QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (26) Citing Articles via Google Scholar Google Scholar Articles by Lü, Q. Articles by Dunlap, K. Search for Related Content PubMed PubMed Citation Articles by Lü, Q. Articles by Dunlap, K.

 Previous Article  |  Next Article 

The Journal of Neuroscience, May 1, 2001, 21(9):2949-2957

Syntaxin 1A Supports Voltage-Dependent Inhibition of _1B Ca²⁺ Channels by G in Chick Sensory Neurons

Qiang Lü¹, M. S. AtKisson¹, Scott E. Jarvis², Zhong-Ping Feng^{2, 3}, Gerald W. Zamponi², and Kathleen Dunlap¹

¹ Department of Neuroscience, Tufts University School of Medicine, Boston, Massachusetts 02111, ² Department of Physiology and Biophysics, University of Calgary, Calgary, Alberta T2N 4N1, Canada, and ³ NeuroMed Technologies, Vancouver, British Columbia V6T 1Z4, Canada

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

N-type Ca²⁺ channels are modulated by a variety of G-protein-coupled pathways. Some pathways produce a transient, voltage-dependent (VD) inhibition of N channel function and involve direct binding of G-protein subunits; others require the activation of intermediate enzymes and produce a longer-lasting, voltage-independent (VI) form of inhibition. The ratio of VD:VI inhibition differs significantly among cell types, suggesting that the two forms of inhibition play unique physiological roles in the nervous system. In this study, we explored mechanisms capable of altering the balance of VD and VI inhibition in chick dorsal root ganglion neurons. We report that (1) VD:VI inhibition is critically dependent on the G concentration, with VI inhibition dominant at low G concentrations, and (2) syntaxin-1A (but not syntaxin-1B) shifts the ratio in favor of VD inhibition by potentiating the VD effects of G. Variations in expression levels of G-proteins and/or syntaxin provide the means to alter over a wide range both the extent and the rate of Ca²⁺ influx through N channels.

Key words: G-protein modulation; dorsal root ganglion neurons; GABA receptors; adrenergic receptors; recombinant channels; presynaptic regulation

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The modulation of voltage-dependent Ca²⁺ channels by G-protein-coupled receptors takes many forms and varies as a function not only of the receptor and channel type but also of the cell under study (Dolphin, 1998; Dunlap and Ikeda, 1998; Ikeda and Dunlap, 1999). Among the many Ca²⁺ channel gene products identified, those from class B (or N-type) have been best studied, because they have proven to be most sensitive to G-protein-coupled pathways. Several receptor-dependent pathways have been described to target N channels in native cells. The most ubiquitous is mediated by direct binding between complexes released from heterotrimeric G-proteins (G) and Ca²⁺ channel ₁ subunits (DeWaard et al., 1997; Qin et al., 1997; Zamponi et al., 1997; Furukawa et al., 1998); such binding produces a voltage-dependent (VD) form of inhibition often characterized by slowed current activation kinetics (Marchetti et al., 1986; Bean, 1989; Elmslie et al., 1990; Arnot et al., 2000). In contrast, other forms of modulation are mediated by more complex signaling pathways involving kinase-dependent phosphorylation and producing long-lasting, voltage-independent (VI) effects (Dunlap and Ikeda, 1998).

In most neurons, both VD and VI forms of G-protein-mediated inhibition coexist. Given their unique biophysical and biochemical profiles and variations in their relative abundance from cell to cell, the two forms of inhibition have been hypothesized to play distinct physiological roles in the nervous system (Brody et al., 1997; Park and Dunlap, 1998; Brody and Yue, 2000). Thus, understanding the molecular mechanisms responsible for these forms of inhibition is of potential physiological significance. Our studies have used dorsal root ganglion (DRG) neurons from embryonic chick, because they prominently express both VD and VI inhibition (Luebke and Dunlap, 1994) that can be activated by a variety of G-protein-coupled receptors. We have, in addition, demonstrated some selectivity between receptors and the pathways to which they couple (Diversé-Pierluissi and Dunlap, 1993; Diversé-Pierluissi et al., 1995), suggesting the possibility of receptor-specific modulation of physiological processes.

Use of function-blocking antibodies directed against G-protein _o and _i subunits allowed the demonstration that norepinephrine (NE) and GABA mediate VD inhibition in chick DRG neurons via G_o, whereas NE also produces VI inhibition via G_i (Diversé-Pierluissi et al., 1995). This latter pathway requires the activation of PLC and protein kinase C (PKC) (Rane et al., 1989; Diversé-Pierluissi et al., 2000). When purified G is introduced intracellularly into these cells, only the VI form of inhibition is observed, suggesting that VD inhibition might be mediated by G_o. This lack of G-mediated VD inhibition, however, is at odds with many studies of mammalian Ca²⁺ channels demonstrating that G (and not G) produces VD inhibition (Herlitze et al., 1996; Ikeda, 1996) and raises the question of whether structural differences in the chick N channel _1B subunits underlie differences in modulation.

