 |
 Previous Article | Next Article 
The Journal of Neuroscience, 2001, 21:RC185:1-6
RAPID COMMUNICATION
Motoneuron-Specific Expression of NR3B, a Novel NMDA-Type
Glutamate Receptor Subunit That Works in a Dominant-Negative
Manner
Mayumi
Nishi1,
Heather
Hinds2,
Hai-Ping
Lu1,
Mitsuhiro
Kawata1, and
Yasunori
Hayashi2
1 Department of Anatomy and Neurobiology, Kyoto
Prefectural University of Medicine, Kawaramachi-Hirokoji, Kamigyo-ku,
Kyoto 602-8566, Japan, and 2 RIKEN-MIT
Neuroscience Research Center, Center for Learning and Memory,
Department of Brain and Cognitive Science, Massachusetts Institute of
Technology, Cambridge, Massachusetts 02139
 |
ABSTRACT |
We have identified a novel glutamate receptor subunit on the human
and mouse genome. Cloning of the mouse cDNA revealed a protein
consisting of 1003 amino acids encoded by at least nine exons. This
protein showed the highest similarity (51%) to the NR3A subunit of the
NMDA receptor and therefore was termed NR3B. NR3B has a structure
typical of glutamate receptor family members with a signal peptide and
four membrane-associated regions. Amino acids forming a ligand-binding
pocket are conserved. When coexpressed with NR1 and NR2A in
heterologous cells, NR3B suppressed glutamate-induced current similarly
to NR3A. Thus members of the NR3 class of NMDA receptors act as
dominant-negative subunits in the NMDA receptor complex. NR3B shows
very restricted expression in somatic motoneurons of the brainstem and
spinal cord. Its expression in other types of motoneurons, including
autonomic motoneurons in Onuf's nucleus and oculomotor neurons, is
significantly weaker. Our results indicate that NR3B is important as a
regulatory subunit that controls NMDA receptor transmission in
motoneurons. It may be involved in the pathogenesis of
neurodegenerative diseases involving motoneurons as well.
Key words:
NMDA-type glutamate receptor; genomic sequence; cDNA
cloning; motoneurons; in situ hybridization; amyotrophic
lateral sclerosis; Onuf's nucleus
| |
INTRODUCTION |
Glutamate
is the major excitatory neurotransmitter in the mammalian CNS.
Its action is mediated by two distinct classes of glutamate receptors,
ionotropic and metabotropic glutamate receptors (Seeburg, 1993 ;
Nakanishi et al., 1996; Dingledine et al., 1999). The ionotropic
glutamate receptor is a ligand-gated cation channel that passes cation
with glutamate binding. It consists of several different subclasses
including NMDA, AMPA, kainate, and  , which, in turn, are
hetero-oligomers of several subunits (Seeburg, 1993; Hollmann and
Heinemann, 1994; Dingledine et al., 1999). The NMDA receptor is
composed of hetero-oligomers of NR1, NR2A-NR2D, and NR3A
subunits (also called  -1 or NMDA receptor-like subunits). NR1
is a key subunit that confers essential functions of the NMDA receptor
and is expressed ubiquitously in the CNS. In contrast, other subunits
show more limited expression and confer a functional diversity. For
example, during development of the visual cortex, NR2B is expressed
predominantly in the early stages. After functional maturation of the
cortex, predominant expression switches to NR2A (Quinlan et al., 1999).
Concomitantly, the decay time course of the NMDA receptor-mediated
synaptic current becomes faster (Carmignoto and Vicini, 1992; Philpot
et al., 2001). Dark rearing of animals, which prolongs the critical
period of the visual cortex, delays this conversion (Quinlan et al.,
1999).
In contrast to NR2 subunits, less is known about the NR3 class of
subunits. To date, the NR3A subunit has been the only reported member
of this class (Ciabarra et al., 1995; Sucher et al., 1995). NR3A is
expressed ubiquitously during development and its expression level
reaches a maximum at approximately the first postnatal week. Thereafter, the level gradually decreases, and in adult animals, NR3A
is confined to limited nuclei in the thalamus, amygdala, and nucleus of
the lateral olfactory tract (Ciabarra et al., 1995; Sucher et al.,
1995). The NR3A subunit binds to NR1 and NR2 and acts in a
dominant-negative manner against the NMDA receptor to reduce whole-cell
current as well as single-channel conductance (Ciabarra et al., 1995;
Sucher et al., 1995; Das et al., 1998; Perez-Otano et al., 2001).
Consistent with this role for NR3A, mice lacking NR3A have a larger
NMDA receptor-mediated current and an increased dendritic spine density
in cerebrocortical neurons (Das et al., 1998), suggesting that the NR3A
subunit is important for the development and plasticity of the CNS
through a modulation of NMDA receptor function. Therefore,
understanding the NR3 class of NMDA receptor subunits is important for
understanding the physiology of the CNS.
