 |
Previous Article | Next Article 
The Journal of Neuroscience, April 1, 2001, 21(7):2361-2372
Evidence for the Involvement of Tiam1 in Axon Formation
Patricia
Kunda1,
Gabriela
Paglini1,
Santiago
Quiroga2,
Kenneth
Kosik3, and
Alfredo
Cáceres1
1 Instituto Mercedes y Martín Ferreyra
(INIMEC-CONICET), 5000 Cordoba, Argentina, 2 Departamento
Química Bíologica (CIQUIBIC-CONICET), Universidad Nacional
Córdoba, 5000 Córdoba, Argentina, and
3 Department of Neurology (Neuroscience), Harvard Medical
School and Center for Neurological Diseases, Department of Medicine,
Brigham and Women's Hospital, Boston, Massachusetts 02115
 |
ABSTRACT |
In cultured neurons, axon formation is preceded by the appearance
in one of the multiple neurites of a large growth cone containing a
labile actin network and abundant dynamic microtubules. The invasion-inducing T-lymphoma and metastasis 1 (Tiam1) protein that
functions as a guanosine nucleotide exchange factor for Rac1 localizes
to this neurite and its growth cone, where it associates with
microtubules. Neurons overexpressing Tiam1 extend several axon-like
neurites, whereas suppression of Tiam1 prevents axon formation, with
most of the cells failing to undergo changes in growth cone size and in
cytoskeletal organization typical of prospective axons. Cytochalasin D
reverts this effect leading to multiple axon formation and penetration
of microtubules within neuritic tips devoid of actin filaments. Taken
together, these results suggest that by regulating growth cone actin
organization and allowing microtubule invasion within selected growth
cones, Tiam1 promotes axon formation and hence participates in neuronal polarization.
Key words:
Tiam1; microtubules; microfilaments; axons; growth cones; polarity
 |
INTRODUCTION |
Neuronal polarization occurs
when one of the multiple neurites emerging from the cell body initiates
a phase of rapid elongation; this neurite becomes the axon, whereas the
remaining ones develop as dendrites (Dotti et al.,
1988 ). In cultured hippocampal pyramidal neurons, axon
formation is preceded by the appearance in one of the multiple neurites
of a large and highly dynamic growth cone containing a very labile
actin network (Bradke and Dotti, 1997 , 1999 ;
Paglini et al., 1998a ). Thus, the regulation of actin
organization and activity within selected growth cones appears to be
one of the major factors underlying the establishment of neuronal polarity.
Members of the Ras superfamily of small GTPases control a wide variety
of cellular responses (Bogusky and McCormick, 1993 ) and
a subgroup of this family, the Rho-like GTPases, affects the organization of the actin cytoskeleton. In fibroblasts, Cdc42 is
involved in the induction of filopodia, whereas Rac induces the
formation of lamellipodia, and Rho leads to the assembly of actin
stress fibers (Ridley and Hall, 1992 ; Ridley et
al., 1992 ; Nobes and Hall, 1995 ). Not
surprisingly, Rho-like GTPases have recently been put forward as
potential regulators of neurite outgrowth. Activation of Rho by
thrombin and the lysophospholipid LPA induces neurite retraction in
mouse neuroblastoma cells (Mackay et al., 1995 ), whereas
expression of constitutively active variants of Rac promote neurite
extension in Drosophila (Luo et al., 1994 ) and primary neurons (van Leeuwen et al., 1997 );
conversely, inhibition of Rac activity in both Drosophila
and mice blocks the growth of axons (Luo et al., 1994 ,
1996 ). Taken collectively, these observations demonstrate that
Rac- and Rho-mediated pathways oppose each other during neurite
formation and that regulation of their balance may have a role in
determining neuronal morphology.
Evidence in favor of such a possibility has come from studies showing
the involvement of guanosine nucleotide exchange factors (GEFs), which
activate these GTPases by catalyzing the exchange of GDP for GTP. One
of these factors is the invasion-inducing T-lymphoma and metastasis 1 (Tiam1) protein that functions as a GEF for Rac1 (Habets et al.,
1994 ). Tiam1 is expressed at high levels in the developing
brain (Habets et al., 1995 ), and its overexpression
promotes lamellar spreading and neurite formation in neuroblastoma
cells (van Leeuwen et al., 1997 ). Because one of the
early events during neuronal polarization appears to involve the
regulation of actin organization and dynamics by Rho-GTPases (Bradke and Dotti, 1999 ), it may well be that factors
such as Tiam1 have an active participation in this event.
To test this hypothesis, in the present study we have analyzed the
pattern of expression, subcellular distribution, and consequences of
Tiam1 overexpression and suppression on axon formation in cultured hippocampal pyramidal neurons. The results obtained suggest the participation of Tiam1 in the establishment of neuronal polarity.
 |
MATERIALS AND METHODS |
Cell culture. Dissociated cultures of hippocampal
pyramidal cells from embryonic rat brain tissue were prepared as
described previously (Cáceres et al., 1986 ;
Mascotti et al., 1997 ). Cells were plated onto
polylysine-coated glass coverslips (12 or 25 mm in diameter) at
densities ranging from 5,000 to 15,000 cells/cm2 and
maintained with DMEM plus 10% horse serum for 1 hr. The coverslips with the attached cells were then transferred to 60 mm Petri dishes containing serum-free medium plus the N2 mixture of Bottenstein and Sato (1979) . All cultures were maintained in a humidified 37°C incubator with 5% CO2. For some experiments
cytochalasin D was added to the cultures at a concentration of 0.5 µg/ml.
Expression construct and transient transfection assays. A
Tiam1 cDNA (C1199) (Habets et al., 1994 ; van
Leeuwen et al., 1997 ) cloned as a
BamHI/XhoI fragment into pcDNA3 containing a
cytomegalovirus promoter and a hemoagglutinin (HA) tag (Invitrogen,
Carlsbad, CA), a generous gift of Dr. John Collard (The Netherlands
Cancer Institute, Amsterdam, The Netherlands), was used for
transfection of primary neurons. Transient transfection of cultured
hippocampal pyramidal neurons was performed using the modified calcium
phosphate precipitation method described by Xia et al.,
(1996) .
Antisense oliqonucleotides. Phosphorothioate
oligonucleotides were used in this study. One of them, designated
AST1a, corresponds to the sequence AACGTCCGATGACAGCCTTAAACCA and is the
inverse complement of nucleotides +1231-1255 of the sequence of mouse
Tiam1; oligonucleotide AST1b, consisting of the sequence
AGAGACTCCTCCGTACAGTAATTA, is the inverse complement of nucleotides
+1307-1330 of the mouse sequence. Both of the regions selected from
the sequence show no significant homology with any other sequence,
except for that of Tiam1.
The oligonucleotides were purified by reverse chromatography and taken
up in serum-free medium as described previously (Paglini et al.,
1998a ,b ). For all experiments the antisense oligonucleotides were preincubated with 2 µl of Lipofectin Reagent (1 mg/ml; Life Technologies, Gaithersburg, MD) diluted in 100 µl of serum-free medium. The resulting oligonucleotide suspension was then added to the
primary cultured neurons at concentrations ranging from 0.5 to 5 µM. Control cultures were treated with the same
concentration of the corresponding sense-strand oligonucleotides.
