 |
Previous Article | Next Article 
The Journal of Neuroscience, April 15, 2001, 21(8):2678-2686
Transport and Localization of the DEG/ENaC Ion Channel BNaC1
to Peripheral Mechanosensory Terminals of Dorsal Root Ganglia
Neurons
Jaime
García-Añoveros1,
Tarek
A.
Samad2,
Ljiljana
uvela-Jelaska1,
Clifford J.
Woolf2, and
David P.
Corey1
1 Howard Hughes Medical Institute and Department of
Neurobiology, Massachusetts General Hospital and Harvard Medical
School, Boston, Massachusetts 02114, and 2 Neural
Plasticity Research Group, Department of Anesthesia and Critical Care,
Massachusetts General Hospital and Harvard Medical School, Charlestown,
Massachusetts 02129
 |
ABSTRACT |
Mammalian brain sodium channel (BNaC, also known as BNC/ASIC)
proteins form acid-sensitive and amiloride-blockable sodium channels
that are related to putative mechanosensory channels. Certain BNaC
isoforms are expressed exclusively in dorsal root ganglia (DRG)
and have been proposed to form the ion channels mediating tissue
acidosis-induced pain. With antibody labeling, we find that the
BNaC1 isoform is expressed by most large DRG neurons (low-threshold
mechanosensors not involved in acid-induced nociception) and few small
nociceptor neurons (which include high-threshold mechanoreceptors).
BNaC1 is transported from DRG cell bodies to sensory terminals in
the periphery, but not to the spinal cord, and is located specifically
at specialized cutaneous mechanosensory terminals, including Meissner,
Merkel, penicillate, reticular, lanceolate, and hair follicle palisades
as well as some intraepidermal and free myelinated nerve endings.
Accordingly, BNaC1 channels might participate in the transduction of
touch and painful mechanical stimuli.
Key words:
DEG/ENaC channels; mechanosensory; mechanotransduction; touch; nociception; dorsal root ganglion; unidirectional transport; degenerin
 |
INTRODUCTION |
Ion channel subunits of the
degenerin/epithelial sodium channel (DEG/ENaC) family have two
transmembrane domains and a large extracellular loop. They form
homomeric or heteromeric channels that are blocked by amiloride and
that are permeable to sodium and sometimes other monovalent cations,
but rarely calcium. These channels are not gated by voltage but by
diverse stimuli, including extracellular protons, neuropeptides, and
perhaps mechanical forces (see Fig. 1; Corey and
García-Añoveros, 1996 ; Duggan et al., 2000 ).
One branch of the DEG/ENaC family, the degenerins, form ion channels
(García-Añoveros et al., 1998 ) that are needed for mechanosensation in nematodes. MEC-4 and MEC-10 are required for touch
perception by six touch receptor neurons (Driscoll and Chalfie, 1991 ;
Huang and Chalfie, 1994 ), UNC-8 has been implicated in proprioception (Tavernarakis et al., 1997 ), and UNC-105 has been implicated in response to muscle stretch (Liu et al., 1996 ). It has been proposed that degenerin channels are tethered both to the extracellular matrix
and the cytoskeleton and that the tension between these gates the
channel (García-Añoveros et al., 1995 ;
García-Añoveros and Corey, 1996 , 1997 ).
The pickpocket (PPK) protein in insects represents another branch. It
is localized at the peripheral dendrites of a subset of suspected
mechanosensory neurons that innervate the insect skin and has been
proposed to function as a mechanosensitive channel (Adams et al., 1998 ;
Darboux et al., 1998 ).
The mammalian epithelial sodium channels (ENaCs) are a third branch.
They are expressed in epithelia lining the lumen of the kidney, colon,
and lung and form channels that constitutively reabsorb sodium and are
not gated directly by any known stimuli (Canessa et al., 1993 , 1994 ).
However, some of these also are expressed at the baroreceptor terminals
of nodose ganglion neurons, where they are proposed to form
mechanically gated channels involved in the sensing of blood pressure
(Drummond et al., 1998 ).
We and others have cloned mammalian channels that constitute a fourth
branch of the DEG/ENaC family: the brain sodium channel subunits
(BNaCs, also known as BNCs or ASICs; Price et al., 1996 ; Waldmann et
al., 1996 , 1997 ; García-Añoveros et al., 1997 ; Ishibashi and Marumo, 1998 ; Babinski et al., 1999 ). BNaC channels are activated by extracellular protons (see Fig. 2A; Waldmann and
Lazdunski, 1998 ), and the proton-induced currents of many are enhanced
by FMRFamide neuropeptides (Askwith et al., 2000 ). The BNaC branch contains five known genes, some of which are alternative-spliced (Fig.
1B). Certain splice
forms of BNaC1 and BNaC2 are widely expressed in brain neurons
(García-Añoveros et al., 1997 ; Waldmann and Lazdunski,
1998 ). However, ASIC (BNaC2 ) and DRASIC isoforms are expressed
nearly exclusively in subsets of cells of the dorsal root ganglia (Chen
et al., 1998 ; Waldmann and Lazdunski, 1998 ). Because tissue acidosis is
a source of inflammatory pain and a sensitizing agent for other painful
stimuli such as heat (Bevan and Geppetti, 1994 ; Reeh and Steen, 1996 ),
it has been proposed that some BNaC/ASIC channels are involved directly
in acid-induced or acid-modulated pain (Waldmann and Lazdunski, 1998 ).
However, others have attributed the sustained acid-induced currents
characteristic of nociceptors to the capsaicin receptor, termed
vanilloid receptor 1 (VR1; Caterina et al., 1997 , 2000 ; Tominaga et
al., 1998 ).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1.
Top, Phylogenetic tree of the
DEG/ENaC ion channel family, which contains proteins from nematodes,
insects, mollusks, and mammals. Bottom, Members of the
BNaC branch, with assigned human gene names and the protein isoforms
resulting from alternative splicing. The various names of each isoform
are separated by slashes.
|
|
Now we have cloned BNaC1 from mouse. Although earlier studies that
used in situ hybridization failed to find this isoform in
the DRG (Waldmann and Lazdunski, 1998 ), we find that it is expressed in
that subset of DRG neurons likely to be mechanosensors, transported
exclusively to the periphery, and localized at specialized mechanosensory terminal endings. This distribution is compatible with a
possible role for BNaC1 in cutaneous mechanosensory transduction.
 |
MATERIALS AND METHODS |
Cloning. On the basis of our partial cDNA clone of
mouse BNaC1 (García-Añoveros et al., 1997 ), we designed
oligonucleotides MB1-A3 (GGTCTCACAGTCGATCCGACAGGCTG) and MB1-S4
(TACAGCATCACAGCCTGTCGGATCGAC) and performed 5' and 3' rapid
amplification of cDNA ends (RACE) from Marathon-ready mouse brain cDNA
(Clontech, Palo Alto, CA). Then the two overlapping cDNA fragments that
were obtained were sequenced.
Mapping. We found a polymorphism in the 3'-untranslated
region (UTR) sequence of BNaC1, between the Spretus and
C57BL/6J mouse strains, which could be detected by PCR
amplification with primers MB1-S11 (TCAGGCAGCCCAGCACCTCCAAACAG) and
MB1-A10 (GTCACAGGGAGAGAACAAAGTGGCTCC), followed by restriction
digestion with SmaI. We typed the Jackson Laboratories (Bar
Harbor, ME) backcross B6xSpret mapping panels (BSB Panel 1 and BBS Panel2, each with DNA from 94 backcross progeny) for this
polymorphism to determine the map position of BNaC1.
RT-PCR and in situ hybridization. Total RNA was
isolated from rat lumbar DRGs (L4-L6) with Trizol (Life Technologies,
Gaithersburg, MD), and first-strand cDNA was synthesized with either
oligo-dT or random hexamer primers, using the Gibco Superscript
Preamplification System (Life Technologies). One-tenth of the resulting
cDNAs (or water as negative control) was used as a template for PCR
amplification with the BNaC1 -specific primers rmB1a-S1
(ATGGACCTCAAGGAGAGCCCCAG) and rmB1a-A1 (AAGTCTTGATGCCCACACTCCTGC). The
resulting 548 bp fragment (corresponding to BNaC1 codons 1-183) was
subcloned into the pCRII vector (Invitrogen, San Diego, CA), confirmed
by DNA sequencing, linearized, and used as a template for in
vitro transcription in the presence of digoxigenin-labeled cRNA
probes (Promega, Madison, WI). Antisense probe was obtained by
linearization with XhoI and transcription with SP6 RNA
polymerase. Sense probe was obtained by linearization with
KpnI and transcription with T7 RNA polymerase. These probes
were used to hybridize sections of rat DRG as described (Amaya et al.,
2000 ).