In this report, we describe a novel NR3 subunit termed NR3B and
characterize the structure, expression pattern, and
electrophysiological properties of mouse NR3B.
| |
MATERIALS AND METHODS |
Identification of a novel glutamate receptor. We
performed a basic local alignment search tool (BLAST) search on
the published human genomic sequence using the amino acid sequence of
the mouse 2 subunit as a query sequence. This search detected a
stretch of genomic sequence with significant homology to members of the glutamate receptor family on a contig from human chromosome 19p13.3 (GenBank accession number AC004528). We then used this sequence to search the unfinished high throughput genomic sequences database (including phases 0, 1, and 2) and identified the mouse homolog (accession numbers AC087114 and AC073805) on chromosome 10. A search of
the expressed sequence tag (EST) database with these sequences
identified the following ESTs: accession number AL040053 (human);
accession numbers AW045848, BE864387, AW048083, and BE955769 (mouse);
and accession numbers AW525909, BE108608, and BE112464 (rat). AW045848
and BE864387 are the same clone sequenced from opposite ends. We used
this clone, which corresponds to the extracellular domain of the
putative receptor, for screening of a mouse spinal cord cDNA library
and in situ hybridization (Clontech, Palo Alto, CA).
Reverse transcriptase-PCR and in situ
hybridization. We performed reverse transcriptase (RT)-PCR
with primers spanning predicted exons 1 (CCTCTATAACCTTTCCCGAGG) and 2 (CTAGAGCAATGTCCTCCCAGG) of mouse NR3B. As a positive control for
RT-PCR, we used a primer set for NR1 (5' primer,
GATCCTCGAGCCATGGAGATCGCCTACAAGCGACAC; 3' primer,
GATCGGATCCGCATGCTCAGCTCTCCCTATGACGGG). For in situ hybridizations on brain and spinal cord sections from male mice (C57BL/6, 6 weeks of age), we used either
33P- or digoxigenin-labeled RNA probes
(Simmons et al., 1989; Lu et al., 2001). Serotonin was
immunohistochemically detected with anti-serotonin antibody (Incstar,
Stillwater, MN).
Electrophysiology in human embryonic kidney 293. To express
the receptors in human embryonic kidney (HEK)293 cells, we transfected the cells with 1 µg of each plasmid unless otherwise stated (Shi et
al., 1999). We tagged the NR1 and NR2A with green fluorescent protein
(GFP) on the extracellular domain to facilitate the identification of
transfected cells. Such constructs have been shown to preserve the
properties of the glutamate receptor (Shi et al., 1999). NMDA receptor-mediated current was recorded in the presence of 10 µM glycine. AMPA receptor current was recorded
as described previously (Shi et al., 1999). Pipette solutions contained
(in mM): cesium methanesulfonate 110, CsCl
30, NaCl 4, HEPES 10, EGTA 5, and CaCl2 0.5, adjusted to a pH of 7.3 with CsOH. A 1 mM
concentration of glutamate (for NMDA receptor) or kainate (for AMPA
receptor) was pressure-applied (1.0 psi) through a puffer pipette
positioned ~10 µm to the cells. We used a program based on
Igor to acquire data on a Macintosh computer.
| |
RESULTS |
Identification and cloning of a new mouse glutamate receptor
A BLAST search of the published human and mouse genomic
sequences identified a unique sequence with significant homology to the
glutamate receptor family (Fig.
1A). We examined
transcript levels as well as the tissue distribution of mRNA by RT-PCR
of mouse RNA using a primer set spanning the predicted exons 1 and 2 (Fig. 2A). It revealed
a band of the expected size for spliced product in brainstem and spinal
cord. We also detected a fainter band in the cerebellum. Using other
primer sets covering exons 2 and 3, we detected a similar pattern of
expression (data not shown). More rostral structures did not show any
significant expression of this transcript, whereas RT-PCR for the NR1
subunit performed in parallel showed positive bands in all brain
regions. We did not detect the band when we omitted reverse
transcriptase from the reaction (Fig. 2A,
 RT), ruling out the possibility of amplification from contaminated genomic DNA. An additional BLAST search
identified EST clones from humans, mice, and rats. When the mouse EST
clone AW045848 was used to probe polyA+
RNA from mouse spinal cord, it hybridized to a band at ~3.5 kb (Fig.
2B). We used this clone to screen a mouse spinal cord
cDNA library. The screening of ~106
clones yielded three positive clones, one of which contained full-length cDNA (GenBank accession number AF396649).
View larger version (57K):
[in this window]
[in a new window]
|
Figure 1.
Structure of the glutamate receptor subtype NR3B.
A, Phylogenic tree of the members of the glutamate
receptor family based on the neighbor-joining method. The
horizontal length of the branch indicates the distance
between proteins. B, Mouse and human NR3B sequence. The
human sequence is assembled from the genomic sequence and is not
complete at the C terminus. Identical amino acids between two species
are indicated by ":" and homologous ones are indicated by ".".
SP and M1-M4 indicate the predicted
signal peptide and membrane-associated region, respectively. Putative
glycosylation sites are boxed. Upward
arrowheads indicate exon boundaries. Amino acids implicated in
ligand binding of GluR2 from a crystallographic study are shown below
the mouse sequence at the corresponding positions. C, A
comparison of the M2 domain that forms a channel pore. The critical
amino acid at the Q/R/N site, which controls ion permeability and
rectification, is glycine followed by an arginine in both NR3B and NR3A
(shown in red). In human NR3B, the Q/R/N site is an
arginine (B). D, Genomic structure
of mouse NR3B. Open and shaded boxes are
coding and noncoding regions, respectively. The 5' noncoding region may
extend further upstream.
|
|
View larger version (85K):
[in this window]
[in a new window]
|
Figure 2.
Tissue distribution of mouse NR3B.