Primary antibodies. The following primary antibodies were
used in this study: a monoclonal antibody (mAb) against tyrosinated -tubulin (clone TUB-1A2, mouse IgG; Sigma, St. Louis, MO) diluted 1:1000; an mAb against microtubule-associated protein (MAP)1b clone AA6
(DiTella et al., 1996 ) diluted 1:500; an mAb
against MAP2 (clone AP14) (Caceres et al., 1992 ); an mAb
against tau (clone tau-1) (Caceres et al., 1992 );
a rabbit antiserum against - and -tubulin (Sigma); an
affinity-purified rabbit polyclonal antibody raised against a peptide
corresponding to an amino acid sequence mapping at the C terminus of
Tiam1 of mouse origin (C16; Santa Cruz Biotechnology, Santa Cruz, CA)
diluted 1:500, 1:100 or 1:50; an mAb against a peptide corresponding to
an amino acid sequence of RhoA of human origin (clone 26C4, mouse IgG;
Santa Cruz Biotechnology) diluted 1:100 or 1:50; and an
affinity-purified rabbit polyclonal antibody raised against a peptide
corresponding to an amino acid sequence mapping at the C terminus of
Rac1 of human origin (identical to mouse sequence, C14; Santa Cruz
Biotechnology) diluted 1:100 or 1:50.
Immunofluorescence. Cells were fixed before or after
detergent extraction under microtubule-stabilizing conditions and
processed for immunofluorescence as described previously
(Paglini et al., 1998a ). For some experiments a mild
extraction protocol that preserves cytoskeletal-membrane interactions
was also used (Nakata and Hirokawa, 1987 ; Brandt
et al., 1995 ; Paglini et al., 1998b ). The
antibody staining protocol entailed labeling with the first primary
antibody, washing with PBS, staining with labeled secondary antibody
(fluorescein or rhodamine conjugated), and washing similarly; the same
procedure was repeated for the second primary antibody. Incubations
with primary antibodies were for 1 or 3 hr at room temperature, whereas incubations with secondary antibodies were performed for 1 hr at
37°C. For some experiments, rhodamine-labeled phalloidin (Molecular Probes, Eugene, OR) was included with the secondary antibody to visualize filamentous actin (F-actin). The cells were analyzed with a
Zeiss LSM 410 confocal scanning microscope or with an inverted microscope (Carl Zeiss Axiovert 35M) equipped with epifluorescence and
differential interference contrast optics. For some experiments, the
relative intensities of tubulin, Tiam1, Rac1, and RhoA
immunofluorescence, as well as of phalloidin staining, were evaluated
in fixed unextracted cells or in detergent-extracted cytoskeletons
using quantitative fluorescence techniques as described previously
(Paglini et al., 1998a ,b ). To image labeled cells, the
incoming epifluorescence illumination was attenuated with glass neutral
density filters. Images were formed on the faceplate of a Silicon
Intensified Target camera (SIT; Hamamatsu Corporation, Middlesex, NJ)
set for manual sensitivity, gain, and black level; they were digitized
directly into a Metamorph/Metafluor Image Processor (Universal Imaging Corporation, West Chester, PA) controlled by a host IBM-AT computer and
stored on laser discs with an optical memory disc recorder (OMDR,
LQ-3031, Panasonic). Fluorescence intensity measurements were performed
pixel by pixel within the cell body and neurites of identified neurons;
using this data, we then calculated the average fluorescence intensity
within the cell body and inner, middle, and distal third of identified
neurites (either minor processes or axons), including the central and
peripheral regions of growth cones. Photographs were printed using
Adobe Photoshop.
Subcellular fractionation techniques. Fetal rat brain (18 d
of gestation) was fractionated according to Pfenninger et al. (1983) (see also Paglini et al., 1998a ,b ) to
obtain growth cone particles (GCPs). Briefly, the low speed supernatant
of fetal brain homogenate was loaded on a discontinuous
sucrose gradient in which the 0.75 and 1 M sucrose layers
were replaced with a single 0.83 M sucrose step. This
facilitated collection of the interface and increased GCP yield without
decreasing purity (Quiroga et al., 1995 ). The 0.32 M/0.83 M interface, or A fraction, was collected, diluted with 0.32 M sucrose, and pelleted to
give the GCP fraction. This was resuspended in 0.32 M
sucrose for experimentation.
Preparation of microtubules. Microtubules were prepared from
5-d-old rat brains through three cycles of temperature-dependent assembly-disassembly purification as described by Ihara et al. (1979) . Microtubules were also prepared essentially according to the taxol method of Vallee (1982) . To dissociate MAPs
from microtubules, microtubule pellets were resuspended in buffer A (0.1 M MES, pH 6.5, 1 mM EGTA, 1 mM
MgCl2) containing 1 mM GTP and 20 µM taxol,
and NaCl was added to 0.5 M. After incubation at 37°C for
10 min, the solution was centrifuged at 30,000 × g for
25 min, leaving the MAPs in the supernatant (Vallee,
1982 ). The MAP fraction was submitted to gel filtration on a
Superose 12 HR 10/30 column (Pharmacia, Upsala, Sweden) equilibrated
and eluted with 20 mM PIPES, pH 6.9, 0.1 M
NaCl, 1 mM EGTA, 0.5 mM MgCl2, 1 mM
dithiothreitol, and 0.1 mM GTP at a flow rate of 0.5 ml/min, and fractions of 0.25 ml were collected. The MAP fraction was
also loaded on a phosphocellulose (P11) (Whatman, Maidstone, UK) column
equilibrated with buffer A and eluted with buffer A containing 0.1-0.5
M NaCl in stepwise increments [see also
Morishima-Kawashima and Kosik (1996) ].
Western blot analysis of Tiam1 protein expression. Changes
in the levels of Tiam1 during neuronal development were analyzed by
Western blotting as described previously (Paglini et al.,
1998a ,b ). Briefly, equal amounts of crude brain homogenates or
whole-cell extracts from cultured cells were separated on SDS-PAGE and
transferred to polyvinylidene difluoride membranes in a Tris-glycine
buffer, 20% methanol. The filters were dried, washed several times
with TBS (10 mM Tris, pH 7.5, 150 mM NaCl), and
blocked for 1 hr in TBS containing 5% BSA. The filters were incubated
for 1 hr at 37°C with the primary antibodies in TBS containing 5%
BSA. They were then washed three times (10 min each) in TBS containing
0.05% Tween 20 and incubated with a secondary horseradish
peroxidase-conjugated antibody (Promega Corporation, Madison, WI) for 1 hr at 37°C. After five washes with TBS and 0.05% Tween 20, the blots
were developed using a chemiluminiscence detection kit (ECL, Amersham Life Science, Buckinghamshire, England).
Morphometric analysis of neuronal shape parameters. Images
were digitized on a video monitor using Metamorph/Metafluor software. To measure neurite length or growth cone shape parameters, fixed unstained or antibody-labeled cells were randomly selected and traced
from a video screen using the morphometric menu of the Metamorph as
described previously (Paglini et al., 1998a ,b ).
Differences among groups were analyzed by the use of ANOVA and
Student-Newman-Keuls test.
 |
RESULTS |
Changes in the morphology and cytoskeletal organization of growth
cones during the establishment of neuronal polarity
In the first set of experiments, changes in growth cone size and
shape, as well as in the distribution of microtubules and microfilaments, were evaluated in control hippocampal pyramidal neurons
maintained in culture for 24 hr. At this time point, ~70% of the
neurons have extended a symmetric array of short neurites, designated
as minor processes (stage 2) (Dotti et al., 1988 ), whereas 25% have already extended an axon (stage 3) that exceeds the
length of the other processes in >20 µm. We observed that in >60%
of stage 2 cells, a single growth cone was distinctively larger than
the others [see also Bradke and Dotti (1997) ].
Quantitative measurements of growth cone surface area revealed that
this growth cone was three to four times larger than those of the
remaining minor neurites (Fig.
1A,B); a similar
phenomenon was detected in the majority of stage 3 cells (Fig.
1A,B).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 1.
A, Graph showing variations in surface
area (µm2) of growth cones from minor processes
(MP), prospective axons (pAxon), and axons
(Axon) of stage 2 or 3 hippocampal pyramidal neurons.