Antibody generation and purification. Peptide
MDLKESPSEGSLQPSSC (corresponding to residues 1-16 of mouse, rat, and
human BNaC1 , plus a cysteine for conjugation) was synthesized by
Chiron Technologies (San Diego, CA). Peptide (5 mg each) was conjugated
to keyhole limpet hemocyanin (KLH). Rabbit R6798 was immunized with
injections of the KLH-conjugated peptides, and anti-BNaC1 antibodies
were affinity-purified by passing the purified IgGs through SulfoLink columns (Pierce, Rockford, IL) to which the unconjugated BNaC1 peptide had been immobilized.
We purchased the other antibodies that were used: mouse monoclonal
anti-protein gene product (PGP) 9.5 (31A3; Biogenesis, Brentwood, NH),
mouse monoclonal anti-neurofilament 200 (RT97; Biodesign International,
Kennebunk, ME), mouse monoclonal anti-peripherin (mAb1527; Chemicon,
Temecula, CA), and sheep anti-CGRP (Affiniti, Nottingham, UK).
Secondary antibodies were purchased from Jackson ImmunoResearch (West
Grove, PA).
Heterologous expression and electrophysiology. Cultured
Chinese hamster ovary (CHO) cells were cotransfected with a plasmid containing the complete coding sequence of hBNaC1 under the
cytomegalovirus (CMV) promoter or the complete coding sequence of
mBNaC1 under the same promoter (provided by Anne Duggan,
Massachusetts General Hospital) and with a marker plasmid that
expresses green fluorescent protein (GFP; pEGFP-N3, from Clontech) or
with pEGFP-N3 alone. To confirm that the CHO cells express BNaC1
channels and incorporate them in the plasma membrane, we recorded
acid-induced currents with whole-cell patch clamp (Fig.
2A). We used CHO cells
because human embryonic kidney (HEK) 293 cells have an endogenous
acid-activated amiloride-sensitive channel very similar to that
produced by BNaC channels, and COS cells often display a slowly
developing, amiloride-insensitive acid-activated current (our
unpublished observations). The pipette solution contained (in
mM): 140 CsCl, 5 EGTA, and 10 HEPES, pH 7.4. To
activate BNaC1 or BNaC2 channels, we replaced the
extracellular solution [containing (in mM): 140 NaCl, 5 KCl, 2 CaCl2, 2 MgCl2, 10 glucose, and 10 HEPES, pH7.4] with a
similar solution buffered to pH 5.0 with MES. Partial block was
obtained with 500 µM amiloride in the bath
solution. Then the antiserum raised against BNaC1 (R6798) was tested
on CHO cells expressing hBNaC1 or mBNaC1 by immunocytochemistry
(Fig. 2B,C) and Western blots (Fig.
2E).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 2.
Antibody recognition of BNaC1 heterologously
expressed in cultured CHO cells. A, Currents elicited by
extracellular acidic pH in cultured CHO cells expressing BNaC1 .
Currents were blocked by 500 µM amiloride and were absent
from control CHO cells. B-D, Immunocytochemical
labeling with the anti-BNaC1 antibody R6798 (red) of
cells expressing human BNaC1 (B) or mouse
BNaC1 (C) and showing the absence of labeling
in control cells (D). Cells in all three
conditions express GFP as a marker. E, Western blot
detection of a 58.5 kDa protein from extracts of hBNaC1 -expressing
cells, but not of control cells.
|
|
Animals and tissues. We used adult CD1 mice and male Sprague
Dawley rats (200-250 gm) from Charles River Farms (Wilmington, MA). To
obtain total protein or RNA, we dissected rat lumbar dorsal root
ganglia (L4, L5, and L6). For immunohistochemistry, rat and mouse
tissues (paws or paw skin, whisker pads, DRGs, and sciatic and dorsal
root nerves) were dissected, usually after cardiac perfusion of
terminally anesthetized animals with 4% paraformaldehyde (PFA) in PBS.
Tissues were post-fixed in 4% PFA in PBS at 4°C for 2 hr and
decalcified in 100 mM EDTA in PBS at 4°C if they contained bone. Frozen sections of 10-20 µm were collected on gelatin-covered slides.
Animals were operated on under halothane anesthesia (2%). Sciatic
nerves were tied with a single 5/0 silk ligature at the level of the
mid-thigh. L4 and L5 dorsal roots were tied similarly after a
hemilaminectomy of the L2 and L3 vertebrae. At 3 d after the
ligations, the nerves were dissected, mounted in O.C.T., frozen, and
processed for cryosectioning and immunohistochemistry. The animal
protocols were approved by the Animal Use Committee of Massachusetts
General Hospital.
Immunoblots. Total protein was purified from CHO cells
transfected as indicated above or from dissected rat DRGs. Scraped cells or diced tissues were homogenized in the presence of ice-cold RIPA lysis buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, and
0.1% SDS, in PBS) containing protease inhibitors (2 µg/ml leupeptin
and 2 µg/ml pepstatin). After the addition of PMSF to 0.1 gm/ml and
incubation for 30 min on ice, the samples were centrifuged at
10,000 × g for 20 min at 4°C, and the lysis was
collected from the supernatant. Lysate containing 10-20 µg of total
protein was run by SDS-PAGE (Bio-Rad, Hercules, CA) and transferred to
Hybond ECL nitrocellulose membranes (Amersham Pharmacia Biotech,
Buckinghamshire, UK). The filters were probed with the anti-BNaC1
antibody R6798, using the ECL Western blotting analysis system
(Amersham Pharmacia Biotech).
Immunocytochemistry. CHO cells were fixed in 4% PFA in PBS
for 10 min, rinsed five times with PBS for 10 min each, permeabilized with 0.1% Triton X-100 for 15 min, rinsed five times with PBS for 10 min each, blocked with 1% normal goat serum and 5% BSA in PBS for
1-2 hr, and incubated with anti-BNaC1 antibodies diluted in 0.5%
normal goat serum and 0.5% BSA in PBS at 4°C overnight. After five
washes in 0.5% BSA in PBS, the cells were incubated in Cy-3 goat
anti-rabbit (1:100; Jackson ImmunoResearch) in 0.5% normal goat serum
and 0.5% BSA in PBS for 1 hr, washed three times in 0.5% BSA in PBS
for 5 min each and two times in PBS, covered with anti-fade reagent
(Gelmount, Bio-Rad), and viewed with a confocal microscope (Zeiss
Axiophot with a Bio-Rad Radiance 2000).
Frozen sections were post-fixed and labeled as described above for
cultured cells, but with the following alterations. Sections were
blocked with either 3% normal donkey serum and 3% BSA in PBS or with
3% normal goat serum and 0.3% Triton X-100 in PBS; primary antibodies
were diluted in identical solutions and incubated with the sections for
2 d at 4°C. Afterward, washes were performed with PBS, and
secondary antibodies (FITC goat anti-rabbit and Cy-3- or Texas
Red-conjugated goat anti-mouse) were diluted in the same block
solution; alternatively, washes were performed with 0.05% Tween 20 in
PBS, and secondary antibodies (Cy-3 donkey anti-rabbit and FITC donkey
anti-mouse) were diluted in the same solution.
 |
RESULTS |
Cloning and mapping of mBNaC1
On the basis of a partial mouse BNaC1 cDNA clone we had obtained
previously, we performed RACE to generate cDNA fragments that encompass
the complete coding sequence of mouse BNaC1 . The resulting contig
consists of 225 nucleotides of 5'-UTR, 1536 nucleotides of coding
sequence, and up to 891 nucleotides of 3'-UTR (accession number
AF348465). This is the mouse ortholog of the human hBNaC1 (García-Añoveros et al., 1997 ), also known in the rat as
BNC1 (Price et al., 1996 ) and MDEG1 (Waldmann et al., 1996 ).
