 |
Previous Article | Next Article 
The Journal of Neuroscience, May 1, 2001, 21(9):2949-2957
Syntaxin 1A Supports Voltage-Dependent Inhibition of
1B Ca2+ Channels by G in Chick Sensory
Neurons
Qiang
Lü1,
M. S.
AtKisson1,
Scott E.
Jarvis2,
Zhong-Ping
Feng2, 3,
Gerald W.
Zamponi2, and
Kathleen
Dunlap1
1 Department of Neuroscience, Tufts University School
of Medicine, Boston, Massachusetts 02111, 2 Department of
Physiology and Biophysics, University of Calgary, Calgary, Alberta T2N
4N1, Canada, and 3 NeuroMed Technologies, Vancouver,
British Columbia V6T 1Z4, Canada
 |
ABSTRACT |
N-type Ca2+ channels are modulated by a variety
of G-protein-coupled pathways. Some pathways produce a transient,
voltage-dependent (VD) inhibition of N channel function and involve
direct binding of G-protein subunits; others require the activation of
intermediate enzymes and produce a longer-lasting, voltage-independent
(VI) form of inhibition. The ratio of VD:VI inhibition differs
significantly among cell types, suggesting that the two forms of
inhibition play unique physiological roles in the nervous system. In
this study, we explored mechanisms capable of altering the balance of
VD and VI inhibition in chick dorsal root ganglion neurons. We report
that (1) VD:VI inhibition is critically dependent on the G
concentration, with VI inhibition dominant at low G concentrations, and (2) syntaxin-1A (but not syntaxin-1B) shifts the
ratio in favor of VD inhibition by potentiating the VD effects of
G . Variations in expression levels of G-proteins and/or syntaxin provide the means to alter over a wide range both the extent and the
rate of Ca2+ influx through N channels.
Key words:
G-protein modulation; dorsal root ganglion neurons; GABA
receptors; adrenergic receptors; recombinant channels; presynaptic
regulation
 |
INTRODUCTION |
The modulation of voltage-dependent
Ca2+ channels by G-protein-coupled
receptors takes many forms and varies as a function not only of the
receptor and channel type but also of the cell under study (Dolphin,
1998 ; Dunlap and Ikeda, 1998 ; Ikeda and Dunlap, 1999 ). Among the many
Ca2+ channel gene products identified,
those from class B (or N-type) have been best studied, because they
have proven to be most sensitive to G-protein-coupled pathways. Several
receptor-dependent pathways have been described to target N channels in
native cells. The most ubiquitous is mediated by direct binding between
 complexes released from heterotrimeric G-proteins (G ) and
Ca2+ channel 1
subunits (DeWaard et al., 1997 ; Qin et al., 1997 ; Zamponi et al., 1997 ;
Furukawa et al., 1998 ); such binding produces a voltage-dependent (VD)
form of inhibition often characterized by slowed current activation
kinetics (Marchetti et al., 1986 ; Bean, 1989 ; Elmslie et al., 1990 ;
Arnot et al., 2000 ). In contrast, other forms of modulation are
mediated by more complex signaling pathways involving kinase-dependent
phosphorylation and producing long-lasting, voltage-independent (VI)
effects (Dunlap and Ikeda, 1998 ).
In most neurons, both VD and VI forms of G-protein-mediated inhibition
coexist. Given their unique biophysical and biochemical profiles and
variations in their relative abundance from cell to cell, the two forms
of inhibition have been hypothesized to play distinct physiological
roles in the nervous system (Brody et al., 1997 ; Park and Dunlap, 1998 ;
Brody and Yue, 2000 ). Thus, understanding the molecular mechanisms
responsible for these forms of inhibition is of potential physiological
significance. Our studies have used dorsal root ganglion (DRG) neurons
from embryonic chick, because they prominently express both VD and VI
inhibition (Luebke and Dunlap, 1994 ) that can be activated by a variety
of G-protein-coupled receptors. We have, in addition, demonstrated some
selectivity between receptors and the pathways to which they couple
(Diversé-Pierluissi and Dunlap, 1993 ; Diversé-Pierluissi et
al., 1995 ), suggesting the possibility of receptor-specific modulation
of physiological processes.
Use of function-blocking antibodies directed against G-protein
o and i subunits
allowed the demonstration that norepinephrine (NE) and GABA
mediate VD inhibition in chick DRG neurons via
Go, whereas NE also produces VI inhibition via
Gi (Diversé-Pierluissi et al., 1995 ). This
latter pathway requires the activation of PLC
and protein kinase C (PKC) (Rane et al., 1989 ; Diversé-Pierluissi et al., 2000 ). When purified G is introduced intracellularly into
these cells, only the VI form of inhibition is observed, suggesting
that VD inhibition might be mediated by G o.
This lack of G -mediated VD inhibition, however, is at odds with
many studies of mammalian Ca2+ channels
demonstrating that G (and not G ) produces VD inhibition (Herlitze et al., 1996 ; Ikeda, 1996 ) and raises the question of whether
structural differences in the chick N channel
1B subunits underlie differences in modulation.
To allow a test of this hypothesis, we first cloned cDNAs encoding the
expressed N-type channels from chick DRG cells and identified three
variable regions in which the avian channels differ significantly from
their mammalian counterparts (Lü and Dunlap, 1999 ). Here we
compare G -induced modulation of these recombinant N channels
expressed in tsA-201 cells with those of native N channels in chick DRG
neurons. Results demonstrate that the modulation of chick N channels
does not differ between the isoforms, either in their native
environments or when expressed heterologously, and (as is true for rat
N channels) G mediates VD inhibition. We find that, at low
G concentrations, VI inhibition dominates, but syntaxin 1A
promotes a switch to VD inhibition by enhancing the interaction between
the G complex and the Ca2+ channel subunit.
 |
MATERIALS AND METHODS |
Cell culture and transfection. Dorsal root ganglia
were dissected from chicken embryos (11- to 12-d-old for most
experiments), incubated for 20 min in 0.005-0.01% collagenase A
(Sigma, St. Louis, MO or Boehringer Mannheim, Indianapolis, IN) in a
Ca2+-Mg2+-free
saline, and dissociated mechanically in tissue culture medium (below)
by trituration through a small-bore Pasteur pipette. The culture medium
was DMEM supplemented with 10% heat-inactivated horse serum, 1 mM glutamine, 50 U/ml penicillin, 50 µg/ml
streptomycin (Life Technologies, Gaithersburg, MD), and an empirically
determined amount of male mouse submaxillary gland homogenate (to
supply nerve growth factor). Cells were plated in 35 mm tissue culture dishes (Falcon).
Human embryonic kidney cells (clone tsA-201) were cultured and
transfected using methods previously described (Lü and Dunlap, 1999 ). Before transfection, cells were split 1:10, and 24 hr later, they were transfected using the calcium-phosphate method (Dhallan et
al., 1990 ) with a mixture of 10 µg of
Ca2+ channel 1B
subunit cDNA with 10 µg of rat 1B (provided
by S. R. Ikeda, Guthrie Institute, Sayre, PA), 8 µg of
rat 2 (provided by H. Chin, National
Institutes of Health, Bethesda, MD), and 2 µg of large T
antigen (provided by D. T. Yue, Johns Hopkins University,
Baltimore, MD), all in pcDNA3. The cDNA for
rn 1B-b was kindly supplied by Diane Lipscombe (Brown
University, Providence, RI). In some experiments, 4 µg each of cDNAs
encoding G-protein 1 and
2 subunits (in pcDNA3; provided by Stephen
Ikeda) or syntaxin 1A (in pMT2; Jarvis et al., 2000 ) were also
cotransfected. Currents were recorded 2-4 d after transfection.