B, Frequency histogram analysis showing variations in growth
cone surface among MP, prospective axons, and axons of stage 2-3
hippocampal pyramidal neurons. C, A confocal micrograph
showing a stage 2 neuron with several minor neurites; note that one of
them displays a large growth cone. The cell was double labeled with an
mAb against tyrosinated -tubulin (green) and
rhodamine phalloidin (red). D, E, High-power
confocal images showing the distribution of microtubules
(green) and F-actin (red) in large growth
cones from stage 2 hippocampal pyramidal neurons. Note that the growth
cones display a large, flattened lamellipodial veil with short actin
ribs and that microtubules enter the central growth cone region.
F, G, High-power fluorescence micrographs showing the
distribution of tyrosinated -tubulin (F) and
F-actin (G) in a small growth cone of a stage 2 hippocampal pyramidal neuron. H, Red-green
overlay of the images shown in F and G. Note that
F-actin (red) occupies the central and peripheral region of
the growth cone and that microtubules (green) end at
its base. Scale bars: C, 10 µm; D, E, 5 µm; F-H, 7 µm.
|
|
Confocal and high-resolution fluorescence microscopy of stage 2 or 3 neurons labeled with an mAb against tyrosinated -tubulin and
rhodamine phalloidin revealed that the larger growth cone displays a
central microtubule-containing zone completely surrounded by a
peripheral lamellipodial veil composed of a radially oriented array of
short actin ribs (Fig. 1C-E). By contrast, the remaining minor neurites display growth cones with radial striations that originate at the base of the growth cone and reach its periphery; in
addition, fewer microtubules penetrate in the central growth cone
region, with the majority of them ending at its base (Fig. 1F-H). Taken together, these observations
strongly suggest that a major change accompanying the transformation of
a growth cone from a minor neurite into that of an axon involves an
expansion of the peripheral lamellipodial veil, a shortening of actin
ribs, and the penetration of dynamic microtubules within the central growth cone region.
Expression of Tiam1 during neuronal development
The monospecificity of the affinity-purified rabbit
polyclonal antibody raised against a peptide corresponding to an amino acid sequence mapping at the C terminus of Tiam1 of mouse origin is
shown in Figure 2A.
This antibody recognizes a single band of ~190 kDa Mr in
Western blots of whole-cell homogenates from the cerebral cortex of
developing rats (Fig. 2 A, lanes 1-3). In the cerebral
cortex or hippocampus, the expression of the Tiam1-immunoreactive protein species is higher at late embryonic and early postnatal days
and declines gradually but significantly until adulthood, where the
lowest levels are detected. A similar analysis performed with cell
extracts obtained from cultured hippocampal pyramidal neurons revealed
an increase in Tiam1 protein levels 24 hr after plating, just at the
time in which cells are beginning to extend axons; no further increases
were detected at later time points. RhoA also increases with a similar
time course, whereas Rac1 protein levels peak 1 d after plating
and afterward show a slight decrease (data not shown).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 2.
A, Specificity of the affinity-purified
peptide antibody against Tiam1 (C-16) as revealed by Western blot
analysis of whole-tissue extracts obtained from the cerebral cortex of
3-d-old rats. The Tiam1 antibody diluted 1:100 (lane 1) or
1:250 (lane 2) stains a single immunoreactive protein
species with an apparent molecular weight of 190 kDa. The staining
generated by this antibody (dilution 1:100) is completely abolished by
neutralization with the corresponding purified peptide (lane
3). Ten micrograms of total protein were loaded in each lane.
B, Red-green overlay showing the distribution of
Tiam1 (green) and F-actin (red) in a stage
1 hippocampal pyramidal neuron; note that Tiam1 immunofluorescence is
localized to the cell body. For this experiment the Tiam1 antibody was
used at a concentration of 1 µg/ml. C, D,
Double-immunofluorescence micrographs showing the distribution of
tyrosinated -tubulin (green) and Tiam1
(red) in stage 2 hippocampal pyramidal neurons. Note that
Tiam1 is preferentially localized to a single neurite; this neurite
usually displays the larger growth cone. For this experiment the
antibody was used at a dilution of 1:100 (0.2 µg/ml). E,
F, High-power view of an axonal growth cone from a culture labeled
with the Tiam1 antibody (green) and rhodamine
phalloidin (red). Note that Tiam1 immunolabeling localizes
to the axonal shaft and the central and peripheral region of the growth
cone. The Tiam1 antibody was used at a concentration of 1 µg/ml.
G, H, Double-immunofluorescence micrographs showing the
distribution of tyrosinated -tubulin (G) and Rac1
(H) in a stage 2 hippocampal pyramidal neuron. Note
that Rac1 localizes to all minor processes and their growth cones.
Scale bar: B-D, G, H, 10 µm; E, F, 5 µm;
I, Western blots of total homogenates from embryonic rat
brain (lane 1) and growth cone particles (lane 2)
reacted with antibodies against Tiam1, RhoA, and Rac1. Note that Tiam1
is enriched in the growth cone fraction. Ten micrograms of total
protein were loaded in each lane.
|
|
Tiam1 preferentially localizes to the neurite displaying the larger
growth cone in stage 2-3 hippocampal pyramidal cells
The subcellular distribution of Tiam1 in cultured hippocampal
pyramidal neurons was analyzed by fluorescence microscopy. In stage 1 neurons, light Tiam1 immunofluorescence was found in the cell body
(Fig. 2B); no staining of the lamellipodial veil that surrounds the cell body was detected in these cells (antibody concentration, 1-2 µg/ml). In stage 2 neurons, an intense staining of the cell body and one of the several minor neurites that individual cells extend was observed with the Tiam1 antibody used at a
concentration of 0.2-0.5 µg/ml (Fig. 2C,D). In >90% of
the cases, the minor process with the larger growth cone was the one
displaying intense Tiam1 immunofluorescence. In this neurite, Tiam1
immunolabeling extends toward the tip and reaches the base and central
region of the growth cone. At higher antibody concentrations (1-2
µg/ml), Tiam1 immunolabeling was also detected within the peripheral
lamellipodial veil of the larger growth cone (Fig.
2E,F). To test whether this pattern was shared
with proteins of the Ras superfamily of small GTPases, the subcellular
localization of rac1 and rhoA was analyzed in stage 2 hippocampal
pyramidal neurons. The results obtained showed that both proteins have
a widespread distribution localizing to all neuritic shafts and their
growth cones (Fig. 2G,H). In a complementary series
of experiments, we used quantitative fluorescence techniques to measure
the relative amounts of Tiam1, rac1, and rhoA in axons, minor neurites,
and growth cones of stage 2 or 3 hippocampal pyramidal neurons. The
results obtained, which are shown in Table
1, confirmed our observations and clearly
established that Tiam1 immunolabeling is preferentially localized to
the minor neurite displaying the larger growth cone in the case of
stage 2 neurons or to the axon in stage 3 neurons.
View this table:
[in this window]
[in a new window]
|
Table 1.
Quantitative measurements of Tiam1, Rac1, and RhoA
immunofluorescence in growth cones of cultured hippocampal pyramidal
cells
|
|
To confirm biochemically the presence of Tiam1 within growth
cones, GCPs were isolated from the cerebral cortex (see Materials and
Methods) and probed with the antibody against Tiam1 used at a
concentration of 1 µg/ml. The results obtained clearly revealed that
Tiam1 was not only present, but also enriched in GCPs obtained from the
embryonic cerebral cortex (Fig. 2I, lanes 1,2).
Tiam1 associates with microtubules
To test whether the localization of Tiam1 in neurites and growth
cones involves an interaction with components of the cytoskeleton, neurons were extracted with Triton X-100 (0.2%) before fixation under
microtubule stabilizing conditions (Paglini et al.,
1998a ). This procedure, which selectively removes cytosolic
proteins while preserving microtubules, did not significantly alter the
distribution of Tiam1 when compared with that observed in cells fixed
before detergent extraction. In addition, high-resolution fluorescence microscopy revealed a significant colocalization of Tiam1 with microtubules along the central and peripheral regions of axonal growth
cones (Fig. 3A-D).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 3.
