Jun-dependent transcription (Albanese et al., 1995 ; Bakiri et al.,
2000 ).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 8.
Addition of TGF 1 to newborn rat Schwann cells
in vitro causes serine-63 phosphorylation of c-Jun,
activation of AP1-dependent transcriptional activity, and induction of
cyclin D1 mRNA. A, C, and
E show immunopanned newborn rat Schwann cells stained
with Hoechst dye to reveal the nuclei, and B,
D, and F show Schwann cells immunolabeled
with antibody specific for the serine-63-phosphorylated form of c-Jun.
A and B show control untreated cells with
low levels of phosphorylated c-Jun. C and
D show Schwann cells treated for 1 hr with TGF 1 (2 ng/ml). Note substantial serine-63 phosphorylation of c-Jun.
E and F are
|
|
To test functionally whether TGF 1 activated c-Jun and stimulated the
corresponding AP1-dependent transcriptional activity, we performed
transient transfections into Schwann cells with an AP1-responsive CAT
reporter construct (Bossy-Wetzel et al., 1997 ). Figure
8K shows that addition of TGF 1 to Schwann cells
resulted in a massive increase (~23-fold) in AP1-dependent
transcription in Schwann cells, further demonstrating the link between
TGF 1 and activation of c-Jun/AP1 in Schwann cells.
Overexpression of dominant negative c-Jun inhibits TGF 1-induced
cell death of Schwann cells
Having identified that there is activation of c-Jun and
AP1-dependent transcription in Schwann cells after TGF 1 addition, we
next investigated whether activity of c-Jun was required for induction
of cell death by TGF 1. These experiments were performed with Schwann
cells at high density at which TGF 1 will induce apoptosis as
measured by combined Hoechst/TUNEL analysis. Using an adenoviral
infection protocol (see Materials and Methods) we overexpressed a
FLAG-tagged dominant negative c-Jun protein, FLAG 169-Jun. This lacks
the transcriptional activation domain of the protein and inhibits
c-Jun-dependent transcription (Ham et al., 1995 ). After infection of
immunopanned Schwann cells from newborn animals with FLAG 169-Jun
adenoviral supernatant, >90% of Schwann cells showed expression of
the dominant negative c-Jun protein at time 0 before TGF 1 addition
(Fig.
9A,B).
Adenovirus expressing the LacZ gene was used as a control in these
experiments. Figure 9 shows that overexpression of the dominant
negative c-Jun (FLAG169-Jun) significantly (p < 0.01 at 10 ng/ml TGF 1) inhibits TGF 1-induced cell death in this
assay as compared with Schwann cells infected with the LacZ control.
TGF 1 (10 ng/ml) kills 46% of control cells (LacZ) over a 24 hr
period when compared with 15% in Schwann cells infected with the
dominant negative c-Jun construct (FLAG169-Jun). After 48 hr,
TGF 1-induced cell death in control cultures was further increased,
whereas dominant negative c-Jun expression still exerted an inhibitory
effect on death (data not shown). These experiments demonstrate a
requirement for c-Jun activity in TGF 1-induced cell death in Schwann
cells.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 9.
Overexpression of dominant negative c-Jun inhibits
TGF 1-induced apoptosis in Schwann cells. A,
B, Immunolabeling of Schwann cells with anti-FLAG
antibody 48 hr after addition of adenoviral supernatants before TGF 1
addition shows expression of FLAG-tagged dominant negative c-Jun
(FLAG 169-Jun) in >90% of Schwann cell nuclei. A
shows Hoechst stain of nuclei; B shows
immunofluorescence with FLAG antibody. C, In
vitro survival assays of Schwann cells infected with control
virus (Lac-Z) or with dominant negative c-Jun
(FLAG169-Jun). The cells were exposed to medium alone or
to medium containing 10 or 20 ng/ml TGF 1 for 24 hr. Schwann cells treated with UV light, a known activator of
c-Jun phosphorylation, as positive control. G and
H show immunolabeling in control
(G) and TGF 1-treated
(H) (2 ng/ml for 1 hr) Schwann cells to
show that c-Jun protein levels remain unaltered at this time point
after TGF 1 addition. c-Jun mRNA as assayed by semiquantitative
RT-PCR (I) also remains unaltered at this
time. J shows RT-PCR data demonstrating TGF 1 (2 ng/ml) induction of cyclin D1 mRNA; amplification using primers
specific for 18S rRNA indicates equal input of cDNA into PCR assays.
K shows that TGF 1 causes strong induction of
AP1-dependent transcription in Schwann cells. Schwann cells were
cotransfected with an AP1-dependent CAT reporter construct together
with pCH110 lac-Z plasmid. Thirty hours after transfection in the
absence (Control) or presence of 5 ng/ml of
TGF 1 (+TGFB1), lysates were assayed for CAT
activity.
|
|
To determine whether activation of c-Jun is sufficient to cause cell
death, we used a construct expressing v-Jun, a constitutively active
form of c-Jun. The transcriptional activity of v-Jun is independent of
stress-activated protein kinase/Jun N-terminal kinase (SAPK/JNK)
phosphorylation (Black et al., 1994 ) and has been shown to act as a
strong transcriptional activator in a majority of systems (Bohmann and
Tjian, 1989 ; Black et al., 1994 ; Hartl and Bister, 1998 ; Huguier et
al., 1998 ; Bader et al., 2000 ) (see however Gao et al., 1996 ; Kilbey et
al., 1996 ). We found that when Schwann cells expressing v-Jun were
cultured at high density in serum-free supplemented defined medium, the
amount of cell death was strongly increased compared with control cells
infected with vector alone (Fig. 10).