A, NR3B transcripts detected by RT-PCR with primers that
span exons 1 and 2. The PCR product of the expected length was detected
in the brainstem (BS) and spinal cord
(Sp) and to a much lesser extent in the cerebellum
(Cb). When reverse transcriptase was omitted
(RT), the product was not detected. As a
positive control for RT-PCR, the NR1 was amplified in parallel,
producing two bands that correspond to different slice variants.
OB, Olfactory bulb; Cx, cerebral cortex;
Str, striatum; Hip, hippocampus;
Th-MB, thalamus to midbrain region. B,
Northern blot analysis of mouse spinal cord polyA+
RNA detecting a single band at ~3.5 kb. C, In
situ hybridization of sagittal sections of mouse brain with
33P-labeled antisense (AS) and sense
(S) probes. The antisense probe detected a
discrete signal in trigeminal motor (V),
facial (VII), and ambiguus
(IX) nuclei. The cerebellum also had a faint
signal. D, Higher magnification of cranial nerve nuclei.
A restricted expression of NR3B was detected in motoneurons that
control somatic movement but not in those controlling ocular movement.
Left, Low- and high-magnification images of
Nissl-stained sections of oculomotor (III),
trochlear (IV), trigeminal motor
(V), facial (VII),
and abducens (VI) nuclei are shown.
Right, In situ hybridization using
antisense and sense probes labeled with digoxigenin. A strong signal
was observed in trigeminal motor and facial nuclei but not in
those innervating extraocular muscles. Scale bars: C, 1 mm; D, 100 µm.
|
|
Structure of the NR3B gene, cDNA, and protein product
Sequence analysis of the clone revealed a cDNA of 3283 bp encoding
a protein of 1003 amino acids (Fig. 1B). The cDNA is
encoded by at least nine exons in the mouse genome spanning ~6.5 kb
(Fig. 1D). A TATA box is found in the genomic
sequence at 339 from the start codon ATG, whereas the cDNA starts at
185, suggesting that a 5' untranslated sequence exists beyond our
cDNA. All nucleotides in the genomic sequence and the cDNA are
identical, indicating that RNA editing does not occur in this gene. The
predicted protein has a significant similarity to NR3A (51%);
therefore, we named it NR3B (Fig. 1A). A glutamate
receptor member named -2 has been reported in abstract form, but
because of a lack of detailed information, the identity of NR3B
with -2 is obscure (Sevarino et al., 1996). The human sequence was
assembled from the genomic sequence deposited in GenBank (Fig.
1B) (third-party annotation section of DNA Data Bank
of Japan/European Molecular Biology Laboratory/GenBank accession number
Bk 000070). The C terminus of the human clone loses homology after
Gly890, which is followed by a possible splice donor site (GGG T), indicating that there may be one or
more additional exons in the human sequence. All of the other
exon-intron boundaries are preserved between the two species and
conform to a consensus splice donor-acceptor site (GT-AG). The
homology between the human and mouse sequence is 81.3%.
NR3B has a transmembrane topology that is typical of glutamate
receptors with an N-terminal signal peptide and four
membrane-associated regions. Five (in mice) or four (in humans)
consensus sequences for N-glycosylation sites are found on the
N-terminal domain, and one (for both species) is found at the loop
between the third and fourth membrane-associated regions. The
intracellular C terminus of mouse NR3B has three threonines and
five serines, which may serve as regulatory phosphorylation sites. The
C terminus ends with Ala-Glu-Ser, which does not conform to the
consensus (PSD-05, Dlg, Z0-1) domain protein-binding site
sequence typical of other glutamate receptor family members (Songyang
et al., 1997; Sheng and Sala, 2001).
The amino acid residues forming the glutamate-binding pocket have been
elucidated by structural studies of the crystallized ligand-binding
domain of glutamate receptor 2 (GluR2) (Armstrong and Gouaux,
2000). Importantly, the 2-carboxyl group of glutamate binds to the
guanidium group of Arg485 and the amino H group of Thr480; the
2-amino group interacts with the carboxyl group of Glu705 in GluR2.
These residues can be mapped precisely on the sequence of NR3B with
Thr480 of GluR2 corresponding to Ser533 of NR3B, Arg485 to Arg538, and
Glu705 to Asp745. Other amino acids forming the putative ligand-binding
pocket are also well conserved (Fig. 1B), indicating
that NR3B itself is likely to bind to glutamate.
Expression of NR3B is limited to motoneurons
The RT-PCR revealed that NR3B is expressed selectively in a
limited number of brain regions. In situ hybridization of a
sagittal section of a mouse brain consistently detected signal in
limited regions in the brainstem (Fig. 2C). A
counterstaining of the sections (data not shown) showed that these are
the trigeminal motor (V), facial
(VII), and ambiguus (IX) nuclei. A
higher magnification of these structures revealed hybridization signals
in motoneurons with large cell bodies (Fig. 2D). In
contrast, the signal was significantly weaker in motoneurons in the
nuclei controlling the external ocular muscles (Fig.
2D, III, oculomotor; IV,
trochlear; and VI, abducens).