Tiam1 associates with microtubules.
A-D, Double-fluorescence micrographs showing the
distribution of tyrosinated microtubules (A), Tiam1
(B, D), and rhodamine phalloidin (C) in
axonal growth cones. For this experiment cultures were extracted with
detergents before fixation under microtubule-stabilizing conditions.
Note that Tiam colocalizes with microtubules located in the central and
peripheral regions of the growth cone; there is also some Tiam1
colocalization with F-actin. Scale bar, 5 µm. E, Western
blot showing the relative levels of tubulin and Tiam1 in a total brain
homogenate (lane 1) and in microtubules (lane 2)
prepared through repeated cycles (3) of temperature-dependent assembly
and disassembly. Tubulin was visualized with a rabbit polyclonal
antibody that recognizes - and -tubulin, whereas Tiam1 was
visualized with the C-16 antibody diluted 1:250. Total brain homogenate
and microtubules were prepared from the cerebral cortex of 5-d-old
rats. Five micrograms of total protein were loaded in each lane.
F, Western blots showing that Tiam1 is eluted from a
microtubule-associated protein (MAP) fraction in the
presence of 0.3 M NaCl. For this experiment a MAP fraction
was applied onto a phosphocellulose column from which the bound
proteins were eluted in a stepwise gradient with 0.1-0.5 M
NaCl as indicated at the top of each lane.
Aliquots from each fraction were immunoblotted with antibodies against
MAP1b, MAP2, Tiam1, and tau. G, Western blots show the
distribution of MAP1b, Tiam1, and tau after fractionation of the MAPs
on a size-exclusion column; no codistribution of Tiam with either MAP1b
or tau was detected.
|
|
To verify biochemically the association of Tiam1 with microtubules,
microtubules and microtubule-binding proteins were purified from
high-speed extracts of newborn rat cerebral cortex using two standard
methods and analyzed by immunoblotting. Co-purification through
repeated cycles of temperature-dependent microtubule assembly and
disassembly showed that a high proportion of Tiam1 associates with
microtubules even in pellets from the third cycle of assembly (Fig.
3E), the usual criterion for defining a MAP.
Co-sedimentation of assembled microtubules using taxol also brought
down a considerable amount of the total Tiam1 (data not shown). When
the MAP fraction was separated from the tubulin fraction by increasing
the salt concentration in the presence of taxol and GTP, Tiam1
distributed to the MAP fraction. To resolve Tiam1 from co-eluting MAPs,
we separated the MAP fraction using a cation-exchange column, a
phosphocellulose column. An immunoblot analysis of the MAP fraction
applied onto and eluted from the column revealed that the elution
position of Tiam1 precisely corresponds to 0.3 M NaCl
eluates; Tau and MAP2 a/b proteins, but not MAP2c or MAP1b, were also
detected in the 0.3 M NaCl eluate (Fig.
3F). Therefore, to examine a possible association of
Tiam1 with Tau or MAP2, the MAP fraction was further examined using a
gel-filtration column under native conditions. The results obtained
showed that almost all of the Tiam1 eluted from the column at the
elution volume expected from its molecular weight; in addition, this
analysis revealed no co-elution of Tiam1 with MAP1b (Fig.
3G), MAP2 (data not shown), or tau (Fig. 3G). To
further investigate a possible association of Tiam1 with MAPs, MAP2,
tau, and MAP1b were immunoprecipitated from rat brain extracts and
analyzed for the presence of Tiam1; as expected according to our
previous results, no Tiam1 was detected in the immunoprecipitates (data
not shown).
Overexpression of Tiam1 induces the extension of multiple
axon-like neurites
The time course of expression and the subcellular localization of
Tiam1 are consistent with the possibility of this protein participating in axon formation and hence in the establishment of
neuronal polarity. Therefore, to investigate this possibility we first
examined the consequences of Tiam1 overexpression on the morphological
development of cultured hippocampal pyramidal neurons. For such a
purpose, cells were transfected with an NH2 terminally truncated
variant known as C1199 Tiam1. This variant can efficiently activate
Rac1, is more stably expressed, and appears to be more active than the
full-length protein (Habets et al., 1994 ; van
Leeuwen et al., 1997 ). Cells were transfected with 6 or 12 µg
of C1199 Tiam1 using a modified calcium phosphate precipitation protocol 12 hr after plating; 1 d later, the cultures were fixed and processed for immunofluorescence with antibodies against Tiam1, HA,
tyrosinated -tubulin, and tau-1, or labeled with rhodamine phalloidin. Staining with the Tiam1 antibody used at a dilution of
1:500 (0.05 µg/ml) allows for a rapid and reliable identification of
transfected neurons, because cells expressing normal levels of
Tiam1 display very light immunofluorescence, whereas in those overexpressing Tiam1 a very high immunofluorescence signal was detected
(Fig. 4). Using this criterion we
estimated a transfection efficiency of ~5%, which is well within the
value reported by Xia et al., (1996) . A similar result
was obtained when the cells were stained with the HA antibody (data not
shown). Analysis of the morphology of neurons overexpressing C1199
Tiam1 revealed that after either 12 or 24 hr, >95% of these cells
have extended several long (>50 µm) and thin processes that resemble
axon-like neurites. As shown in Figure 4A-D, these
neurites were highly immunoreactive with the Tiam1 antibody;
interestingly, they also stained with tau1 (Fig. 4C,D), an
mAb that recognizes a dephosphorylated variant of tau normally present
in axonal processes (Cáceres et al., 1992 ;
Black et al., 1996 ; Mandell and Banker,
1996 ). By contrast, cells transfected with pcDNA lacking the
C1199 insert display a morphology identical to that of stage 2 or 3 control cells; in addition, almost no neurons with multiple axon-like neurites were found under this condition (data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 4.
Overexpression of Tiam1 induces the extension of
multiple axon-like neurites. A, B, Immunofluorescence
micrographs showing hippocampal pyramidal neurons transfected with
Tiam1 cDNA (C11990). The cells were transfected 12 hr after plating and
fixed for immunofluorescence 1 d later; they were then stained
with the Tiam1 antibody diluted 1:500. Note that the cells have
extended several long and thin processes (thin arrows),
which are immunoreactive for Tiam1. One of these neurites extends out
of the micrograph field (thick arrow). C, D,
Double-immunofluorescence micrograph showing the distribution of Tiam1
(A) and tau (D) in a hippocampal
pyramidal neuron transfected with Tiam1 cDNA (C1199). Note the high
Tiam1 immunofluorescence signal in the transfected neuron; note also
that Tiam1-immunoreactive neurites (arrows) also stained
with the tau1 antibody. Scale bar, 10 µm.
|
|
Phosphorothioate antisense oligonucleotides inhibit the expression
of Tiam1 and the morphological development of neuronal polarity
In the next series of experiments we used antisense
phosphorothioate oligonucleotides to inhibit the expression of Tiam1. Cultured hippocampal pyramidal cells incubated for 24 hr with 2.5, 1.25, or 0.5 µM of the AST1a antisense oligonucleotide
described in Materials and Methods showed markedly reduced reactivity
to the Tiam1 antibody, as assessed by Western blotting of whole-cell extracts; this phenomenon was dose dependent (Fig.