Combined TUNEL/Hoechst analysis of these cultures, together with
labeling with CM1 antibody for active caspase 3, established that cells
in these cultures are dying by apoptosis (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 10.
Overexpression of v-Jun causes apoptosis of
Schwann cells in serum-free medium. Schwann cells infected with either
LexA control (Control) or LexA-vJun
(v-Jun) were plated at high density (5000 cells per
coverslip). The medium of the cells was then changed to supplemented
defined medium, and the number of surviving cells was counted after 48 hr.
|
|
TGF activation of c-Jun occurs predominantly in
MBP-negative cells
The previous experiment provided evidence that TGF kills
Schwann cells from newborn nerves by activating the c-Jun pathway. We
now tested whether a failure to activate this pathway could provide an
explanation for the failure of TGF to kill more differentiated Schwann cells.
Immunopanned rat Schwann cells from P4 animals were plated at high
density on laminin-coated coverslips in supplemented defined medium. As
discussed in a previous section, approximately half of the Schwann
cells in these cultures have started myelination as evidenced by
expression of MBP, whereas the other half is less differentiated. One
hour after TGF 1 (2 ng/ml) addition, the cells were immunolabeled
with antibodies against MBP and serine-63 phospho c-Jun. Figure
11 shows that TGF 1 stimulated
immunohistochemically detectable c-Jun phosphorylation in 31 ± 8.4% of MBP-negative cells but in only 5 ± 2.6% of MBP-positive
cells. Furthermore, the immunohistochemical labeling was consistently
stronger in the nuclei of the MBP-negative cells, indicating higher
levels of phosphorylated c-Jun. This correlates well with our
observation that MBP-positive Schwann cells are relatively resistant to
induction of cell death by TGF 1 and suggests that the inability of
TGF to kill differentiating Schwann cells can be explained in part by a failure to activate c-Jun in these cells. Therefore, the molecular
mechanism responsible for the differentiation-related immunity to
TGF killing may lie upstream of c-Jun activation.

View larger version (62K):
[in this window]
[in a new window]
|
Figure 11.
Phosphorylation of c-Jun in Schwann cells by
TGF 1 occurs mostly in MBP-negative cells. Immunopanned Schwann cells
from P4 rats were treated for 1 hr with TGF 1 (2 ng/ml) and double
immunolabeled with antibodies to MBP (B) and
ser-63 phospho c-Jun (C). After addition of
TGF 1, cells indicated by arrowheads in the
phase-contrast micrograph (A) are shown to be
negative for MBP (B) but positive for ser-63-
phosphorylated c-Jun (C). The two MBP-positive
cells in this field (arrows) are negative for
phosphorylated c-Jun. Note the typical vesicular appearance of MBP in
Schwann cells in culture after loss of axonal contact. D
quantifies this effect, illustrating the percentage of MBP-negative
(MBP ) and MBP-positive (MBP+) Schwann
cells that are also positive for the phosphorylated serine-63 form of
c-Jun in this assay.
|
|
TGF -activated death pathways involve the
interleukin-1 -converting enzyme-like protease pro-caspase 3
The interleukin-1 -converting enzyme (ICE) protease
inhibitor Z-VAD.fmk was used to investigate the role of ICE-like
proteases on Schwann cell death induced by TGF and by the absence of
survival factors. This synthetic peptide inhibitor prevents other types of cell death by blocking irreversibly the activation of the ICE-like protease, pro-caspase-3 (Chow et al., 1995 ; Zhu et al., 1995 ; Slee et
al., 1996 ). It is not clear that Z-VAD.fmk is specific for caspase-3
alone, and it might act similarly on the processing of other ICE-like
proteases. It was found that Z-VAD.fmk exerted different effects on the
two types of Schwann cell death: 100 µM Z-VAD.fmk did not
affect death of cells in medium alone, whereas its effects on the
TGF -mediated death were to increase survival by threefold, from 15 to 47% (Fig. 12). This effect was dose
dependent, with 50 µM Z-VAD.fmk increasing survival
twofold (data not shown). We also tested the effects of one proteasome
inhibitor, lactacystin, a metabolite of streptomyces (Fenteany et al.,
1995 ) on TGF -induced cell death. Like Z-VAD.fmk, lactacystin offered
negligible protection against cell death caused by the absence of
survival factors, whereas it completely blocked additional death
induced by TGF in a dose-dependent way (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 12.
