 |
Previous Article | Next Article 
The Journal of Neuroscience, November 15, 2001, 21(22):8734-8745
Increased Seizure Susceptibility in Mice Lacking Metabotropic
Glutamate Receptor 7
Gilles
Sansig1,
Trevor
J.
Bushell2,
Vernon R. J.
Clarke2,
Andrei
Rozov3,
Nail
Burnashev3,
Chantal
Portet1,
Fabrizio
Gasparini1,
Markus
Schmutz1,
Klaus
Klebs1,
Ryuichi
Shigemoto4,
Peter J.
Flor1,
Rainer
Kuhn1,
Thomas
Knoepfel1,
Markus
Schroeder1,
David R.
Hampson5,
Valerie J.
Collett2,
Congxiao
Zhang6,
Robert M.
Duvoisin6,
Graham L.
Collingridge2, and
Herman
van der
Putten1
1 Nervous System Department, Novartis Pharma AG,
CH-4002 Basel, Switzerland, 2 Medical Research Council
Center for Synaptic Plasticity, Department of Anatomy, The School of
Medical Sciences, University of Bristol, Bristol, BS8 1TD, United
Kingdom, 3 Abteilung Zellphysiologie, Max-Planck-Institut
für Medizinische Forschung, D-69120 Heidelberg, Germany,
4 Division of Cerebral Structure, National Institute for
Physiological Sciences, Myodaiji, Okazaki 444-8585, Japan,
5 Faculty of Pharmacy and Department of Pharmacology,
University of Toronto, Ontario, Canada M5S 2S2, and
6 Margaret M. Dyson Vision Research Institute, Department
of Ophthalmology, Cornell University Medical College, New York, New
York 10021
 |
ABSTRACT |
To study the role of mGlu7 receptors (mGluR7), we used homologous
recombination to generate mice lacking this metabotropic receptor
subtype (mGluR7 / ). After the serendipitous
discovery of a sensory stimulus-evoked epileptic phenotype, we tested
two convulsant drugs, pentylenetetrazole (PTZ) and bicuculline. In
animals aged 12 weeks and older, subthreshold doses of these drugs
induced seizures in mGluR7 / , but not in
mGluR7+/ , mice. PTZ-induced seizures were
inhibited by three standard anticonvulsant drugs, but not by the group
III selective mGluR agonist
(R,S)-4-phosphonophenylglycine (PPG). Consistent with the lack of signs of epileptic activity in the absence of specific stimuli, mGluR7 / mice showed no major changes in
synaptic properties in two slice preparations. However, slightly
increased excitability was evident in hippocampal slices. In addition,
there was slower recovery from frequency facilitation in cortical
slices, suggesting a role for mGluR7 as a frequency-dependent regulator
in presynaptic terminals. Our findings suggest that mGluR7 receptors
have a unique role in regulating neuronal excitability and that these
receptors may be a novel target for the development of anticonvulsant drugs.
Key words:
epilepsy; mGluR7; knock-out; mice; group III mGluR; (R,S)-4-phosphonophenylglycine
 |
INTRODUCTION |
An imbalance in glutamatergic
excitatory neurotransmission and GABAergic synaptic inhibition in the
vertebrate CNS can cause seizures and may be a major cause of epilepsy.
There is, therefore, considerable interest in how these
neurotransmitter systems are regulated physiologically. Metabotropic
glutamate receptors (mGluRs) couple to G-proteins and can modulate
L-glutamate release, GABA release, and neuronal
excitability (Conn and Pin, 1997 ). They are subdivided into groups I
(mGluR1, mGluR5), II (mGluR2, mGluR3), and III (mGluR4, mGluR6, mGluR7,
mGluR8) on the basis of homology, intracellular messengers, and ligand
selectivity (Conn and Pin, 1997 ). mGluR7 is the most highly conserved
member, and its mGluR7a-isoform is distributed widely throughout
the CNS (Kinzie et al., 1995 ; Ohishi et al., 1995 ; Bradley et al.,
1996 ; Brandstaetter et al., 1996 ; Flor et al., 1997 ; Shigemoto et al.,
1997 ). The two isoforms of the receptor are localized presynaptically,
close to release sites (Bradley et al., 1996 ; Brandstaetter et al.,
1996 ; Shigemoto et al., 1996 ; Kinoshita et al., 1998 ).
In recombinant expression systems
L-2-amino-4-phosphonobutyrate (L-AP4),
L-serine-O-phosphate
(L-SOP), and
(R,S)-4-phosphonophenylglycine [(R,S)PPG]
activate mGluR7 and its coupling to adenylate cyclase inhibition
(Gasparini et al., 1999 ). Among the group III mGluRs, mGluR7 has the
lowest affinity for these group III mGluR selective ligands and the
endogenous ligand L-glutamate (Okamoto et al., 1994 ; Saugstad et al., 1994 ; Flor et al., 1997 ). In a variety of
preparations L-AP4 and
L-SOP reduce excitatory synaptic transmission (Koerner and Cotman, 1981 ; Davies and Watkins, 1982 ; Lanthorn et al.,
1984 ; Anson and Collins, 1987 ; Bushell et al., 1995 ; Manzoni and
Bockaert, 1995 ; Vignes et al., 1995 ; Pisani et al., 1997 ) via a
putative presynaptic mechanism (Baskys and Malenka, 1991 ; Gereau and
Conn, 1995 ) or via heterosynaptic effects on interneuron terminals
(Salt and Eaton, 1995 ; Wan and Cahusac, 1995 ; Cartmell and
Schoepp, 2000 ; Semyanov and Kullmann, 2000 ).
The notion that group III mGluRs are potential targets for novel
antiepileptic drugs is supported by results in rodent models of
epilepsy in which group III selective agonists showed prolonged anticonvulsant actions [L-AP4, L-SOP (Tizzano
et al., 1995 ; Tang et al., 1997 ); (R,S)-PPG (Chapman
et al., 1999 ; Gasparini et al., 1999 ); L-SOP (Yip
et al., 2001 )] and increased seizure threshold (L-AP4; Suzuki et al., 1999 ) or seizure latency
(Thomsen and Dalby, 1998 ). In addition, in epilepsy the changes have
been noted in the agonist sensitivity (Neugebauer et al., 2000 ),
expression (Aronica et al., 1997 ; Liu et al., 2000 ; Yip et al., 2001 ),
and receptor responses of group III mGluRs (Holmes et al., 1996 ;
Neugebauer et al., 1997 ; Dietrich et al., 1999 ; Klapstein et al.,
1999 ).
The lack of specific ligands to address mGluR7 function prompted us to
generate mice lacking these receptors. A previous study that used these
animals revealed deficits in taste aversion and fear responses (Masugi
et al., 1999 ). The present study describes a role of mGluR7 in epilepsy.
 |
MATERIALS AND METHODS |
Generation of mGluR7 / mice
A genomic fragment of the mouse mGluR7 gene was isolated from a
129SV/J FIX phage library (Stratagene, La Jolla, CA) and probed with
a human mGluR7 cDNA. A 2.055 kb NheI-NheI DNA
fragment comprising the first coding exon was sequenced. It contained
405 bp of 5'-untranslated region (UTR; as judged by homology to rat mGluR7 cDNA), followed by codons for the first 164 amino acids of mouse
mGluR7. The targeting vector was constructed by inserting a 0.6 kb
NruI-XhoI DNA fragment (comprising 115 bp of
5'-UTR) 5' of the pMCNeo cassette into a
StuI-XhoI cleaved pTV-0 vector that contains the
herpes virus thymidine kinase (TK) gene for negative selection. A 7 kb
NheI-NheI DNA fragment comprising genomic sequences downstream of the 2.055 kb NheI-NheI
fragment was inserted into a NheI site located between
pMCNeo and pMCTK in pTV-0. Proper targeting resulted in deleting 0.585 kb of the first coding exon and 0.73 kb of the next intron of the mGlu7
gene. Embryonic day 14 (E14) embryonic stem (ES) cells [129/Ola;
genotype Aw (agouti),
cch (albino), p (pink-eyed dilution)]
were transfected with 30 µg of NotI-linearized and
dideoxynucleotide-end-filled (using Klenow enzyme) targeting
vector by electroporation (250 V and 500 µF; Bio-Rad Gene Pulser,
Munich, Germany). G418 (600 µg/ml) and Ganciclovir (Gancv; 2 µM) selection were applied 24 and 48 hr later,
respectively. DNA from double-resistant ES colonies was subjected to
PCR analysis by using either one of two PCR primers matching sequences
in the NheI-NruI fragment located just 5' to,
but not contained within, the targeting vector (primer-1,
5'-cttctgccagagctgacagtcaaag-3'; primer-2,
5'-gtcagcaccaatatcgcgactcatc-3') and either one of two primers located
in the neo gene (primer-3, 5'-gcgtgcaatccatcttgttcaatgg-3'; primer-4, 5'-gcgctgacagccggaacacg-3'). Combinations of primer-1 or
primer-2 and either one of two primers matching sequences in the coding
region of the first coding exon (primer-5,
5'-gaaagtgagcgactgttcgagcg-3'; primer-6,
5'-gatgttggctaccatgatggagaccg-3') served to detect the presence of a
wild-type mGluR7 allele. Two of 112 G418rGancvr
double-resistant ES cell clones carried a correctly targeted mGluR7
allele, as assessed by PCR and confirmed by Southern blot analysis of
genomic DNA digested with NheI and NcoI,
respectively, and probed with probe A (158 bp
NheI-NruI fragment), probe B (0.6 kb
NruI-XhoI fragment), and a neo gene
probe (probe D) (Fig. 1). Southern blot
analysis that used a complete mGluR7 cDNA probe (probe D) revealed no
additional rearrangements in the locus (data not shown). Wild-type (+)
and mutant alleles ( ) are indicated by the presence of a 2 kb (+)
versus 1.8 kb ( ) NheI and a 2.5 kb (+) versus a 2.3 kb
( ) NcoI DNA fragment when probed with probe A or B (Fig.
1a,b). The diagnostic sizes for a properly targeted mGluR7
allele when probed with neo (probe D) are 1.8 kb
(NheI) and 2.3 kb (NcoI). Both ES clones were
used successfully to produce germ line chimeras (11 for each clone) by
aggregation for 2-3 hr with 106 ES cells
per milliliter.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 1.
Targeted disruption of the mouse mGluR7 gene and
its molecular analysis. a, Scheme of mGluR7 genomic DNA,
targeting vector, disrupted gene, probes (stippled
bars), and PCR primers (arrows).
Neo, Neomycin resistance gene; TK, herpes
virus thymidine kinase gene; Nh, NheI;
Nc, NcoI; Nr,
NruI; X, XhoI.
b, Southern blot analysis. Shown is the result of a
representative litter of F2 mice obtained by crossing a pair of
mGluR7+/ F1 mice. DNA was NheI
digested. Probe A was used (as shown in a). Wild-type
and mutant alleles are represented by DNA fragments of 2.055 and 1.885 kb, respectively. c, PCR genotyping. Example of a
typical PCR result with the use of tail DNA of
mGluR7+/+, mGluR7+/ , and
mGluR7 / mice. Primer pairs 1 + 3 yield a 1.1 kb
product (mutant allele). Primers 7 + 8 yield a 0.7 kb DNA fragment
(wild-type allele). d, Northern blot analysis. Total RNA
was isolated from mGluR7+/+,
mGluR7+/ , and mGluR7 /
brains. cDNA probes were APP, mGluR7, mGluR4, and mGluR8. e,
f, RT-PCR. mGluR7b-specific RT-PCR products of expected sizes
2.7 kb (primers 11 + 10) and 0.092 kb (primers 9 + 10) were detected
readily with mGluR7+/+, but not with
mGluR7 / , brain RNA as a template.
|
|
Genotyping
F1 mice carrying a targeted mGluR7 allele were identified by
Southern blot analysis (Fig. 1b). F2 mice, derived from
matings of pairs of heterozygous parents, were screened by PCR and used pairs of one of three different forward primers
(5'-cttctgccagagctgacagtcaaag-3' or 5'-gtcagcaccaatatcgcgactcatc-3' or
5'-acagtcaaagatcagactcaggggc-3' or 5'-ctccccataagtcagcaccaatatc-3') and
one of two Neo-specific primers (primer-3 or primer-4) (Fig.