Cell injection. Proteins were overexpressed in DRG neurons
by direct injection (Microinjector 5242; Eppendorf, Westbury, NY) of
expression plasmids into the nucleus of cells cultured for 4-30 hr
according to methods above. Plasmid concentrations were 50 ng/µl in
125 mM KCl and 5 mM HEPES,
pH 7.2. Fluorescein dextran (10 kDa, 2.5 µg/µl; Molecular Probes,
Eugene OR) was included to allow later identification of injected
cells. Recordings were made 16-24 hr after injection. Approximately
50% of fluorescent cells showed the expected effect of overexpression
(alteration of current amplitude and/or time course); in the remaining
cells, it is likely that the injection missed the nucleus. Use of green fluorescent protein cDNA as a control for successful nuclear injection was precluded because the protein is toxic to chick DRG neurons, regardless of the expression method (M. S. AtKisson, unpublished observations).
Reverse transcriptase-PCR. Total RNA was
purified from whole ganglia or brain dissected from chicks at embryonic
days 12, 15, 18, and 21 or from adult chicken or adult Sprague Dawley
rats using RNA STAT-60 (Tel-Test B, Friendswood, TX). Poly(A+) RNA was
purified from the total RNA using the Oligotex mini kit (Qiagen, Valencia, CA). Reverse transcriptase (RT) reactions were performed with
the GeneAmp RNA PCR core kit (PE Biosystems, Foster City, CA) according
to the manufacturer's directions, using a ratio of oligo-dT to random
hexamers of 3:1. Five microliters of the RT reaction was used for PCR,
which was performed using Advantage enzyme (Clontech, Palo Alto, CA).
Primers were designed based on alignments of syntaxin 1A sequences from
rat, human, and fruit fly (GenBank) accession numbers AF217191,
NM_004603, and L37732), and of syntaxin 1B sequences from human, rat,
and mouse (GenBank accession numbers NM_003163, M95735, and
D29743). Alignments were performed using the ClustalW program
maintained on the web by EMBL-European Bioinformatics Institute. Primer
designations are for bookkeeping purposes, and do not reflect any
information. PCR protocols consisted of a hot start and touchdown (five
cycles at 72°C, five cycles at 70°C, and 23 cycles at 68°C),
using an Eppendorf MasterGradient thermocycler.
Cloning of rat syntaxin 1B. All reagents and primers
were purchased from Life Technologies (Rockville, MD). The
forward primer (with a 5' NotI restriction site) was
(5'-CGAAGAAGGGGAGGAGGAGCTGCGGCCGCCATGAAGGATCGGACTCAGGAGC-3'), and the
reverse primer (with a 5' XhoI restriction site) was
(5'GGTCCTGGGCTCGAGAAGGGTAGGGGCCTACAAGCCCAGTGTCCC3'). Rat brain cDNA was
kindly provided by Bob Winkfein (University of Calgary, Calgary,
Alberta, Canada). The PCR reaction was performed in a volume of 50 µl
and included 20 mM Tris-HCl, pH 8.4, 50 mM KCl, dNTPs (0.2 mM
each), 3.5 mM MgCl2, 2.5 U
of platinum Taq DNA polymerase, 20 pmol of each primer, and
50 ng of cDNA. Using a PTC-100HB thermal-cycler (MJ Research,
Watertown, MA), the reaction began with a hot start, and was held at
9°C for 2 min. Thirty cycles were conducted, consisting of
denaturation for 30 sec at 94°C, annealing for 45 sec at 62°C, and
extension for 1.5 min at 72°C. The resultant syntaxin 1B DNA product
was run on a 0.8% agarose gel, extracted, and purified using QIAquick
Gel Extraction (Qiagen, Mississauga, Ontario, Canada), ligated into a
pGEM T-Easy vector (Promega, Madison, WI), and sequenced to rule out
PCR errors. The syntaxin 1B-T-Easy construct was then digested by
NotI and XhoI, and the syntaxin 1B fragment was
ligated into pMT2sx (Genetics Institute, Andover, MA) for subsequent
expression in tsA-201 cells. Rat syntaxin 1A cDNA was also subcloned
into pMT2sx, and G 1 and G 2 were subcloned into pcDNA3 (Invitrogen,
Carlsbad, CA).
Current recording and data analysis. Standard tight-seal,
whole-cell recording methods were used to measure
Ca2+ current through N-type channels using
a List Biologic (Campbell, CA) EPC9 amplifier. Internal solution
for recording from chick DRG neurons or tsA-201 cells expressing the
recombinant chick N channel clones contained 150 mM CsCl, 10 mM HEPES, 5 mM BAPTA, and 5 mM MgATP,
pH-adjusted to 7.2 with CsOH; external solution contained 93 mM NaCl, 50 mM
tetraethylammonium chloride, 2 mM CaCl2, 25 mM HEPES, 12.5 mM NaOH, 5 mM
D-glucose, and 0.3 µ mM tetrodotoxin, pH-adjusted to 7.4 with TEA-OH.
Where noted, some experiments on recombinant chick and rat N channels
expressed in tsA-201 cells used an external solution of 20 mM BaCl2, 1 mM
MgCl2,10 mM HEPES, 40 mM
TEA-Cl, 10 mM glucose, and 65 mM CsCl, pH 7.2 with TEA-OH, and an internal solution containing 108 mM
Cs-methanesulfonate, 4 mM MgCl2, 9 mM EGTA, and 9 mM HEPES, pH 7.2. Such solutions
enhanced current amplitudes but otherwise did not alter fundamental
properties of their modulation by G-protein subunits when compared with
the Ca2+-based external solution.
For some experiments, purified bovine brain G was applied
intracellularly via the patch pipette. The G preparation (kindly provided by John Hildebrandt, University of South Carolina Medical Center, Charleston, SC) was stored at 80°C as a stock
solution of ~1 mg/ml in buffer containing 20 mM Tris, pH
8.0, 1 mM EDTA, 1 mM dithiothreitol, 100 mM NaCl, and either 0.7% CHAPS or 0.7% CHAPS and
0.1% polyoxyethylene-9-lauryl ether (Thesit). No differences were
observed between the two storage buffers. On the day of the experiments, a sample was diluted into intracellular recording solution
to a final concentration of 20 nM and applied by passive diffusion from the pipette to the cytoplasm. Heat-inactivated G
served as negative control.
 |
RESULTS |
Purified G produces VI but not VD inhibition of
N current
Tight-seal, whole-cell methods were used to record macroscopic,
N-type Ca2+ channel currents from
dissociated chick DRG neurons and from tsA-201 cells transfected with N
channel clones (Lü and Dunlap, 1999 ). Currents were evoked by a
15 msec test pulse to 0 mV and were monitored during the intracellular
application of purified, bovine brain G added to the recording
pipette solution. In chick DRG neurons, a saturating concentration of
G (20 nM; Diversé-Pierluissi et al., 1995 ,
2000 ) produced a maximal 49.7 ± 4.2% (n = 6)
inhibition of N current after ~25 min of dialysis with
G -containing solution as compared with control recordings with
heat-inactivated G in the pipette (Fig.
1A). A three-pulse
voltage protocol consisting of two test pulses to 0 mV separated by a
15 msec conditioning depolarization to 80 mV was used to assay for the
relief of inhibition that is characteristic of VD inhibition by
G-proteins (Elmslie et al., 1990 ). G -mediated inhibition was
insensitive to the conditioning pulse (i.e., no prepulse-induced
facilitation), indicating a distinct absence of VD inhibition (Fig.
1A). In contrast, intracellular application of 5 µM GTP S (to directly activate endogenous
G-protein heterotrimers) inhibited N current even more strongly
(82.0 ± 5.1%; n = 5; Fig. 1B)
and produced the slowing of current activation that is characteristic
of VD inhibition (Marchetti et al., 1986 ; Bean, 1989 ; Grassi and Lux,
1989 ; Elmslie et al., 1990 ). Furthermore, in the presence of GTP S,
conditioning depolarizations evoked strong facilitation (Fig.