ICE protease inhibitor Z-VAD.fmk inhibits
TGF 1-induced apoptosis in Schwann cells. The graph shows 24 hr
survival assays for immunopanned newborn rat Schwann cells plated at
low density (300 cells per coverslip) on polyornithine-coated
coverslips. Cells were maintained in defined medium alone
(DM), defined medium supplemented with NRG (10 ng/ml) (NRG), Z-VAD.fmk (100 µM)
(Z-VAD), TGF 1 (2 ng/ml) (TGFB), or
TGF 1 plus Z-VAD.fmk (TGFB+Z-VAD).
|
|
These results implicate ICE-like proteases, in particular caspase-3, in
the intracellular death pathways activated by TGF in Schwann cells.
They also suggest that these pathways are to some extent different from
those used when Schwann cells undergo cell death caused by the absence
of survival-promoting factors.
 |
DISCUSSION |
Although developmental and trauma-induced cell death in the
nervous system has classically been considered to be regulated by
positive survival signals present in limiting amounts, it is apparent
that in some situations cell death is in fact controlled by an
interplay between survival factors and negative survival signals that
actively induce cell death. The present work provides evidence that the
survival of Schwann cells is in some circumstances regulated by such a
dual mechanism involving the negative survival signal TGF , a family
of growth factors that is expressed by Schwann cells and secreted by
purified Schwann cells in a signal-poor environment in vitro
in an inactive form (Stewart et al., 1995b ). We pinpoint
phosphorylation of c-Jun as a key downstream event in TGF -induced
Schwann cell death. We also show that the ability of TGF to kill
Schwann cells, like normal Schwann cell death in vivo, is
under strong developmental regulation and provide evidence that the
decreasing ability of TGF to kill older cells is caused by a
decreasing ability of TGF to phosphorylate c-Jun in more
differentiated cells.
c-Jun is strongly expressed in cultured Schwann cells and in Schwann
cells in the distal stump of transected nerves, whereas expression
levels in the cells of normal untransected newborn and adult nerves are
low (De Felipe and Hunt, 1994 ; Stewart, 1995 ). We show here, using an
antibody specific for the ser-63 phosphorylated and thus activated
form, that TGF 1 activates c-Jun in Schwann cells. In confirmation of
this, we find that TGF 1 will both activate transcription of an AP1
reporter gene and upregulate cyclin D1 mRNA, a known target of c-Jun
[Wisdom et al. (1999) and references therein]. Activation of the
c-Jun transcription factor is involved in cell death in a number of
different cell types, including sympathetic neurons and fibroblasts
(Ham et al., 1995 ; Bossy-Wetzel et al., 1997 ). Activation of
c-Jun occurs by phosphorylation of two serine residues (ser-63 and
ser-73) by members of the JNK family (Derijard et al., 1994 ; Minden et
al., 1994 ; Eilers et al., 1998 ), and this phosphorylation event has
been shown to correlate with transcriptional activation by the
jun-containing AP1 complex (Smeal et al., 1991 ) and to be
required for apoptosis (Watson et al., 1998 ). In addition, using an
antibody specific for the active phosphorylated forms of SAPK/JNK, we
have also recently shown that TGF strongly increases SAPK/JNK
activity in Schwann cells (L. von Hertzen, unpublished observation).
SAPK/JNK activation has also recently been implicated in apoptosis of
Schwann cells after serum withdrawal (Cheng et al., 2001 ). We show that
expression of a dominant negative c-Jun is sufficient to inhibit
TGF 1-induced cell death of Schwann cells. In addition to this, we
have shown that expression of v-Jun, which is constitutively active
independent of its phosphorylation status (Black et al., 1994 ; Clark
and Gillespie, 1997 ), will induce cell death of Schwann cells when
survival signals are removed, thus mimicking the effects of TGF application.
TGF 1 has been shown to induce apoptosis in hepatoma cells,
B-lymphocytes, epithelial cells, and some other cell types, and blocking antibodies to TGF have recently been shown to prevent developmentally regulated motor and neuronal cell death in chick (Chalaux et al., 1999 ; Schrantz et al., 1999 ; Shima et al., 1999 ; Krieglstein et al., 2000 ). Analysis of pathways involved in TGF 1 signaling has identified activation of the JNK pathway by the TGF -activated kinase, TAK1 (Wang et al., 1997 ). Activation of TAK1
has also recently been linked to induction of apoptosis in eye
development in Drosophila (Takatsu et al. 2000 ). In
addition, TGF s activate multiple pathways in different cell types,
including activation of the SMAD family of proteins, which may
cooperate with other transcription factors to elicit a cell-specific
response to TGF stimulation (Massague and Wotton, 2000 ). SMAD3 and
SMAD4 proteins have been shown to interact with jun/fos heterodimers, stimulating AP1-dependent transcription, demonstrating convergence of
the JNK and SMAD pathways in response to TGF (Zhang et al., 1998 ).
Indeed, treatment of Schwann cells with TGF causes nuclear localization of SMAD4 (D. Parkinson, unpublished observation). The link
seen in the present experiments between TGF stimulation, c-Jun
phosphorylation, and cell death is of particular interest, because to
our knowledge it has not been seen before in the same cell type.