1a) to detect the targeted allele. A combination of primer-7
(5'-gagagatggatagcaagcaagggag-3') and primer-8
(5'-gtgtccctggaacaagtgtccag-3') served to detect the endogenous mGluR7
allele in mGluR7+/+ and
mGluR7+/ mice and to confirm its absence
in mGluR7 / mice. mGluR4 mutant mice
were genotyped as described previously (Pekhletski et al., 1996 ).
mGluR8 (Duvoisin et al., 1995 ) mutant mice (R. Duvoisin and C. Zhang,
unpublished results) were genotyped by PCR (hot-start PCR, TaqStart
antibody; Promega, Madison, WI) according to the manufacturer's
instructions. Annealing was 45 sec at 68°C; primer extension was at
74°C for 45 sec for 34 cycles. One combination of two primers
(taactaccaggtggacgaactctc; cacaaaggtggtggcaatgattcc) was used to
diagnose the endogenous mGluR8 allele in
mGluR8+/+ and
mGluR8+/ mice and to confirm its absence
in mGluR8 / mice. Another primer
(taatatgcgaagtggacctgggac) combined with the first one shown above
served to detect the targeted allele.
DNA and RNA analysis
Southern and Northern blot analyses, sequencing, PCR, and RT-PCR
were performed according to standard protocols. For Northern blot
analysis the following probes were used: a 3 kb EcoRI
fragment of mouse amyloid precursor protein (APP) cDNA, a 3 kb
HindIII fragment of human mGluR7b cDNA, a 0.57 kb
PstI human mGluR4 cDNA fragment (encoding amino acids
520-710), and a 1.150 kb rat mGluR8 cDNA probe (encoding amino acids
1-350 of mGluR8). Hybridization with APP cDNA served as a control for
loading equivalent amounts of total brain RNA in each lane. RT-PCR of
mGluR7+/+ and
mGluR7 / brain RNA was performed with
several pairs of oligonucleotide primers, including primer-1 and
primer-4, primer-1 and primer-10, primer-11 and primer-10, and primer-9
and primer-10. Primer-9 and primer-10 were designed specifically to
detect sequences comprising exon b (92 bp) encoding one of two (a and
b) C-terminal splice variants of mGluR7 (Flor et al., 1997 ).
Western blot and immunocytochemical analysis
Immunoblot procedures and immunocytochemistry were as described
previously (Shigemoto et al., 1996 , 1997 ; Kinoshita et al., 1998 ).
Briefly, for Western blot analysis the crude membrane preparations from
mouse cerebellum, hippocampus, and combined brain regions other than
the cerebellum and hippocampus were separated by 7% SDS-PAGE and
transferred to polyvinylidene difluoride membranes. The membranes were
reacted with an affinity-purified antibody for mGluR7a (Shigemoto et
al., 1996 ). For detection, an alkaline phosphatase-labeled anti-rabbit
secondary antibody (Chemicon, Temecula, CA) was used. For
immunocytochemistry, wild-type and mGluR7 / mice were anesthetized deeply
and perfused transcardially with 3.5% paraformaldehyde, 1% picric
acid, and 0.05% glutaraldehyde in 0.1 M phosphate buffer
(PB), pH 7.3. The brains were removed, cryoprotected (30% sucrose in
0.1 M PB overnight at 4°C), and cut on a freezing
microtome. The 40-µm-thick sections were incubated with antibodies
for mGluR7a, mGluR7b, mGluR4a, or mGluR8a (Shigemoto et al., 1997 ;
Kinoshita et al., 1998 ) in PBS containing 2% normal goat serum and
0.1% Triton X-100 overnight at 15°C. After washes in PBS the
sections were incubated with biotinylated goat anti-rabbit or goat
anti-guinea pig IgG (Vector Laboratories, Burlingame, CA). Then the
sections were washed again, reacted with the ABC kit (Vector
Laboratories), and finally incubated with 0.05% diaminobenzidine and
0.0006% hydrogen peroxide.
Chromosomal mapping of the mGluR7 gene
A 129 mouse bacterial artificial chromosome (BAC) was identified
and isolated by the PCR screening of a genomic 129SV DNA bank in
pBeloBAC11 (Research Genetics, Huntsville, AL). The PCR primers were 7 and 8 (Fig. 1). These amplified specifically the first coding exon of
the mGluR7 gene, as confirmed by sequencing. Southern blot analysis was
performed with a mGluR7 cDNA probe to confirm the presence of
unrearranged and diagnostic mGluR7 genomic DNA fragments. For
fluorescent in situ hybridization (FISH), BAC DNA was
labeled with digoxigenin-dUTP by nick translation and hybridized to
normal metaphase chromosomes derived from mouse embryo fibroblasts.
These analyses were performed at Genome Systems (St. Louis, MO).
Electrophysiology
Hippocampus. The 400-µm-thick slices were prepared
from 5- to 29-week-old mutant mice and littermate wild types via
standard procedures, as described previously (Conquet et al., 1994 ).
Slices were submerged in a medium that comprised (in mM)
124 NaCl, 3 KCl, 26 NaHCO3, 1.4 NaH2PO4, 1 MgSO4, 2 CaCl2, and 10 D-glucose (bubbled with 95% O2/5%
CO2, pH 7.4); the medium was perfused at a rate
of ~4 ml/min (29-31°C). Extracellular recordings were obtained
from stratum radiatum or stratum pyramidale of area CA1 in response to
low-frequency (0.033 Hz) stimulation of the Schaffer collateral-commissural pathway. For each protocol one slice was used
per animal; hence n values give the number of slices per mice used. Results were analyzed via Student's t tests or
ANOVA, with p < 0.05 taken to indicate
statistical significance. Animals were genotyped by PCR and presented
to the experimenter in a randomized and blind manner.
Neocortex. Brain slice preparation and visualization of
neurons in the living slice are described previously (Stuart et al., 1993 ; Markram et al., 1997 ). During recordings the slices were maintained at room temperature (20-24°C) in extracellular solution consisting of (in mM) 125 NaCl, 2.5 KCl, 25 glucose, 25 NaHCO3, 1.25 NaH2PO4, 2 CaCl2, and 1 MgCl2, pH 7.2. Whole-cell voltage recordings were performed simultaneously from two
neurons with pipettes filled with (in mM) 115 K-gluconate,
20 KCl, 4 ATP-Mg, 10 phosphocreatine, 0.3 GTP, and 10 HEPES, pH 7.3 (310 mOsm). In synaptically connected neurons a suprathreshold
intracellular stimulation of presynaptic pyramidal cells evoked
depolarizing EPSPs. Presynaptic pyramidal cells were stimulated with a
10 Hz train of two to three suprathreshold current pulses. Typically, the trains were delivered at intervals of 5-7 sec for
mGluR7+/+ mice and at 30 sec for
mGluR7 / mice so that recovery from
short-term modification was complete, as evidenced by the lack of
systematic changes in the amplitude of the first EPSP of a train during
successive trains of stimuli. For recovery from facilitation
measurements, two action potentials delayed at variable time intervals
( t) were delivered every 30 sec in both
mGluR7+/+ and
mGluR7 / mice. Voltage traces that are
shown are averages of 50-100 sweeps. The amplitude of the first EPSP
of the train is defined as the difference between the peak of the EPSP
and baseline. For the second (or third) EPSP the amplitude is the
difference between the peak of the EPSP and the baseline measured just
before the onset of the EPSP. Stimulus delivery, data acquisition, and
analyses were performed with macros in IGOR (Wavemetrics, Lake Oswego, OR).
Drug administration
Pentylenetetrazole (PTZ; Metrazol, Knoll AG, Liestal,
Switzerland) was given intraperitoneally at a subthreshold dose of 40 mg/kg or at a suprathreshold dose of either 60 (in mGluR4 wild types
and mutants) or 70 mg/kg (in mGluR7 and mGluR8 wild types and mutants).
A dose of 40 mg/kg PTZ induced clonic or clonic-tonic seizures in
mGluR7 / mice only, whereas it failed
to induce seizures that were visible behaviorally in
mGluR4+/+,
mGluR4+/ ,
mGluR4 / ,
mGluR7+/+,
mGluR7+/ ,
mGluR8+/+,
mGluR8+/ , or
mGluR8 / mice. A PTZ dose of 70 mg/kg
induced clonic seizures of ~5 sec duration in at least 90% of all of
the mGluR mutant and wild-type mice. Anticonvulsant drugs were given 1 hr before PTZ. Doses used in mGluR7+/+,
mGluR7+/ , and
mGluR7 / mice treated with 40 mg/kg PTZ
were as follows: valproate (VPA; Depakine, Sanofi, Paris, France) (500 mg/kg, p.o.), ethosuximide (ESM; Galenica, Berne, Switzerland) (500 mg/kg, p.o.), clonazepam (CZP; Rivotril, Roche, Gipf-Oberfrick,
Switzerland) (0.1 mg/kg, p.o.). In the experiment in which mGluR7
mutant mice were given 70 mg/kg PTZ (see Fig. 4, black
bars), at 1 hr before PTZ the mice received placebo (water, p.o.),
500 mg/kg VPA, 750 mg/kg ESM, or 1 mg/kg CZP. In this experiment the
dosing of ESM and CZP was increased to assure maximum chances of
success for counteracting the seizures in
mGluR7 / mice. Note that a dose of 70 mg/kg PTZ is far above threshold in
mGluR7 / mice. Bicuculline (Sigma, St.
Louis, MO) was given subcutaneously at 2.5 mg/kg
(mGluR7+/ and
mGluR7 / mice) or 3.5 mg/kg [Maus
Auszucht Geigy (MAG) mice]. (R,S)-4-phosphonophenylglycine (PPG; Tocris, Bristol, UK) was dissolved in 0.9% NaCl, pH-adjusted to
6-7, and injected intracerebroventricularly into the mice under light
Fluothane anesthesia. Injection volume was 2.5 µl/mouse. Intracerebroventricular administration of PPG in 0.9% NaCl or placebo
(0.9% NaCl) occurred 15 min before PTZ was given. Doses required to
evoke seizures in 80% of anesthetized (and 0.9% NaCl placebo
injected intracerebroventricularly) wild-type (OF-1, MAG, 129Ola×C57BL/6) or heterozygous mGluR4, mGluR7, or mGluR8 mutant mice
with different and mixed genetic backgrounds including 129Sv/J×CD-1 (mGluR4), 129Ola×C57BL/6 or 129Ola×BALB/c (mGluR7), and
129Sv/J×C57BL/6 (mGluR8) were 60 mg/kg (for 129×CD-1) and 70 mg/kg
(for all others). Concentrations and application modes are indicated in
the text and legends. All whole animal experiments were approved and
conducted according to the Swiss legislation and guidelines on animal experimentation.
Seizure scoring
Mice were considered protected from seizures and scored as such
when neither clonic nor clonic-tonic seizures were observed within the
first 10 min after PTZ treatment and within 30 min after bicuculline
treatment. After PTZ or bicuculline treatment, clonic convulsions
(myoclonic jerks, forelimb clonus) of ~5 sec duration and
clonic-tonic (hindlimb extension) convulsions were scored by using
behavioral monitoring, as described previously (Schmutz et al.,
1990 ).