1Bc).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 1.
G produces VI inhibition in chick
DRG neurons. Whole-cell Ca2+ current evoked by a
three-pulse stimulus paradigm was monitored over time during
application of 20 nM G (A) or 5 µM GTP S (B) through the patch
pipette solution. Controls contained heat-inactivated G (20 nM). Panels marked a each show two
superimposed current traces taken at the start of whole-cell recording
or after (*) maximal effect of G or GTP S (Aa
and Ba, respectively). Panels marked b
show the mean ± SEM Ca2+ charge entry
(normalized to the maximum) as a function of time for control cells
(filled circles) or during application of G
(n = 6) or GTP S (n = 5)
(open circles); panels marked c plot the
time course of the facilitation ratio produced in the same cells by
conditioning depolarization (defined as charge entry during test pulse
II divided by charge entry during test pulse I).
|
|
These results suggest that VI inhibition is mediated by G
(confirming previous studies of Diversé-Pierluissi et al., 1995 , 2000 ) but they imply that VD inhibition may be mediated by some other
mechanism. Given, however, that VD inhibition of mammalian N channels
is well accepted to involve direct binding of G to Ca2+ channel 1
subunits (Herlitze et al., 1996 ; Ikeda, 1996 ; DeWaard et al., 1997 ; Qin
et al., 1997 ; Zamponi et al., 1997 ; Furukawa et al., 1998 ), we sought
an explanation for the apparent resistance to G of the VD pathway
in chick DRG cells. Alternatively, (1) the VI pathway could be
activated at lower concentrations of G , (2) the VD pathway could
reside in a compartment of the cell that is inaccessible to applied
G , and/or (3) other accessory proteins could be present in the
primary cells that promote VI or suppress VD inhibition. To explore
between these possibilities, experiments used recombinant
Ca2+ channels expressed heterologously.
G -mediated inhibition of recombinant chick N channels
Chick N-type Ca2+ channel cDNAs were
transiently expressed in tsA-201 cells, and G was applied via the
patch pipette as for the primary cells above. Recombinant rat
rn 1B-b (Lin et al., 1997 ) was studied for
comparison. Four different, full-length 1
subunit clones from chick (cdB1-4; Lü and Dunlap, 1999 ) were tested for their sensitivities to G . The chick channels differed from one another in their putative cytoplasmic linkers between membrane-spanning domains I and II and/or in an alternatively spliced
C-terminal domain (Fig.
2A) both regions
generally implicated in G -binding to mammalian
Ca2+ channel 1
subunits (Zhang et al., 1996 ; DeWaard et al., 1997 ; Qin et al., 1997 ;
Zamponi et al., 1997 ). When applied for 20-30 min through the patch
pipette, 20 nM G evoked only a small
inhibition of the recombinant channel currents (23.2 ± 1.7%,
n = 25 for chick; 24.8 ± 4.2%, n = 5 for rat); a conditioning depolarization relieved a small fraction
of this inhibition (8.4%). No differences among any of the four cdB
clones or the rat clone were observed (Fig. 2B).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 2.
G -mediated inhibition is similar for all N
channel clones tested. A contains diagrams summarizing
key structural differences between a1B
Ca2+ channel variants cloned from chick DRG (cdB;
Lü and Dunlap, 1999 ) or rat (Dubel et al., 1992 ; Lin et al.,
1997 ). The gray rectangles marked with roman
numerals represent the four homologous membrane-spanning
repeats; the white rectangles represent the
putative intracellular domains. A is a 75 bp insert
contained in some but not all chick clones; B is a 33 bp
insert contained in all mammalian but not in some chick variants;
C is a 5 bp insert found in some but not all chick
variants (creating a premature stop codon and a channel subunit that is
truncated by 175 amino acids in the C-terminal end). B
is a histogram plotting the percentage inhibition of
Ca2+ current produced by 20 nM G
in tsA-201 cells transfected with the N channel 1
subunit clone designated on abscissa, coexpressed with rat
1b and 2 subunits. A three-pulse
voltage protocol was used to identify the VD component of inhibition.
White bars represent total inhibition in the absence of
a prepulse ( PP); black bars denote
inhibition after prepulse to +80 mV (+PP). Number of
cells noted in parentheses.
|
|
Given that G -mediated VD inhibition has been generally studied
under conditions of G-protein overexpression (Ikeda and Dunlap, 1999 ),
we sought to determine whether VD inhibition was promoted when cells
were cotransfected with G and G cDNAs (because the biochemical
preparation of purified G did not allow application of
concentrations >20 nM). When G was overexpressed in
tsA-201 cells, a robust, tonic VD inhibition was observed (Fig.
3). Ca2+
current amplitude was, on average, 62.2% of control cells transfected with channel subunits alone, and currents activated slowly, as expected
for VD inhibition. Conditioning depolarizations produced an average
142% facilitation of Ca2+ current,
because of a relief of the tonic inhibition (Fig. 3A), indicating that chick 1B
Ca2+ channel subunits are inhibited by
G in a manner similar to that of their mammalian counterparts. In
addition, all four cdB clones behaved similarly to one another as well
as to the rat clone, rn 1B-b, when
cotransfected with G (Fig. 3B), further suggesting
that the dominance of the VI pathway in native neurons is not because
of the expression of a uniquely G -resistant
1B channel subunit.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 3.
Overexpression of G enhances VD inhibition
of N current. TsA-201 cells were cotransfected with 1
subunit clones designated on abscissa of B and either
G 1 2 or G i2 (as marked).
A, Ca2+ current evoked in cell
expressing cdB1 by voltage pulse protocol used to estimate VD
inhibition (top panel). B,
Prepulse-induced facilitation (average ± SEM) for each of the
Ca2+ channel clones studied. Numbers of cells in
parentheses.
|
|
Overexpression of G produces VD inhibition of native
N current
To explore whether native N currents in chick DRG neurons, unlike
their mammalian counterparts, are refractory to G , we overexpressed G 1 2 in
the cells by nuclear injection of the cDNAs. In 8 of 13 injected cells
tested, Ca2+ currents activated slowly,
peaked at a level 24.9% of currents measured from uninjected control
cells, and facilitated in response to a conditioning depolarization
(Fig. 4A). Such tonic
inhibition and prepulse-induced facilitation is not observed in
uninjected control cells. The remaining five injected cells were
indistinguishable from control. The apparent lack of
G 1 2-induced
inhibition in these latter cells (Fig. 4B) is likely
to result from an absence of
G 1 2 expression (from
ineffective injection), because basal Ca2+
currents were found to be no different between these cells and uninjected control cells (Fig. 4C); were
G 1 2 actually
overexpressed, robust VI inhibition would be expected, even in the
absence of VD inhibition. These results demonstrate that G can
evoke significant VD inhibition of chick DRG N channels (as with
mammalian N channels), but apparently only when sufficiently high
concentrations (and/or correct targeting of G ) is achieved.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4.
Overexpression of G enhances VD inhibition
in chick DRG neurons. G 1 and G 2 cDNAs
were injected into chick DRG cell nuclei, and Ca2+
currents were studied 18-24 hr later. A,
B, Two superimposed Ca2+ currents
evoked by test pulses to 0 mV with (*) or without a preceding
conditioning pulse to +80 mV. Traces in A
taken from an injected cell with tonic VD inhibition;
traces in B from an injected cell
(identified by fluorescence) without tonic inhibition.