We find that TGF -induced death is distinct from the cell death
observed after the withdrawal of survival signals such as NRG or the
autocrine survival mixture of IGF-2, NT3, and PDGF-BB (Grinspan et al.,
1996 ; Syroid et al., 1996 ; Meier et al., 1999 ), because in Schwann
cells the cell death induced by withdrawal of these growth factors is
not inhibited by the general caspase inhibitor Z-VAD.fmk and apparently
is not accompanied by phosphorylation of c-Jun (C. Meier, unpublished
observation). In contrast, the cell death induced by TGF 1 in Schwann
cells requires the activity of caspases and is inhibited by the caspase
inhibitor Z-VAD.fmk, in keeping with previous findings of caspase
activation in cells by TGF (Schrantz et al., 1999 ; Shima et al.,
1999 ). TGF -induced cell death is reduced but not prevented by
autocrine survival signals or by NRG , although in combination these
signals allow survival of TGF -treated cells. This requirement for a
combination of survival signals may suggest a role for TGF -mediated
death during the embryonic and neonatal phase of Schwann cell
development when autocrine signals are less prominent than at later
stages (Meier et al., 1999 ). TGF 1 has also been shown to reduce
levels of NT3 mRNA expression in Schwann cells (Cai et al., 1999 ).
Because this is an important component of the autocrine survival
factors produced by Schwann cells, it may be an additional mechanism by which TGF 1 induces cell death (Meier et al., 1999 ). The resistance of Schwann cells to TGF -induced killing as the nerve matures is
paralleled by a failure to phosphorylate c-Jun in vitro.
Nevertheless, after some days in culture, presumably as they
dedifferentiate, previously resistant cells become susceptible to
TGF -induced killing, suggesting that under some circumstances, even
in mature Schwann cells, TGF could play a role in cell death,
particularly in combination with other factors such as TNF- (Skoff
et al., 1998 ).
Induction of apoptosis is often related to regulation of the
Bcl-2 family of molecules, specifically an alteration in the balance
between pro- and anti-apoptotic members of this group (Newton and
Strasser, 1998 ). Upregulation of JNK activity involved in apoptosis of
Schwann cells after serum deprivation is inhibited by Bcl-X(L)
overexpression (Cheng et al., 2001 ). We have observed a transcriptional
upregulation of the pro-apoptotic Bax mRNA by TGF 1 in Schwann cells,
and furthermore that Bax and p53 mRNAs are strongly downregulated
during development in a manner that is inversely related to
differentiation (data not shown). Regulation of such pro-apoptotic
molecules may contribute to TGF 1-induced apoptosis in Schwann cells
and the altering susceptibility of cells to apoptosis during development.
The present experiments argue that one of the functions of TGF in
peripheral nerves is to take part in negative survival regulation of
developing Schwann cells. There is evidence that NGF/p75 signaling acts
in a comparable manner, whereas positive survival signals in developing
nerves are likely to include NRG , IGF-2, NT3, PDGF-BB, and LIF (for
references, see introductory remarks). In addition to taking part in
this network of survival-regulating signals, there is good evidence
that TGF is capable of controlling Schwann cell proliferation and
differentiation without necessarily inducing cell death (Mews and
Meyer, 1993 ; Morgan et al., 1994 ; Einheber et al., 1995 ; Guenard et
al., 1995 ). This shows clearly that the effects of TGF on Schwann
cells are context dependent, a point illustrated in the present work in
the interactions between TGF and NRG and autocrine signals. It
will be some time before we are in a position to generate an integrated
picture of the involvement of TGF in Schwann cell biology.
 |
FOOTNOTES |
Received Jan. 30, 2001; revised Aug. 8, 2001; accepted Aug. 10, 2001.
This work was supported by a Wellcome Trust Program grant and a
European Community (EC) Biomed 2 collaborative research grant (CT97/2069) to K.R.J. and R.M., an EC Training and Mobility Research fellowship (CT961028) to C.M., a Wellcome Trust 4 year PhD fellowship to H.M., and a Wolfson Scholarship to H.B. We thank G. Evan and J. Ham
for gifts of antibodies and D. Bartram for editing this manuscript.
D.P. and Z.D. are joint first authors.
Correspondence should be addressed to K. R. Jessen, Department of
Anatomy and Developmental Biology, University College London, Gower
Street, London WC1E 6BT, UK. E-mail:
k.jessen{at}ucl.ac.uk.
 |
REFERENCES |
-
Albanese C,
Johnson J,
Watanabe G,
Eklund N,
Vu D,
Arnold A,
Pestell RG
(1995)
Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions.
J Biol Chem
270:23589-23597[Abstract/Free Full Text].
-
Bader AG,
Hartl M,
Bister K
(2000)
Conditional cell transformation by doxycycline-controlled expression of the ASN17 v-Jun allele.
Virology
270:98-110[Medline].
-
Bakiri L,
Lallemand D,
Bossy-Wetzel E,
Yaniv M
(2000)
Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression.
EMBO J
19:2056-2068[Web of Science][Medline].
-
Berkner KL
(1998)
Development of adenovirus vectors for the expression of heterologous genes.
Biotechniques
6:616-629.
-
Black EJ,
Catling AD,
Woodgett JR,
Kilbey A,
Gillespie DA
(1994)
Transcriptional activation by the v-Jun oncoprotein is independent of positive regulatory phosphorylation.
Oncogene
9:2363-2368[Web of Science][Medline].