EEG recordings
Stainless steel screw electrodes were implanted bilaterally over
the frontal and parietal cortex under
isoflurane/O2/N2O (0.5 l/min) anesthesia. An indifferent electrode served as ground electrode and was positioned at bregma F1.6/l2.5. All screw electrodes were connected by insulated stainless steel wiring to a four-pole socket embedded in dental cement. The electroencephalogram (EEG) that was
analyzed was the differential between the frontal (bregma F 1.0/l3.2) and parietal (F 3.0/l3.2) electrodes of the same hemisphere compared with the combined reference electrodes. Bipolar leads from the mice were recorded via cables connected to a slipstring system, at the earliest 21 d after the operation. The behavior of
the animals, which were housed singly in wooden observation cages
measuring 32 × 32 × 40 cm, was observed over a closed
circuit TV system. The EEGs were amplified by an isolated four-channel bipolar EEG amplifier (Spectralab EEG-2104, Kilchberg, Switzerland), recorded on a thermorecorder (MTK95, Astromed), and collected on a
personal computer.
 |
RESULTS |
Generation of mGluR7 / mice
mGluR7 / mice were generated by
homologous recombination (Fig. 1a). They completely lacked
mGluR7 mRNA (Fig. 1d-f) in agreement with previously
shown in situ hybridization results (Masugi et al., 1999 ).
mGluR7a (Fig. 2a-c) and
mGluR7b proteins (data not shown) were absent in
mGluR7 / mice. Brain mRNA expression
levels for other group III mGluRs (mGluR4 and mGluR8) were unchanged
(Fig. 1d). Gross histological abnormalities in brains of
mice aged 12 weeks were not apparent, neither in standard hematoxylin
and eosin-stained sections nor after immunohistology. The latter
analysis included antibodies specific for the group III mGluRs mGluR4a
and mGluR8a, respectively, as well as antibodies directed against other
mGluR subtypes (Shigemoto et al., 1997 ) (data not shown).

View larger version (103K):
[in this window]
[in a new window]
|
Figure 2.
Lack of mGluR7 protein in
mGluR7 / mice. a-d,
Immunocytochemical analysis comparing reactivity of the
mGluR7a-specific antibody in a brain section of a
mGluR7+/+ mouse (a and hippocampus
shown enlarged in c) and lack of reactivity in
mGluR7 / mouse brain (b and
hippocampus shown enlarged in d). Scale bars: 2 mm
(white horizontal line in a, b) and 400 µm (black horizontal line in c, d),
respectively. e, Immunoblot that uses a polyclonal
rabbit mGluR7a-specific antibody (Shigemoto et al., 1996 , 1997 ;
Kinoshita et al., 1998 ) of homogenates of mGluR7+/+
(wt) and mGluR7 /
(ko) brain regions, including cerebellum [lanes
1, 4; serving also as a negative control because this brain
region contains undetectable levels of mGluR7a (Kinoshita et al.,
1998 )], hippocampus (lanes 2, 5), and the other
combined brain regions without hippocampus and cerebellum (lanes
3, 6). The arrow indicates the position
in the gel of the bulk of mGluR7a protein. f,
Localization of the mouse mGluR7 gene to chromosome 6E1 by fluorescent
in situ hybridization (FISH). White
arrows indicate the position of the fluorescent signal on
chromosome 6.
|
|
Previous observations in 6- to 8-week-old animals from our colony also
had not revealed any histological abnormalities (Masugi et al., 1999 ).
Aging and health status of mGluR7 /
mice did not differ from mGluR7+/
littermates, except for a slight reduction in body weight
(mGluR7 / , 25 ± 4 gm,
n = 10 vs mGluR7+/ ,
31 ± 3 gm, n = 9; age 4 months) and poor
fecundity. There was no major morbidity except for seizures in mice
aged from 10 to 12 weeks and abnormal fear and conditioned taste
aversion responses in mice aged 6-8 weeks (Masugi et al., 1999 ).
An epilepsy-prone phenotype of
mGluR7 / mice
Spontaneous seizures were precipitated repeatedly in standard
pathogen-free (SPF) mGluR7 / mice. The
seizures were observed in mice aged from 10 weeks to 9 months (oldest
age that was examined), but not in 6- to 8-week-old mGluR7 / mice. They were never observed
in mGluR7+/+ or
mGluR7+/ littermates, but an observer
(unaware of the genotype) was able to detect the phenotype in 17 of 20 mGluR7 / mice.
These sensory stimulus-evoked seizure episodes occurred after cage
transfer. The seizures were clonic (myoclonic jerks, forelimb clonus)
and sometimes tonic in nature. A lag phase of 3 d generally was
required before mGluR7 / mice showed
renewed susceptibility to the same type of stimulus. Whatever its
chemical nature (so far unresolved), it derived from the bedding
material and, most likely, was olfactory in nature (data not shown).
Its further characterization proved difficult because of the
variability that was seen in seizure frequency with different batches
of bedding material. Interestingly, a series of other visual,
vestibular, and olfactory sensory stimuli that were tested failed to
identify another stimulus that was evoking seizures (data not shown).
In contrast, two chemical convulsants reproducibly evoked seizures in
mGluR7 / mice at doses that were
significantly below threshold for
mGluR7+/ and
mGluR7+/+ mice (see below).
The epilepsy-prone phenotypes appeared in
mGluR7 / mice derived from two
independently targeted ES cell clones and in mutants with different
genetic backgrounds [in 129Ola×C57BL/6 hybrid mice and in mice
back-crossed for several generations on either C57BL/6 (F3-F14) or
BALB/c (F6)].
The mouse mGluR7 gene was localized to chromosome 6E1 (Fig.
2f), and 70 kb of 129Ola mouse genomic DNA was
sequenced around the disrupted mGluR7 exon (S. D. McDonald, S. Goff, H. van der Putten, unpublished results). Neither procedure
provided links to genes (other than the mGluR7 gene) known for
predisposing to epilepsy (Allen and Walsh, 1996 ; McNamara and Puranam,
1998 ; Bate and Gardiner, 1999 ; Frankel, 1999 ), strongly suggesting that
it is the homozygous mutant mGluR7 genotype that determines the
epilepsy-prone phenotype in these mice.
mGluR7 / mice have a lower seizure threshold
for convulsants
The initial discovery of sensory stimulus-evoked seizures was not
suitable as an experimental paradigm for further studies, first because
of the unresolved chemical nature of the stimulus and second because of
the great degree of variability in seizure incidence of
mGluR7 / mice housed in different
environments. Nevertheless, our initial findings in SPF-housed
mGluR7 / mice suggested a significantly
reduced threshold for seizures in these mice. Our failure to identify
another defined sensory stimulus that could provoke seizures
reproducibly in mGluR7 / mice prompted
us to test subconvulsant doses of two drugs, pentylenetetrazole (PTZ)
and bicuculline.
When administered intraperitoneally at a dose of 40 mg/kg, PTZ is
generally subthreshold for inducing clonic seizures in control animals.
In mice 12 weeks and older, it induced seizures in 1 of 40 mGluR7+/+ and in 4 of 49 mGluR7+/ mice. In contrast, it evoked
seizures in the majority of mGluR7 /
littermate mice (43 of 58; 74%) (Fig.
3a). Note that all of these mice were aged 10 weeks or older
before testing to assure development of the epilepsy-prone phenotype in
mGluR7 / mice. The PTZ-evoked seizures
in mGluR7 / mice were frequently both
clonic and tonic in nature and were followed by death (>50% of the
mice). For comparison, in mGluR7+/+ and
mGluR7+/ mice, 70 mg/kg PTZ was required
to produce seizures that consistently were generally only clonic in
nature.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 3.
Increased PTZ susceptibility of
mGluR7 / mice to convulsant drugs.
a, Age-dependent development of a seizure-prone
phenotype in mGluR7 / mice (129Ola×C57BL/6 and
129Ola×BALB/c mixed strain backgrounds). Groups of 8-10
mGluR7+/+, mGluR7+/ , and
mGluR7 / mice aged 6, 10, and older than 12 weeks
(this last group included a group of nine mGluR7+/
and nine mGluR7 / mice aged 36 weeks) were given
PTZ (40 mg/kg, i.p.). Seizures (tonic in mGluR7+/+
and mGluR7+/ mice, and either tonic or
tonic-clonic in mGluR7 / mice) were scored
behaviorally. Animals were considered protected from the convulsant
effect of PTZ when neither clonic nor clonic-tonic convulsions were
observed within the first 10 min after PTZ (Schmutz et al., 1990 ). The
numbers above the bars correspond to the
number of mice tested in an age group. The group aged >12 weeks
included groups of mGluR7+/+,
mGluR7+/ , and mGluR7 / mice
aged 12-14, 14-18, and 22-24 weeks, respectively. It also included
one group aged 36 weeks, of nine mGluR7+/ and nine
mGluR7 / mice, but no
mGluR7+/+ mice. Of these mice, one of nine
mGluR7+/ and eight of nine
mGluR7 / showed seizures. Confidence limits in
the groups of >12 weeks were ±10% for the
mGluR7+/ groups and ±15% for the
mGluR7 / groups. b, Electrographic seizures in
mGluR7 / mice. EEGs recorded for 1 week and for
24 hr continuously in freely moving mGluR7 / and
mGluR7+/ mice (each group n = 4, aged 16-20 weeks) revealed no spontaneous epileptiform activity
(data not shown). After the 1 week of recording the same mice were
given 40 mg/kg PTZ, and the seizures were recorded by behavior as well
as by electroencephalography. For each genotype group two
representative EEG recordings from two different individuals are shown,
starting at 210 sec after PTZ injection. The top two
traces are from two different mGluR7 /
mice; the bottom two traces are from two different
mGluR7+/ mice. The first
mGluR7 / mouse (top trace) had
tonic-clonic seizures; the second mGluR7 / mouse
(second trace from top) had clonic
seizures manifested behaviorally as body jerks
(arrowheads in EEG). None of the
mGluR7+/ mice (bottom two traces)
showed epileptiform activity. Time scale is shown in seconds, and
amplitude is in microvolts. c, Increased susceptibility
to seizures for the GABAA receptor antagonist bicuculline,
as shown by comparing two groups of 10 mGluR7+/
and mGluR7 / mice (aged 14-16 weeks) that were
given 2.5 mg/kg bicuculline. Seizures were scored behaviorally. Plotted
is the time in minutes for individual animals to develop clonic
seizures. Observation time was 30 min after drug application, and mice
plotted at this value were without seizures.
|
|
In mice aged 6 weeks the PTZ (40 mg/kg) failed to evoke seizures in a
statistically significant manner (Kruskal-Wallis one-way ANOVA on
ranks, p = 0.407). In only 1 of 10 mGluR7 / mice were the seizures
observed. When this mouse was eliminated from the group and the others
were retested (40 mg/kg PTZ) at age 10 weeks, six of nine
mGluR7 / mice showed clonic seizures.
In parallel and at both ages only one mouse of two groups of
n = 10 mGluR7+/+ mice
(MAG; parental strains, NIH and Maus Inzucht Geigy) and no mGluR7+/ mice showed seizures
(p = 0.003, Kruskal-Wallis one-way ANOVA on
ranks revealed a significant difference among the genotypes; p = 0.023, Mann-Whitney rank-sum test for +/ vs
/ ).
Five different groups (n = 9-10 per group and
genotype) of mGluR7 / ,
mGluR7+/+, and
mGluR7+/ mice were tested at ages 12-36
weeks, and the overall results are shown (Fig. 3a). One of
40 (2.5%) mGluR7+/+ and 4 of 49 (8%)
mGluR7+/ mice showed seizures (clonic
only). In contrast, 37 of 49 (75%) mGluR7 / mice showed clonic seizures
that often (in >60% of these mice) progressed to tonic seizures.