5A). By contrast, cells
treated with sense oligonucleotides were comparable in their immunoreactivity to untreated control ones (Fig. 5A). This
analysis also revealed that treatment with the AST1b antisense
oligonucleotide (2.5 µM) reduced the levels of Tiam1
(Fig. 5A). On the other hand, none of the Tiam1 antisense
oligonucleotides reduced the levels of tubulin (Fig. 5A) and
of several cytoskeletal-associated proteins, including the small
GTPases RhoA (Fig. 5A) and Rac1 (data not shown). The
presence of normal levels of these proteins in the Tiam1-suppressed
cells suggests that the effect of the antisense treatment is specific
and that the regulation of the expression of other proteins, including
Rho-like GTPases, is independent of Tiam1.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5.
A, Western blots showing the effect of
Tiam1 antisense oligonucleotides on Tiam1, tubulin (Tub),
and Rho protein levels. Lane 1, Control non-treated;
lane 2, sense treated (ST1a); lane 3, sense
treated (ST1b); lane 4, AST1a treated (0.5 µM); lane 5, AST1a treated (1.25 µM); lane 6, AST1a treated (2.5 µM); lane 7, AST1b treated (2.5 µM). For this experiment the oligonucleotides were added
4 hr after plating and replenished 12 hr later. Cell extracts were
obtained 1 d after plating. The blots were revealed with Tiam1,
tyrosinated -tubulin, and Rho antibodies; 20 µg of protein was
loaded in each lane. Lanes 3 and 4 of the blot
stained with the Rho antibody contain no protein. B-I,
Tiam1 suppression prevents growth cone enlargement in stage 2 neurons.
Double-immunofluorescence micrographs from non-treated (B,
C), sense-treated (D, E), AST1a-treated (F,
G), or AST1b-treated (H, I) cultures showing the
morphology of stage 2 hippocampal pyramidal neurons. Note that all
control or sense-treated neurons display a neurite with a large growth
cone. This phenomenon is not observed in the antisense-treated neurons;
all of the growth cones are of uniform and small size. For this
experiment cultures were labeled with rhodamine phalloidin (B, D,
F, H) and with an mAb against tyrosinated -tubulin
(C, E, G, I). Oligonucleotides were used at
concentrations of 2.5 µM. Scale bar, 10 µm.
|
|
To analyze the consequences of Tiam1 suppression on neurite
outgrowth and development of polarity, the Tiam1 antisense
oligonucleotides were added to the cultures shortly after plating, when
most of the neurons lack neurites, and examined 24 and 36 hr later. The results obtained indicate that suppression of Tiam1 profoundly affects
the development of these neurons. The most significant alteration,
which was observed after treatment with 2.5 µM of either
AST1a or AST1b, involved a dramatic decrease in the number of cells
displaying an axon-like neurite, and hence in entering stage 3 of
neuritic development (Fig. 5, Table 2).
In addition, none of the stage 2 Tiam1-suppressed neurons exhibited a
single growth cone significantly larger than the other ones; all of the growth cones were of small and uniform size (Fig. 5, Table 2). High-resolution fluorescence microscopy of growth cones from
Tiam1-suppressed neurons labeled with an antibody against tyrosinated
-tubulin and rhodamine phalloidin revealed that all of them have
long actin ribs that extend from the base of the growth cone toward its
periphery, and that microtubules do not enter this F-actin-rich zone
(Fig. 6). By contrast, when the medium
was changed and replaced by a fresh one lacking antisense
oligonucleotides, the neurons reexpressed Tiam1 (Table 2), a phenomenon
initially paralleled by growth cone enlargement, lamellar spreading,
and penetration of microtubules in the central growth cone region of
one of the minor neurites; these events are later followed by the
extension of axon-like neurites in >90% of the cells. Taken together,
our observations are consistent with a model in which remodeling of the
actin cytoskeleton in selected growth cones (e.g., those containing
Tiam1) produces a loose actin meshwork in the central growth cone
region that allows microtubule protrusion and thereafter process
elongation (Forscher and Smith, 1988 ).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 6.
A, B, Double-immunofluorescence
micrographs showing the morphology and cytoskeletal organization of a
large growth cone of a sense-treated neuron. The culture was labeled
with an mAb against tyrosinated -tubulin (A) and
rhodamine phalloidin (B). Note the large
lamellipodial veil, the short actin ribs at the growth cone edge, and
the penetration of microtubules within the central and peripheral
growth cone region. C, D, Equivalent micrographs but from a
culture treated with the AST1a oligonucleotide (2.5 µM).
Note the small size of the growth cone, that microtubules end at its
base (C), and that long F-actin (D)
radial striations extend from the base of the growth cone toward its
periphery. Scale bar, 10 µm.
|
|
With these considerations in mind, and because previous studies have
shown that global application of actin-depolymerizing drugs produced
neurons with multiple axon-like neurites (Bradke and Dotti,
1999 ; Ruthel and Hollenbeck, 2000 ), we sought
and to determine whether axon formation could be induced in
Tiam1-suppressed neurons by treatment with cytochalasin D. For such a
purpose, experimental conditions were optimized as follows. After
16-18 hr in cultures, cells were treated with a single dose of
cytochalasin D (0.5 µg/ml) and fixed 3 or 12 hr later; fixed cultures
were then processed for immunofluorescence. Sense and antisense
oligonucleotides were added to the culture medium 2 hr after plating
and replenished every 12 hr until the end of the experiment. The
results obtained show that after 12 hr in the presence of cytochalasin
D, control, sense-treated, or antisense-treated neurons typically
display multiple long and thin processes that resemble axon-like
neurites (Fig. 7A-D, Table
3); in a small percentage of cases 25%),
we also detected neurons with a single dominant (both longer and thicker) process. Staining with rhodamine phalloidin to visualize actin
filaments showed aggregates of F-actin in the cell body and along the
processes, verifying the effectiveness of the cytochalasin D treatment
(Ruthel and Hollenbeck, 2000 ). Equivalent percentages of
cells forming one, two, or more axons were detected in control and
Tiam-1 suppressed cells treated with cytochalasin D. As in the case of
cells overexpressing Tiam1, an axon-like neurite was defined as a
process at least twice as long as any other neurite of the same cell,
with a minimum length of 50 µm, and was immunoreactive for tau1.
Finally, our results show that in both control and Tiam1-suppressed neurons, a 3 hr treatment with cytochalasin D (0.5 µg/ml) results in
a flattening of neuritic processes and penetration of microtubules within areas devoid of F-actin, a phenomenon particularly evident at
neuritic tips (Fig. 7E,F).

View larger version (72K):
[in this window]
[in a new window]
|
Figure 7.
A, B, Double-fluorescence micrograph
showing that a 12 hr treatment with cytochalasin D (0.5 µg/ml)
induces the extension of several axon-like neurites in cultured
hippocampal pyramidal neurons. Note the disappearance of F-actin and of
growth cones at neuritic tips. C, D, A similar
phenomenon is also observed in AST1a-treated neurons. E, F,
Double-immunofluorescence micrographs from an AST1a-treated culture
showing that a 3 hr treatment with cytochalasin D (0.5 µg/ml) induces
a flattening of neuritic processes with penetration of microtubules in
areas devoid of actin filaments. Note that microtubules reach the outer
rim (arrows) of the flattened neuritic tips. All cultures
were labeled with an mAb against tyrosinated -tubulin (A, C,
E) or rhodamine phalloidin (B, D, F). Antisense
oligonucleotides were used at a concentration of 2.5 µM.
Scale bar, 10 µm.
|
|
 |
DISCUSSION |
Differentiation-dependent expression of Tiam1 in the developing
brain and the consequences of its overexpression in neuroblastoma cells
suggest a role for this GEF and its effector Rac in the control of
neuronal morphology (Habets et al., 1995 ; van
Leeuwen et al., 1997 ). The present results are fully consistent
with this idea and provide direct experimental evidence revealing the
functional involvement of Tiam1 in the development of neuronal
polarity. Thus, one striking finding in Tiam1 antisense-treated
hippocampal pyramidal neurons is the selective inhibition of axon
formation, with most of the cells arrested at stage 2 and failing to
undergo changes in growth cone size and in cytoskeletal organization
typical of the stage 2-3 transition.