-
Blanchard AD,
Sinanan A,
Parmantier E,
Zwart R,
Broos L,
Meijer D,
Meier C,
Jessen KR,
Mirsky R
(1996)
Oct-6 (SCIP/Tst-1) is expressed in Schwann cell precursors, embryonic Schwann cells, and postnatal myelinating Schwann cells: comparison with Oct-1, Krox-20 and Pax-3.
J Neurosci Res
46:630-640[Web of Science][Medline].
-
Bohmann D,
Tjian R
(1989)
Biochemical analysis of transcriptional activation by Jun: differential activity of c- and v-Jun.
Cell
59:709-717[Web of Science][Medline].
-
Bossy-Wetzel E,
Bakiri L,
Yaniv M
(1997)
Induction of apoptosis by the transcription factor c-Jun.
EMBO J
16:1695-1709[Web of Science][Medline].
-
Cai F,
Campana WM,
Tomlinson DR,
Fernyhough P
(1999)
Transforming growth factor-beta1 and glial growth factor 2 reduce neurotrophin-3 mRNA expression in cultured Schwann cells via a cAMP-dependent pathway.
Brain Res Mol Brain Res
71:256-264[Medline].
-
Cassacia-Bonnefil P,
Gu C,
Chao MV
(1999)
Neurotrophins in cell survival/death decisions.
Adv Exp Med Biol
468:275-282[Web of Science][Medline].
-
Chalaux E,
Lopez-Rovira T,
Rosa JL,
Pons G,
Boxer LM,
Bartrons R,
Ventura F
(1999)
A zinc-finger transcription factor induced by TGF-beta promotes apoptotic cell death in epithelial Mv1Lu cells.
FEBS Lett
457:478-482[Web of Science][Medline].
-
Cheng HL,
Steinway ML,
Xin X,
Feldman EL
(2001)
Insulin-like growth factor-I and Bcl-X(L) inhibit c-jun N-terminal kinase activation, rescue Schwann cells from apoptosis.
J Neurochem
76:935-943[Web of Science][Medline].
-
Cheng L,
Mudge AW
(1996)
Cultured Schwann cells constitutively express the myelin protein P0.
Neuron
16:309-319[Web of Science][Medline].
-
Chow SC,
Weis M,
Kass GEN,
Holmstroem TH,
Eriksson JE,
Orrenius S
(1995)
Involvement of multiple proteases during Fas-mediated apoptosis in T lymphocytes.
FEBS Lett
364:134-138[Medline].
-
Clark W,
Gillespie DA
(1997)
Transformation by v-Jun prevents cell cycle exit and promotes apoptosis in the absence of serum growth factors.
Cell Growth Differ
8:371-380[Abstract].
-
Cryns V,
Yuan J
(1998)
Proteases to die for.
Genes Dev
12:1551-1570[Free Full Text].
-
De Felipe C,
Hunt SP
(1994)
The differential control of c-Jun expression in regenerating sensory neurons and their associated glial cells.
J Neurosci
14:2911-2923[Abstract].
-
Derijard B,
Hibi M,
Wu IH,
Barrett T,
Su B,
Deng T,
Karin M,
Davis RJ
(1994)
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:1025-1037[Web of Science][Medline].
-
Devary Y,
Gottlieb RA,
Lau LF,
Karin M
(1991)
Rapid and preferential activation of the c-jun gene during the mammalian UV response.
Mol Cell Biol
11:2804-2811[Abstract/Free Full Text].
-
Dong Z,
Brennan A,
Liu N,
Yarden Y,
Lefkowitz G,
Mirsky R,
Jessen KR
(1995)
NDF is a neuron-glia signal and regulates survival, proliferation, and maturation of rat Schwann cell precursors.
Neuron
15:585-596[Web of Science][Medline].
-
Dong Z,
Dean C,
Walters JE,
Mirsky R,
Jessen KR
(1997)
Response of Schwann cells to mitogens in vitro is determined by pre-exposure to serum, time in vitro and developmental age.
Glia
20:219-230[Web of Science][Medline].
-
Dong Z,
Sinanan A,
Parkinson D,
Parmantier E,
Mirsky R,
Jessen KR
(1999)
Schwann cell development in embryonic mouse nerves.
J Neurosci Res
56:334-348[Web of Science][Medline].
-
Dowsing BJ,
Morrison WA,
Nicola NA,
Starkey GP,
Bucci T,
Kilpatrick TJ
(1999)
Leukemia inhibitory factor is an autocrine survival factor for Schwann cells.
J Neurochem
73:96-104[Web of Science][Medline].
-
Eilers A,
Whitfield J,
Babij C,
Rubin LL,
Ham J
(1998)
Role of the Jun kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons.
J Neurosci
18:1713-1724[Abstract/Free Full Text].
-
Einheber S,
Hannocks M-J,
Metz CN,
Rifkin DB,
Salzer JL
(1995)
Transforming growth factor-beta 1 regulates axon-Schwann cell interactions.
J Cell Biol
129:443-458[Abstract/Free Full Text].
-
Fenteany G,
Standaert RF,
Lane WS,
Choi S,
Corey EJ,
Schreiber SL
(1995)
Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin.
Science
268:726-731[Abstract/Free Full Text].
-
Frade JM,
Barde YA
(1999)
Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord.