Often, mGluR7 / mice with tonic
seizures died. Statistical significance for the results in the groups
aged >12 weeks is given by pairwise comparison of the genotype groups
with the Mann-Whitney rank-sum test (p = < 0.001 for the +/+ vs / and the +/ vs / groups;
p > 0.05 and no statistical significance when
comparing +/+ and +/ groups). At age 36 weeks, differences in PTZ
sensitivity remained statistically significant
(p = 0.002, Mann-Whitney rank-sum test;
comparison of a single group of nine
mGluR7+/ and nine
mGluR7 / mice).
Spontaneous epileptiform activity was not detected during 1 week of
continuous (24 hr/d) EEG recordings by using bilaterally implanted
frontal and parietal electrodes in
mGluR7+/ (n = 4) and
mGluR7 / (n = 4) mice.
A subsequent injection of PTZ (40 mg/kg, i.p.) rapidly triggered
epileptiform discharges and seizure manifestations that were specific
to the mGluR7 / mice. The same dose of
PTZ injected into the mGluR7+/ mice
triggered no detectable discharges (Fig. 3b), indicating a
significantly reduced threshold for PTZ-induced discharges and seizures
in the mGluR7 / mice.
Susceptibility to seizures also was increased for the competitive
GABAA receptor antagonist bicuculline. Two groups
of 10 mGluR7+/ and
mGluR7 / mice (aged 14-16 weeks) were
given 2.5 mg/kg bicuculline subcutaneously and were observed for 30 min. The latency to first seizure was plotted (Fig. 3c) for
individual animals showing clonic seizures. Mice plotted at the 30 min
value were without seizures. The median (horizontal bar in
bold) for each group was 4 min
(mGluR7 / , 25% at 4 min and 75% at 5 min) versus 26 min (mGluR7+/ , 25% at 8 min and 75% at 30 min), respectively (Mann-Whitney rank-sum test,
p = 0.003). For reference, nine of nine
mGluR7+/+ MAG mice treated with the same
lot, and for MAG mice a standard suprathreshold dose of 3.5 mg/kg
bicuculline, showed clonic seizures with a mean onset time of 3.2 min
(data not shown).
Effects of standard anticonvulsant drugs
Three widely used mechanistically different antiepileptic drugs
(White, 1997 ), ethosuximide (ESM), clonazepam (CZP), and valproate (VPA), were tested in mGluR7 / mice for
protection from PTZ-evoked seizures (Fig.
4).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 4.
The actions of three standard anticonvulsants are
unimpaired in mGluR7 / mice. a, b,
Plotted is the percentage of mice with seizures, scored behaviorally,
for a period of 10 min in response to PTZ (40 or 70 mg/kg) given
intraperitoneally. The number above each
bar indicates the group size. The gray
bars represent groups of mice given 40 mg/kg PTZ that were
pretreated 1 hr before PTZ with either placebo (Methocel in two groups
of n = 10 per genotype and as reference for ESM and
CZP; water was the placebo in one group of n = 10 per genotype and compared with VPA) or anticonvulsant (0.1 mg/kg CZP,
p.o.; 500 mg/kg ESM, p.o.; or 500 mg/kg VPA, p.o.). The black
bars in a and b represent groups
of 10 mice per genotype that had received PTZ (70 mg/kg, i.p). At 1 hr
before PTZ all of the mice in a group had received the placebo (water,
p.o.), CZP (1 mg/kg, p.o.), ESM (750 mg/kg, p.o.), or ESM (500 mg/kg).
Unlike in mGluR7 / mice
(b), the 40 mg/kg PTZ dose is below threshold for
inducing seizures in mGluR7+/
(a) and wild types (mGluR7+/+
mice; data not shown). Therefore, mGluR7+/ mice
displayed no seizures, regardless of pretreatment with placebo or
anticonvulsant. In contrast, 70% of all mGluR7 /
mice showed clonic or clonic-tonic seizures when given placebo
(b). The injection of 70 mg/kg PTZ evoked
seizures (clonic in mGluR7+/ and
mGluR7+/+ mice; clonic or clonic-tonic in
mGluR7 / mice) in at least 90% of all
placebo-treated mice, regardless of their mGluR7 genotype. CZP, ESM,
and VPA fully protected from PTZ-induced clonic seizures in
mGluR7+/ (black bars in
a) and mGluR7+/+ mice (data not
shown) as well as from PTZ-induced clonic or clonic-tonic seizures in
mGluR7 / mice.
|
|
First (Fig. 4a,b, gray bars), three groups of 10 mGluR7+/ and 10 mGluR7 / mice (all aged 14-20 weeks)
received pretreatment (1 hr before 40 mg/kg PTZ, i.p.) with an
antiepileptic drug (CZP, 0.1 mg/kg, p.o.; ESM, 500 mg/kg, p.o.; VPA,
500 mg/kg, p.o.). In parallel, another group of 10 mGluR7+/ and 10 mGluR7 / mice and, in addition, 10 mGluR7+/+ wild-type (MAG) mice received a
placebo (Methocel as reference for ESM and CZP; water compared with
VPA). At 1 hr after placebo or anticonvulsant drug treatment all of the
mice were given PTZ (40 mg/kg, i.p.). PTZ induced seizures in 60-90%
of each of the placebo-treated mGluR7 /
groups (n = 3 × 10), but not in any of the
placebo-treated mGluR7+/
(n = 3 × 10) or
mGluR7+/+ (MAG; n = 3 × 10) mice. ESM, CZP, and VPA protected 100% of the mGluR7 / mice (n = 10 per group and compound) from PTZ-induced seizures (statistical
significance for each drug-treated versus placebo group is given by
p < 0.05, Mann-Whitney rank-sum test).
All three anticonvulsant drugs also provided protection in
mGluR7 / mice when challenged with 70 mg/kg PTZ (Fig. 4a,b, black bars), a dose that
evoked clonic seizures in at least 90% all
mGluR7+/ (Fig. 4b) and
mGluR7+/+ mice (data not shown). In this
experiment we increased the dose of ESM (to 750 instead of 500 mg/kg)
and CZP (to 1 mg/kg instead of 0.1 mg/kg). VPA dosing (500 mg/kg) was
not increased, because this can cause lethality in mice. Given that all
three anticonvulsants protected
mGluR7 / mice from either 40 or 70 mg/kg PTZ-induced seizures, we conclude that mGluR7 receptors do not
contribute significantly to mechanisms underlying the action of these antiepileptics.
Anticonvulsant effects of PPG are diminished greatly in
mGluR7 / mice
The group III mGluR selective agonist PPG has shown potent and
sustained anticonvulsant actions in several rodent models of epilepsy
(Chapman et al., 1999 ; Gasparini et al., 1999 ). Therefore, we compared
its anticonvulsant action against PTZ-evoked seizures in
mGluR7 / mice and two other mGluR group
III mutant mice, the mGluR4 / and
mGluR8 / mutants. All of the mice used
in these experiments were aged from 12 to 20 weeks before testing to
allow for development of the seizure-prone phenotype in the
mGluR7 / mice. Also, we tested
different doses of PTZ to determine, in each of the strain backgrounds
of the different mutants, a dose that evoked clonic convulsions in 80%
or more of the mice under the experimental conditions that were used,
i.e., light Fluothane anesthesia, intracerebroventricular injection of
placebo (0.9% NaCl), followed 15 min later by
intraperitoneal injection of PTZ. Determining these experimental
conditions was necessary because PPG is not active when given
systemically (Gasparini et al., 1999 ), and, when given
intracerebroventricularly, it requires brief anesthesia that increases
PTZ thresholds (data not shown). In addition, PTZ thresholds depend on
multiple chromosomal loci that differ between mouse strains (Kosobud et
al., 1992 ; Ferraro et al., 1999 ), and mGluR4 / ,
mGluR7 / , and
mGluR8 / mutant mice have mixed and
different genetic contributions from a number of strains. Accordingly,
the PTZ doses required under our experimental conditions were 60 mg/kg
in mGluR4 mutants (129Sv/J×CD1) and 70 mg/kg in mGluR7
[129Ola×C57BL/6 and (129Ola×C57BL/6)×BALB/c] and mGluR8
[(129×C57BL/6)×C57BL/6] mutants.
Next, dose responses for PPG (see Gasparini et al., 1999 ) (data not
shown) in the different heterozygous mGluR mutant mice revealed that
634 nmol intracerebroventricularly (2.2 mg/kg) could protect 70% of
the different heterozygous mutant mice from seizures induced by PTZ.
This protective effect of PPG was reduced dramatically in
mGluR7 / , but not in
mGluR4 / and
mGluR8 / , mice (Fig.
5). The loss of the anticonvulsant
activity of PPG in mGluR7 / mice
treated with 70 mg/kg PTZ was specific to PPG because CZP, ESM, and VPA
provided complete protection in both
mGluR7+/ and
mGluR7 / mice challenged with this dose
of PTZ (Fig. 4a,b; 70 mg/kg PTZ dose results are represented
by black bars in the histograms).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 5.
Greatly reduced anticonvulsant action of PPG in
mGluR7 / mice. Shown are the protective effects
of 634 nmol of PPG intracerebroventricularly (black
bars) versus 0.9% NaCl (gray bars) in
mGluR7+/+ mice (+/+) and the different
mGluR+/ and mGluR / mutant
mice as indicated by the numbers 4, 7,
and 8 on the horizontal axis (all mice aged 12 weeks).
PPG was given intracerebroventricularly 15 min before the
intraperitoneal injection of PTZ [60 mg/kg in mGluR4 mutants; 70 mg/kg
in all wild types (+/+) and other mGluR mutants].
Seizures were scored behaviorally for a period of 10 min (Schmutz et
al., 1990 ). The numbers above the bars
indicate the number of mice per group. The protective effects of PPG
versus NaCl were 78% (22 of 28) versus 6% (1 of 17) in mice with one
mutant mGluR7 allele and 26% (6 of 23) versus 0% (0 of 20) in mice
with two mutant mGluR7 alleles. Unlike a comparison of the protective
effect of PPG between mGluR7+/ and
mGluR7 / mice, there were no statistically
significant differences in the protective action of PPG when
mGluR4+/ , mGluR4 / ,
mGluR8+/ , and mGluR8 /
groups were compared (all p > 0.05). Confidence
limits for the groups n > 10 were ±10%. For PPG
versus NaCl comparisons in all groups, p values were
<0.001 (Kruskal-Wallis one-way ANOVA on ranks, Dunn's test). Other
values were mGluR7 / versus
mGluR7+/+ (wild type), p = 0.004; mGluR7 / versus
mGluR4 / , p < 0.001;
mGluR7 / versus mGluR8 / ,
p = 0.014 (Mann-Whitney rank-sum tests).
|
|
Altered excitability in hippocampal slices
Because of similarities between seizures observed in
mGluR7 / mice and those known to
involve limbic systems, we examined electrophysiological responses in
hippocampal slices. We focused primarily on synaptic transmission in
the CA1 region because CA3-derived Schaffer collateral-commissural terminals are rich in mGluR7a (Shigemoto et al., 1996 , 1997 ) (Fig. 2c) and CA3 is a major trigger region for discharge activity
that can propagate to CA1 and beyond in different models of epileptic discharge (Wong and Traub, 1983 ; Barbarosie and Avoli, 1997 ). Input-output curves relating the initial slope of the field EPSP to
either stimulus intensity or presynaptic fiber volley amplitude revealed no significant differences between
mGluR7 / and
mGluR7+/+ mice (Fig.
6a,b). Paired pulse
facilitation was also similar between groups. For example, with an
interpulse interval of 50 msec the facilitation ratios in CA1 were
1.45 ± 0.04 (n = 9) and 1.49 ± 0.03 (n = 9), respectively.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6.