We mapped mBNaC1 to mouse chromosome 11, linked to the mouse loci
vibrator, NF1, Myo1c, and D11Mit34. This is one of the mouse genomic regions syntenic to human 17q11.2-12, where hBNaC1 maps (García-Añoveros et al., 1997 ). The exon encoding the
BNaC1 -specific N-terminal region is contained in mouse genomic BAC
clones RP23-328G11, RP23-92G22, and RP23-433D11.
Localization of BNaC1 mRNA to the DRG
BNaC1 /BNC1/MDEG1/ASIC2a and BNaC1 /MDEG2/ASIC2b are identical
in their 327 C-terminal residues but differ in their N termini (185 residues in BNaC1 and 236 residues in BNaC1 ), which include the
intracellular N terminus, the first transmembrane domain, and 135 amino
acids of the extracellular loop. With PCR primers unique to the
BNaC1 splice form, we performed RT-PCR with rat DRG total RNA as a
template and detected BNaC1 mRNA in the DRG (Fig.
3A). We then performed
in situ hybridization, using a cRNA probe corresponding to
the unique fragment of BNaC1 , and detected BNaC1 mRNA in DRG,
primarily in large-diameter neurons (Fig. 3B,C).

View larger version (47K):
[in this window]
[in a new window]
|
Figure 3.
Expression of BNaC1 mRNA in rat dorsal root
ganglion. A, Detection of mBNaC1 by RT-PCR (30 cycles), using DRG total RNA as a template. B, C,
Detection by in situ hybridization with antisense
digoxigenin-labeled cRNA probe (C), but not with
sense cRNA probe (B). Arrows in
C point at some of the unlabeled cells.
|
|
Localization of BNaC1 protein in the DRG
We raised and affinity-purified an antibody (R6798) that
recognizes the first 16 amino acids of mouse, rat, and human BNaC1 and that differs from BNaC1 /MDEG2. This antibody specifically labeled cultured CHO cells expressing human or mouse BNaC1 , but not
untransfected cells (see Fig. 2A-D). In Western
blots from transfected cells the antibody primarily recognized a
protein band of ~58 kDa, indistinguishable from the 57.7 kDa
predicted for BNaC1 (Fig. 2E).
Similarly, on a Western blot of rat DRG proteins, the anti-BNaC1
antibody R6798 labeled a single band of ~58 kDa (Fig.
4A). With
immunofluorescence on DRG sections we found that BNaC1 protein was
expressed by ~21% of L4 and L5 DRG neurons (Fig.
4B). Nearly all of the cells that express
neurofilament 200 (a marker of the large and medium-sized, A-fiber
neurons; Lawson et al., 1984 ; Lawson and Waddell, 1991 ; Sann et al.,
1995 ) were labeled by the BNaC1 antibody (90.5 ± 2.1%,
mean ± SD; n = 528 cells from four sections),
whereas only a few of the cells that express the C-fiber marker
peripherin (small-diameter neurons; Goldstein et al., 1991 ) were
labeled (4.1 ± 1.6% SD; n = 573 cells from four
sections). Within these neurons BNaC1 is not concentrated in the
plasma membrane but, instead, accumulates prominently in the cytoplasm adjacent to the axon hillock and in the axonal process that emerges from it (Fig. 4C). This localization suggests that BNaC1
is transported anterogradely toward the terminals.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 4.
Expression of BNaC1 protein in dorsal root
ganglion. A, Western blot detection of BNaC1 from rat
lumbar DRG protein extract with the anti-BNaC1 antibody R6798.
B, Subcellular accumulation of
BNaC1 immunoreactivity (white) within
the cell body near the axon hillock (arrows) and in the
proximal neuronal process. C-F, Immunohistochemical
labeling of sections of rat lumbar DRG with R6798 antibody
(red; C), anti-peripherin antibody
(green; D), and both
(E). Note the absence BNaC1 from the small
cells, labeled with peripherin. F, Peptide preincubation
control. The R6798 antibody (red) was preincubated with
the antigenic peptide that was used to raise it. Only nonspecific
low-level background label was detected with R6798. The anti-peripherin
antibody label is in green.
|
|
Transport of BNaC1 to the periphery
To determine whether BNaC1 is transported to peripheral sensory
or central synaptic terminals, we ligated the central axons in the
dorsal roots that extend from lumbar DRGs to the spinal cord. In a
separate experiment we ligated peripheral DRG axons in the sciatic
nerve that extends from lumbar DRGs to the periphery. We looked for
BNaC1 immunoreactivity at either side of the ligatures, because
proteins that are transported orthogradely will accumulate proximal to
the ligature and those retrogradely, distal. As a positive control, we
found an accumulation of calcitonin gene-related peptide (CGRP) on the
DRG side of both ligatures (Fig.
5F,G). By contrast, BNaC1
immunoreactivity was not seen at either side of the ligated dorsal
roots (Fig. 5E). Furthermore, we did not detect any BNaC1
immunoreactivity in the unligated dorsal roots entering the lumbar
spinal cord and in the dorsal columns, nor in the dorsal horn and the
dorsal column nuclei, the sites of termination of cutaneous afferents
(Fig. 5B; data not shown). This suggests that BNaC1 is
not transported toward the central, presynaptic terminals in the spinal
cord. However, we detected a substantial accumulation of BNaC1 on
the DRG side of the ligated sciatic nerve (Fig. 5D),
indicating that BNaC1 is transported from DRG cell bodies toward the
peripheral sensory terminals.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 5.
Unidirectional transport of BNaC1 to the
periphery. A, Section of rat lumbar dorsal root
ganglion, showing abundant BNaC1 immunoreactivity in the cell
bodies. B, Section of rat lumbar dorsal root
(arrow) and spinal cord (each demarcated by
dotted lines), showing no detectable immunoreactivity.
Sections for A and B were treated under
the same conditions, at the same time, and were photographed with
identical confocal settings. C, Schematic drawing of
experiments in which ligatures were applied either to the peripheral
sensory axons in the rat sciatic nerve (D, F) or
to their central axons in the L4 dorsal root (E, G).
D, Accumulation of BNaC1 at the proximal (from DRG)
side of a ligated sciatic nerve. E, Absence of BNaC1
at either side of a ligated dorsal root. The sections of both ligated
dorsal roots and sciatic nerve were labeled and photographed under the
same conditions. F, G, Control labeling demonstrating
the accumulation of CGRP in adjacent sections of the same ligatures of
sciatic nerve (F) and dorsal root
(G). The nerve funiculi are demarcated with a
dotted white line.
|
|
Localization of BNaC1 in mechanosensory terminals of
the skin
To identify the destination of BNaC1 in DRG peripheral fibers,
we labeled sections of glabrous and hairy skin with the antibody. We
found that BNaC1 immunoreactivity often colocalizes with
neurofilament 200, a marker of myelinated A-fibers, which are primarily
mechanosensitive (Sann et al., 1995 ), and is found specifically in a
variety of mechanosensory terminals.
Meissner corpuscles
In the glabrous skin of rat and mouse paws, BNaC1 localizes to
fibers innervating Meissner corpuscles (Fig.
6A-D), structures located in the dermal papillae of the digits that are thought to be
innervated by rapidly adapting mechanoreceptor fibers. These fibers
extend apically on the dermal papillae and then branch and run a
meandering course within the Meissner corpuscle where they terminate
(Cauna and Ross, 1960 ; Bruce and Sinclair, 1980 ; Sinclair, 1982 ).

View larger version (65K):
[in this window]
[in a new window]
|
Figure 6.
BNaC1 localization in mechanosensory terminals
of the skin. A, E, I, M, Q, Immunoreactivity to
neurofilament 200 (NF200) or the neuronal marker PGP 9.5 (green; Thompson et al., 1983 ). B, F, J,
N, R, Immunoreactivity to BNaC1 (red).
C, G, K, O, S, Merging of the images to demonstrate
colocalization (yellow). D, H, L, P,
T, Schematic drawing of the tissues, derived from other images
of the same sections. A dotted line represents the basal
membrane that separates the epidermis (gray) from
the dermis (white). A-D, BNaC1
immunoreactivity of a neurite innervating a Meissner corpuscle situated
in a dermal papilla of the glabrous skin of a mouse forepaw.