As with any study involving the use of antisense oligonucleotides, it
was important to establish that the observed effects were not related
to a diminution in the health of the cultures. Several observations
suggest that the Tiam1 antisense oligonucleotides specifically and
selectively blocked the expression of Tiam1. First, sequence analysis
of the regions of the mouse Tiam1 mRNA selected for designing the
antisense oligonucleotides revealed no significant homology with any
other reported sequence. In addition, none of the S-modified antisense
oligonucleotides used in this study contained four contiguous
guanosines residues, which are believed to increase oligomer affinity
to proteins and hence generate nonspecific inhibitory effects
(Wagner, 1995 ). Second, the antisense oligonucleotide
treatment dramatically reduced Tiam1 protein levels without altering
the levels of several other proteins, including tubulin, RhoA, and
Rac1. Finally, the effects of the antisense oligonucleotides were dose
dependent, not observed when the cells were treated with equivalent
doses of the corresponding "sense" oligonucleotides, and reversible
after changing the medium from a fresh one lacking antisense
oligonucleotides (see also below).
Growth cone enlargement, lamellipodial spreading, shortening of actin
ribs, and the subsequent penetration of microtubules within the central
growth cone region are hallmarks of the stage 2-3 transition in
hippocampal pyramidal neurons. This reorganization of the growth cone
cytoskeleton is essential for axon formation (Bradke and Dotti,
1997 , 1999 ; Paglini et al., 1998a ; this study) and absent in Tiam1-suppressed neurons. Interestingly, cytochalasin D
reverts the Tiam1 phenotype, with neurons extending one or more axons.
It is likely that cytochalasin D replaces Tiam1 by allowing microtubules to penetrate any neuritic tip devoid of actin filaments and hence leads to multiple axon formation (Forscher and Smith, 1988 ; Bradke and Dotti, 1999 ). Interestingly,
and as predicted by these results, overexpression of Tiam1 also results
in the extension of several axon-like neurites, all of which are
immunoreactive for Tiam1 and Tau1. Therefore, the extension of a single
axon under control conditions suggests that the regulation of actin organization and dynamics is a more restricted process, occurring only
in selected growth cones. Such a selection that allows a growth cone to
become either permissive or limiting for microtubule invasion and
subsequent axonal growth appears to depend on factors such as Tiam1.
In this regard, two complementary lines of evidence further support a
role for Tiam1 in neuronal polarization. First, we detected a high
degree of temporal correlation between its expression and the
morphological development of axons. Second, in cultured
hippocampal pyramidal neurons, Tiam1 protein levels peak 24 hr after
plating just at the time in which axon formation begins. Third,
qualitative and quantitative immunofluorescence studies show that in
stage 3 neurons Tiam1 preferentially localizes to axonal shafts and their growth cones. As expected, a restricted distribution of Tiam1 is
also detected in neurons at the stage 2-3 transition; in these cells,
Tiam1 preferentially localizes to the minor process displaying the
larger growth cone. The small amount of Tiam1 detected in the remaining
minor neurites of stage 2 neurons may reflect the potential of all of
these processes to become axons (Dotti and Banker, 1987 ;
Esch et al., 1999 ) or that the sorting machinery is
still not fully developed in young neurons (Bradke and Dotti, 1997 ). On the other hand, it is unlikely that the preferential localization of Tiam1 to axons is the result of bulk cytoplasmic flow;
such a mechanism has recently been proposed for explaining a higher
amount and transport of cytoskeletal and membrane proteins to the axon
during the initial establishment of polarity (Bradke and Dotti,
1997 ). The predominant axonal localization of Tiam1, as opposed
to the widespread distribution of rac1 and rhoA, argues against bulk
flow being a major single determinant of its subcellular localization.
Several additional mechanisms could account for the axonal enrichment
of Tiam1. In future studies it will be of interest to address this
issue and to determine whether Tiam1 subcellular distribution is
somehow related to its interaction with microtubules.
Thus, one additional and novel finding of the present study is that we
show by immunocytochemical and biochemical methods that a substantial
amount of Tiam1 associates with microtubules. The lack of
co-purification and co-immunoprecipitation of Tiam1 with MAP1b, MAP2,
and tau and the fact that the largest amount of Tiam1 from a MAP
fraction applied to a gel filtration column eluted at the volume
expected from its molecular weight suggest a direct interaction with
tubulin. The association of GEFs with microtubules may not be an
unusual event. For example, GEF-H1 and the Dbl-related protein, Lfc,
two GEFs for rac and rho, appear to localize to microtubules in
non-neuronal cells (Best et al., 1996 ; Ren et
al., 1998 ; Glaven et al., 1999 ). Moreover, a
pleckstrin homology (PH) domain of Lfc specifically associates with
tubulin (Glaven et al., 1999 ). Interestingly, analysis
of the Tiam1 sequence reveals the presence of at least two PH domains
located at the C terminus of the molecule that may bind to tubulin.
The association of GEFs with tubulin may contribute to explain positive
feedback interactions between microtubules and actin dynamics during
cell motility (Waterman-Storer and Salmon, 1999 ). Thus,
several recent reports have shown that the growth of microtubules in
fibroblasts can lead to rac1 activation, which in turn results in actin
polymerization and protrusion of the leading lamellipodia (Waterman-Storer and Salmon, 1999 ;
Waterman-Storer et al., 1999 ). The association of
rac-GDP, but not rac-GTP, with tubulin has been demonstrated using blot
overlay assays (Best et al., 1996 ). On the basis of
these observations, Waterman-Storer and Salmon (1999)
have suggested a model in which growth of microtubules could directly
activate rac1 with GTP-bound rac being released from tubulin during
microtubule growth, which in turn promotes lamellipodial protrusion.
Interestingly, polymerizing microtubules also activate site-directed
F-actin assembly in nerve growth cones (Rochlin et al.,
1999 ), a phenomenon that may well be related to the presence of Tiam1.
Therefore, it is likely that during the stage 2-3 transition,
microtubule-associated Tiam1 could promote rac activation and hence
growth cone lamellar spreading and enlargement. In favor of this view,
previous studies have established that neuroblastoma cells
overexpressing Tiam1 become polarized, retracting from the substrate at
one end of the cell and carrying a leading lamella at the other one,
like migrating fibroblast; after some time, these polarized cells begin
to form neuritic-like processes that carry prominent lamellipodia at
their tips (van Leeuwen et al., 1997 ). This response is
rac dependent because it does not occur in cells coexpressing
dominant-negative variants of rac and also may involve a silencing of
Rho-activated pathways (van Leeuwen et al., 1997 ). In
this regard, in future studies, it will be of interest to establish
whether the disappearance of actin ribs from the central growth cone
region involves Rho inactivation.
 |
FOOTNOTES |
Received June 19, 2000; revised Dec. 22, 2000; accepted Jan. 5, 2001.
This work was supported by grants from CONICET (PICT-PIP 4906), FONCyT
(PICT 05-00000-00937), CONICOR, Fundación Perez-Companc, Fundación Antorchas, and a Fogarty International Collaborative Award (FIRCA). It was also supported by a Howard Hughes Medical Institute grant to A.C. (HMMI 75197-553201) awarded under the International Research Scholars Program. P.K. is a fellow from CONICET.
G.P. is a postdoctoral fellow from Min. Salud (Argentina).
Correspondence should be addressed to Alfredo Cáceres, Instituto
Mercedes y Martín Ferreyra, Casilla de Correo 389, 5000 Córdoba, Argentina. E-mail:
acaceres{at}immf.uncor.edu.
 |
REFERENCES |
-
Best A,
Ahmed S,
Kozma R,
Lim L
(1996)
The Ras-related GTPase Rac1 binds tubulin.