In the spinal cord, the signal was also detected in the motoneurons in
the anterior horn (Fig. 3). However, at
the L6 level, the signal intensity of NR3B in motoneurons was
significantly weaker than at higher levels, although the presence of
motoneurons at this level was confirmed by Nissl staining. These
motoneurons were classified as those in Onuf's nucleus, which controls
external anal and urethral sphincters, based on plexus formation of
serotonin immunoreactive fibers on the cell body (Fig. 3,
bottom) (Micevych et al., 1986) and a comparison with the
cytoarchitecture of the mouse spinal cord (Sidman et al., 1971) as well
as with previous studies on a rat counterpart (Schroder, 1980; McKenna
and Nadelhaft, 1986). However, because of a lack of systematic analyses
of Onuf's nucleus in the mouse, this assignment is tentative and
awaits more extensive study (for example, a retrograde labeling) to be conclusive.
View larger version (111K):
[in this window]
[in a new window]
|
Figure 3.
Expression of NR3B in spinal cord.
Left, Low-magnification images of sections stained with
Nissl and adjacent sections hybridized with antisense probe.
Right, Higher magnification of the same sections.
Somatic motoneurons are strongly labeled at the C2 and
L2 levels. In contrast, the expression of NR3B was
significantly weaker in the motoneurons at the L6 level.
There was a plexus of serotonin immunoreactive fibers
(arrowheads) surrounding these cells, which is one of
the characteristics of motoneurons in Onuf's nucleus. Scale bars, 100 µm.
|
|
NR3B acts as a dominant-negative subunit
Finally, we tested the electrophysiological properties of NR3B by
expressing NR3B in HEK293 cells. A conventional NMDA receptor channel
is formed by a heteromeric combination of NR1, which is a key subunit
for functionality, and at least one NR2 subunit, which is
modulatory (Dingledine et al., 1999). NR3B cannot substitute for either
of these subunits, because expression of NR3B alone (n = 6) or coexpression with NR1 (n = 6) or NR2A
(n = 5) did not result in electrophysiologically
functional channels (data not shown), whereas coexpression of NR1 and
NR2A gave a robust current (Fig. 4).
However, coexpression of all three subunits markedly depressed the whole-cell current compared with the combination of NR1
and NR2A (Fig. 4A,C). Increasing the amount of NR3B
versus the other subunits had a stronger suppressive effect (Fig.
4C). This is not attributable to a nonspecific reduction of
the protein expression level, because a direct quantification of
expression levels of NR1 and NR2A tagged with GFP using fluorescence as
a measure did not show any significant difference in the presence or
absence of NR3B (Fig. 4D). The effect of NR3B is
specific to the NMDA receptor, because the AMPA receptor-mediated
current was not changed by the presence of NR3B (Fig. 4C).
The sensitivity of the remaining current to
Mg2+ block was not affected by the
presence of NR3B subunit (Fig. 4B).
View larger version (34K):
[in this window]
[in a new window]
|
Figure 4.
Glutamate-induced whole-cell current recorded from
HEK293 cells expressing NR3B. NR3B was coexpressed with the NR1 and
NR2A subunits. A, Sample traces of glutamate-induced
current recorded at 80 to +60 mV (20 mV step) in the presence or
absence of 1 mM Mg2+. B,
The remaining current in NR3B-expressing cells exhibits a
Mg2+ block indistinguishable from cells not
expressing NR3B. The slight block at 60 and 80 mV may be
attributable to residual Mg2+. C,
NR3B acts as a dominant-negative subunit and suppresses
glutamate-induced whole-cell current in cells coexpressing NR1 and
NR2A. The distribution of averaged responses obtained at +60 mV in
Mg2+-free solution is shown in a cumulative plot.
Increasing the amount of NR3B plasmid (0, 1, and 3 µg) versus other
subunits (each 1 µg) caused a concomitant decrease in current
amplitude. Statistical significances were as follows: 1:1:0 vs 1:1:1,
p < 0.05; 1:1:0 vs 1:1:3, p < 0.01; and 1:1:1 vs 1:1:3, p < 0.01. AMPA
receptor-mediated current was unchanged by coexpression with NR3B.
GluR2-(R586Q)-GFP was used because we know empirically that this
construct gives a reliable response. D, Coexpression
with NR3B did not change the expression levels of NR1 or NR2A. NR1 and
NR2A tagged with GFP were individually expressed with NR3B and their
expression levels were measured by the fluorescence intensity. The
statistical significance in this figure was assessed by a
Kolmogorov-Smirnov test.
|
|
| |
DISCUSSION |
We have identified a novel glutamate subunit, NR3B. The most
intriguing feature of this receptor is its expression pattern. It is
almost exclusively expressed in somatic motoneurons in cranial nerve
nuclei (including trigeminal motor and facial nuclei) and in the spinal
anterior horn, which control somatic movement. In addition to these
somatic motoneurons, there are other classes of motoneurons. The
extraocular muscles are controlled by motoneurons originating from the
oculomotor, trochlear, and abducens nuclei. Also, external urethral and
anal sphincter muscles are controlled by a distinct group of
motoneurons present in Onuf's nucleus in lower spinal cord (Mannen et
al., 1982; Anneser et al., 1999). These different classes of
motoneurons are affected differently under pathological conditions. As
a typical example, in amyotrophic lateral sclerosis (ALS), a selective
loss of somatic motoneurons is observed but no loss of those autonomic
motoneurons and oculomotor neurons is apparent (Mannen et al., 1982;
Anneser et al., 1999; Nimchinsky et al., 2000). Given the importance of
glutamate neurotoxicity in various neurodegenerative diseases (Choi,
1992), we tested the expression of NR3B in those motoneurons.