E-H, Penicillate terminals under the basal layer of the
epidermis in the glabrous skin of a mouse forepaw. I-L,
Merkel cells in the glabrous skin of the rat forepaw. The PGP 9.5 antibody (green) labels the subepidermal nerves,
their terminals (the Merkel disks), and the closely apposed Merkel
cells at the base of the epidermis. The BNaC1 antibody
(red) labels the Merkel disks and, less prominently, the
neuronal processes leading to them. Note the two thin intraepidermal
fibers, which do not contain BNaC1 . M-P,
Intraepidermal fibers of myelinated origin in the glabrous skin of the
rat forepaw. Q-T, Thin intraepidermal fibers of C-fiber
origin in the glabrous skin of the rat forepaw. These fibers do not
label for BNaC1 . The strong fluorescence signal from the stratum
corneum is attributable to autofluorescence.
|
|
Penicillate endings
In the dermis of both glabrous and hairy skin, many nerve fibers
contain BNaC1 , often extending toward the basal layer of the
epidermis and then splitting into a leash of fibers that runs subepidermally under the basal layer (Fig.
6E-H). This leash of fibers has been termed
the "penicillus," and its various penicillate endings attach to the
basal layer of the epidermis via collagen fibers (Cauna, 1973 ;
Sinclair, 1982 ), connections that might serve as points of mechanical tethering.
Merkel disks
Some of the fibers that run subepidermally end in an expanded
discoid terminal in close contact with Merkel cells, specialized cells
located at the base of the epidermis that are innervated by type I
slowly adapting mechanoreceptor neurons (Sinclair, 1982 ). BNaC1 was
highly enriched in these Merkel disk terminals (Fig. 6I-L).
Intraepidermal terminals
Other cutaneous afferent fibers do not turn as they reach the
basal layer of the epidermis but, instead, penetrate into the epidermis. Most of these are unmyelinated, and most (98% in rat glabrous skin) do not contain BNaC1 (Fig. 6Q-T, I-L).
This is consistent with the absence of BNaC1 from 96% of the
peripherin-positive cell bodies in the DRG (see Fig.
4E). However, a few intraepidermal endings originate
from myelinated, A fibers, which express neurofilament 200 and are
considered high-threshold mechanosensory (HTM) terminals that initiate
the sensation of pricking pain (Kruger et al., 1981 ). BNaC1 was
localized at these neurofilament 200-positive intraepidermal fibers
(Fig. 6M--P).
Hair follicle afferents
Hair follicles are innervated by fibers that either wrap around
the follicle (circumferential endings) or encircle the follicle with
comb-like terminals (palisade endings); these correspond to rapidly
adapting mechanoreceptor neurons (Sinclair, 1982 ; Millard and Woolf,
1988 ; Rice et al., 1993 ). BNaC1 localizes to both circumferential
and palisade terminals of follicles from different areas of hairy skin,
such as the furry skin of the rat snout and the less hairy skin of the
dorsal side of the mouse paw (Fig. 7).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 7.
Palisade and circumferential endings around hair
follicles from fur. Shown is immunoreactivity to NF200
(green), BNaC1 (red), or both (colocalization
in yellow). A-C, E, F, Follicles of the
mouse forepaw. Note that BNaC1 immunoreactivity is more prominent at
the tips than at the base of the palisade endings (small
arrows). D, Schematic drawing of a hair follicle
and its innervation. G, Follicle of the rat mystacial
fur, showing palisade endings and circumferential fibers (large
arrows).
|
|
Vibrissal afferents
The whiskers (or vibrissae) of the snout are the hairs with the
most elaborate, varied, and complex innervation; they constitute specialized mechanosensory structures that endow most mammals with very
fine tactile discrimination. The whisker follicle is formed by an
epidermal layer that surrounds the base of the whisker hair and is
surrounded by dermis and specialized blood sinuses (Fig.
8D). Whisker follicles
are innervated by many neuronal fibers but mostly by myelinated
NF200-positive neurons representing several distinct types of
mechanosensory terminals. Each type of terminal not only is abundant
but also innervates the follicle at a stereotyped position (Rice et
al., 1993 , 1997 ). We found that the non-mechanosensory terminals lacked
BNaC1 (i.e., most of the circumferential fibers; see below), whereas
all types of mechanosensory terminals reaching the follicle
contained BNaC1 . These include the reticular endings of the
mesenchymal sheath that surrounds the deeper portion of the follicle
(which branch profusely and terminate in contact with the basal
membrane of the follicle; Fig. 8H-J), the
Merkel disks situated at mid-depth along the periphery of the follicle (within its epidermis, just past the "glassy" basement membrane; Fig. 8E-G), and the lanceolate endings at
approximately the same depth but in the dermis (Fig.
8A-C). More superficially, at the level of the inner
conical body, many nerve fibers wrap around the follicle. Most of these
are unmyelinated sensory, sympathetic, or parasympathetic fibers.
However, a few of them are myelinated, express NF200, terminate as
branched lanceolate endings, and are thought to be mechanosensory (Rice
et al., 1997 ). BNaC1 was present in only a few of the
circumferential fibers, the ones with branched, lanceolated terminals
(Fig. 8A-C).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 8.
Innervation of rat whisker hair follicles. Shown
is immunoreactivity to the neuronal marker PGP 9.5 (green), BNaC1 (red), or both
(colocalization in yellow). A-C, Section
of whisker pad at the level of the inner conical body, with
circumferential fibers (only a few of which contain BNaC1 ;
arrowheads) and vertical, lanceolate endings
(bottom left). D, Schematic drawing of a
whisker (vibrissal) follicle and its associated innervation, derived
from Rice et al. (1993) . The epidermis is in gray, and
the dermis is in white; myelinated terminals are
depicted as black lines and unmyelinated terminals as
gray lines. E-G, Merkel cells and disks
within the epidermis of the follicle at mid-depth. H-J,
Section through the base of the follicle, with reticular endings that
terminate in contact with the basal membrane of the follicle. The nerve
that supplies all reticular, lanceolate, and Merkel endings may be
observed on the left of each panel
(arrows).
|
|
In the reticular endings of the whisker pad (Fig.
8H-J), as well as in the palisade endings of
regular hair follicles (see Fig. 7A-F), we noticed
that BNaC1 increases in density toward the terminals. In the fibers
that contact the Merkel cells in both hairy and glabrous skin (see
Figs. 6I-L, 8E-G), BNaC1 also accumulates in the terminals (the Merkel disks) and is much less abundant in the axons leading to them. Thus BNaC1 is transported to
and located at many, if not all, sites of mechanosensory transduction in the skin, whereas it is absent from the nerve endings that have been
considered to be non-mechanosensory (Rice et al., 1997 ).
 |
DISCUSSION |
Although it has been reported previously that BNaC1
(MDEG/ASIC2) mRNA is not expressed in the DRG (Waldmann and Lazdunski, 1998 ), we found that BNaC1 is expressed in the DRG, as assessed by
four different methods: in situ hybridization, RT-PCR,
Western blotting, and immunocytochemistry.
Unidirectional protein transport within DRG neurons
Within the cell bodies of DRG neurons, BNaC1 protein has a
rather distinctive subcellular localization: it is not conspicuously in
the plasma membrane but accumulates in the cytoplasm near the axon
hillock. Such a distribution would be expected of a protein that is
actively transported from the cell body. Despite this, we found no
detectable levels of BNaC1 in the central synaptic terminals of DRG
cells (in the spinal cord or in dorsal column nuclei) nor in the
processes leading to them (the dorsal roots and the dorsal columns).
However, BNaC1 is clearly transported from the cell bodies toward
the sensory terminals in the skin. Although we cannot rule out that
very small amounts of BNaC1 are present in central terminals of
primary sensory neurons, it is clear that a large portion of the
protein ends up localized at the peripheral terminals where sensory
transduction occurs. The unidirectional transport of BNaC1 from the
cell body toward the periphery is, as far as we know, unique. Other
sensory receptor channels such as the ATP-gated P2X3 (Vulchanova et
al., 1998 ) or the capsaicin-, heat-, and pH-gated VR1 (Guo et al.,
1999 ) are not transported exclusively to the periphery and are found in
central terminals also. The peripheral transport of BNaC1 indicates
that there must be a selective sorting mechanism, previously unnoticed
in the DRG for any protein, at the branch point of peripheral and
central axons; it also suggests that this channel is involved in
functions exclusive to the peripheral fibers, such as sensory transduction.