Development
126:683-690[Abstract].
-
Frade JM,
Rodriguez-Tebar A,
Barde YA
(1996)
Induction of cell death by endogenous nerve growth factor through its p75 receptor.
Nature
383:166-168[Medline].
-
Gao M,
Morgan I,
Vogt PK
(1996)
Differential and antagonistic effects of v-Jun and c-Jun.
Cancer Res
56:4229-4235[Abstract/Free Full Text].
-
Garnier A,
Cote J,
Nadeau J,
Kamen A,
Massie B
(1994)
Scale-up of the adenovirus expression system for the production of recombinant protein in human 293S cells.
Cytotechnology
15:145-155[Medline].
-
Gavrilovic J,
Brennan A,
Mirsky R,
Jessen KR
(1995)
Fibroblast growth factors and insulin growth factors combine to promote survival of rat Schwann cell precursors without induction of DNA synthesis.
Eur J Neurosci
7:77-85[Web of Science][Medline].
-
Grinspan JB,
Marchionni MA,
Reeves M,
Coulaloglou M,
Scherer SS
(1996)
Axonal interactions regulate Schwann cell apoptosis in developing peripheral nerve: neuregulin receptors and the role of neuregulins.
J Neurosci
16:6107-6118[Abstract/Free Full Text].
-
Guenard V,
Gwynn LA,
Wood PM
(1995)
Transforming growth factor-beta blocks myelination but not ensheathment of axons by Schwann cells in vitro.
J Neurosci
15:419-428[Abstract].
-
Ham J,
Babij C,
Whitfield J,
Pfarr CM,
Lallemand D,
Yaniv M,
Rubin LL
(1995)
A c-Jun dominant negative protects sympathetic neurons against programmed cell death.
Neuron
14:927-939[Web of Science][Medline].
-
Hartl M,
Bister K
(1998)
Structure and transcriptional regulation of BKJ, a novel AP-1 target gene activated during jun- or fos-induced fibroblast transformation.
Oncogene
17:2901-2913[Web of Science][Medline].
-
Huguier S,
Baguet J,
Perez S,
van Dam H,
Castellazzi M
(1998)
Transcription factor ATF2 cooperates with v-Jun to promote growth factor-independent proliferation in vitro and tumor formation in vivo.
Mol Cell Biol
18:7020-7029[Abstract/Free Full Text].
-
Jessen KR,
Mirsky R
(1992)
Schwann cells: early lineage, regulation of proliferation and control of myelin formation.
Curr Opin Neurobiol
2:575-581[Medline].
-
Jessen KR,
Mirsky R
(1999)
Schwann cells and their precursors emerge as major regulators of nerve development.
Trends Neurosci
22:402-410[Web of Science][Medline].
-
Jessen KR,
Brennan A,
Morgan L,
Mirsky R,
Kent A,
Hashimoto Y,
Gavrilovic J
(1994)
The Schwann cell precursor and its fate: a study of cell death and differentiation during gliogenesis in rat embryonic nerves.
Neuron
12:509-527[Web of Science][Medline].
-
Kilbey A,
Black EJ,
Unlu M,
Gillespie DAF
(1996)
The v-Jun oncoprotein replaces p39 c-Jun as the predominant AP-1 constituent in ASV17-transformed fibroblasts: implications for SAPK/JNK-mediated signal transduction.
Oncogene
12:2409-2418[Medline].
-
Krieglstein K,
Richter S,
Farkas L,
Schuster N,
Dunker N,
Oppenheim RW,
Unsicker K
(2000)
Reduction of endogenous transforming growth factors beta prevents ontogenic neuron death.
Nat Neurosci
3:1085-1090[Web of Science][Medline].
-
Massague J
(2000)
How cells read TGF
signals.
Nat Rev Mol Cell Biol
1:169-178[Web of Science][Medline]. -
Massague J,
Wotton D
(2000)
Transcriptional control by the TGF
/Smad signalling system.
EMBO J
19:1745-1754[Web of Science][Medline]. -
Meier C,
Parmantier E,
Brennan A,
Mirsky R,
Jessen KR
(1999)
Developing Schwann cells acquire the ability to survive without axons by establishing an autocrine circuit involving IGF, NT-3, and PDGF-BB.
J Neurosci
19:3847-3859[Abstract/Free Full Text].
-
Mews M,
Meyer M
(1993)
Modulation of Schwann cell phenotype by TGF-beta 1: inhibition of P0 mRNA expression and downregulation of the low affinity NGF receptor.
Glia
8:208-217[Web of Science][Medline].
-
Minden A,
Lin A,
Smeal T,
Derijard B,
Cobb M,
Davis R,
Karin M
(1994)
c-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated kinases.
Mol Cell Biol
14:6683-6688[Abstract/Free Full Text].
-
Mirsky R,
Jessen KR
(1996)
Schwann cell development, differentiation and myelination.
Curr Opin Neurobiol
6:89-96[Web of Science][Medline].
-
Morgan L,
Jessen KR,
Mirsky R
(1991)
The effects of cyclic AMP on differentiation of cultured Schwann cells: progression from an early phenotype (04+) to a myelin phenotype (Po+, GFAP
, N-CAM , NGF-receptor ) depends on growth inhibition.