J Biol Chem
271:3756-3762[Abstract/Free Full Text].
-
Black M,
Slaughter T,
Moshiach S,
Obrocka M,
Fisher I
(1996)
Tau is enriched on dynamic microtubules in the distal region of growing axons.
J Neurosci
16:3601-3619[Abstract/Free Full Text].
-
Bogusky MS,
McCormick F
(1993)
Protein regulating Ras and its relatives.
Nature
366:643-654[Medline].
-
Bottenstein J,
Sato G
(1979)
Growth of a rat neuroblastoma cell line in a serum-free supplemented medium.
Proc Natl Acad Sci USA
81:5613-5617.
-
Bradke F,
Dotti CG
(1997)
Neuronal polarity: vectorial cytoplasmic flow precedes axon formation.
Neuron
19:1175-1186[Web of Science][Medline].
-
Bradke F,
Dotti CG
(1999)
The role of local actin instability in axon formation.
Science
283:1931-1934[Abstract/Free Full Text].
-
Brandt R,
Leger J,
Lee G
(1995)
Interaction of tau with the neural plasma membrane mediated by tau's amino-terminal projection domain.
J Cell Biol
131:1327-1340[Abstract/Free Full Text].
-
Cáceres A,
Banker G,
Binder LI
(1986)
Immunocytochemical localization of tubulin and microtubule-associated protein 2 during the development of hippocampal neurons in culture.
J Neurosci
6:714-722[Abstract].
-
Cáceres A,
Mautino J,
Kosik KS
(1992)
Suppression of MAP2 in cultured cerebellar macroneurons inhibits minor neurite formation.
Neuron
9:607-618[Web of Science][Medline].
-
Ditella M,
Feipuin F,
Carri N,
Kosik K,
Cáceres A
(1996)
MAP-1b/Tau functional redundancy during laminin-enhanced axonal growth.
J Cell Sci
109:467-477[Abstract].
-
Dotti C,
Banker G
(1987)
Experimentally induced alterations in the polarity of developing neurons.
Nature
330:254-256[Medline].
-
Dotti CG,
Sullivan CA,
Banker GA
(1988)
The establishment of polarity by hippocampal neurons in culture.
J Neurosci
8:1454-1468[Abstract].
-
Esch T,
Lemmon V,
Banker G
(1999)
Local presentation of substrate molecules directs axon specification by cultured hippocampal neurons.
J Neurosci
19:6417-6426[Abstract/Free Full Text].
-
Forscher P,
Smith SJ
(1988)
Actions of cytochalasins on the organization of actin filaments and microtubules in a neuronal growth cone.
J Cell Biol
107:1505-1516[Abstract/Free Full Text].
-
Glaven JA,
Whitehead I,
Bagrodia S,
Kay R,
Cerione RA
(1999)
The Dbl-related protein, Lfc, localizes to microtubules and mediates the activation of rac signaling pathways in cells.
J Biol Chem
274:2279-2285[Abstract/Free Full Text].
-
Habets GGM,
Scholtes EHM,
Zuydgeest D,
van der Kammen RA,
Stam JC,
Berns A,
Collard JG
(1994)
Identification of an invasion inducing gene, Tiam1, that encodes a protein with homology to GDP-GTP exchangers for Rho-like proteins.
Cell
77:537-549[Web of Science][Medline].
-
Habets GGM,
van der Kammen RA,
Stam JC,
Berns A,
Collard JG
(1995)
Sequence of the human invasion-inducing Tiam1 gene, its conservation in evolution and its expression in tumor cell lines of different tissue origin.
Oncogene
10:1371-1376[Web of Science][Medline].
-
Ihara Y,
Fujii T,
Azai T,
Omori A,
Tanaka R,
Kaziro Y
(1979)
The presence of an adenosine-5'-triphosphatase dependent on 6S-tubulin and calcium ions in rat brain microtubules.
J Biochem
86:587-590[Abstract/Free Full Text].
-
Luo L,
Liao YJ,
Jan LY,
Jan YN
(1994)
Distinct morphogenetic functions of similar small GTPases: Drosophila Dra 1 is involved in axonal outgrowth and myoblast fusion.
Gene Dev
8:1787-1802[Abstract/Free Full Text].
-
Luo L,
Hensh TK,
Ackerman L,
Barbel S,
Jan LY,
Yan YN
(1996)
Differential effects of the rac GTPase on Purkinje cell axons and dendritic trunks and spines.
Nature
379:837-840[Medline].
-
Mackay DJG,
Nobes CD,
Hall A
(1995)
The Rho's progress: a potential role during neuritogenesis for the Rho family of GTPases.
Trends Neurosci
18:496-501[Web of Science][Medline].
-
Mandell J,
Banker GA
(1996)
A spatial gradient of tau protein phosphorylation in nascent axons.
J Neurosci
16:5727-5740[Abstract/Free Full Text].
-
Mascotti F,
Cáceres A,
Pfenninger KH,
Quiroga S
(1997)
Expression and distribution of IGF-1 receptors containing a
-subunit ( gc) in developing neurons.
J Neurosci
17:1447-1459[Abstract/Free Full Text]. -
Morishima-Kawashima M,
Kosik KS
(1996)
The pool of MAP kinase associated with microtubules is small but constitutively active.
Mol Biol Cell
7:893-905[Abstract].
-
Nakata T,
Hirokawa N
(1987)
Cytoskeletal reorganization of human platelets after stimulation revealed by the quick-freeze deep-etch technique.
J Cell Biol
106:1771-1780.
-
Nobes CD,
Hall A
(1995)
Rho, Rac and Cdc42 GTP-ases regulate the assembly of multi-molecular focal complexes associated with actin stress fibers, lamellipodia and filopodia.
Cell
81:53-62[Web of Science][Medline].
-
Paglini G,
Kunda P,
Quiroga S,
Kosik K,
Cáceres A
(1998a)
Suppression of radixin and moesin alters growth cone morphology, motility, and process formation in primary cultured neurons.
J Cell Biol
143:443-455[Abstract/Free Full Text].
-
Paglini G,
Pigino G,
Kunda P,
Morfini G,
Maccioni R,
Quiroga S,
Cáceres A
(1998b)
Evidence for the participation of the neuron-specific cdk5 activator p35 during laminin-enhanced axonal growth.
J Neurosci
18:9858-9869[Abstract/Free Full Text].
-
Pfenninger K,
Ellis L,
Johnson M,
Friedman L,
Somlo L
(1983)
Nerve growth cones isolated from fetal rat brain: subcellular fractionation and characterization.
Cell
35:573-584[Web of Science][Medline].
-
Quiroga S,
Garofalo S,
Pfenninger K
(1995)
Insulin-like growth factor I receptors of fetal brain are enriched in nerve growth cones and contain a
-subunit variant.
Proc Natl Acad Sci USA
92:4309-4312[Abstract/Free Full Text]. -
Ren Y,
Li R,
Zheng Y,
Busch H
(1998)
Cloning and characterization of GEF-H1, a microtubule-associated guanine nucleotide exchange factor for rac and rho GTPases.
J Biol Chem
273:34954-34960[Abstract/Free Full Text].
-
Ridley AJ,
Hall A
(1992)
The small GTP-binding protein rho regulates the assembly of focal adhesion and actin stress fibers in response to growth factors.
Cell
70:389-399[Web of Science][Medline].
-
Ridley AJ,
Peterson HF,
Johnson CI,
Diekmann D,
Hall A
(1992)
The small GTP-binding protein rac regulates growth factor-induced membrane ruffling.
Cell
70:401-410[Web of Science][Medline].
-
Rochlin MW,
Dailey ME,
Bridgman PC
(1999)
Polymerizing microtubules activate site-directed F-actin assembly in nerve growth cones.
Mol Biol Cell
10:2309-2327[Abstract/Free Full Text].