C, Histogram of average total Ca2+
charge entry (±SEM) for the sample showing tonic inhibition (group A),
the sample of injected cells without tonic inhibition (group B), and
control (noninjected) cells. Effect of conditioning depolarization
(+PP) shown in black bars; number of
cells shown in parentheses.
|
|
The notion that concentration plays an important role in the selective
activation of VI and VD pathways is supported by previous results from
our laboratory. Lower concentrations of NE ( 10 µM) preferentially activate the VI pathway, with 10 µM
producing a total inhibition of 25 ± 7%, most of which is
resistant to depolarizing prepulses. Higher concentrations of NE (100 µM) recruit a VD component to the inhibition, producing a
total inhibition of 30%, a third of which is reversed by conditioning
depolarizations (Diversé-Pierluissi et al., 1995 ). It makes
further sense that VI inhibition would be preferentially activated by
lower concentrations of G , because G binds
PLC at higher affinity (Myung et al., 1999 )
than that to which it binds the Ca2+
channel (DeWaard et al., 1997 ).
Syntaxin 1A potentiates VD inhibition by G
The strength of the G-protein-Ca2+
channel interaction is known to be modulated by accessory proteins,
such as syntaxin 1A (Stanley and Mirotznik, 1997 ; Jarvis et al., 2000 )
and Ca2+ channel subunits (Roche et
al., 1995 ; Roche and Triestman, 1998 ; Meir et al., 2000 ). We focused
our studies on syntaxin 1A to explore whether the predominance of VI
inhibition in chick DRG neurons could be influenced by the expression
level of this protein, known to directly interact with
Ca2+ channel 1
subunits (Sheng et al., 1998 ; Catterall, 1999 ). In particular, we
tested whether overexpression of syntaxin 1A in chick DRG cells would
support VD inhibition by 20 nM applied G . The cDNA
for rat syntaxin 1A was injected into DRG cell nuclei, and
Ca2+ currents were recorded 16-24 hr
later. Among a total of 39 injected cells (identified by the presence
of coinjected fluorescent dextran), 18 showed tonic VD inhibition (Fig.
5A) in the absence of G application (facilitation ratio of 1.14 vs 1.02 for control and the
other 21 injected cells). Total charge entry for these 18 cells
(12.07 ± 1.22 pC) was 70% of that measured from cells showing no
tonic inhibition. This result suggests that syntaxin 1A expression increases the sensitivity of N channels to modulation by endogenous free G . Moreover, whole-cell recordings from 11 of these 18 cells
lasted long enough to detect further inhibition by 20 nM G applied through the recording pipette.
Six of the eleven responded with significantly more VD inhibition
during exposure to G (additional inhibition, 46%; final
facilitation ratio, 1.38 Fig. 5B). Given that uninjected
control cells do not respond to 20 nM G
with VD inhibition (Fig. 1), voltage-dependent responses observed in these six injected neurons argue strongly that syntaxin 1A shifts the
equilibrium in favor of VD inhibition. In the remaining five cells,
G produced a mean 50 ± 6.3% inhibition over 12-27 min of
dialysis; the additional inhibition was purely VI, however, showing no
prepulse-induced facilitation over that associated with tonic
inhibition (Fig. 5B). These results confirm recent reports
of syntaxin 1A-induced enhancement of G -mediated inhibition of
recombinant rat N channels expressed in tsA-201 cells (Jarvis et al.,
2000 ; Jarvis and Zamponi, 2001 ) and provide additional data supporting
the similarity between avian and mammalian N channels.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5.
Syntaxin 1A expression in chick DRG neurons
enhances VD inhibition by G . Rat syntaxin 1A cDNA was injected
into nuclei of chick DRG neurons, and Ca2+ currents
were studied 16-24 hr later. Three-pulse voltage protocol was used to
measure prepulse-induced facilitation. A, Histogram of
facilitation induced by prepulse in three groups of cells: group A
(injected and demonstrating facilitation), group B (injected but
without facilitation), and control (uninjected). B,
Histogram showing responsiveness of Ca2+ currents in
group A injected cells to intracellular application of 20 nM G through the patch pipette. White
bars represent mean prepulse-induced facilitation seen
immediately after achieving whole-cell access; black
bars represent mean facilitation after ~20 min of dialysis
with 20 nM G . The two data sets are from cells
in which additional VD inhibition was observed (left) or
not (right). Number of cells shown in parentheses.
Inset, Two superimposed current traces before and after
application of G (taken from one of the cells in the left-hand
group). Dotted line marks level of peak current during
first test pulse. Calibration: 1 nA, 20 msec.
|
|
Chick DRG neurons do not express syntaxin 1A but do express
syntaxin 1B
An absence of syntaxin 1A expression in chick DRG neurons could
explain why purified G does not produce VD inhibition of N
currents in these cells. RT-PCR was used to explore this issue, using
primers (Table 1) designed against three domains that are tightly
conserved among distantly related species (Drosophila, rat,
and human). Primer pair designated 301/302 consisted of a sense primer
specific to syntaxin 1A and an antisense primer across a domain
conserved between syntaxins 1A and 1B. A second pair (303/302)
consisted of sense and antisense sequences common to syntaxins 1A and
1B. Both primer pairs amplified the expected products from rat and
Drosophila nervous tissue, but only the primer pair with
homology to both syntaxins 1A and 1B amplified a product from chick
brain or DRG (Fig. 6), suggesting that
syntaxin 1A is not expressed in chick. Sequence analysis of the 303/302 product from chicken revealed homology to syntaxin 1B, which is a
separate gene and not a splice variant of syntaxin 1A (Bennett et al.,
1993 ). To confirm that syntaxin 1B was present, separate RT-PCR
reactions were performed using specific primers to syntaxin 1B (pair
304/305). This pair amplified the expected product, confirmed as a
syntaxin 1B homolog by sequence analysis.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 6.
Chick neurons do not express syntaxin 1A. RT-PCR
was used to assay for the expression of syntaxin 1A or syntaxin 1B in
chick and rat nervous tissue (noted at the bottom of the
gel). Specificity of primer pairs used and the presence (+) or absence
( ) of RT is noted at the top and the
bottom of the gel, respectively. Expected product sizes
for syntaxin 1A and syntaxin 1B noted by arrows on the
right. The plasmid carrying rat syntaxin 1A that was
used for injection was used here as a positive control (rat
stx-1A).
|
|
Because rat syntaxin 1A levels in cerebellum (Veeranna and Pant, 1997 )
and retina (Dhingra et al., 1997 ) have been shown to be tightly
regulated during development, we looked for variation in syntaxin 1A
expression during neuronal embryogenesis in chick using RT-PCR. No
syntaxin 1A was found in DRG cells at any embryonic stage (days 12, 15, 18, and 21) or in adult chicken brain (data not shown). No products
were amplified from syntaxin 1A-specific primers, but primers 303/302
with homology to both syntaxins 1A and 1B amplified a product.
To confirm that this product was amplified from syntaxin 1B RNA, PCR
was used with a new primer pair (304/305) based on regions homologous
among syntaxin 1B clones (mouse, human, rat), but differing from
syntaxin 1A. This primer pair amplified the expected length product,
which was confirmed as a syntaxin 1B homolog by sequence analysis.
Thus, chick DRG cells express syntaxin 1B but not syntaxin 1A. To
evaluate whether this could explain the lack of VD inhibition by
applied G , we compared effects of syntaxin 1B with those of
syntaxin 1A on inhibition of N channels by G in tsA-201 cells.
Syntaxin 1B does not support VD inhibition of recombinant
N channels
A full-length syntaxin 1B cDNA was cloned from rat mRNA using
RT-PCR (see Materials and Methods), subcloned into pMT2sx, and expressed in tsA-201 cells along with N channel
1 subunits from rat (rbBII) or chick (cdB1)
and with rat 1b, and
2- . Comparisons were made between cells
transfected with syntaxin 1A or syntaxin 1B cDNAs. Overexpression of
syntaxin 1A promoted tonic, VD inhibition in these cells expressing the
rat and chick N channels, exhibiting facilitation ratios of 1.75 ± 0.08 (rbBII; n = 8) and 1.56 ± 0.11 (cdB1;
n = 20). In such experiments, the VD pathway is
saturated by basal concentrations of G ; additional G
(through overexpression) produces no additional effect on
Ca2+ current (Jarvis et al., 2000 ). In
contrast, N currents in cells transfected with syntaxin 1B showed
little or no tonic inhibition, with facilitation ratios near 1 (Fig.