The physiological function of BNaC1
In which sensory modality might BNaC1 participate? The
activation of BNaC1 (and most other BNaC proteins) by extracellular acidification has led to a proposal that BNaC channels in nociceptive DRG neurons may detect tissue acidosis and mediate acid-induced pain
(Waldmann and Lazdunski, 1998 ). However, the sustained currents of
nociceptive neurons, activated below pH 6.5 and lasting for minutes
(Bevan and Yeats, 1991 ; Bevan and Geppetti, 1994 ), differ considerably
from BNaC1 currents in cultured cells, which are activated only
below pH 5.5 and inactivate within tens of seconds (see Fig.
2A; Waldmann and Lazdunski, 1998 ). More importantly, BNaC1 is expressed by most large-diameter neurons, which do not exhibit the sustained acid pH-induced current characteristic of nociceptors (Bevan and Yeats, 1991 ; Bevan and Geppetti, 1994 ). Instead,
the endogenous proton-gated currents in nociceptive neurons are very
similar to those of the capsaicin receptor, which is activated (with a
slow inactivation) below pH 6, and they are nearly eliminated in mutant
mice with no functional VR1 (Bevan and Geppetti, 1994 ; Caterina et al.,
1997 , 2000 ; Tominaga et al., 1998 ). Therefore, BNaC1 is not likely
to contribute significantly to the acid-sensing current characteristic
of peripheral nociception, although other related isoforms of the
BNaC/ASIC family may (see Benson et al., 1999 ).
In addition to the sustained acid-induced current of nociceptive
C-fibers, most cultured DRG neurons (as well as many neurons of the
CNS) are endowed with an inactivating acid-induced current (Bevan and Yeats, 1991 ; Bevan and Geppetti, 1994 ). Although these currents are activated below pH 7.0 and heterologously expressed BNaC1 channels activate only below pH 5.5, it is conceivable that
BNaC1 subunits might contribute to this endogenous current (for
example, as part of a heteromultimeric channel). However, the
physiological role of this current is not known.
Our data show that BNaC1 is expressed in that complement of DRG
neurons that is expected to be mechanosensory. This includes most
(90%) of the NF200 positive large-diameter neurons, which respond to
low intensity mechanical stimuli (touch, pressure, vibration, stretch,
and hair displacement), as well as the NF200-positive medium-diameter
and a few (4%) of the NF200-negative small-diameter neurons, some of
which are high-threshold mechanonociceptors. Most suggestively,
BNaC1 accumulates in the skin at all of the specialized
mechanosensitive endings that we have examined and not in other
non-mechanosensory endings, such as the intraepidermal C-fibers or the
circumferential fibers around the whisker follicle. Thus, the
expression pattern of BNaC1 is suggestive of a role in
mechanosensitivity, whether nociceptive or innocuous.
Although the location of BNaC1 in mechanosensitive terminals is not
direct evidence for activation by mechanical stimuli, it is intriguing
that other branches of the DEG/ENaC channel superfamily also have been
implicated in several types of mechanosensation. These include the
nematode degenerins MEC-4, MEC-10, UNC-105, and UNC-8 (Driscoll and
Chalfie, 1991 ; Huang and Chalfie, 1994 ; García-Añoveros
et al., 1995 ; García-Añoveros and Corey, 1996 ; Liu et
al., 1996 ; Tavernarakis et al., 1997 ), the Drosophila PPK protein (Adams et al., 1998 ; Darboux et al., 1998 ), and mammalian ENaCs
found at baroreceptor terminals (Drummond et al., 1998 ). We suggest,
based on its distribution and localization, that BNaC1 also may be a
mechanosensitive channel, participating in cutaneous touch sensation in mammals.
While this paper was under review, a report was published indicating
that transgenic mice with no functional BNaC1 have impaired mechanosensory cutaneous responses but retain normal responses to acid
pH (Price et al., 2000 ). These results support the hypothesis that
BNaC1 mediates touch sensation.
The physiological role of the activation of BNaC1 channels by
protons remains unclear. It is conceivable, although rather unorthodox,
that acid activation of this channel is part of the touch transduction
cascade. Alternatively, it seems plausible that the effect of protons
on BNaC1 is modulatory and that its primary gating stimulus is
force. In fact, the touch response of certain mechanosensory DRG
neurons is sensitized by extracellular acidity (Steen et al.,
1992 ).
In DRG neurons a mechanosensitive channel that can be blocked by the
amiloride analog benzamil has been described, and it has been proposed
that it may be a DEG/ENaC channel (McCarter et al., 1999 ). On the other
hand, with heterologous expression of either BNaC1 or the nematode
degenerin UNC-105 in CHO cells, we cannot elicit mechanosensitive
currents (data not shown). Other attempts to activate mechanically the
DEG/ENaC channels expressed in heterologous systems have failed also
(Awayda and Subramanyam, 1998 ). This is not surprising if DEG/ENaC
channels require specialized extracellular and intracellular tethering
proteins for mechanical gating (García-Añoveros and
Corey, 1996 , 1997 ), unlike mechanosensitive channels that may be opened
by forces applied through the lipid bilayer (Morris, 1990 ; Sukharev et
al., 1997 ). Therefore, functional testing of BNaC1 channel
mechanosensitivity most likely awaits the identification of these
proteins and the reconstitution of a macromolecular touch-sensitive complex.
If BNaC1 is a mechanotransducer, the diverse mechanosensitivity of
BNaC1 -containing nerve terminals (low and high threshold, slowly and
rapidly adapting) would imply that it contributes to different
mechanosensory complexes. Channels with different properties might be
obtained by forming heteromultimers with other subunits of the BNaC
branch, like ASIC1 (BNaC2 ), which also is expressed by subsets of
A- and C-fiber neurons (Chen et al., 1998 ), or with the subunits of the
epithelial sodium channel ( , , and -ENaC), which recently have
been detected in palisade nerve endings (Fricke et al., 2000 ). In
addition, even homomultimeric channels might interact with different
accessory proteins (such as extracellular tethering proteins) that
convey tension with varying efficiencies. Finally, potential
mechanosensory roles do not preclude activation by other physiological
stimuli such as acidic pH or neuropeptides. In fact, most nociceptors
are polymodal and respond to high-threshold mechanical stimuli, heat,
or chemical stimuli, including acidic pH. In nociceptor cells the BNaCs
might form, alone or in combination with other proteins, ion channels
that gate in response to a variety of stimuli.
 |
FOOTNOTES |
Received Sept. 27, 2000; revised Jan. 24, 2001; accepted Jan. 26, 2001.
This work was supported by the Howard Hughes Medical Institute (D.P.C.)
and by National Institutes of Health Grant NS38253-01 (C.J.W.). D.P.C.
is an Investigator and J.G.-A. is an Associate of the Howard Hughes
Medical Institute. We are indebted to Dr. Anne Duggan for materials and
experimental advice and to Dr. Frank Rice for expert anatomical advice.
We thank Alo Basu for antibody purification.
Correspondence should be addressed to Dr. Jaime
García-Añoveros at the above address. E-mail:
anoveros{at}helix.mgh.harvard.edu.
 |
REFERENCES |
-
Adams CM,
Anderson MG,
Motto DG,
Price MP,
Johnson WA,
Welsh MJ
(1998)
Ripped pocket and pickpocket, novel Drosophila DEG/ENaC subunits expressed in early development and in mechanosensory neurons.
J Cell Biol
1:143-152.
-
Amaya F,
Decosterd I,
Samad TA,
Plumpton C,
Tate S,
Mannion RJ,
Costigan M,
Woolf CJ
(2000)
Diversity of expression of the sensory neuron-specific TTX-resistant voltage-gated sodium ion channels SNS and SNS2.
Mol Cell Neurosci
15:331-342[Web of Science][Medline].