Increased excitability in the CA1 region of
hippocampal slices from mGluR7 / mice.
a, Plotted is the slope of the field EPSP, recorded in
stratum radiatum, versus relative stimulus strength, expressed as a
function of the threshold intensity (i.e., the intensity at which a
response is just detectable in single records) for
mGluR7 / and mGluR7+/+ mice.
The traces are averages of successive responses from a typical
mGluR7 / mouse at the times indicated
(1-3); the input-output curves show no significant
difference in excitatory synaptic transmission between wild-type
(n = 14) and null mice (n = 12). b, Input-output curve, relating the slope of the
field EPSP to the presynaptic fiber volley amplitude. c,
Examples of somatic field recordings from wild-type
(1-3) and mGluR7 / mice
(4-6) to illustrate the effects of increasing
concentrations of PTZ. The insets are a magnification
(2.5×) of the windows shown in c1 and c4
to illustrate the generation of multiple population spikes on a faster
time base. Field potentials were recorded from stratum pyramidale and
input-output curves that were constructed. Then the stimulus intensity
was set at that which produced a first population spike of ~30% of
the maximum, and PTZ was applied sequentially in increasing
concentrations. d, Pooled data for 10 wild-type and 11 mGluR7 / mice (aged between 8 and 29 weeks) of
the amplitude of the second population spike, expressed as a function
of the primary population spike, versus PTZ concentration. Open
symbols, mGluR7 / mice; filled
symbols, littermate wild types, throughout.
|
|
Next, we determined whether hippocampal slices from
mGluR7 / mice were more excitable when
the stimulus intensity was increased to evoke a population spike and
activate GABAergic synapses polysynaptically (Fig. 6c,d). In
the absence of PTZ a very small secondary population spike was apparent
in 8 of 11 slices from null mice (0.067 ± 0.020 of the first
population spike) but only in 1 of 10 slices from controls (0.009 ± 0.011 of the first population spike; Student's t test,
p < 0.05). Thus, slices prepared from
mGluR7 / mice were slightly more
excitable under control conditions.
Given the lower seizure threshold of
mGluR7 / mice to PTZ, we examined the
effects of PTZ on synaptic transmission in CA1. PTZ caused a reduction
in synaptic inhibition, manifest as a concentration-dependent appearance of multiple population spikes in both
mGluR7 / and wild-type mice (Fig.
6c,d). The effect was such that differences in excitability
between mGluR7 / and wild-type
littermates, observed in the absence of PTZ, were no longer evident
when higher concentrations of PTZ (1-4 mM) were used.
Altered frequency-dependent facilitation in
mGluR7 / mice
To investigate mechanisms that might underlie the changes in
excitability, we turned to a different slice preparation and studied
transmission between synaptically coupled pyramidal neurons and
bitufted interneurons in layer 2/3 of the neocortex. This synapse
contains a high density of presynaptic mGluR receptors, including
mGluR7 (Shigemoto et al., 1996 ), and it demonstrates frequency-dependent facilitation (Reyes et al., 1998 ), which is believed to arise from the elevation of
Ca2+ at the presynaptic release site
(Zucker, 1994 ; Fisher et al., 1997 ; Rozov et al., 2001 ).
As seen in the hippocampus (see paired pulse data in previous section),
facilitation in response to brief trains of two or three action
potentials (at 10 Hz in this preparation) was similar in
mGluR7 / and
mGluR7+/+ mice, provided that the
intersweep interval time was sufficiently long (Fig.
7a; in both cases intersweep
interval was 30 sec). However, a marked difference was observed among
mice when recovery from facilitation was studied. In one set of
experiments paired pulses were delivered with a fixed interpulse
interval of 100 msec, but the interval between paired pulses
(intersweep interval) was varied between 5 and 30 sec (Fig.
7b). Averaged EPSPs recorded from the same bitufted neuron
(see left trace in a) in a
mGluR7+/+ mouse in response to a train (10 Hz) of two action potentials delivered at 20 sec (left) and 7 sec
(right) intersweep intervals shows that the amplitude of the first EPSP
(EPSP1) and the paired pulse facilitation ratio (EPSP2/EPSP1) were
similar at 20 and 7 sec intersweep interval times. In this mouse the
EPSP1 amplitudes were 0.46 and 0.49 mV, and EPSP2/EPSP1 ratios were
2.24 and 2.12 at the 20 and 7 sec intersweep intervals, respectively.
In the mGluR7 / mouse (bottom
traces) the EPSP1 amplitude increased from 0.39 mV at the 20 sec
intersweep interval to 0.75 mV at the 7 sec intersweep interval, and
the EPSP2/EPSP1 ratio decreased from 2.61 to 1.28 at the 20 and 7 sec
intersweep intervals, respectively. Overall, in this set of experiments
the EPSP1 amplitudes with the 7 sec intersweep interval were 100 ± 12% of those measured with 20 sec interval, and the EPSP2/EPSP1
ratios were 2.51 ± 0.28 and 2.56 ± 0.47 at the 20 and 7 sec
intersweep intervals, respectively, in
mGluR7+/+ mice (n = 4). In
the mGluR7 / group the EPSP1 amplitudes
with the 7 sec intersweep interval were 59.7 ± 28.3% larger than
those recorded at the 20 sec interval. EPSP2/EPSP1 ratios decreased
from 2.87 ± 0.88 to 1.27 ± 0.03 for 20 and 7 sec,
respectively. In summary, in mGluR7+/+
mice the facilitation recovered within 5-7 sec, as observed previously with rats (Reyes et al., 1998 ). In contrast, in
mGluR7 / mice full recovery from
facilitation required 20-30 sec.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7.
Altered recovery from paired pulse facilitation in
mGluR7 / mice. Simultaneous whole-cell paired
recordings from synaptically connected pyramidal and bitufted neurons
in layer 2/3 of mGluR7+/+ (n = 9) and mGluR7 / (n = 7) mice
(P14; neocortex). a, Averaged EPSPs
(n = 50-100) recorded from bitufted neurons of
mGluR7+/+ and mGluR7 / mice in
response to a train of three action potentials evoked in a projecting
pyramidal neuron at 10 Hz. Time intervals between trains (intersweep
intervals) were 30 sec in both cases. b, Averaged EPSPs
of 50-100 sweeps recorded from bitufted neurons in response to two
action potentials that were evoked in pyramidal neurons with a 100 msec
time interval. The difference between the left and
right traces is the intersweep interval (time between
subsequent pairs of action potentials). For the left
traces it was 20 sec, and for the right traces
it was 7 sec, as indicated above the traces. The top
traces in each box represent recordings from
mGluR7+/+ mice, and the bottom traces
are from mGluR7 / mice. For each genotype the
representative recordings that are shown (i.e., averaged EPSPs of
50-100 sweeps) are from the same bitufted neuron. c,
Time course of recovery from facilitation measured in bitufted neurons.
The ratios of the mean EPSP amplitudes (EPSP2/EPSP1) were plotted
against t.
|
|
In a separate set of experiments the time course of recovery from
facilitation was calculated by using a repeated paired pulse protocol.
Every 30 sec a train of two action potentials (indicated as EPSP1 and
EPSP2) was evoked. One of several different time intervals was chosen
( t = 0.1, 1, 2, 5, and 10 sec, respectively) between
action potentials 1 and 2, and 50-100 individual sweeps were averaged
for each t. The intersweep intervals thus were kept
constant at 30 sec in all of these experiments to allow the facilitation to recover in mGluR7 /
mice also. The plot shows the summarized results of delivering paired
pulses with the different interpulse intervals. In
mGluR7+/+ mice the recovery from
facilitation was evident by 2 sec, whereas even after 10 sec the
recovery in mGluR7 / mice was still
incomplete (Fig. 7c).
 |
DISCUSSION |
Epilepsy-prone phenotype of mGluR7 / mice,
but not other mGluR-deficient mice
In contrast to gene ablations of mGluR 1, 2, 4, 5, 6, and 8, respectively (Aiba et al., 1994 ; Conquet et al., 1994 ; Masu et al.,
1995 ; Pekhletski et al., 1996 ; Yokoi et al., 1996 ; Lu et al., 1997 ;
Duvoisin and Zhang, unpublished observations), gene disruption
of mGluR7 predisposes to epilepsy. This points toward an important role
of this particular group III mGluR in regulating the balance between
excitatory and inhibitory transmission. The reduced thresholds for PTZ,
bicuculline, and sensory stimulus-evoked seizures in
mGluR7 / mice are acute results of the
absence in adult tissue of a single or both isoforms of mGluR7
receptors. Alternatively, they are a consequence of absence of the
receptor throughout development. Addressing these questions awaits the
development of mGluR7-specific antagonists, conditional knock-outs, or
mGluR7 / mice in which receptor
expression is reconstituted in the adult.
In either case the mGluR7 / mouse
provides an interesting model of epilepsy, given that (1) the seizure
susceptibility phenotype develops gradually, (2) they are uniquely
associated with an ablation of this and no other mGluR subtype, and (3)
when evoked by PTZ, the seizures are responsive to representatives of
three major classes of anticonvulsants [ethosuximide is thought to act
via modulation of Na+ and
Ca2+ channels (Coulter et al., 1989 );
clonazepam, a benzodiazepine, increases the frequency of
GABAA receptor chloride channel opening and is
especially potent in preventing PTZ-induced seizures (Henriksen, 1998 ); valproate is a drug with a broad preclinical and clinical profile but is poorly understood mechanistically (McLean and Macdonald, 1986 ; Kelly et al., 1990 ; Rogawski and Porter, 1990 ; Van Erp et al.,
1990 ; Zona and Avoli, 1990 )]. Apparently, mGluR7 does not contribute
significantly to mechanisms underlying the actions of these antiepileptics.
In contrast, mGluR7 appears to be an important mediator of a
mechanistically different (and potentially clinically viable) anticonvulsant principle, namely, the activation of group III mGluRs.
This was shown here by using the group III mGluR selective agonist PPG,
which proved effective against PTZ-induced seizures in
mGluR4 / ,
mGluR8 / , and
mGluR7+/ , but not
mGluR7 / , mice under experimental
conditions in which PTZ evoked primarily clonic seizures. These
findings are somewhat surprising, because PPG is least potent on mGluR7
of all of the human and rat recombinant group III mGluRs for the
inhibition of forskolin-stimulated cAMP accumulation in mammalian cells
(Nakajima et al., 1993 ; Okamoto et al., 1994 ; Conn and Pin, 1997 ;
Gasparini et al., 1999 ). PPG also is anticonvulsant against
sound-induced seizures in DBA/2 mice and genetically epilepsy-prone
rats (Chapman et al., 1999 ) in the mouse maximal electroshock model
(Gasparini et al., 1999 ) and in the mouse PTZ model (Fig. 5). Unlike
L-AP4 and L-SOP, PPG lacks proconvulsant
activity, and its anticonvulsant effects last much longer than those of
L-AP4 or L-SOP (Chapman et al., 1999 ; Gasparini
et al., 1999 ). However, PPG is not active when given systemically, and
the compound has sedative effects (Chapman et al., 1999 ; our
unpublished results). Therefore, novel compounds are needed to evaluate
the potential of group III and, in particular, mGluR7-selective drugs
for treating epilepsy and/or other disorders (Masugi et al., 1999 ). A
recent finding that further strengthens a role for mGluR7 receptors in
epilepsy is its selective upregulation in the inferior colliculus of
genetically epilepsy-prone (GEP) rats. This was shown to be associated
with a prolonged anticonvulsant effect of intracollicular administrated
L-SOP against sound-induced seizures in GEP rats (Yip et
al., 2001 ).
One very limited gene polymorphism study in patients (Goodwin et al.,
2000 ) could not provide a link between the mGluR7 gene and epilepsy.