7A). Western blot analysis of
the syntaxin 1B-transfected cells using an antibody that recognizes both forms of syntaxin demonstrated the expression of syntaxin 1B
protein (Fig. 7B).
Furthermore, when cells were
cotransfected with syntaxin 1B and syntaxin 1A (at 1:1), the
facilitation ratio was reduced from 1.75 ± 0.08 to 1.2 ± 0.05 (rbBII; n = 8), confirming that syntaxin 1B was
expressed in the transfected cells and suggesting that it binds the
synprint motif in the II-III linker of the N channel
1 subunit. This dominant-negative effect of
syntaxin 1B is likely to be specific, because overexpression of other
proteins (e.g., the II-III linker from 1C
Ca2+ channels) does not alter the ability
of syntaxin 1A to promote VD inhibition by G (Magga et al.,
2000 ). Thus, overexpression of a second protein does not, per se,
reduce syntaxin 1A expression. These results suggest that, despite
their significant sequence identities, the two syntaxins differ from
one another in their abilities to support VD inhibition. Low levels of
syntaxin 1A expression are likely to be one reason why low
concentrations of G (either applied or produced by submaximal
activation of G-protein-coupled receptors), do not naturally promote VD
inhibition in chick DRG cells.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 7.
Syntaxin 1A but not syntaxin 1B potentiates VD
inhibition by G . TsA-201 cells were transfected with chick cdB1
(white bars) or rat rbBII (gray
bars) Ca2+ channel 1B subunit
clones and calcium currents isolated using whole-cell recording.
A, Histogram of tonic VD inhibition plotted as mean
facilitation ratio ± SEM (measured with three-pulse voltage
protocol) in control cells or in cells transfected with syntaxin 1A
(stx-1A) or syntaxin 1B (stx-1B), as
marked on abscissa. Numbers of cells noted in parentheses.
B, Western blot of control cells or cells transfected
with syntaxin 1B cDNA, probed with anti-syntaxin antibody [methods per
Jarvis et al. (2000) ].
|
|
 |
DISCUSSION |
Results presented here provide an explanation for the observation
that both the form and extent of G -mediated inhibition of N
channels vary among preparations and/or with different experimental approaches. By comparing the inhibition of recombinant and native N
channels produced by purified or overexpressed G , we have shown
that VI inhibition is preferentially evoked in chick DRG neurons with
direct applications of low G concentrations, whereas VD
inhibition is evoked strongly only when G is either overexpressed or when syntaxin 1A (but not syntaxin 1B) is present. Our results further demonstrate that four 1B channel
splice variants cloned from chick DRG cells are all modulated similarly
to one another as well as to rat 1B channels.
Thus, these data argue that cell-to-cell variations in the ratio of VI
to VD inhibition of N channels are more likely to result from
variations in concentration and targeting of the signaling molecules
than from differences in primary structure of the
1B subunits present.
That being said, however, it should be noted that saturating
concentrations of NE and/or overexpression of G in chick DRG neurons produce less VD inhibition (as assayed by prepulse-induced facilitation) than that typically reported, for example, in superior cervical ganglion cell somata (Hille, 1994 ; Ikeda and Dunlap, 1999 ;
Delmas et al., 1999 ). That is, G -mediated inhibition of N
channels in chick DRG neurons appears to be less sensitive to voltage,
even under conditions optimized to produce VD inhibition. Side-by-side
comparisons of G -mediated inhibition of recombinant chick
1B subunit variants with the
rn 1Bb variant showed no quantitative differences in tsA-201 cells, however, so the differences in voltage dependence of G action on native chick and rat neurons may be the
result of differences in other accessory proteins expressed by the
cells. Results of others demonstrate that the extent of Ca2+ current inhibition by G-proteins can
be regulated by the type of Ca2+ channel
subunit associated with the channel (Roche et al., 1995 ; Roche and
Triestman, 1998 ; Meir et al., 2000 ), and we demonstrate here that
syntaxin 1A can enhance the ability of G to produce VD inhibition
as well. In addition, Delmas et al. (2000) have identified N channels
in somata and dendrites of sympathetic neurons that are differentially
sensitive to G , suggesting that, in vivo, the N
channel family might exhibit a range of responsiveness to G .
Given the observation by Jarvis et al. (2000) , that syntaxin 1A binds
both N channel 1 subunits and G , a
reasonable interpretation of the results reported here is that syntaxin
1A promotes G -mediated VD inhibition by increasing the local
G concentration near its binding site or sites on
1B subunits. When syntaxin 1A concentration is
low, therefore, VI inhibition predominates, as we see in chick DRG
neurons. By contrast, in neurons expressing syntaxin 1A, VD inhibition
would be expected to dominate. The targeting, by syntaxin 1A, of
G to its binding sites on Ca2+
channels may be the reason why some cells (e.g., rat sympathetic neurons) (1) exhibit prominent basal (or tonic) inhibition and (2) show
preferential VD inhibition when stimulated by even very low
concentrations of transmitter (Delmas et al., 1999 ). Thus, the
differential expression of such regulatory molecules may promote unique
functional states for neurons.
The issue of targeting is an important one and could complicate the
interpretation of our results. Molecules applied to the bulk cytoplasm
may not have full access to signaling complexes, particularly if such
complexes are sequestered in membrane compartments. Because of this,
our results do not eliminate the possibility that spatial
inaccessibility accounts, in part, for the inability of G
to promote VD inhibition. Incomplete access may also provide an
explanation for our observation that activation of G-proteins via
intracellular application of GTP S evokes stronger VD inhibition of N
channels than does direct application of G . That is, should N
channels exist in a complex with G-protein heterotrimers, G released during activation of the heterotrimer may have more ready access to the channel than would G applied to the cytoplasm. Because G evokes VD inhibition in chick DRG neurons when syntaxin 1A is expressed, however, a putative spatially restricted signaling compartment must be amenable to alteration by syntaxin 1A.
Our results raise the possibility that variations in syntaxin
expression might underlie differences in N channel modulation among
cells or as a result of changes in physiological stimuli. Although our
RT-PCR results demonstrate that syntaxin 1A expression is absent from
chick DRGs at all stages of development and absent from adult chicken
brain, rat syntaxin 1A levels in both cerebellum (Veeranna and Pant,
1997 ) and retina (Dhingra et al., 1997 ) have been shown to be low
at birth and increase substantially during development. Furthermore,
after long-term potentiation-inducing stimulation in the
hippocampus, syntaxin 1B expression is upregulated, and the ratio of
splice variants syntaxin 3A-to-3B is reversed (Helme-Guizon et al.,
1998 ; Rodger et al., 1998 ). Additionally, a recent study has
demonstrated that syntaxin 1A gene expression is controlled by
Ca2+ influx through
1A (or P-type)
Ca2+ channels (Sutton et al., 1999 ). Thus,
differential expression of P-type Ca2+
channels is likely to lead to differences in syntaxin 1A content in
tissues. It is interesting in this regard that embryonic chick DRG
neurons do not express P-type channels at the ages studied (Cox and
Dunlap, 1992 ) (AtKisson, unpublished observations), suggesting an
explanation for their low syntaxin 1A levels.
Results reported here are the first to suggest that syntaxins 1A and 1B
are functionally distinct. These two proteins, products of separate
genes (Bennett et al., 1993 ), are 82% identical over the 288 amino
acid residues constituting the full-length proteins, with only 10 residues (scattered throughout the proteins) representing nonconservative differences. It is, thus, not surprising that both
serve as substrates for botulinum toxin C1, and competitive interactions (such as those reported here) would be expected. That
syntaxin 1B cannot substitute for syntaxin 1A to enhance G -mediated VD inhibition offers a powerful tool for identifying residues critical for the enhancement of G action by syntaxin 1A.