-
Askwith CC,
Cheng C,
Ikuma M,
Benson C,
Price MP,
Welsh MJ
(2000)
Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels.
Neuron
26:133-141[Web of Science][Medline].
-
Awayda MS,
Subramanyam M
(1998)
Regulation of the epithelial Na+ channel by membrane tension.
J Gen Physiol
112:97-111[Abstract/Free Full Text].
-
Babinski K,
Lê K-T,
Séguéla P
(1999)
Molecular cloning and regional distribution of a human proton receptor subunit with biphasic functional properties.
J Neurochem
72:51-57[Web of Science][Medline].
-
Benson CJ,
Eckert SP,
McCleskey EW
(1999)
Acid-evoked currents in cardiac sensory neurons, a possible mediator of myocardial ischemic sensation.
Circ Res
84:921-928[Abstract/Free Full Text].
-
Bevan S,
Geppetti P
(1994)
Protons: small stimulants of capsaicin-sensitive sensory nerves.
Trends Neurosci
17:509-512[Web of Science][Medline].
-
Bevan S,
Yeats J
(1991)
Protons activate a cation conductance in a subpopulation of rat dorsal root ganglion neurones.
J Physiol (Lond)
433:145-161[Abstract/Free Full Text].
-
Bruce MF,
Sinclair DC
(1980)
Relationship between tactile thresholds and histology of the human finger.
J Neurol Neurosurg Psychiatry
43:235-242[Abstract/Free Full Text].
-
Canessa CM,
Horrisberger JD,
Rossier BC
(1993)
Epithelial sodium channel related to proteins involved in neurodegeneration.
Nature
361:467-470[Medline].
-
Canessa CM,
Schild L,
Buell G,
Thorens B,
Gutschi I,
Horrisberger JD,
Rossier BC
(1994)
Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits.
Nature
367:463-467[Medline].
-
Caterina MJ,
Schumacher MA,
Tominaga M,
Rosen TA,
Levine JD,
Julius D
(1997)
The capsaicin receptor: a heat-activated ion channel in the pain pathway.
Nature
389:816-824[Web of Science][Medline].
-
Caterina MJ,
Leffler A,
Malberg AB,
Martin WJ,
Trafton J,
Petersen-Zeitz KR,
Koltzenburg M,
Basbaum AI,
Julius D
(2000)
Impaired nociception and pain sensation in mice lacking the capsaicin receptor.
Science
288:306-313[Abstract/Free Full Text].
-
Cauna N
(1973)
The free penicillate nerve endings of the human hairy skin.
J Anat
115:277-288[Web of Science][Medline].
-
Cauna N,
Ross LL
(1960)
Fine structure of Meissner's touch corpuscles of human fingers.
J Biophys Biochem Cytol
8:467-482[Abstract/Free Full Text].
-
Chen C-C,
England S,
Akopian AN,
Wood JN
(1998)
A sensory neuron-specific, proton-gated ion channel.
Proc Natl Acad Sci USA
95:10240-10245[Abstract/Free Full Text].
-
Corey DP,
García-Añoveros J
(1996)
Mechanosensation and the DEG/ENaC ion channels.
Science
273:323-324[Web of Science][Medline].
-
Darboux I,
Lingueglia E,
Pauron D,
Barbry P,
Lazdunski M
(1998)
A new member of the amiloride-sensitive sodium channel family in Drosophila melanogaster peripheral nervous system.
Biochem Biophys Res Commun
246:210-216[Web of Science][Medline].
-
Driscoll M,
Chalfie M
(1991)
The mec-4 gene is a member of a family of Caenorhabditis elegans genes that can mutate to induce neuronal degeneration.
Nature
349:588-593[Medline].
-
Drummond HA,
Price MP,
Welsh MJ,
Abboud FM
(1998)
A molecular component of the arterial baroreceptor mechanotransducer.
Neuron
21:1435-1441[Web of Science][Medline].
-
Duggan A,
García-Añoveros J,
Corey DP
(2000)
Insect mechanoreception: what a long, strange TRP it's been.
Curr Biol
10:R384-R387[Web of Science][Medline].
-
Fricke B,
Lints R,
Stewart G,
Drummond H,
Dodt G,
Driscoll M,
von Düring M
(2000)
Epithelial Na+ channels and stomatin are expressed in rat trigeminal mechanosensory neurons.
Cell Tissue Res
299:327-334[Web of Science][Medline].
-
García-Añoveros J,
Corey DP
(1996)
Mechanosensation: touch at the molecular level.
Curr Biol
6:541-543[Medline].
-
García-Añoveros J,
Corey DP
(1997)
The molecules of mechanosensation.
Annu Rev Neurosci
20:567-594[Web of Science][Medline].
-
García-Añoveros J,
Ma C,
Chalfie M
(1995)
Regulation of Caenorhabditis elegans degenerin proteins by a putative extracellular domain.
Curr Biol
5:441-448[Medline].
-
García-Añoveros J,
Derfler B,
Neville-Golden J,
Hyman BT,
Corey DP
(1997)
BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels.
Proc Natl Acad Sci USA
94:1459-1464[Abstract/Free Full Text].
-
García-Añoveros J,
García JA,
Liu JD,
Corey DP
(1998)
The nematode degenerin UNC-105 forms ion channels that are activated by degeneration- or hypercontraction-causing mutations.
Neuron
20:1231-1241[Web of Science][Medline].
-
Goldstein ME,
House SB,
Gainer H
(1991)
NF-L and peripherin immunoreactivities define distinct classes of rat sensory ganglion cells.
J Neurosci Res
30:92-104[Web of Science][Medline].
-
Guo A,
Vulchanova L,
Wang J,
Li X,
Elde R
(1999)
Immunocytochemical localization of the vanilloid receptor 1 (VR1): relationship to neuropeptides, the P2X3 purinoceptor, and IB4 binding sites.
Eur J Neurosci
11:946-958[Web of Science][Medline].
-
Huang M,
Chalfie M
(1994)
Gene interactions affecting mechanosensory transduction in Caenorhabditis elegans.
Nature
367:467-470[Medline].
-
Ishibashi K,
Marumo F
(1998)
Molecular cloning of a DEG/ENaC sodium channel cDNA from human testis.
Biochem Biophys Res Commun
245:589-593[Web of Science][Medline].
-
Kruger L,
Perl ER,
Sedivec MJ
(1981)
Fine structure of myelinated mechanical nociceptor endings in cat hairy skin.
J Comp Neurol
198:137-154[Web of Science][Medline].
-
Lawson SN,
Waddell PJ
(1991)
Soma neurofilament immunoreactivity is related to cell size and fibre conduction velocity in rat primary sensory neurons.
J Physiol (Lond)
435:41-63[Abstract/Free Full Text].
-
Lawson SN,
Harper AA,
Harper EI,
Garson JA,
Anderton BH
(1984)
A monoclonal antibody against neurofilament protein specifically labels a subpopulation of rat sensory neurones.
J Comp Neurol
228:263-272[Web of Science][Medline].
-
Liu J,
Schrank B,
Waterston R
(1996)
Interaction between a putative mechanosensory membrane channel and a collagen.
Science
273:361-364[Abstract].
-
McCarter GC,
Reichling DB,
Levine JD
(1999)
Mechanical transduction by rat dorsal root ganglion neurons in vitro.
Neurosci Lett
273:179-182[Web of Science][Medline].
-
Millard CL,
Woolf CJ
(1988)
Sensory innervation of the hairs of the rat hindlimb: a light microscopic analysis.
J Comp Neurol
277:183-194[Web of Science][Medline].
-
Morris CE
(1990)
Mechanosensitive ion channels.
J Membr Biol
113:93-107[Web of Science][Medline].
-
Price M,
Snyder P,
Welsh MJ
(1996)
Cloning and expression of a novel human brain Na+ channel.
J Biol Chem
271:7879-7882[Abstract/Free Full Text].
-
Price MP,
Lewin GR,
McIlwrath SL,
Cheng C,
Xie J,
Heppenstall PA,
Stucky CL,
Mannsfeldt AG,
Brennan TJ,
Drummond HA,
Qiao J,
Benson CJ,
Tarr DE,
Hrstka RF,
Yang B,
Williamson RA,
Welsh MJ
(2000)
The mammalian sodium channel BNC1 is required for normal touch sensation.