J Cell Biol
112:457-467[Abstract/Free Full Text]. -
Morgan L,
Jessen KR,
Mirsky R
(1994)
Negative regulation of the P0 gene in Schwann cells: suppression of P0 mRNA and protein induction in cultured Schwann cells by FGF2 and TGF
1, TGF 2 and TGF 3.
Development
120:1399-1409[Abstract]. -
Morgenstern JP,
Land H
(1990)
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res
18:3587-3596[Abstract/Free Full Text].
-
Newton K,
Strasser A
(1998)
The Bcl-2 family and cell death regulation.
Curr Opin Genet Dev
8:68-75[Web of Science][Medline].
-
Nicholson DW,
Thornberry NA
(1997)
Caspases: killer proteases.
Trends Biochem Sci
22:229-306.
-
Owens GC,
Boyd CJ
(1991)
Expressing antisense Po RNA in Schwann cells perturbs myelination.
Development
112:639-649[Abstract].
-
Raoul C,
Pettmann B,
Henderson CE
(2000)
Active killing of neurons during development and following stress: a role for p75(NTR) and Fas?
Curr Opin Neurobiol
10:111-117[Web of Science][Medline].
-
Rufer M,
Flanders K,
Unsicker K
(1994)
Presence and regulation of transforming growth factor beta mRNA and protein in the normal and lesioned rat sciatic nerve.
J Neurosci Res
39:412-423[Web of Science][Medline].
-
Scherer SS,
Salzer JL
(1996)
Axon-Schwann cell interactions during peripheral nerve degeneration and regeneration.
In: Glial cell development (Jessen KR,
Richardson WD,
eds), pp 165-196. Oxford: Bios Scientific.
-
Scherer SS,
Kamholz J,
Jakowlew SB
(1993)
Axons modulate the expression of transforming growth factor-betas in Schwann cells.
Glia
8:265-276[Web of Science][Medline].
-
Schrantz N,
Blanchard DA,
Auffredou MT,
Sharma S,
Leca G,
Vasquez A
(1999)
Role of caspases and possible involvement of retinoblastoma protein during TGFbeta-mediated apoptosis of human B lymphocytes.
Oncogene
10:3511-3519.
-
Shima Y,
Nakao K,
Nakashima T,
Kawakami A,
Nakata K,
Hamasaki K,
Kato Y,
Eguchi K,
Ishii N
(1999)
Activation of caspase-8 in transforming growth factor-beta-induced apoptosis of human hepatoma cells.
Hepatology
30:1215-1222[Web of Science][Medline].
-
Skoff AM,
Lisak RP,
Bealmar B,
Benjamins JA
(1998)
TNF-alpha and TGF-beta act synergistically to kill Schwann cells.
J Neurosci Res
53:747-756[Web of Science][Medline].
-
Slee E,
Zhu H,
Chow SC,
MacFarlane M,
Nicholson DW,
Cohen GM
(1996)
Benzyloxycarbonyl-Val-Ala-Asp (OMe) fluoromethylketone (Z-VAD.FMK) inhibits apoptosis by blocking the processing of CPP32.
Biochem J
315:21-24.
-
Smeal T,
Binetruy B,
Mercola DA,
Birrer M,
Karin M
(1991)
Oncogenic and transcriptional cooperation with Ha-Ras requires phosphorylation of c-Jun on serines 63 and 73.
Nature
354:494-496[Medline].
-
Soilu-Hanninen M,
Eckert P,
Bucci T,
Syroid D,
Bartlett PF,
Kilpatrick TJ
(1999)
Nerve growth factor signalling through p75 induces apoptosis in Schwann cells via a Bcl-2-independent pathway.
J Neurosci
19:4828-4838[Abstract/Free Full Text].
-
Stein B,
Angel P,
van Dam H,
Ponta H,
Herrlich P,
van der Eb A,
Rahmsdorf HJ
(1992)
Ultraviolet-radiation induced c-jun gene transcription: two AP-1 like binding sites mediate the response.
Photochem Photobiol
55:409-415[Web of Science][Medline].
-
Stewart HJS
(1995)
Expression of c-jun, Jun B, Jun D and cAMP response element binding protein by Schwann cells and their precursors in vivo and in vitro.
Eur J Neurosci
7:1366-1375[Medline].
-
Stewart HJS,
Curtis R,
Jessen KR,
Mirsky R
(1995a)
TGF
s and cAMP regulate GAP-43 expression in Schwann cells and reveal the association of this protein with the trans Golgi network.
Eur J Neurosci
7:1761-1772[Web of Science][Medline]. -
Stewart HJ,
Rougon G,
Dong Z,
Dean C,
Jessen KR,
Mirsky R
(1995b)
TGF-betas upregulate NCAM and L1 expression in cultured Schwann cells, suppress cyclic AMP-induced expression of O4 and galactocerebroside, and are widely expressed in cells of the Schwann cell lineage in vivo.
Glia
15:419-436[Web of Science][Medline].
-
Struhl K
(1988)
The JUN oncoprotein, a vertebrate transcription factor, activates transcription in yeast.
Nature
332:649-650[Medline].