Given that syntaxin 1A is an integral component of the secretory
apparatus and is thought to interact directly with exocytotic Ca2+ channels at sites of transmitter
release (Sheng et al., 1998 ; Catterall, 1999 ), VD inhibition of
Ca2+ channels would be predicted to
dominate in nerve terminals. This is supported by direct recordings
from presynaptic calyces innervating chick ciliary ganglion neurons,
where intracellular application of GTP S evokes VD inhibition of
Ca2+ currents an effect abrogated by
proteolysis of syntaxin with botulinum toxin C1 (Stanley and Mirotznik,
1997 ). This latter result is at odds, however, with the findings
presented here in that (1) chick nervous tissue expresses syntaxin 1B,
but not syntaxin 1A, and the former cannot support VD inhibition of
somatic N currents by G , and (2) even in the absence of syntaxin
1A, GTP S evokes VD inhibition in chick neurons lacking syntaxin 1A.
Although we do not have an explanation for this discrepancy, it is
possible that nerve terminal N channels differ from their somatic
counterparts in their regulation by G (Delmas et al., 2000 ). Our
RT-PCR results demonstrate that, in addition to syntaxin 1B, for
example, chick nervous tissue expresses syntaxin 3 (data not shown).
Because this latter isoform is also a substrate for botulinum toxin C1 (Schiavo et al., 1995 ), it might play a role similar to that of syntaxin 1A to potentiate VD inhibition in ciliary ganglion calyx terminals. Alternatively, chick ciliary neurons might express an N
channel variant different from those we have tested in our studies. It
is interesting in this regard that biophysical studies of the calyx N
channel demonstrate currents that inactivate more slowly than their
somatic counterparts (Stanley and Goping, 1991 ; Stanley and Mirotznik,
1997 ). In addition, the ability of syntaxin 1A to enhance
voltage-dependent inactivation of some N channel types (Bezprozvanny et
al., 1995 ; Degtiar et al., 2000 ; Jarvis and Zamponi, 2001 ) is not
observed for the calyx N channels (Stanley and Mirotznik, 1997 ),
arguing for their uniqueness. That different N channel types might be
differentially regulated by G is an idea that has received
support recently. Delmas et al. (2000) identified an N-type
Ca2+ channel (uniquely targeted to the
dendrites of sympathetic neurons) that is more susceptible to
G -mediated VD inhibition than are somatic N channels in the same cells.
In addition to potentiating receptor-mediated inhibition of
Ca2+ current, syntaxin 1A clearly also
plays a role in tonic modulation of Ca2+
channels under basal conditions, as demonstrated by Jarvis et al.
(2000) and confirmed here. Many Ca2+
channels are tonically modulated under basal conditions (Ikeda, 1991 ;
Kasai, 1991 ). The VD component of such tonic inhibition can be reversed
by a conditioning prepulse (Elmslie et al., 1990 ; Ikeda, 1991 ) or
(under more natural physiological conditions) during action potential
trains (Brody et al., 1997 ; Patil et al., 1998 ; Park and Dunlap, 1998 ;
Brody and Yue, 2000 ). In addition, tonic inhibition can be reversed by
activation of protein kinase C (PKC) through a mechanism thought to
involve PKC-dependent phosphorylation of the
Ca2+ channel 1
subunit, thereby preventing the binding of G (Swartz, 1993 ; Yang
and Tsien, 1993 ; Hamid et al., 1999 ; Cooper et al., 2001 ). Thus,
syntaxin 1A and PKC are antagonistic regulators of VD inhibition in
mammalian neurons. By contrast, in cells that lack syntaxin 1A (such as
the embryonic chick DRG neurons studied here), PKC may be freed to play
a different modulatory role. These neurons do not show tonic inhibition
under normal circumstances, and it has long been recognized that
activators of PKC produce strong VI inhibition of chick N current (Rane
et al., 1989 ; Diversé-Pierluissi et al., 1995 ). Syntaxin 1A
expression levels might, thus, set the ratio of VD-to-VI inhibition
differentially among cell types. In addition, given that
Ca2+ influx plays a number of
physiological and/or biochemical roles in neurons, targeting of
syntaxin 1A to particular cellular domains might allow differential or
region-specific regulation of Ca2+ influx.
 |
FOOTNOTES |
Received Oct. 5, 2000; revised Feb. 22, 2001; accepted Feb. 23, 2001.
This work was supported by United States Public Health Service Grant
NS16483 (K.D.), a Medical Foundation Fellowship (Q.L.), the Canadian
Institutes of Health Research (G.W.Z.), the EJLB Foundation
(G.W.Z.), the Alberta Heritage Foundation for Medical Research (G.Z.,
S.E.J.), and the Natural Science and Engineering Research Council
(Z.P.F.). We gratefully acknowledge John Hildebrandt and coworkers
(Department of Pharmacology, University of South Carolina) for their
kind gifts of purified bovine brain G . We also thank Michael Goy
for his critical comments on this manuscript.
Correspondence should be addressed to Kathleen Dunlap, Department of
Neuroscience, Tufts University School of Medicine, 136 Harrison Avenue,
Boston, MA 02111. E-mail: kathleen.dunlap{at}tufts.edu.
Dr. Lü's present address: Department of Neuroscience,
Wyeth-Ayerst Research, CN8000, Princeton, NJ 08543.
 |
REFERENCES |
-
Arnot MI,
Stotz SC,
Jarvis SE,
Zamponi GW
(2000)
Differential modulation of N-type
1B and P/Q-type 1A calcium channels by different G protein subunit isoforms.
J Physiol (Lond)
527:203-212[Abstract/Free Full Text]. -
Bean BP
(1989)
Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence.
Nature
340:153-156[Medline].
-
Bennett MK,
García-Arrarás JE,
Elferink LA,
Peterson K,
Fleming AM,
Hazuka CD,
Scheller RH
(1993)
The syntaxin family of vesicular transport receptors.
Cell
74:863-873[Web of Science][Medline].
-
Bezprozvanny I, Scheller RH, Tsien RW (1995) Functional
impact of syntaxin on gating of N-type and Q-type calcium channels.
378:623-626.
-
Brody DL,
Yue DT
(2000)
Relief of G-protein inhibition of calcium channels and short-term synaptic facilitation in cultured hippocampal neurons.
J Neurosci
20:889-898[Abstract/Free Full Text].
-
Brody DL,
Patil PG,
Mulle JG,
Snutch TP,
Yue DT
(1997)
Bursts of action potential waveforms relieve G-protein inhibition of recombinant P/Q-type Ca2+ channels in HEK 293 cells.
J Physiol (Lond)
499:637-644[Abstract/Free Full Text].
-
Catterall WA
(1999)
Interactions of presynaptic Ca2+ channels and snare proteins in neurotransmitter release.
Ann NY Acad Sci
868:144-159[Web of Science][Medline].
-
Cooper CB,
Arnot MI,
Feng ZP,
Jarvis SE,
Hamid J,
Zamponi GW
(2000)
Crosstalk between G protein and PKC modulation of N-type calcium channels is dependent on the G protein subunit isoform.
J Biol Chem
275:40777-40781[Abstract/Free Full Text].
-
Cox DH,
Dunlap K
(1992)
Pharmacological discrimination of N-type from L-type calcium current and its selective modulation by transmitters.
J Neurosci
12:906-914[Abstract].
-
Degtiar VE,
Scheller RH,
Tsien RW
(2000)
Syntaxin modulation of slow inactivation of N-type calcium channels.
J Neurosci
20:4355-4367[Abstract/Free Full Text].
-
Delmas P,
Abogadie FC,
Milligan G,
Buckley NJ,
Brown DA
(1999)
 dimers derived from Go and Gi proteins contribute different components of adrenergic inhibition of Ca2+ channels in rat sympathetic neurones.