Strikingly, less expression was clearly observed in these structures
compared with the somatic motoneurons (Figs. 2 and 3). This selective
expression of NR3B in somatic motoneurons versus other types of neurons
may explain a selective loss of somatic motoneurons in ALS. The low but
not absent level of expression is consistent with the fact that
incontinence and opthalmoplegia still appear at the terminal stage
after prolonged respiratory support (Palmowski et al., 1995).
In the glutamate receptor family, the second membrane-associated domain
forms a channel pore. The critical site for determining ion
channel permeability and the selectivity of glutamate receptors is
called the Q/R/N site (Seeburg, 1993; Hollmann and Heinemann, 1994;
Dingledine et al., 1999). Non-NMDA receptors have either a glutamine or
an arginine, and the presence of arginine confers a linear IV
relationship and the monovalent cation selectivity of this class of
channel. In NR1 and NR2 subtypes of NMDA receptor, this site is
asparagine and it is critical for the Mg2+
block at negative potential and the Ca2+
permeability of this channel. The corresponding residue of NR3B is
glycine followed by an arginine, which may also be important for
determining the channel properties. This feature is shared with NR3A
(Fig. 1C). Previous reports indicate that coexpression of
NR3A with NR1 and NR2 also decreases whole-cell current (Ciabarra et
al., 1995; Sucher et al., 1995) as well as single-channel conductance (Das et al., 1998; Standley et al., 2000). A similar mechanism may
explain an observed decrease in the whole-cell current in NR3B-expressing cells. In fact, in an outside-out patch obtained from
motoneurons, one study detected a decreased conductance channel (Pale ek et al., 1999).
Alternatively, this decrease in whole-cell current could be explained
by a decrease in the surface delivery of functional receptors. For
example, NR1A has an endoplasmic reticulum retention signal at the
intracellular C terminus (Standley et al., 2000; Scott et al., 2001).
Also, the AMPA receptor subtype GluR1 has a delivery signal to the
synaptic surface, which retains GluR1 in the absence of
Ca2+/calmodulin-dependent protein kinase
II activity (Hayashi et al., 2000; Shi et al., 2001). A similar
mechanism may be involved in the regulation of the NMDA receptor by the
NR3B subunit.
Because of this dominant-negative role of the NR3B subunit,
downregulation or dysfunction of NR3B would lead to enhanced NMDA receptor activity, which may increase the vulnerability of neurons to
excitotoxicity. Considering the relatively specific expression of NR3B
in somatic motoneurons, reduction of NR3B (for example, by a genetic
mutation) may specifically affect somatic motoneurons. Alternatively,
an autoimmune antibody against NR3B could have a similar impact on
somatic motoneurons, as has been shown for other classes of receptors
and channels (Appel et al., 1993; Rogers et al., 1994; Smitt et al.,
2000). Such mechanisms may explain the selective loss of somatic
motoneurons in ALS. Further characterization of NR3B is indispensable
for a precise understanding of the physiology and pathophysiology of motoneurons.
| |
FOOTNOTES |
Received Aug. 16, 2001; revised Sept. 18, 2001; accepted Sept. 19, 2001.
This study was supported in part by a grant-in-aid for scientific
research from the Ministry of Education, Culture, Sports, Science, and
Technology of Japan and by the Ellison Medical Foundation. We thank
Drs. Kazutoshi Nakazawa, Satoshi Kaneko, Masahiko Watanabe, Ryosuke
Takahashi, Hidenori Suzuki, and Takaaki Abe for valuable discussion and
advice; Drs. Andrés Barría, Yoshitsugu Aoki, Nami
Yamashita, Roberto Malinow, and Shigetada Nakanishi for the NR1 and
NR2A cDNA expression vector constructs; and Dr. Jeffrey Diamond for the
data acquisition program.
Correspondence should be addressed to Yasunori Hayashi, RIKEN-MIT
Neuroscience Research Center, Center for Learning and Memory, Department of Brain and Cognitive Science, Massachusetts Institute of
Technology E18-270, 77 Massachusetts Avenue, Cambridge, MA 02139. E-mail: yhayashi{at}mit.edu.
This article is published in
The Journal of Neuroscience, Rapid Communications Section,
which publishes brief, peer-reviewed papers online, not in print. Rapid
Communications are posted online approximately one month earlier than
they would appear if printed. They are listed in the Table of Contents
of the next open issue of JNeurosci. Cite this article as:
JNeurosci, 2001, 21:RC185 (1-6). The
publication date is the date of posting online at
www.jneurosci.org.
| |
REFERENCES |
-
Anneser JM,
Borasio GD,
Berthele A,
Zieglgansberger W,
Tölle TR
(1999)
Differential expression of group I metabotropic glutamate receptors in rat spinal cord somatic and autonomic motoneurons: possible implications for the pathogenesis of amyotrophic lateral sclerosis.
Neurobiol Dis
6:140-147.
-
Appel SH,
Smith RG,
Engelhardt JI,
Stefani E
(1993)
Evidence for autoimmunity in amyotrophic lateral sclerosis.
J Neurol Sci
118:169-174.
-
Armstrong N,
Gouaux E
(2000)
Mechanisms for activation and antagonism of an AMPA-sensitive glutamate receptor: crystal structures of the GluR2 ligand binding core.
Neuron
28:165-181.
-
Carmignoto G,
Vicini S
(1992)
Activity-dependent decrease in NMDA receptor responses during development of the visual cortex.
Science
258:1007-1011.