-
Syroid DE,
Maycox PR,
Burrola PG,
Liu N,
Wen D,
Lee K-F,
Lemke G,
Kilpatrick TJ
(1996)
Cell death in the Schwann cell lineage and its regulation by neuregulin.
Proc Natl Acad Sci USA
93:9229-9234[Abstract/Free Full Text].
-
Takatsu Y,
Nakamura M,
Stapleton M,
Danos MC,
Matsumoto K,
O'Connor MB,
Shibuya H,
Ueno N
(2000)
TAK1 participates in c-Jun N-terminal kinase signalling during Drosophila development.
Mol Cell Biol
20:3015-3026[Abstract/Free Full Text].
-
Ten Dijke P,
Iwata KK,
Goddard C,
Pieler C,
Canalis E,
McCarthy TL,
Centrella M
(1990)
Recombinant transforming growth factor type beta 3: biological activities and receptor-binding properties in isolated bone cells.
Mol Cell Biol
10:4473-4479[Abstract/Free Full Text].
-
Trachtenberg JT,
Thompson WJ
(1996)
Schwann cell apoptosis at developing neuromuscular junctions is regulated by glial growth factor.
Nature
379:174-177[Medline].
-
van Dam H,
Wilhelm D,
Herr I,
Steffen A,
Herrlich P,
Angel P
(1995)
ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents.
EMBO J
14:1798-1811[Web of Science][Medline].
-
Wang W,
Zhou G,
Hu MCT,
Yao Z,
Tan TH
(1997)
Activation of the hematopoietic progenitor kinase-1 (HPK1)-dependent, stress-activated c-Jun N-terminal kinase (JNK) pathway by transforming growth factor beta (TGF-beta)-activated kinase (TAK1), a kinase mediator of TGF beta signal transduction.
J Biol Chem
272:22771-22775[Abstract/Free Full Text].
-
Watson A,
Eilers A,
Lallemand D,
Kyriakis J,
Rubin LL,
Ham J
(1998)
Phosphorylation of c-Jun is necessary for apoptosis induced by survival signal withdrawal in cerebellar granule neurons.
J Neurosci
18:751-762[Abstract/Free Full Text].
-
Wisdom R,
Johnson RS,
Moore C
(1999)
c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms.
EMBO J
18:188-197[Web of Science][Medline].
-
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME
(1995)
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
-
Zhang Y,
Feng XH,
Derynk R
(1998)
Smad3 and Smad4 cooperate with c-Jun/Fos to mediate TGF-beta-induced transcription.
Nature
394:909-913[Medline].
-
Zhu H,
Fearnhead HO,
Cohen GM
(1995)
An ICE-like protease is a common mediator of apoptosis induced by diverse stimuli in human monocytic THP.1 cells.
FEBS Lett
374:303-308[Web of Science][Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/21218572-14$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
D. B. Parkinson, A. Bhaskaran, P. Arthur-Farraj, L. A. Noon, A. Woodhoo, A. C. Lloyd, M. L. Feltri, L. Wrabetz, A. Behrens, R. Mirsky, et al.
c-Jun is a negative regulator of myelination
J. Cell Biol.,
October 17, 2008;
181(4):
625 - 637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nodari, D. Zambroni, A. Quattrini, F. A. Court, A. D'Urso, A. Recchia, V. L.J. Tybulewicz, L. Wrabetz, and M. L. Feltri
{beta}1 integrin activates Rac1 in Schwann cells to generate radial lamellae during axonal sorting and myelination
J. Cell Biol.,
July 30, 2007;
177(6):
1063 - 1075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D'Antonio, A. Droggiti, M. L. Feltri, J. Roes, L. Wrabetz, R. Mirsky, and K. R. Jessen
TGFbeta Type II Receptor Signaling Controls Schwann Cell Death and Proliferation in Developing Nerves.
J. Neurosci.,
August 15, 2006;
26(33):
8417 - 8427.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Atanasoski, S. S. Scherer, E. Sirkowski, D. Leone, A. N. Garratt, C. Birchmeier, and U. Suter
ErbB2 Signaling in Schwann Cells Is Mostly Dispensable for Maintenance of Myelinated Peripheral Nerves and Proliferation of Adult Schwann Cells after Injury
J. Neurosci.,
February 15, 2006;
26(7):
2124 - 2131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Le, R. Nagarajan, J. Y. T. Wang, T. Araki, R. E. Schmidt, and J. Milbrandt
Analysis of congenital hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann cell differentiation and myelination
PNAS,
February 15, 2005;
102(7):
2596 - 2601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Buchstaller, L. Sommer, M. Bodmer, R. Hoffmann, U. Suter, and N. Mantei
Efficient Isolation and Gene Expression Profiling of Small Numbers of Neural Crest Stem Cells and Developing Schwann Cells
J. Neurosci.,
March 10, 2004;
24(10):
2357 - 2365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Parkinson, A. Bhaskaran, A. Droggiti, S. Dickinson, M. D'Antonio, R. Mirsky, and K. R. Jessen
Krox-20 inhibits Jun-NH2-terminal kinase/c-Jun to control Schwann cell proliferation and death
J. Cell Biol.,
February 2, 2004;
164(3):
385 - 394.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|