J Physiol (Lond)
518:23-36[Abstract/Free Full Text]. -
Delmas P,
Abogadie FC,
Buckley NJ,
Brown DA
(2000)
Calcium channel gating and modulation by transmitters depend on cellular compartmentalization.
Nat Neurosci
3:670-678[Web of Science][Medline].
-
DeWaard M,
Liu H,
Walker D,
Scott VES,
Gurnett CA,
Campbell KP
(1997)
Direct binding of G-protein
 complex to voltage-dependent calcium channels.
Nature
385:446-450[Medline]. -
Dhallan RS,
Yau KW,
Schrader KA,
Reed RR
(1990)
Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons.
Nature
347:184-187[Medline].
-
Dhingra NK,
Ramamohan Y,
Raju TR
(1997)
Developmental expression of synaptophysin, synapsin I, and syntaxin in the rat retina.
Dev Brain Res
102:267-273[Medline].
-
Diversé-Pierluissi M,
Dunlap K
(1993)
Distinct, convergent second messenger pathways modulate neuronal calcium currents.
Neuron
10:753-760[Web of Science][Medline].
-
Diversé-Pierluissi M,
Goldsmith PK,
Dunlap K
(1995)
Transmitter-mediated inhibition of N-type calcium channels in sensory neurons involves multiple GTP-binding proteins and subunits.
Neuron
14:191-200[Web of Science][Medline].
-
Diversé-Pierluissi M,
McIntire WE,
Myung CS,
Linforfer MA,
Garrison JC,
Goy MG,
Dunlap K
(2000)
Selective coupling of specific G protein
 complexes to inhibition of Ca2+ channels.
J Biol Chem
275:28380-28385[Abstract/Free Full Text]. -
Dolphin AC
(1998)
Mechanisms of modulation of voltage-dependent calcium channels by G proteins.
J Physiol (Lond)
50:3-11.
-
Dubel SJ,
Starr TVB,
Hell J,
Ahlijanian MK,
Enyeart JJ,
Catterall WA,
Snutch TP
(1992)
Molecular cloning of the
-1 subunit of an w-conotoxin-sensitive calcium channel.
Proc Natl Acad Sci USA
89:5058-5062[Abstract/Free Full Text]. -
Dunlap K,
Ikeda SR
(1998)
Receptor-mediated pathways that modulate calcium channels.
Semin Neurosci
9:198-208.
-
Elmslie KS,
Zhou W,
Jones SW
(1990)
LHRH and GTP-
-S modify calcium current activation in bullfrog sympathetic neurons.
Neuron
5:75-80[Web of Science][Medline]. -
Furukawa T,
Miura R,
Mori Y,
Strobeck M,
Suzuki K,
Ogihara Y,
Asano T,
Morishita R,
Hashii M,
Higashida H,
Yoshii M,
Nukada T
(1998)
Differential interactions of the C terminus and the cytoplasmic I-II loop of neuronal Ca2+ channels with G-protein
and  subunits. II. Evidence for direct binding.
J Biol Chem
273:17595-603[Abstract/Free Full Text]. -
Grassi F,
Lux HD
(1989)
Voltage-dependent GABA-induced modulation of calcium currents in chick sensory neurons.
Neurosci Lett
105:113-119[Web of Science][Medline].
-
Hamid J,
Nelson D,
Spaetgens R,
Dubel SJ,
Snutch TP,
Zamponi GW
(1999)
Identification of an integration center for cross-talk between protein kinase C and G protein modulation of N-type calcium channels.
J Biol Chem
274:6195-6202[Abstract/Free Full Text].
-
Helme-Guizon A,
Davis S,
Israel M,
Lesbats B,
Mallet J,
Laroche S,
Hicks A
(1998)
Increase in syntaxin 1B and glutamate release in mossy fibre terminals after induction of LTP in the dentate gyrus: a candidate molecular mechanism underlying transsynaptic plasticity.
Eur J Neurosci
10:2231-2237[Web of Science][Medline].
-
Herlitze S,
Garcia DE,
Mackie K,
Hille B,
Scheuer T,
Catterall WA
(1996)
Modulation of Ca2+ channels by G-protein
 subunits.
Nature
380:258-262[Medline]. -
Hille B
(1994)
Modulation of ion-channel function by G-protein-coupled receptors.
Trends Neurosci
17:531-536[Web of Science][Medline].
-
Ikeda SR
(1991)
Double-pulse calcium channel current facilitation in adult rat sympathetic neurones.
J Physiol (Lond)
439:181-214[Abstract/Free Full Text].
-
Ikeda SR
(1996)
Voltage-dependent modulation of N-type calcium channels by G-protein
 subunits.
Nature
380:255-258[Medline]. -
Ikeda SR,
Dunlap K
(1999)
Voltage-dependent modulation of N-type calcium channels: role of G protein subunits.
Adv Second Messenger Phosphoprotein Res
33:131-151[Web of Science][Medline].
-
Jarvis SE,
Zamponi GW
(2001)
Distinct molecular determinants govern syntaxin 1A-mediated inactivation and G-protein inhibition of N-type calcium channels.
J Neurosci
21:2939-2948[Abstract/Free Full Text].
-
Jarvis SE,
Magga JM,
Beedle AM,
Braun JEA,
Zamponi GW
(2000)
G protein modulation of N-type calcium channels is facilitated by physical interactions between syntaxin 1A and G
 .
J Biol Chem
275:6388-6394[Abstract/Free Full Text]. -
Kasai H
(1991)
Tonic inhibition and rebound facilitation of a neuronal calcium channel by a GTP-binding protein.
Proc Natl Acad Sci USA
88:8855-8859[Abstract/Free Full Text].
-
Lin Z,
Haus S,
Edgerton J,
Lipscombe D
(1997)
Identification of functionally distinct isoforms of the N-type Ca2+ channel in rat sympathetic ganglia and brain.
Neuron
18:153-166[Web of Science][Medline].
-
Lü Q,
Dunlap K
(1999)
Cloning and functional expression of novel N-type Ca2+ channel variants.
J Biol Chem
274:34566-75[Abstract/Free Full Text].
-
Luebke JI,
Dunlap K
(1994)
Sensory neuron N-type calcium currents are inhibited by both voltage-dependent and -independent mechanisms.
Pflügers Arch
428:499-507[Web of Science][Medline].
-
Marchetti C,
Carbone E,
Lux HD
(1986)
Effects of dopamine and noradrenaline on Ca channels of cultured sensory and sympathetic neurons of chick.
Pflügers Arch
406:104-111[Web of Science][Medline].
-
Magga J,
Jarvis SE,
Arnot MI,
Zamponi GW,
Braun JEA
(2000)
Cysteine string protein regulates G protein modulation of N-type calcium channels.
Neuron
28:195-204[Web of Science][Medline].
-
Meir A,
Bell DC,
Stephens GJ,
Page KM,
Dolphin AC
(2000)
Calcium channel
subunit promotes voltage-dependent modulation of 1B by G .
Biophys J
79:731-746[Web of Science][Medline]. -
Myung CS,
Paterson A,
Harden TK,
Garrison JC
(1999)
Development of an assay for phospholipase C using column-reconstituted, extruded phospholipid vesicles.
Anal Biochem
270:303-313[Web of Science][Medline].
-
Park D,
Dunlap K
(1998)
Dynamic regulation of calcium influx by G-proteins, action potential waveform, and neuronal firing frequency.
J Neurosci
18:6757-6766[Abstract/Free Full Text].
-
Patil PG,
Brody DL,
Yue DT
(1998)
Preferential closed-state inactivation of neuronal calcium channels.
Neuron
20:1027-1038[Web of Science][Medline].