Nature
407:1007-1011[Medline].
-
Reeh PW,
Steen KH
(1996)
Tissue acidosis in nociception and pain.
Prog Brain Res
113:143-151[Web of Science][Medline].
-
Rice FL,
Kinnman E,
Aldskogius H,
Johansson O,
Arvidsson J
(1993)
The innervation of the mystacial pad of the rat as revealed by PGP 9.5 immunofluorescence.
J Comp Neurol
337:366-385[Web of Science][Medline].
-
Rice FL,
Fundin BT,
Arvidsson J,
Aldskogius H,
Johansson O
(1997)
Comprehensive immunofluorescence and lectin binding analysis of vibrissal follicle sinus complex innervation in the mystacial pad of the rat.
J Comp Neurol
385:149-184[Web of Science][Medline].
-
Sann H,
McCarthy PW,
Jancsó G,
Pierau F-K
(1995)
RT97: a marker for capsaicin-insensitive sensory endings in the rat skin.
Cell Tissue Res
282:155-161[Web of Science][Medline].
-
Sinclair DC
(1982)
In: Mechanisms of cutaneous sensation. London: Oxford UP.
-
Steen KH,
Reeh PW,
Anton F,
Handwerker HO
(1992)
Protons selectively induce lasting excitation and sensitization to mechanical stimulation of nociceptors in rat skin in vitro.
J Neurosci
12:86-95[Abstract].
-
Sukharev SI,
Blount P,
Martinac B,
Kung C
(1997)
Mechanosensitive channels of Escherichia coli: the MscL gene, protein, and activities.
Annu Rev Physiol
59:633-657[Web of Science][Medline].
-
Tavernarakis N,
Shreffler W,
Wang S,
Driscoll M
(1997)
unc-8, a DEG/ENaC family member, encodes a subunit of a candidate mechanically gated channel that modulates C. elegans locomotion.
Neuron
18:107-119[Web of Science][Medline].
-
Thompson RJ,
Doran JF,
Jackson P,
Dhillon AP,
Rode J
(1983)
PGP 9.5
a new marker for vertebrate neurons and neuroendocrine cells.
Brain Res
278:224-278[Web of Science][Medline]. -
Tominaga M,
Caterina MJ,
Malberg AB,
Rosen TA,
Gilbert H,
Skinner K,
Raumann BE,
Basbaum AI,
Julius D
(1998)
The cloned capsaicin receptor integrates multiple pain-producing stimuli.
Neuron
21:531-543[Web of Science][Medline].
-
Vulchanova L,
Riedl MS,
Shuster SJ,
Stone LS,
Hargreaves KM,
Buell G,
Surprenant A,
North RA,
Elde R
(1998)
P2X3 is expressed by DRG neurons that terminate in inner lamina II.
Eur J Neurosci
10:3470-3478[Web of Science][Medline].
-
Waldmann R,
Lazdunski M
(1998)
H+-gated cation channels: neuronal acid sensors in the NaC/DEG family of ion channels.
Curr Opin Neurobiol
8:418-424[Web of Science][Medline].
-
Waldmann R,
Champigny G,
Voilley N,
Lauritzen I,
Lazdunski M
(1996)
The mammalian degenerin MDEG, an amiloride-sensitive cation channel activated by mutations causing neurodegeneration in Caenorhabditis elegans.
J Biol Chem
271:10433-10436[Abstract/Free Full Text].
-
Waldmann R,
Bassilana F,
de Weille J,
Champigny G,
Heurteaux C,
Lazdunski M
(1997)
Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons.
J Biol Chem
272:20975-20978[Abstract/Free Full Text].
Copyright © 2001 Society for Neuroscience 0270-6474/01/2182678-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. L. McCord, S. G. Hayes, and M. P. Kaufman
Acid-sensing ion and epithelial sodium channels do not contribute to the mechanoreceptor component of the exercise pressor reflex
Am J Physiol Heart Circ Physiol,
September 1, 2008;
295(3):
H1017 - H1024.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Coric, Y. J. Passamaneck, P. Zhang, A. Di Gregorio, and C. M. Canessa
Simple chordates exhibit a proton-independent function of acid-sensing ion channels
FASEB J,
June 1, 2008;
22(6):
1914 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Cadiou, M. Studer, N. G. Jones, E. St. J. Smith, A. Ballard, S. B. McMahon, and P. A. McNaughton
Modulation of Acid-Sensing Ion Channel Activity by Nitric Oxide
J. Neurosci.,
November 28, 2007;
27(48):
13251 - 13260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Duan, L.-J. Wu, Y.-Q. Yu, Y. Ding, L. Jing, L. Xu, J. Chen, and T.-L. Xu
Upregulation of Acid-Sensing Ion Channel ASIC1a in Spinal Dorsal Horn Neurons Contributes to Inflammatory Pain Hypersensitivity
J. Neurosci.,
October 10, 2007;
27(41):
11139 - 11148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. W. Chapleau
Exciting times in sensory transduction from A(drian) to Z
J. Physiol.,
July 1, 2007;
582(1):
13 - 14.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lingueglia
Acid-sensing Ion Channels in Sensory Perception
J. Biol. Chem.,
June 15, 2007;
282(24):
17325 - 17329.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Grifoni, K. P. Gannon, D. E. Stec, and H. A. Drummond
ENaC proteins contribute to VSMC migration
Am J Physiol Heart Circ Physiol,
December 1, 2006;
291(6):
H3076 - H3086.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. L. Jernigan and H. A. Drummond
Myogenic vasoconstriction in mouse renal interlobar arteries: role of endogenous beta and {gamma}ENaC
Am J Physiol Renal Physiol,
December 1, 2006;
291(6):
F1184 - F1191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Corey
What is the hair cell transduction channel?
J. Physiol.,
October 1, 2006;
576(1):
23 - 28.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Poirot, T. Berta, I. Decosterd, and S. Kellenberger
Distinct ASIC currents are expressed in rat putative nociceptors and are modulated by nerve injury
J. Physiol.,
October 1, 2006;
576(1):
215 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Jiang, K. K. Rau, R. D. Johnson, and B. Y. Cooper
Proton Sensitivity Ca2+ Permeability and Molecular Basis of Acid-Sensing Ion Channels Expressed in Glabrous and Hairy Skin Afferents
J Neurophysiol,
April 1, 2006;
95(4):
2466 - 2478.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. M. Albers, C. J. Woodbury, A. M. Ritter, B. M. Davis, and H. R. Koerber
Glial cell line-derived neurotrophic factor expression in skin alters the mechanical sensitivity of cutaneous nociceptors.