This also applies to other group III mGluRs. However, the mGluR7 gene
spans 600 kb
(http://www.ncbi.nlm.nih.gov/AceView/acegquery.cgi?db=300&ORG=hs&term=GM M7), and more detailed studies need to be performed by using a large
number of single nucleotide polymorphisms across the locus before any firm conclusions can be drawn regarding linkage to disease
in human.
Interestingly, mGluR4 / compared with
mGluR4+/ mutant mice showed a
differential resistance to absence-like seizures induced by 30 mg/kg
PTZ (Snead et al., 2000 ). This finding seems to support a facilitating
role of mGluR4 in absence-like seizures. At higher doses PTZ (40-60
mg/kg) evoked clonic convulsions and showed no difference in
susceptibility between wild-type and
mGluR4 / mutant mice (Snead et al.,
2000 ). PTZ injections (60 mg/kg) in mGluR4 / mice under our and different
experimental conditions confirmed this. We failed to reveal a role for
mGluR4 in mediating the anticonvulsant action of PPG in our PTZ
paradigm, but another potent mGluR4 agonist has been shown to increase
the latency of seizure onset in a different PTZ-induced tonic seizure
paradigm (Thomsen and Dalby, 1998 ). Therefore, dependent on the seizure
paradigm that is used, the role of particular group III mGluRs may differ.
This hypothesis is tempting, given findings in neuroprotection
experiments. When we used different magnitudes of a toxic (NMDA) insult, low doses of PPG substantially reduced toxicity in
mGluR4+/ mice, but not in
mGluR4 / mice, whereas higher doses
were protective in both genotypes, suggesting that another receptor
might play a more important role in protection at higher doses (Bruno
et al., 2000 ).
Potential mechanisms underlying the epileptic phenotype
The very small excitability changes detected in the untreated
mGluR7 / hippocampal slices are
consistent and correlate well with the absence of seizures in the
mGluR7 / mice in vivo under
normal circumstances. The weak epileptogenic effects seen in
mGluR7 / hippocampal slices with a
subthreshold concentration of PTZ (for control slices) are consistent
with the increased seizure susceptibility for PTZ in the
mGluR7 / mice in vivo. The
lack of a difference between mGluR7 /
and their wild-type littermates in the excitability in slices exposed
to PTZ and, in particular, at higher concentrations of PTZ is
suggestive of a common expression mechanism, namely, a net reduction in
GABAergic synaptic inhibition, for the two epileptogenic situations
(absence of mGluR7 and presence of PTZ).
Recovery from facilitation reflects the restoration of presynaptic
Ca2+ levels by extrusion while synapses
are not active (Zucker, 1994 ; Fisher et al., 1997 ). Our results in the
paired stimulus paradigms (Fig. 7) are consistent
with the hypothesis that deletion of mGluR7 affects a (slow) component
involved in presynaptic Ca2+ homeostasis.
Resolving the underlying molecular mechanism remains a challenge, not
only because of the multiple mechanisms implicated in presynaptic
Ca2+ regulation
(Na+-Ca2+
exchange, uptake in mitochondria, the plasma membrane
Ca2+ ATPase) [see Zenisek and Matthews
(2000) and references therein] but also because mGluR7 has been linked
to multiple effector pathways (Saugstad et al., 1996 ; Nakajima et al.,
1999 ; O'Connor et al., 1999 ; Perroy et al., 2000 ). Regardless of which
exact molecular mechanism will prove operational, a delayed recovery
from facilitation as observed in
mGluR7 / slices may account, at least
in part, for an epilepsy-prone phenotype, given that such alterations
share some features that are observed when (presynaptic)
K+ channels are blocked by convulsant
drugs (see, for example, Juhng et al., 1999 ). The mGluR7-deficient
mouse adds to a large and growing list of novel models of epilepsy as a
result of gene ablation, recently also including mice that lack the
metabotropic receptor for GABA (Prosser et al., 2001 ; Schuler et al.,
2001 ). Its uniqueness lies in the fact (1) that only few cases have
been reported in which the epileptic phenotype is associated and/or
caused by a specific presynaptic defect (such as synapsin deficiency;
Rosahl et al., 1995 ) and (2) that no other mGluR gene ablation (mGluR1, 2, 4, 5, and 8) has resulted in an epileptic phenotype despite the fact
that two of these receptors (mGluR4 and 8) have a strikingly similar
presynaptic location. Given that mGluR4, mGluR7, and mGluR8 modulate
different presynaptic parameters and show differential expression
patterns (Shigemoto et al., 1997 ), these receptors might serve as
distinct frequency-dependent synaptic transmission filters that
accommodate fine tuning and information transfer under normal
homeostatic and pathological conditions (for review, see Thomson,
2000 ). Dissecting the molecular signaling mechanisms underlying mGluR7
and its frequency-dependent regulation of neurotransmission may shed
light on why this receptor might have potential as a drug target in
epilepsy and/or other indications (Masugi et al., 1999 ).
 |
FOOTNOTES |
Received April 9, 2001; revised July 30, 2001; accepted Sept. 5, 2001.
This work was supported in part by the Biotechnology and Biological
Sciences Research Council and Medical Research Council (UK). We
thank Doris Ruegg for sequencing, Gemma Texido and Klaus Rajewsky for
pTV-0 DNA, J.-F. Pin for mGluR8 cDNA, K. von Figura for E14 ES cells,
Pedro Grandes for histological examination of brain sections, Christoph
Wiessner for help with plots and statistics, Valerie Schuler for help
with Western blots, and the team of the Novartis special strain
breeding facility for their support.
G.S. and T.J.B. contributed equally to this work.
Correspondence should be addressed to Herman van der Putten, Nervous
System Department, Novartis Pharma AG, K125.5.13, CH-4002 Basel,
Switzerland. E-mail: p_herman.van_der_putten{at}pharma.novartis.com.
T. Knoepfel's present address: Laboratory for Neuronal Circuit
Dynamics, The Institute of Physical and Chemical Research (RIKEN) Brain
Science Institute, 2-1 Hirosawa, Wako-Shi, Saitama 351-0198, Japan.
T. Bushell's present address: Imperial College, Department of
Biophysics, Prince Consort Road, London SW7 2BW, UK.
C. Zhang's present address: National Eye Institute, National
Institutes of Health, 10 Center Drive, Bethesda, MD 20982-1857.
R. Duvoisin's present address: Neurological Sciences Institute, Oregon
Health Sciences University, Portland, OR 97201.
 |
REFERENCES |
-
Aiba A,
Kano M,
Chen C,
Stanton ME,
Fox GD,
Herrup K,
Zwingman TA,
Tonegawa S
(1994)
Deficient cerebellar long-term depression and impaired motor learning in mGluR1 mutant mice.
Cell
79:377-388[Web of Science][Medline].
-
Allen KM,
Walsh C
(1996)
Shaking down new epilepsy genes.
Nat Med
2:516-518[Web of Science][Medline].
-
Anson J,
Collins GG
(1987)
Possible presynaptic actions of 2-amino-4-phosphonobutyrate in rat olfactory cortex.
Br J Pharmacol
91:753-761[Web of Science][Medline].
-
Aronica EM,
Gorter JA,
Paupard MC,
Grooms SY,
Bennett MV,
Zukin RS
(1997)
Status epilepticus-induced alterations in metabotropic glutamate receptor expression in young and adult rats.
J Neurosci
17:8588-8595[Abstract/Free Full Text].
-
Barbarosie M,
Avoli M
(1997)
CA3-driven hippocampal-entorhinal loop controls rather than sustains in vitro limbic seizures.
J Neurosci
17:9308-9314[Abstract/Free Full Text].
-
Baskys A,
Malenka RC
(1991)
Agonists at metabotropic glutamate receptors presynaptically inhibit EPSCs in neonatal rat hippocampus.
J Physiol (Lond)
444:687-701[Abstract/Free Full Text].
-
Bate L,
Gardiner M
(1999)
Genetics of inherited epilepsies.
Epileptic Disord
1:7-19[Web of Science][Medline].
-
Bradley S,
Levey AI,
Hersch SM,
Conn JP
(1996)
Immunocytochemical localization of group III metabotropic glutamate receptors in the hippocampus with subtype-specific antibodies.
J Neurosci
16:2044-2056[Abstract/Free Full Text].
-
Brandstaetter JH,
Koulen P,
Kuhn R,
van der Putten H,
Waessle H
(1996)
Compartmental localization of a metabotropic glutamate receptor (mGluR7): two different active sites at a retinal synapse.
J Neurosci
16:4749-4756[Abstract/Free Full Text].
-
Bruno V,
Battaglia G,
Ksiazek I,
van der Putten H,
Catania MV,
Giuffrida R,
Lukic S,
Leonhardt T,
Inderbitzin W,
Gasparini F,
Kuhn R,
Hampson D,
Nicoletti F,
Flor P
(2000)
Selective activation of mGluR4 metabotropic glutamate receptors is protective against excitotoxic neuronal death.
J Neurosci
20:6413-6420[Abstract/Free Full Text].
-
Bushell TJ,
Jane DE,
Tse HW,
Watkins JC,
Davies CH,
Garthwaite J,
Collingridge GL
(1995)
Antagonism of the synaptic depressant actions of L-AP4 in the lateral perforant path by MAP4.
Neuropharmacology
34:239-241[Web of Science][Medline].
-
Cartmell J,
Schoepp DD
(2000)
Regulation of neurotransmitter release by metabotropic glutamate receptors.
J Neurochem
75:889-907[Web of Science][Medline].
-
Chapman AG,
Nanan K,
Yip P,
Meldrum BS
(1999)
Anticonvulsant activity of a metabotropic glutamate receptor 8 preferential agonist (R,S)-4-phosphonophenylglycine.
Eur J Pharmacol
383:23-27[Web of Science][Medline].
-
Conn PJ,
Pin JF
(1997)
Pharmacology and functions of metabotropic glutamate receptors.
Annu Rev Pharmacol Toxicol
37:205-237[Web of Science][Medline].
-
Conquet F,
Bashir ZI,
Davies CH,
Daniel H,
Ferraguti F,
Bordi F,
Franz-Bacon K,
Reggiani A,
Matarese V,
Conde F,
Collingridge GL,
Crepel F
(1994)
Motor deficit and impairment of synaptic plasticity in mice lacking mGluR1.
Nature
372:237-243[Medline].
-
Coulter DA,
Huguenard JR,
Prince DA
(1989)
Specific petit mal anticonvulsants reduce calcium currents in thalamic neurons.
Neurosci Lett
13:74-78.
-
Davies J,
Watkins JC
(1982)
Actions of D and L forms of 2-amino-5-phosphonovalerate and 2-amino-4-phosphonobutyrate in the cat spinal cord.
Brain Res
235:378-386[Web of Science][Medline].
-
Dietrich D,
Kral T,
Clusmann H,
Friedl M,
Schramm J
(1999)
Reduced function of L-AP4 metabotropic glutamate receptors in human epileptic sclerotic hippocampus.
Eur J Neurosci
11:1109-1113[Web of Science][Medline].
-
Duvoisin RM,
Zhang C,
Ramonell K
(1995)
A novel metabotropic glutamate receptor expressed in the retina and olfactory bulb.
J Neurosci
15:3075-3083[Abstract].
-
Ferraro TN,
Golden GT,
Smith GG,
St. Jean P,
Schork NJ,
Mulholland N,
Ballas C,
Schill J,
Buono RJ,
Berrettini WH
(1999)
Mapping loci for pentylenetetrazol-induced seizure susceptibility in mice.
J Neurosci
19:6733-6739[Abstract/Free Full Text].
-
Fisher SA,
Fisher TM,
Carew TJ
(1997)
Multiple overlapping processes underlying short-term synaptic enhancement.
Trends Neurosci
20:170-177[Web of Science][Medline].