-
Qin N,
Platano D,
Olcese R,
Stefani E,
Birnbaumer L
(1997)
Direct interaction of G
 with a C-terminal G -binding domain of the Ca2+ channel 1 subunit is responsible for channel inhibition by G protein-coupled receptors.
Proc Natl Acad Sci USA
94:8866-8871[Abstract/Free Full Text]. -
Rane SR,
Walsh MP,
McDonald JR,
Dunlap K
(1989)
Specific inhibitors of protein kinase C block transmitter-induced modulation of sensory neuron calcium current.
Neuron
3:239-245[Web of Science][Medline].
-
Roche JP,
Triestman SN
(1998)
The Ca2+ channel
3 subunit differentially modulates G-protein sensitivity of 1A and 1B Ca2+ channels.
J Neurosci
18:876-886. -
Roche JP,
Anantharam V,
Triestman SN
(1995)
Abolition of G protein inhibition of
1A and 1B calcium channels by co-expression of the 3 subunit.
FEBS Lett
371:43-46[Web of Science][Medline]. -
Rodger J,
Davis S,
Laroche S,
Mallet J,
Hicks A
(1998)
Induction of long-term potentiation in vivo regulates alternative splicing to alter syntaxin 3 isoform expression in rat dentate gyrus.
J Neurochem
71:666-675[Web of Science][Medline].
-
Schiavo G,
Shone CC,
Bennett MK,
Scheller RH,
Montecucco C
(1995)
Botulinum neurotoxin type C cleaves a single Lys-Ala bond within the carboxyl-terminal region of syntaxins.
J Biol Chem
270:10566-70[Abstract/Free Full Text].
-
Sheng ZH,
Westenbroek RE,
Catterall WA
(1998)
Physical link and functional coupling of presynaptic calcium channels and the synaptic vesicle docking/fusion machinery.
J Bioenerg Biomembr
30:335-345[Web of Science][Medline].
-
Stanley EF,
Goping G
(1991)
Characterization of a calcium current in a vertebrate cholinergic presynaptic nerve terminal.
J Neurosci
11:985-993[Abstract].
-
Stanley EF,
Mirotznik RR
(1997)
Cleavage of syntaxin prevents G-protein regulation of presynaptic calcium channels.
Nature
385:340-343[Medline].
-
Sutton KG,
McRory JE,
Guthrie H,
Murphy TH,
Snutch TP
(1999)
P/Q-type Ca2+ channels mediate the activity dependent feedback of syntaxin-1A.
Nature
401:800-804[Medline].
-
Swartz KJ
(1993)
Modulation of Ca2+ channels by protein kinase C in rat central and peripheral neurons: disruption of G protein-mediated inhibition.
Neuron
11:305-320[Web of Science][Medline].
-
Veeranna GP,
Pant HC
(1997)
Expression of p67 (Munc-18), Cdk5, P-NFH and syntaxin during development of the rat cerebellum.
Dev Neurosci
19:172-183[Web of Science][Medline].
-
Yang J,
Tsien RW
(1993)
Enhancement of N- and L-type calcium channel currents by protein kinase C in frog sympathetic neurons.
J Neurophysiol
72:1549-1560[Abstract/Free Full Text].
-
Zamponi GW,
Bourinet E,
Nelson D,
Nargeot J,
Snutch TP
(1997)
Crosstalk between G proteins and protein kinase C mediated by the calcium channel
1 subunit.
Nature
385:442-446[Medline]. -
Zhang JF,
Ellinor PT,
Aldrich RW,
Tsien RW
(1996)
Multiple structural elements in voltage-dependent Ca2+ channels support their inhibition by G proteins.
Neuron
17:991-1003[Web of Science][Medline].
Copyright © 2001 Society for Neuroscience 0270-6474/01/2192949-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
E. M. Silinsky
Selective disruption of the mammalian secretory apparatus enhances or eliminates calcium current modulation in nerve endings
PNAS,
April 29, 2008;
105(17):
6427 - 6432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ng, Y. Kang, C. L. Elias, Y. He, H. Xie, J. B. Hansen, P. Wahl, and H. Y. Gaisano
The Actions of a Novel Potent Islet {beta}-Cell Specific ATP-Sensitive K+ Channel Opener Can Be Modulated by Syntaxin-1A Acting on Sulfonylurea Receptor 1
Diabetes,
August 1, 2007;
56(8):
2124 - 2134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. W. Tedford and G. W. Zamponi
Direct G Protein Modulation of Cav2 Calcium Channels
Pharmacol. Rev.,
December 1, 2006;
58(4):
837 - 862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M Silinsky
Modulation of calcium currents is eliminated after cleavage of a strategic component of the mammalian secretory apparatus
J. Physiol.,
August 1, 2005;
566(3):
681 - 688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Li, F. Wang, M. Lai, Y. Chen, and J.-f. Zhang
A Protein Phosphatase 2c{alpha}-Ca2+ Channel Complex for Dephosphorylation of Neuronal Ca2+ Channels Phosphorylated by Protein Kinase C
J. Neurosci.,
February 23, 2005;
25(8):
1914 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H Hurley, A. L Cahill, M. Wang, and A. P Fox
Syntaxin 1A regulation of weakly inactivating N-type Ca2+ channels
J. Physiol.,
October 15, 2004;
560(2):
351 - 363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Gladycheva, C. S. Ho, Y. Y. F. Lee, and E. L. Stuenkel
Regulation of syntaxin1A-munc18 complex for SNARE pairing in HEK293 cells
J. Physiol.,
August 1, 2004;
558(3):
857 - 871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Li, A. Lau, T. J. Morris, L. Guo, C. B. Fordyce, and E. F. Stanley
A Syntaxin 1, G{alpha}o, and N-Type Calcium Channel Complex at a Presynaptic Nerve Terminal: Analysis by Quantitative Immunocolocalization
J. Neurosci.,
April 21, 2004;
24(16):
4070 - 4081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Jurkat-Rott and F. Lehmann-Horn
The impact of splice isoforms on voltage-gated calcium channel {alpha}1 subunits
J. Physiol.,
February 1, 2004;
554(3):
609 - 619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Tosetti, T. Turner, Q. Lu, and K. Dunlap
Unique Isoform of Galpha -interacting Protein (RGS-GAIP) Selectively Discriminates between Two Go-mediated Pathways That Inhibit Ca2+ Channels
J. Biol. Chem.,
November 22, 2002;
277(48):
46001 - 46009.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Jarvis, W. Barr, Z.-P. Feng, J. Hamid, and G. W. Zamponi
Molecular Determinants of Syntaxin 1 Modulation of N-type Calcium Channels
J. Biol. Chem.,
November 8, 2002;
277(46):
44399 - 44407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Kawasaki, S. C. Collins, and R. W. Ordway
Synaptic Calcium-Channel Function in Drosophila: Analysis and Transformation Rescue of Temperature-Sensitive Paralytic and Lethal Mutations of Cacophony
J. Neurosci.,
July 15, 2002;
22(14):
5856 - 5864.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kaneko, C. B. Cooper, N. Nishioka, H. Yamasaki, A. Suzuki, S. E. Jarvis, A. Akaike, M. Satoh, and G. W. Zamponi
Identification and Characterization of Novel Human Cav2.2 (alpha 1B) Calcium Channel Variants Lacking the Synaptic Protein Interaction Site
J. Neurosci.,
January 1, 2002;
22(1):
82 - 92.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Jarvis and G. W. Zamponi
Distinct Molecular Determinants Govern Syntaxin 1A-Mediated Inactivation and G-Protein Inhibition of N-Type Calcium Channels
J. Neurosci.,
May 1, 2001;
21(9):
2939 - 2948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-P. Feng, M. I. Arnot, C. J. Doering, and G. W. Zamponi
Calcium Channel beta Subunits Differentially Regulate the Inhibition of N-type Channels by Individual Gbeta Isoforms
J. Biol. Chem.,
November 21, 2001;
276(48):
45051 - 45058.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|