J. Neurosci.,
March 15, 2006;
26(11):
2981 - 2990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A J Page, S M Brierley, C M Martin, M P Price, E Symonds, R Butler, J A Wemmie, and L A Blackshaw
Different contributions of ASIC channels 1a, 2, and 3 in gastrointestinal mechanosensory function
Gut,
October 1, 2005;
54(10):
1408 - 1415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. L. Jernigan and H. A. Drummond
Vascular ENaC proteins are required for renal myogenic constriction
Am J Physiol Renal Physiol,
October 1, 2005;
289(4):
F891 - F901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. P. Zagorodnyuk, P. Lynn, M. Costa, and S. J. H. Brookes
Mechanisms of mechanotransduction by specialized low-threshold mechanoreceptors in the guinea pig rectum
Am J Physiol Gastrointest Liver Physiol,
September 1, 2005;
289(3):
G397 - G406.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Nagata, A. Duggan, G. Kumar, and J. Garcia-Anoveros
Nociceptor and Hair Cell Transducer Properties of TRPA1, a Channel for Pain and Hearing
J. Neurosci.,
April 20, 2005;
25(16):
4052 - 4061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Wilson-Gerwing, M. V. Dmyterko, D. W. Zochodne, J. M. Johnston, and V. M. K. Verge
Neurotrophin-3 Suppresses Thermal Hyperalgesia Associated with Neuropathic Pain and Attenuates Transient Receptor Potential Vanilloid Receptor-1 Expression in Adult Sensory Neurons
J. Neurosci.,
January 19, 2005;
25(3):
758 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Price, R. J. Thompson, J. O. Eshcol, J. A. Wemmie, and C. J. Benson
Stomatin Modulates Gating of Acid-sensing Ion Channels
J. Biol. Chem.,
December 17, 2004;
279(51):
53886 - 53891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Drummond, D. Gebremedhin, and D. R. Harder
Degenerin/Epithelial Na+ Channel Proteins: Components of a Vascular Mechanosensor
Hypertension,
November 1, 2004;
44(5):
643 - 648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Benos
Sensing Tension: Recognizing ENaC as a Stretch Sensor
Hypertension,
November 1, 2004;
44(5):
616 - 617.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gandhi, J. M. Ryals, and D. E. Wright
Neurotrophin-3 Reverses Chronic Mechanical Hyperalgesia Induced by Intramuscular Acid Injection
J. Neurosci.,
October 20, 2004;
24(42):
9405 - 9413.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-P. Chu, J. A. Wemmie, W.-Z. Wang, X.-M. Zhu, J. A. Saugstad, M. P. Price, R. P. Simon, and Z.-G. Xiong
Subunit-Dependent High-Affinity Zinc Inhibition of Acid-Sensing Ion Channels
J. Neurosci.,
October 6, 2004;
24(40):
8678 - 8689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Syntichaki and N. Tavernarakis
Genetic Models of Mechanotransduction: The Nematode Caenorhabditis elegans
Physiol Rev,
October 1, 2004;
84(4):
1097 - 1153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Roza, J.-L. Puel, M. Kress, A. Baron, S. Diochot, M. Lazdunski, and R. Waldmann
Knockout of the ASIC2 channel in mice does not impair cutaneous mechanosensation, visceral mechanonociception and hearing
J. Physiol.,
July 15, 2004;
558(2):
659 - 669.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Drew, D. K. Rohrer, M. P. Price, K. E. Blaver, D. A. Cockayne, P. Cesare, and J. N. Wood
Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones
J. Physiol.,
May 1, 2004;
556(3):
691 - 710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sukharev and D. P. Corey
Mechanosensitive Channels: Multiplicity of Families and Gating Paradigms
Sci. Signal.,
February 10, 2004;
2004(219):
re4 - re4.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. P Zagorodnyuk, B. N. Chen, M. Costa, and S. J H Brookes
Mechanotransduction by intraganglionic laminar endings of vagal tension receptors in the guinea-pig oesophagus
J. Physiol.,
December 1, 2003;
553(2):
575 - 587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Xu, Y. Gu, G.-Y. Xu, P. Wu, G.-W. Li, and L.-Y. M. Huang
Adeno-associated viral transfer of opioid receptor gene to primary sensory neurons: A strategy to increase opioid antinociception
PNAS,
May 13, 2003;
100(10):
6204 - 6209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xie, M. P. Price, J. A. Wemmie, C. C. Askwith, and M. J. Welsh
ASIC3 and ASIC1 Mediate FMRFamide-Related Peptide Enhancement of H+-Gated Currents in Cultured Dorsal Root Ganglion Neurons
J Neurophysiol,
May 1, 2003;
89(5):
2459 - 2465.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Strange
From Genes to Integrative Physiology: Ion Channel and Transporter Biology in Caenorhabditis elegans
Physiol Rev,
April 1, 2003;
83(2):
377 - 415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mamet, A. Baron, M. Lazdunski, and N. Voilley
ProInflammatory Mediators, Stimulators of Sensory Neuron Excitability via the Expression of Acid-Sensing Ion Channels
J. Neurosci.,
December 15, 2002;
22(24):
10662 - 10670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Berdiev, J. Xia, B. Jovov, J. M. Markert, T. B. Mapstone, G. Y. Gillespie, C. M. Fuller, J. K. Bubien, and D. J. Benos
Protein Kinase C Isoform Antagonism Controls BNaC2 (ASIC1) Function
J. Biol. Chem.,
November 22, 2002;
277(48):
45734 - 45740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Zhang and C. M. Canessa
Single Channel Properties of Rat Acid-sensitive Ion Channel-1{alpha}, -2a, and -3 Expressed in Xenopus Oocytes
J. Gen. Physiol.,
September 30, 2002;
120(4):
553 - 566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Averill, D. R. Davis, P. J. Shortland, J. V. Priestley, and S. P. Hunt
Dynamic Pattern of Reg-2 Expression in Rat Sensory Neurons after Peripheral Nerve Injury
J. Neurosci.,
September 1, 2002;
22(17):
7493 - 7501.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kollarik and B. J Undem
Mechanisms of acid-induced activation of airway afferent nerve fibres in guinea-pig
J. Physiol.,
September 1, 2002;
543(2):
591 - 600.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kellenberger and L. Schild
Epithelial Sodium Channel/Degenerin Family of Ion Channels: A Variety of Functions for a Shared Structure
Physiol Rev,
July 1, 2002;
82(3):
735 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Xie, M. P. Price, A. L. Berger, and M. J. Welsh
DRASIC Contributes to pH-Gated Currents in Large Dorsal Root Ganglion Sensory Neurons by Forming Heteromultimeric Channels
J Neurophysiol,
June 1, 2002;
87(6):
2835 - 2843.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. J. Drew, J. N. Wood, and P. Cesare
Distinct Mechanosensitive Properties of Capsaicin-Sensitive and -Insensitive Sensory Neurons
J. Neurosci.,
May 31, 2002;
(2002)
20026459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baron, R. Waldmann, and M. Lazdunski
ASIC-like, proton-activated currents in rat hippocampal neurons
J. Physiol.,
March 1, 2002;
539(2):
485 - 494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Benson, J. Xie, J. A. Wemmie, M. P. Price, J. M. Henss, M. J. Welsh, and P. M. Snyder
Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons
PNAS,
February 19, 2002;
99(4):
2338 - 2343.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D Levy and A M Strassman
Distinct sensitizing effects of the cAMP-PKA second messenger cascade on rat dural mechanonociceptors
J. Physiol.,
January 15, 2002;
538(2):
483 - 493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Voilley, J. de Weille, J. Mamet, and M. Lazdunski
Nonsteroid Anti-Inflammatory Drugs Inhibit Both the Activity and the Inflammation-Induced Expression of Acid-Sensing Ion Channels in Nociceptors
J. Neurosci.,
October 15, 2001;
21(20):
8026 - 8033.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Berdiev, T. B. Mapstone, J. M. Markert, G. Y. Gillespie, J. Lockhart, C. M. Fuller, and D. J. Benos
pH Alterations "Reset" Ca2+ Sensitivity of Brain Na+ Channel 2, a Degenerin/Epithelial Na+ Ion Channel, in Planar Lipid Bilayers
J. Biol. Chem.,
October 12, 2001;
276(42):
38755 - 38761.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Duggan, J. Garcia-Anoveros, and D. P. Corey
The PDZ Domain Protein PICK1 and the Sodium Channel BNaC1 Interact and Localize at Mechanosensory Terminals of Dorsal Root Ganglion Neurons and Dendrites of Central Neurons
J. Biol. Chem.,
February 8, 2002;
277(7):
5203 - 5208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baron, L. Schaefer, E. Lingueglia, G. Champigny, and M. Lazdunski
Zn2+ and H+ Are Coactivators of Acid-sensing Ion Channels
J. Biol. Chem.,
September 14, 2001;
276(38):
35361 - 35367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Welsh, M. P. Price, and J. Xie
Biochemical Basis of Touch Perception: Mechanosensory Function of Degenerin/Epithelial Na+ Channels
J. Biol. Chem.,
January 18, 2002;
277(4):
2369 - 2372.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Alvarez de la Rosa, P. Zhang, D. Shao, F. White, and C. M. Canessa
Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system
PNAS,
February 19, 2002;
99(4):
2326 - 2331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D Levy and A M Strassman
Distinct sensitizing effects of the cAMP-PKA second messenger cascade on rat dural mechanonociceptors
J. Physiol.,
January 15, 2002;
538(2):
483 - 493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baron, R. Waldmann, and M. Lazdunski
ASIC-like, proton-activated currents in rat hippocampal neurons
J. Physiol.,
March 1, 2002;
539(2):
485 - 494.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|