-
Ruthel G,
Hollenbeck P
(2000)
Growth cones are not required for initial establishment of polarity or differential axon branch growth in cultured hippocampal neurons.
J Neurosci
20:2266-2274[Abstract/Free Full Text].
-
Vallee RB
(1982)
A taxol-dependent procedure for the isolation of microtubules and microtubule-associated proteins (MAPs).
J Cell Biol
92:435-442[Abstract/Free Full Text].
-
van Leeuwen FN,
Kain HET,
van der Kammen R,
Michiles F,
Kranenburg OW,
Collard JG
(1997)
The guanine nucleotide exchange factor Tiam1 affects neuronal morphology: opposing roles for the small GTPases Rac and Rho.
J Cell Biol
139:797-807[Abstract/Free Full Text].
-
Wagner R
(1995)
The state of the art in antisense research.
Nat Med
1:1116-1118[Web of Science][Medline].
-
Waterman-Storer CM,
Salmon ED
(1999)
Positive feed-back interactions between microtubules and actin dynamics during cell motility.
Curr Opin Cell Biol
11:61-67[Web of Science][Medline].
-
Waterman-Storer CM,
Worthylake RA,
Liu BP,
Burridge K,
Salmon ED
(1999)
Microtubule growth activates Rac1 to promote lamellipodial protrusion in fibroblasts.
Nat Cell Biol
1:45-50[Web of Science][Medline].
-
Xia Z,
Dudek H,
Miranti C,
Greenberg M
(1996)
Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism.
J Neurosci
16:5425-5436[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/2172361-12$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Bisbal, J. Wojnacki, D. Peretti, A. Ropolo, J. Sesma, I. Jausoro, and A. Caceres
KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons
J. Biol. Chem.,
April 3, 2009;
284(14):
9489 - 9497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. E. Schor, N. Rascovan, F. Pelisch, M. Allo, and A. R. Kornblihtt
Neuronal cell depolarization induces intragenic chromatin modifications affecting NCAM alternative splicing
PNAS,
March 17, 2009;
106(11):
4325 - 4330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bisbal, C. Conde, M. Donoso, F. Bollati, J. Sesma, S. Quiroga, A. Diaz Anel, V. Malhotra, M. P. Marzolo, and A. Caceres
Protein Kinase D Regulates Trafficking of Dendritic Membrane Proteins in Developing Neurons
J. Neurosci.,
September 10, 2008;
28(37):
9297 - 9308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sanchez, L. Gastaldi, M. Remedi, A. Caceres, and C. Landa
Rotenone-Induced Toxicity is Mediated by Rho-GTPases in Hippocampal Neurons
Toxicol. Sci.,
August 1, 2008;
104(2):
352 - 361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Witte, D. Neukirchen, and F. Bradke
Microtubule stabilization specifies initial neuronal polarization
J. Cell Biol.,
February 6, 2008;
180(3):
619 - 632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Garvalov, K. C. Flynn, D. Neukirchen, L. Meyn, N. Teusch, X. Wu, C. Brakebusch, J. R. Bamburg, and F. Bradke
Cdc42 Regulates Cofilin during the Establishment of Neuronal Polarity
J. Neurosci.,
November 28, 2007;
27(48):
13117 - 13129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mori, T. Wada, T. Suzuki, Y. Kubota, and N. Inagaki
Singar1, a Novel RUN Domain-containing Protein, Suppresses Formation of Surplus Axons for Neuronal Polarity
J. Biol. Chem.,
July 6, 2007;
282(27):
19884 - 19893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Baldassa, N. Gnesutta, U. Fascio, E. Sturani, and R. Zippel
SCLIP, a Microtubule-destabilizing Factor, Interacts with RasGRF1 and Inhibits Its Ability to Promote Rac Activation and Neurite Outgrowth
J. Biol. Chem.,
January 26, 2007;
282(4):
2333 - 2345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yoshimura, N. Arimura, and K. Kaibuchi
Signaling networks in neuronal polarization.
J. Neurosci.,
October 18, 2006;
26(42):
10626 - 10630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Watabe-Uchida, E.-E. Govek, and L. Van Aelst
Regulators of rho GTPases in neuronal development.
J. Neurosci.,
October 18, 2006;
26(42):
10633 - 10635.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Miyamoto, J. Yamauchi, A. Tanoue, C. Wu, and W. C. Mobley
TrkB binds and tyrosine-phosphorylates Tiam1, leading to activation of Rac1 and induction of changes in cellular morphology
PNAS,
July 5, 2006;
103(27):
10444 - 10449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Aoki, T. Nakamura, K. Fujikawa, and M. Matsuda
Local Phosphatidylinositol 3,4,5-Trisphosphate Accumulation Recruits Vav2 and Vav3 to Activate Rac1/Cdc42 and Initiate Neurite Outgrowth in Nerve Growth Factor-stimulated PC12 Cells
Mol. Biol. Cell,
May 1, 2005;
16(5):
2207 - 2217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yoshizawa, T. Kawauchi, M. Sone, Y. V. Nishimura, M. Terao, K. Chihama, Y.-i. Nabeshima, and M. Hoshino
Involvement of a Rac Activator, P-Rex1, in Neurotrophin-Derived Signaling and Neuronal Migration
J. Neurosci.,
April 27, 2005;
25(17):
4406 - 4419.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E.-E. Govek, S. E. Newey, and L. Van Aelst
The role of the Rho GTPases in neuronal development
Genes & Dev.,
January 1, 2005;
19(1):
1 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rosso, F. Bollati, M. Bisbal, D. Peretti, T. Sumi, T. Nakamura, S. Quiroga, A. Ferreira, and A. Caceres
LIMK1 Regulates Golgi Dynamics, Traffic of Golgi-derived Vesicles, and Process Extension in Primary Cultured Neurons
Mol. Biol. Cell,
July 1, 2004;
15(7):
3433 - 3449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. W. Grabham, B. Reznik, and D. J. Goldberg
Microtubule and Rac 1-dependent F-actin in growth cones
J. Cell Sci.,
September 15, 2003;
116(18):
3739 - 3748.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Buchsbaum, B. A. Connolly, and L. A. Feig
Regulation of p70 S6 Kinase by Complex Formation between the Rac Guanine Nucleotide Exchange Factor (Rac-GEF) Tiam1 and the Scaffold Spinophilin
J. Biol. Chem.,
May 23, 2003;
278(21):
18833 - 18841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Lamoureux, G. Ruthel, R. E. Buxbaum, and S. R. Heidemann
Mechanical tension can specify axonal fate in hippocampal neurons
J. Cell Biol.,
November 7, 2002;
159(3):
499 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kubo, T. Yamashita, A. Yamaguchi, H. Sumimoto, K. Hosokawa, and M. Tohyama
A Novel FERM Domain Including Guanine Nucleotide Exchange Factor Is Involved in Rac Signaling and Regulates Neurite Remodeling
J. Neurosci.,
October 1, 2002;
22(19):
8504 - 8513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Schmidt and A. Hall
Guanine nucleotide exchange factors for Rho GTPases: turning on the switch
Genes & Dev.,
July 1, 2002;
16(13):
1587 - 1609.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Buchsbaum, B. A. Connolly, and L. A. Feig
Interaction of Rac Exchange Factors Tiam1 and Ras-GRF1 with a Scaffold for the p38 Mitogen-Activated Protein Kinase Cascade
Mol. Cell. Biol.,
June 15, 2002;
22(12):
4073 - 4085.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Matsuo, M. Hoshino, M. Yoshizawa, and Y.-i. Nabeshima
Characterization of STEF, a Guanine Nucleotide Exchange Factor for Rac1, Required for Neurite Growth
J. Biol. Chem.,
January 18, 2002;
277(4):
2860 - 2868.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|