-
Choi DW
(1992)
Excitotoxic cell death.
J Neurobiol
23:1261-1276.
-
Ciabarra AM,
Sullivan JM,
Gahn LG,
Pecht G,
Heinemann S,
Sevarino KA
(1995)
Cloning and characterization of -1: a developmentally regulated member of a novel class of the ionotropic glutamate receptor family.
J Neurosci
15:6498-6508.
-
Das S,
Sasaki YF,
Rothe T,
Premkumar LS,
Takasu M,
Crandall JE,
Dikkes P,
Conner DA,
Rayudu PV,
Cheung W,
Chen HS,
Lipton SA,
Nakanishi N
(1998)
Increased NMDA current and spine density in mice lacking the NMDA receptor subunit NR3A.
Nature
393:377-381.
-
Dingledine R,
Borges K,
Bowie D,
Traynelis SF
(1999)
The glutamate receptor ion channels.
Pharmacol Rev
51:7-61.
-
Hayashi Y,
Shi SH,
Esteban JA,
Piccini A,
Poncer JC,
Malinow R
(2000)
Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain interaction.
Science
287:2262-2267.
-
Hollmann M,
Heinemann S
(1994)
Cloned glutamate receptors.
Annu Rev Neurosci
17:31-108.
-
Lu H,
Ozawa H,
Nishi M,
Ito T,
Kawata M
(2001)
Serotonergic neurones in the dorsal raphe nucleus that project into the medial preoptic area contain oestrogen receptor
 .
J Neuroendocrinol
13:839-845. -
Mannen T,
Iwata M,
Toyokura Y,
Nagashima K
(1982)
The Onuf's nucleus and the external anal sphincter muscles in amyotrophic lateral sclerosis and Shy-Drager syndrome.
Acta Neuropathol
58:255-260.
-
McKenna KE,
Nadelhaft I
(1986)
The organization of the pudendal nerve in the male and female rat.
J Comp Neurol
248:532-549.
-
Micevych PE,
Coquelin A,
Arnold AP
(1986)
Immunohistochemical distribution of substance P, serotonin, and methionine enkephalin in sexually dimorphic nuclei of the rat lumbar spinal cord.
J Comp Neurol
248:235-244.
-
Nakanishi S,
Nakajima Y,
Nomura A,
Masu M,
Iwakabe H,
Hayashi Y,
Yokoi M
(1996)
Functions and roles of glutamate receptors in synaptic transmission and plasticity.
Cold Spring Harb Symp Quant Biol
61:67-75.
-
Nimchinsky EA,
Young WG,
Yeung G,
Shah RA,
Gordon JW,
Bloom FE,
Morrison JH,
Hof PR
(2000)
Differential vulnerability of oculomotor, facial, and hypoglossal nuclei in G86R superoxide dismutase transgenic mice.
J Comp Neurol
416:112-125.
-
Paleek JI,
Abdrachmanova G,
Vlachová V,
Vyklicky Jr L
(1999)
Properties of NMDA receptors in rat spinal cord motoneurons.
Eur J Neurosci
11:827-836.
-
Palmowski A,
Jost WH,
Prudlo J,
Osterhage J,
Käsmann B,
Schimrigk K,
Ruprecht KW
(1995)
Eye movement in amyotrophic lateral sclerosis: a longitudinal study.
Ger J Ophthalmol
4:355-362.
-
Perez-Otano I,
Schulteis CT,
Contractor A,
Lipton SA,
Trimmer JS,
Sucher NJ,
Heinemann SF
(2001)
Assembly with the NR1 subunit is required for surface expression of NR3A-containing NMDA receptors.
J Neurosci
21:1228-1237.
-
Philpot BD,
Sekhar AK,
Shouval HZ,
Bear MF
(2001)
Visual experience and deprivation bidirectionally modify the composition and function of NMDA receptors in visual cortex.
Neuron
29:157-169.
-
Quinlan EM,
Philpot BD,
Huganir RL,
Bear MF
(1999)
Rapid, experience-dependent expression of synaptic NMDA receptors in visual cortex in vivo.
Nat Neurosci
2:352-357.
-
Rogers SW,
Andrews PI,
Gahring LC,
Whisenand T,
Cauley K,
Crain B,
Hughes TE,
Heinemann SF,
McNamara JO
(1994)
Autoantibodies to glutamate receptor GluR3 in Rasmussen's encephalitis.
Science
265:648-651.
-
Schroder HD
(1980)
Organization of the motoneurons innervating the pelvic muscles of the male rat.
J Comp Neurol
192:567-587.
-
Scott DB,
Blanpied TA,
Swanson GT,
Zhang C,
Ehlers MD
(2001)
An NMDA receptor ER retention signal regulated by phosphorylation and alternative splicing.
J Neurosci
21:3063-3072.
-
Seeburg PH
(1993)
The TiPS/Trends Neurosci lecture: the molecular biology of mammalian glutamate receptor channels.
Trends Pharmacol Sci
14:297-303.
-
Sevarino KA,
Ciabarra AM,
Forcina MS
(1996)
-1 and -2, members of a novel class of the glutamate receptor superfamily.
Soc Neurosci Abstr
22:592.
-
Sheng M,
Sala C
(2001)
PDZ domains and the organization of supramolecular complexes.
Annu Rev Neurosci
24:1-29.