-
Flor PJ,
van der Putten H,
Ruegg D,
Lukic S,
Leonhardt T,
Bence M,
Sansig G,
Knopfel T,
Kuhn R
(1997)
A novel splice variant of a metabotropic glutamate receptor, human mGluR7b.
Neuropharmacology
36:153-159[Web of Science][Medline].
-
Frankel WN
(1999)
Detecting genes in new and old mouse models for epilepsy: a prospectus through the magnifying glass.
Epilepsy Res
36:97-110[Web of Science][Medline].
-
Gasparini F,
Bruno V,
Battaglia G,
Lukic S,
Leonhardt T,
Inderbitzin W,
Laurie D,
Sommer B,
Varney MA,
Hess SD,
Johnson EC,
Kuhn R,
Urwyler S,
Sauer D,
Portet C,
Schmutz M,
Nicoletti F,
Flor PJ
(1999)
(R,S)-4-phosphonophenylglycine, a potent and selective group III metabotropic glutamate receptor agonist, is anticonvulsive and neuroprotective in vivo.
J Pharmacol Exp Ther
289:1678-1687[Abstract/Free Full Text].
-
Gereau 4th RW,
Conn PJ
(1995)
Multiple presynaptic metabotropic glutamate receptors modulate excitatory and inhibitory synaptic transmission in hippocampal area CA1.
J Neurosci
15:6879-6889[Abstract/Free Full Text].
-
Goodwin H,
Curran N,
Chioza B,
Blower J,
Nashef L,
Asherson P,
Makoff AJ
(2000)
No association found between polymorphisms in genes encoding mGluR7 and mGluR8 and idiopathic generalized epilepsy in a case control study.
Epilepsy Res
39:27-31[Web of Science][Medline].
-
Henrikson O
(1998)
An overview of benzodiazepines in seizure management.
Epilepsia
39[Suppl 1]:S2-S6.
-
Holmes KH,
Keele NB,
Shinnick-Gallagher P
(1996)
Loss of mGluR-mediated hyperpolarizations and increase in mGluR depolarizations in basolateral amygdala neurons in kindling-induced epilepsy.
J Neurophysiol
76:2808-2812[Abstract/Free Full Text].
-
Juhng KN,
Kokate TG,
Yamaguchi S,
Kim BY,
Rogowski RS,
Blaustein MP,
Rogawski MA
(1999)
Induction of seizures by the potent K+ channel-blocking scorpion venom peptide toxins tityustoxin-K
and pandinustoxin-K .
Epilepsy Res
34:177-186[Web of Science][Medline]. -
Kelly KM,
Gross RA,
Macdonald RL
(1990)
Valproic acid selectively reduces the low-threshold (T) calcium current in rat nodose neurons.
Neurosci Lett
116:233-238[Web of Science][Medline].
-
Kinoshita A,
Shigemoto R,
Ohishi H,
van der Putten H,
Mizuno N
(1998)
Immunohistochemical localization of metabotropic glutamate receptors, mGluR7a and mGluR7b, in the central nervous system of the adult rat and mouse: a light and electron microscopy study.
J Comp Neurol
393:332-352[Web of Science][Medline].
-
Kinzie JM,
Saugstad JA,
Westbrook GJ,
Segerson TP
(1995)
Distribution of metabotropic glutamate receptor 7 messenger RNA in the developing and adult rat brain.
Neuroscience
69:167-176[Web of Science][Medline].
-
Klapstein GJ,
Meldrum BS,
Mody I
(1999)
Decreased sensitivity to group III mGluR agonists in the lateral perforant path following kindling.
Neuropharmacology
38:927-933[Web of Science][Medline].
-
Koerner JF,
Cotman CW
(1981)
Micromolar L-2-amino-4-phosphonobutyric acid selectively inhibits perforant path synapses from lateral entorhinal cortex.
Brain Res
216:192-198[Web of Science][Medline].
-
Kosobud AE,
Cross SJ,
Crabbe JC
(1992)
Neural sensitivity to pentylenetetrazol convulsions in inbred and selectively bred mice.
Brain Res
592:122-128[Web of Science][Medline].
-
Lanthorn TH,
Ganong AH,
Cotman CW
(1984)
2-Amino-4-phosphonobutyrate selectively blocks mossy fiber-CA3 responses in guinea pig but not rat hippocampus.
Brain Res
290:174-178[Web of Science][Medline].
-
Liu AA,
Becker A,
Behle K,
Beck H,
Maltschek B,
Conn PJ,
Kuhn R,
Nitsch R,
Plaschke M,
Schramm J,
Elger CE,
Wiestler OD,
Blumcke I
(2000)
Up-regulation of the metabotropic glutamate receptor mGluR4 in hippocampal neurons with reduced seizure vulnerability.
Ann Neurol
47:26-35[Web of Science][Medline].
-
Lu Y-M,
Jia Z,
Janus C,
Henderson JT,
Gerlai R,
Wojtowicz JM,
Roder JC
(1997)
Mice lacking metabotropic glutamate receptor 5 show impaired learning and reduced CA1 long-term potentiation (LTP) but normal CA3 LTP.
J Neurosci
17:5196-5205[Abstract/Free Full Text].
-
Manzoni O,
Bockaert J
(1995)
Metabotropic glutamate receptors inhibiting excitatory synapses in the CA1 area of rat hippocampus.
Eur J Neurosci
7:2518-2523[Web of Science][Medline].
-
Markram H,
L
bke J,
Frotscher M,
Roth A,
Sakmann B
(1997)
Physiology and anatomy of synaptic connections between thick-tufted pyramidal neurons in the developing rat neocortex.
J Physiol (Lond)
500:409-440[Abstract/Free Full Text]. -
Masu M,
Iwakabe H,
Tagawa Y,
Miyoshi T,
Yamashita M,
Fukuda Y,
Sasaki H,
Hiroi K,
Nakamura Y,
Shigemoto R
(1995)
Specific deficit of the ON response in visual transmission by targeted disruption of the mGluR6 gene.
Cell
80:757-765[Web of Science][Medline].
-
Masugi M,
Yokoi M,
Shigemoto R,
Muguruma K,
Watanabe Y,
Sansig G,
van der Putten H,
Nakanishi S
(1999)
Metabotropic glutamate receptor subtype 7 ablation causes deficit in fear response and taste aversion.
J Neurosci
19:955-963[Abstract/Free Full Text].
-
McLean MJ,
Macdonald RL
(1986)
Sodium valproate, but not ethosuximide, produces use- and voltage-dependent limitation of high frequency repetitive firing of action potentials of mouse central neurons in cell culture.
J Pharmacol Exp Ther
237:1001-1011[Abstract/Free Full Text].
-
McNamara JO,
Puranam RS
(1998)
Epilepsy genetics: an abundance of riches for biologists.
Curr Biol
8:R168-R170[Web of Science][Medline].
-
Nakajima Y,
Iwakabe H,
Akazawa C,
Nawa H,
Shigemoto R,
Mizuno N,
Nakanishi S
(1993)
Molecular characterization of a novel retinal metabotropic glutamate receptor mGluR6 with a high agonist selectivity for L-2-amino-4-phosphonobutyrate.
J Biol Chem
268:11868-11873[Abstract/Free Full Text].
-
Nakajima Y,
Yamamoto T,
Nakayama T,
Nakanishi S
(1999)
A relationship between protein kinase C phosphorylation and calmodulin binding to the metabotropic glutamate receptor subtype 7.
J Biol Chem
274:27573-27577[Abstract/Free Full Text].
-
Neugebauer V,
Keele NB,
Shinnick-Gallagher P
(1997)
Loss of long-lasting potentiation mediated by group III mGluRs in amygdala neurons in kindling-induced epileptogenesis.
J Neurophysiol
78:3475-3478[Abstract/Free Full Text].
-
Neugebauer V,
Zinebi F,
Russell R,
Gallagher JP,
Shinnick-Gallagher P
(2000)
Cocaine and kindling alter the sensitivity fo group II and III metabotropic glutamate receptors in the central amygdala.
J Neurophysiol
84:759-770[Abstract/Free Full Text].
-
O'Connor V,
El Far O,
Bofill-Cardona E,
Nanoff C,
Freissmuth M,
Karschin A,
Airas JM,
Betz H,
Boehm S
(1999)
Calmodulin dependence of presynaptic metabotropic glutamate receptor signaling.
Science
286:1180-1184[Abstract/Free Full Text].
-
Ohishi H,
Akazawa C,
Shigemoto R,
Nakanishi S,
Mizuno NJ
(1995)
Distributions of the mRNAs for L-2-amino-4-phosphonobutyrate-sensitive metabotropic glutamate receptors, mGluR4 and mGluR7, in the rat brain.
J Comp Neurol
360:555-570[Web of Science][Medline].
-
Okamoto N,
Hori S,
Akazawa C,
Hayashi Y,
Shigemoto R,
Mizuno N,
Nakanishi S
(1994)
Molecular characterization of a new metabotropic glutamate receptor mGluR7 coupled to inhibitory cyclic AMP signal transduction.
J Biol Chem
269:1231-1236[Abstract/Free Full Text].
-
Pekhletski R,
Gerlai R,
Overstreet LS,
Huang XP,
Agopyan N,
Slater NT,
Abramow-Newerly W,
Roder JC,
Hampson DR
(1996)
Impaired cerebellar synaptic plasticity and motor performance in mice lacking the mGluR4 subtype of metabotropic receptor.
J Neurosci
16:6364-6373[Abstract/Free Full Text].
-
Perroy J,
Prezeau L,
De Waard M,
Shigemoto R,
Bockaert J,
Fagni L
(2000)
Selective blockade of P/Q-type calcium channels by the metabotropic glutamate receptor type 7 involves a phospholipase C pathway in neurons.
J Neurosci
20:7896-7904[Abstract/Free Full Text].
-
Pisani A,
Calabresi P,
Centonze D,
Bernardi G
(1997)
Activation of group III metabotropic glutamate receptors depresses glutamatergic transmission at corticostriatal synapse.
Neuropharmacology
36:845-851[Web of Science][Medline].
-
Prosser HM,
Gill GH,
Hirst WD,
Grau E,
Robbins M,
Calver A,
Soffin EM,
Farmer CE,
Lanneau C,
Gray J,
Schenck E,
Warmerdam BS,
Clapham C,
Reavill C,
Rogers DC,
Stean T,
Upton N,
Humphreys K,
Randall A,
Geppert M,
Davies CH,
Pangalos MN
(2001)
Epileptogenesis and enhanced prepulse inhibition in GABAB1-deficient mice.
Mol Cell Neurosci
17:1059-1070[Web of Science][Medline].
-
Reyes A,
Lujan R,
Rosov A,
Burnashev N,
Somogyi P,
Sakmann B
(1998)
Target cell-specific facilitation and depression in neocortical circuits.
Nat Neurosci
1:279-285[Web of Science][Medline].
-
Rogawski MA,
Porter RJ
(1990)
Antiepileptic drugs: pharmacological mechanisms and clinical efficacy with consideration of promising developmental stage compounds.
Pharmacol Rev
42:223-286[Web of Science][Medline].
-
Rosahl TW,
Spillane D,
Missler M,
Herz J,
Selig DK,
Wolff JR,
Hammer RE,
Malenka RC,
Sudhof TC
(1995)
Essential functions of synapsin I and II in synaptic vesicles.
Nature
375:488-493[Medline].
-
Rozov A,
Burnashev N,
Sakmann B,
Neher E
(2001)
Transmitter release modulation by intracellular Ca2+ buffers in facilitating and depressing nerve terminals of pyramidal cells in layer 2/3 of the rat neocortex indicates a target cell-specific difference in presynaptic calcium dynamics.
J Physiol (Lond)
531:807-826[Abstract/Free Full Text].
-
Salt TE,
Eaton SA
(1995)
Modulation of sensory neurone excitatory and inhibitory responses in the ventrobasal thalamus by activation of metabotropic excitatory amino acid receptors.