-
Shi S-H,
Hayashi Y,
Petralia R,
Zaman S,
Wenthold R,
Svoboda K,
Malinow R
(1999)
Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation.
Science
284:1811-1816.
-
Shi S-H,
Hayashi Y,
Esteban JA,
Malinow R
(2001)
Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons.
Cell
105:331-343.
-
Sidman RL,
Angevine Jr JB,
Pierce ET
(1971)
In: Atlas of the mouse brain and spinal cord. Cambridge, MA: Harvard UP, A Commonwealth Fund Book.
-
Simmons DM,
Arriza JL,
Swanson LW
(1989)
A complete protocol for in situ hybridization of messenger RNAs in brain and other tissues with radiolabeled single-stranded RNA probes.
J Histotechnol
12:169-181.
-
Smitt PS,
Kinoshita A,
De Leeuw B,
Moll W,
Coesmans M,
Jaarsma D,
Henzen-Logmans S,
Vecht C,
De Zeeuw C,
Sekiyama N,
Nakanishi S,
Shigemoto R
(2000)
Paraneoplastic cerebellar ataxia due to autoantibodies against a glutamate receptor.
N Engl J Med
342:21-27.
-
Songyang Z,
Fanning AS,
Fu C,
Xu J,
Marfatia SM,
Chishti AH,
Crompton A,
Chan AC,
Anderson JM,
Cantley LC
(1997)
Recognition of unique carboxyl-terminal motifs by distinct PDZ domains.
Science
275:73-77.
-
Standley S,
Roche KW,
McCallum J,
Sans N,
Wenthold RJ
(2000)
PDZ domain suppression of an ER retention signal in NMDA receptor NR1 splice variants.
Neuron
28:887-898.
-
Sucher NJ,
Akbarian S,
Chi CL,
Leclerc CL,
Awobuluyi M,
Deitcher DL,
Wu MK,
Yuan JP,
Jones EG,
Lipton SA
(1995)
Developmental and regional expression pattern of a novel NMDA receptor-like subunit (NMDAR-L) in the rodent brain.
J Neurosci
15:6509-6520.
Copyright © Society for Neuroscience 0270-6474//$05.00/0
This article has been cited by other articles:
|
|
|
|
 
C. T. Smothers and J. J. Woodward
Expression of Glycine-Activated Diheteromeric NR1/NR3 Receptors in Human Embryonic Kidney 293 Cells Is NR1 Splice Variant-Dependent
J. Pharmacol. Exp. Ther.,
December 1, 2009;
331(3):
975 - 984.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. A. Parra, T. Baust, S. El Mestikawy, M. Quiroz, B. Hoffman, J. M. Haflett, J. K. Yao, and G. E. Torres
The Orphan Transporter Rxt1/NTT4 (SLC6A17) Functions as a Synaptic Vesicle Amino Acid Transporter Selective for Proline, Glycine, Leucine, and Alanine
Mol. Pharmacol.,
December 1, 2008;
74(6):
1521 - 1532.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. H. Ulbrich and E. Y. Isacoff
Rules of engagement for NMDA receptor subunits
PNAS,
September 16, 2008;
105(37):
14163 - 14168.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Wang and W. Slikker Jr
Strategies and Experimental Models for Evaluating Anesthetics: Effects on the Developing Nervous System
Anesth. Analg.,
June 1, 2008;
106(6):
1643 - 1658.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. H.M. Burghes and M. E.R. Butchbach
Let all DNA vote: Who are the amyotrophic lateral sclerosis candidates?
Neurology,
February 26, 2008;
70(9):
662 - 663.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Niemann, J. E. Landers, M. J. Churchill, B. Hosler, P. Sapp, W. C. Speed, B. T. Lahn, K. K. Kidd, R. H. Brown Jr, and Y. Hayashi
Motoneuron-specific NR3B gene: No association with ALS and evidence for a common null allele
Neurology,
February 26, 2008;
70(9):
666 - 676.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
O. Biondi, C. Grondard, S. Lecolle, S. Deforges, C. Pariset, P. Lopes, C. Cifuentes-Diaz, H. Li, B. della Gaspera, C. Chanoine, et al.
Exercise-Induced Activation of NMDA Receptor Promotes Motor Unit Development and Survival in a Type 2 Spinal Muscular Atrophy Model Mouse
J. Neurosci.,
January 23, 2008;
28(4):
953 - 962.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Tong, H. Takahashi, S. Tu, Y. Shin, M. Talantova, W. Zago, P. Xia, Z. Nie, T. Goetz, D. Zhang, et al.
Modulation of NMDA Receptor Properties and Synaptic Transmission by the NR3A Subunit in Mouse Hippocampal and Cerebrocortical Neurons
J Neurophysiol,
January 1, 2008;
99(1):
122 - 132.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Villmann and C.-M. Becker
On the Hypes and Falls in Neuroprotection: Targeting the NMDA Receptor
Neuroscientist,
December 1, 2007;
13(6):
594 - 615.
[Abstract]
[PDF]
|
|
|
|
|
|
|
P. T. Atlason, M. L. Garside, E. Meddows, P. Whiting, and R. A. J. McIlhinney
N-Methyl-D-aspartate (NMDA) Receptor Subunit NR1 Forms the Substrate for Oligomeric Assembly of the NMDA Receptor
J. Biol. Chem.,
August 31, 2007;
282(35):
25299 - 25307.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. T. Smothers and J. J. Woodward
Pharmacological Characterization of Glycine-Activated Currents in HEK 293 Cells Expressing N-Methyl-D-aspartate NR1 and NR3 Subunits
J. Pharmacol. Exp. Ther.,
August 1, 2007;
322(2):
739 - 748.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W. Slikker Jr, X. Zou, C. E. Hotchkiss, R. L. Divine, N. Sadovova, N. C. Twaddle, D. R. Doerge, A. C. Scallet, T. A. Patterson, J. P. Hanig, et al.
Ketamine-Induced Neuronal Cell Death in the Perinatal Rhesus Monkey
Toxicol. Sci.,
July 1, 2007;
98(1):
145 - 158.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Awobuluyi, J. Yang, Y. Ye, J. E. Chatterton, A. Godzik, S. A. Lipton, and D. Zhang
Subunit-Specific Roles of Glycine-Binding Domains in Activation of NR1/NR3 N-Methyl-D-aspartate Receptors
Mol. Pharmacol.,
January 1, 2007;
71(1):
112 - 122.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. P. Bellinger, B. K. Fox, W. Y. Chan, L. K. Davis, M. A. Andres, T. Hirano, E. G. Grau, and I. M. Cooke
Ionotropic glutamate receptor activation increases intracellular calcium in prolactin-releasing cells of the adenohypophysis
Am J Physiol Endocrinol Metab,
December 1, 2006;
291(6):
E1188 - E1196.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Yao and M. L. Mayer
Characterization of a soluble ligand binding domain of the NMDA receptor regulatory subunit NR3A.
J. Neurosci.,
April 26, 2006;
26(17):
4559 - 4566.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. E. Calcagnotto and S. C. Baraban
Prolonged NMDA-Mediated Responses, Altered Ifenprodil Sensitivity, and Epileptiform-Like Events in the Malformed Hippocampus of Methylazoxymethanol Exposed Rats
J Neurophysiol,
July 1, 2005;
94(1):
153 - 162.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Yamakura, A. R. Askalany, A. B. Petrenko, T. Kohno, H. Baba, and K. Sakimura
The NR3B Subunit Does Not Alter the Anesthetic Sensitivities of Recombinant N-Methyl-d-Aspartate Receptors
Anesth. Analg.,
June 1, 2005;
100(6):
1687 - 1692.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. J. Vannucci and H. Hagberg
Hypoxia-ischemia in the immature brain
J. Exp. Biol.,
August 15, 2004;
207(18):
3149 - 3154.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Picconi, F. Gardoni, D. Centonze, D. Mauceri, M. A. Cenci, G. Bernardi, P. Calabresi, and M. Di Luca
Abnormal Ca2+-Calmodulin-Dependent Protein Kinase II Function Mediates Synaptic and Motor Deficits in Experimental Parkinsonism
J. Neurosci.,
June 9, 2004;
24(23):
5283 - 5291.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. A. Simeone, R. M. Sanchez, and J. M. Rho
Molecular Biology and Ontogeny of Glutamate Receptors in the Mammalian Central Nervous System
J Child Neurol,
May 1, 2004;
19(5):
343 - 360.
[Abstract]
[PDF]
|
|
|
|
|
|
|
K. J. Todd, C. A. B. Slatter, and D. W. Ali
Activation of Ionotropic Glutamate Receptors on Peripheral Axons of Primary Motoneurons Mediates Transmitter Release at the Zebrafish NMJ
J Neurophysiol,
February 1, 2004;
91(2):
828 - 840.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. W. Dunah, A. C. Sirianni, A. A. Fienberg, E. Bastia, M. A. Schwarzschild, and David. G. Standaert
Dopamine D1-Dependent Trafficking of Striatal N-Methyl-D-aspartate Glutamate Receptors Requires Fyn Protein Tyrosine Kinase but Not DARPP-32
Mol. Pharmacol.,
January 1, 2004;
65(1):
121 - 129.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Matsuda, M. Fletcher, Y. Kamiya, and M. Yuzaki
Specific Assembly with the NMDA Receptor 3B Subunit Controls Surface Expression and Calcium Permeability of NMDA Receptors
J. Neurosci.,
November 5, 2003;
23(31):
10064 - 10073.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. B. Petrenko, T. Yamakura, H. Baba, and K. Shimoji
The Role of N-Methyl-D-Aspartate (NMDA) Receptors in Pain: A Review
Anesth. Analg.,
October 1, 2003;
97(4):
1108 - 1116.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Fukaya, A. Kato, C. Lovett, S. Tonegawa, and M. Watanabe
Retention of NMDA receptor NR2 subunits in the lumen of endoplasmic reticulum in targeted NR1 knockout mice
PNAS,
April 15, 2003;
100(8):
4855 - 4860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Desai, D. Turetsky, K. Vasudevan, and A. Buonanno
Analysis of Transcriptional Regulatory Sequences of the N-Methyl-D-aspartate Receptor 2A Subunit Gene in Cultured Cortical Neurons and Transgenic Mice
J. Biol. Chem.,
November 22, 2002;
277(48):
46374 - 46384.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. A. Al-Hallaq, B. R. Jarabek, Z. Fu, S. Vicini, B. B. Wolfe, and R. P. Yasuda
Association of NR3A with the N-Methyl-D-aspartate Receptor NR1 and NR2 Subunits
Mol. Pharmacol.,
November 1, 2002;
62(5):
1119 - 1127.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