Neuropharmacology
34:1043-1051[Web of Science][Medline].
-
Saugstad JA,
Kinzie JM,
Milvihill ER,
Segerson TP,
Westbrook GL
(1994)
Cloning and expression of a new member of the L-2-amino-4-phosphonobutyric acid-sensitive class of metabotropic glutamate receptors.
Mol Pharmacol
45:367-372[Abstract].
-
Saugstad JA,
Segerson TP,
Westbrook GL
(1996)
Metabotropic glutamate receptors activate G-protein-coupled inwardly rectifying potassium channels in Xenopus oocytes.
J Neurosci
16:5979-5985[Abstract/Free Full Text].
-
Schmutz M,
Portet C,
Jeker A,
Klebs K,
Vassout A,
Allgeier H,
Heckendorn R,
Fagg GE,
Olpe HR,
van Riezen H
(1990)
The competitive NMDA receptor antagonists CGP37849 and CGP39551 are potent, orally active anti-convulsants in rodents.
Naunyn Schmiedebergs Arch Pharmacol
342:61-66[Web of Science][Medline].
-
Schuler V,
Lüscher C,
Blanchet C,
Klix N,
Sansig G,
Klebs K,
Schmutz M,
Heid J,
Gentry C,
Urban L,
Fox A,
Jaton A-L,
Vigouret J-M,
Pozza M,
Kelly PH,
Mosbacher J,
Froestl W,
Käslin E,
Korn R,
Bischoff S,
Kaupmann K,
van der Putten H,
Bettler B
(2001)
Epilepsy, hyperalgesia, impaired memory, and loss of pre- and postsynaptic GABAB responses in mice lacking GABAB1.
Neuron
31:1-12[Web of Science][Medline].
-
Semyanov A,
Kullmann D
(2000)
Modulation of GABAergic signaling among interneurons by metabotropic glutamate receptors.
Neuron
25:663-672[Web of Science][Medline].
-
Shigemoto R,
Kulik A,
Roberts JDB,
Ohishi H,
Nusser Z,
Kaneko T,
Somogyi P
(1996)
Target cell-specific concentration of a metabotropic glutamate receptor in the presynaptic active zone.
Nature
381:523-525[Medline].
-
Shigemoto R,
Kinoshita A,
Wada E,
Nomura S,
Ohishi H,
Takada M,
Flor PJ,
Neki A,
Abe T,
Nakanishi S,
Mizuno N
(1997)
Differential presynaptic localization of metabotropic glutamate receptor subtypes in the rat hippocampus.
J Neurosci
17:7503-7522[Abstract/Free Full Text].
-
Snead III OC,
Banerjee PK,
Burnham M,
Hampson D
(2000)
Modulation of absence seizures by the GABAA receptor: a critical role for metabotropic glutamate receptor 4 (mGluR4).
J Neurosci
20:6218-6224[Abstract/Free Full Text].
-
Stuart GJ,
Dodt HU,
Sakmann B
(1993)
Patch clamp recordings from the soma and dendrites of neurons in brain slices using infrared video microscopy.
Pfl
gers Arch
423:511-518[Web of Science][Medline]. -
Suzuki T,
Shimizu N,
Tsuda M,
Soma M,
Misawa M
(1999)
Role of metabotropic glutamate receptors in the hypersusceptibility to pentylenetetrazole-induced seizures during diazepam withdrawal.
Eur J Pharmacol
369:163-168[Web of Science][Medline].
-
Tang E,
Yip PK,
Chapman AG,
Jane DE,
Meldrum BS
(1997)
Prolonged anticonvulsant action of glutamate metabotropic receptor agonists in inferior colliculus of genetically epilepsy-prone rats.
Eur J Pharmacol
327:109-115[Web of Science][Medline].
-
Thomsen C,
Dalby NO
(1998)
Roles of glutamate receptor subtypes in modulation of pentylenetetrazole-induced seizure activity in mice.
Neuropharmacology
37:1465-1473[Web of Science][Medline].
-
Thomson AM
(2000)
Molecular frequency filters at central synapses.
Prog Neurobiol
62:159-196[Web of Science][Medline].
-
Tizzano JP,
Griffey KI,
Schoepp DD
(1995)
Receptor subtypes linked to metabotropic glutamate receptor agonist-mediated limbic seizures in mice.
Ann NY Acad Sci
765:230-235[Web of Science][Medline].
-
Van Erp MG,
Van Dongen AM,
Van den Berg RJ
(1990)
Voltage-dependent action of valproate on potassium channels in frog node of Ranvier.
Eur J Pharmacol
184:151-161[Web of Science][Medline].
-
Vignes M,
Clarke VR,
Davies CH,
Chambers A,
Jane DE,
Watkins JC,
Collingridge GL
(1995)
Pharmacological evidence for an involvement of group II and group III mGluRs in the presynaptic regulation of excitatory synaptic responses in the CA1 region of rat hippocampal slices.
Neuropharmacology
34:973-982[Web of Science][Medline].
-
Wan H,
Cahusac PM
(1995)
The effects of L-AP4 and L-serine-O-phosphate on inhibition in primary somatosensory cortex of the adult rat in vivo.
Neuropharmacology
34:1053-1062[Web of Science][Medline].
-
White HS
(1997)
Clinical significance of animal seizure models and mechanism of action studies of potential antiepileptic drugs.
Epilepsia
38[Suppl 1]:S9-S17.
-
Wong RK,
Traub RD
(1983)
Synchronized burst discharge in disinhibited hippocampal slice. I. Initiation in CA2-CA3 region.
J Neurophysiol
49:442-458[Free Full Text].
-
Yip PK,
Meldrum BS,
Rattay M
(2001)
Elevated levels of group III metabotropic glutamate receptors in the inferior colliculus of genetically epilepsy-prone rats following intracollicular administration of L-serine-O-phosphate.
J Neurochem
78:13-23[Web of Science][Medline].
-
Yokoi M,
Kobayashi K,
Manabe T,
Takahashi T,
Sakaguchi I,
Katsuura G,
Shigemoto R,
Ohishi H,
Nomura S,
Nakamura K,
Nakao K,
Katsuki M,
Nakanishi S
(1996)
Impairment of hippocampal mossy fiber LTD in mice lacking mGluR2.
Science
273:645-647[Abstract].
-
Zenisek D,
Matthews G
(2000)
The role of mitochondria in presynaptic calcium handling at a ribbon synapse.
Neuron
25:229-237[Web of Science][Medline].
-
Zona C,
Avoli M
(1990)
Effects induced by the antiepileptic drug valproic acid upon the ionic currents recorded in rat neocortical neurons in cell culture.
Exp Brain Res
81:313-317[Web of Science][Medline].
-
Zucker RS
(1994)
Calcium and short-term synaptic plasticity.
Neth J Zool
44:495-512.
Copyright © 2001 Society for Neuroscience 0270-6474/01/21228734-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. H. Caldwell, G. A. Herin, G. Nagel, E. Bamberg, A. Scheschonka, and H. Betz
Increases in Intracellular Calcium Triggered by Channelrhodopsin-2 Potentiate the Response of Metabotropic Glutamate Receptor mGluR7
J. Biol. Chem.,
September 5, 2008;
283(36):
24300 - 24307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-S. Zhang, F. Bertaso, V. Eulenburg, M. Lerner-Natoli, G. A. Herin, L. Bauer, J. Bockaert, L. Fagni, H. Betz, and A. Scheschonka
Knock-In Mice Lacking the PDZ-Ligand Motif of mGluR7a Show Impaired PKC-Dependent Autoinhibition of Glutamate Release, Spatial Working Memory Deficits, and Increased Susceptibility to Pentylenetetrazol
J. Neurosci.,
August 20, 2008;
28(34):
8604 - 8614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. E. Benarroch
Metabotropic glutamate receptors: Synaptic modulators and therapeutic targets for neurologic disease
Neurology,
March 18, 2008;
70(12):
964 - 968.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Scheschonka, S. Findlow, R. Schemm, O. El Far, J. H. Caldwell, M. P. Crump, K. Holden-Dye, V. O'Connor, H. Betz, and J. M. Werner
Structural Determinants of Calmodulin Binding to the Intracellular C-terminal Domain of the Metabotropic Glutamate Receptor 7A
J. Biol. Chem.,
February 29, 2008;
283(9):
5577 - 5588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Suzuki, N. Tsukamoto, H. Fushiki, A. Kawagishi, M. Nakamura, H. Kurihara, M. Mitsuya, M. Ohkubo, and H. Ohta
In Vitro Pharmacological Characterization of Novel Isoxazolopyridone Derivatives as Allosteric Metabotropic Glutamate Receptor 7 Antagonists
J. Pharmacol. Exp. Ther.,
October 1, 2007;
323(1):
147 - 156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Callaerts-Vegh, T. Beckers, S. M. Ball, F. Baeyens, P. F. Callaerts, J. F. Cryan, E. Molnar, and R. D'Hooge
Concomitant deficits in working memory and fear extinction are functionally dissociated from reduced anxiety in metabotropic glutamate receptor 7-deficient mice.
J. Neurosci.,
June 14, 2006;
26(24):
6573 - 6582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Mitsukawa, R. Yamamoto, S. Ofner, J. Nozulak, O. Pescott, S. Lukic, N. Stoehr, C. Mombereau, R. Kuhn, K. H. McAllister, et al.
From The Cover: A selective metabotropic glutamate receptor 7 agonist: Activation of receptor signaling via an allosteric site modulates stress parameters in vivo
PNAS,
December 20, 2005;
102(51):
18712 - 18717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Holscher, S. Schmid, P. K.D. Pilz, G. Sansig, H. van der Putten, and C. F. Plappert
Lack of the metabotropic glutamate receptor subtype 7 selectively modulates Theta rhythm and working memory
Learn. Mem.,
September 1, 2005;
12(5):
450 - 455.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Rosemond, M. Wang, Y. Yao, L. Storjohann, T. Stormann, E. C. Johnson, and D. R. Hampson
Molecular Basis for the Differential Agonist Affinities of Group III Metabotropic Glutamate Receptors
Mol. Pharmacol.,
October 1, 2004;
66(4):
834 - 842.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Bough, D. D. Mott, and R. J. Dingledine
Medial Perforant Path Inhibition Mediated by mGluR7 Is Reduced After Status Epilepticus
J Neurophysiol,
September 1, 2004;
92(3):
1549 - 1557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Kramer, W. J. Cook, F. P. Roth, J. Zhu, H. Holman, D. M. Knipe, and D. M. Coen
Latent Herpes Simplex Virus Infection of Sensory Neurons Alters Neuronal Gene Expression
J. Virol.,
September 1, 2003;
77(17):
9533 - 9541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. R. J. Gordon and J. S. Bains
Priming of Excitatory Synapses by {alpha}1 Adrenoceptor-Mediated Inhibition of Group III Metabotropic Glutamate Receptors
J. Neurosci.,
July 16, 2003;
23(15):
6223 - 6231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Losonczy, P. Somogyi, and Z. Nusser
Reduction of Excitatory Postsynaptic Responses by Persistently Active Metabotropic Glutamate Receptors in the Hippocampus
J Neurophysiol,
April 1, 2003;
89(4):
1910 - 1919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Coutinho and T. Knopfel
Book Review: Metabotropic Glutamate Receptors: Electrical and Chemical Signaling Properties
Neuroscientist,
December 1, 2002;
8(6):
551 - 561.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Dalezios, R. Lujan, R. Shigemoto, J. D. B. Roberts, and P. Somogyi
Enrichment of mGluR7a in the Presynaptic Active Zones of GABAergic and Non-GABAergic Terminals on Interneurons in the Rat Somatosensory Cortex
Cereb Cortex,
September 1, 2002;
12(9):
961 - 974.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|