To allow a test of this hypothesis, we first cloned cDNAs encoding the expressed N-type channels from chick DRG cells and identified three variable regions in which the avian channels differ significantly from their mammalian counterparts (Lü and Dunlap, 1999). Here we compare G-induced modulation of these recombinant N channels expressed in tsA-201 cells with those of native N channels in chick DRG neurons. Results demonstrate that the modulation of chick N channels does not differ between the isoforms, either in their native environments or when expressed heterologously, and (as is true for rat N channels) G mediates VD inhibition. We find that, at low G concentrations, VI inhibition dominates, but syntaxin 1A promotes a switch to VD inhibition by enhancing the interaction between the G complex and the Ca²⁺ channel subunit.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell culture and transfection. Dorsal root ganglia were dissected from chicken embryos (11- to 12-d-old for most experiments), incubated for 20 min in 0.005-0.01% collagenase A (Sigma, St. Louis, MO or Boehringer Mannheim, Indianapolis, IN) in a Ca²⁺-Mg²⁺-free saline, and dissociated mechanically in tissue culture medium (below) by trituration through a small-bore Pasteur pipette. The culture medium was DMEM supplemented with 10% heat-inactivated horse serum, 1 mM glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin (Life Technologies, Gaithersburg, MD), and an empirically determined amount of male mouse submaxillary gland homogenate (to supply nerve growth factor). Cells were plated in 35 mm tissue culture dishes (Falcon).

Human embryonic kidney cells (clone tsA-201) were cultured and transfected using methods previously described (Lü and Dunlap, 1999). Before transfection, cells were split 1:10, and 24 hr later, they were transfected using the calcium-phosphate method (Dhallan et al., 1990) with a mixture of 10 µg of Ca²⁺ channel _1B subunit cDNA with 10 µg of rat _1B (provided by S. R. Ikeda, Guthrie Institute, Sayre, PA), 8 µg of rat ₂ (provided by H. Chin, National Institutes of Health, Bethesda, MD), and 2 µg of large T antigen (provided by D. T. Yue, Johns Hopkins University, Baltimore, MD), all in pcDNA3. The cDNA for rn_1B-b was kindly supplied by Diane Lipscombe (Brown University, Providence, RI). In some experiments, 4 µg each of cDNAs encoding G-protein ₁ and ₂ subunits (in pcDNA3; provided by Stephen Ikeda) or syntaxin 1A (in pMT2; Jarvis et al., 2000) were also cotransfected. Currents were recorded 2-4 d after transfection.

Cell injection. Proteins were overexpressed in DRG neurons by direct injection (Microinjector 5242; Eppendorf, Westbury, NY) of expression plasmids into the nucleus of cells cultured for 4-30 hr according to methods above. Plasmid concentrations were 50 ng/µl in 125 mM KCl and 5 mM HEPES, pH 7.2. Fluorescein dextran (10 kDa, 2.5 µg/µl; Molecular Probes, Eugene OR) was included to allow later identification of injected cells. Recordings were made 16-24 hr after injection. Approximately 50% of fluorescent cells showed the expected effect of overexpression (alteration of current amplitude and/or time course); in the remaining cells, it is likely that the injection missed the nucleus. Use of green fluorescent protein cDNA as a control for successful nuclear injection was precluded because the protein is toxic to chick DRG neurons, regardless of the expression method (M. S. AtKisson, unpublished observations).

Reverse transcriptase-PCR. Total RNA was purified from whole ganglia or brain dissected from chicks at embryonic days 12, 15, 18, and 21 or from adult chicken or adult Sprague Dawley rats using RNA STAT-60 (Tel-Test B, Friendswood, TX). Poly(A+) RNA was purified from the total RNA using the Oligotex mini kit (Qiagen, Valencia, CA). Reverse transcriptase (RT) reactions were performed with the GeneAmp RNA PCR core kit (PE Biosystems, Foster City, CA) according to the manufacturer's directions, using a ratio of oligo-dT to random hexamers of 3:1. Five microliters of the RT reaction was used for PCR, which was performed using Advantage enzyme (Clontech, Palo Alto, CA). Primers were designed based on alignments of syntaxin 1A sequences from rat, human, and fruit fly (GenBank) accession numbers AF217191, NM_004603, and L37732), and of syntaxin 1B sequences from human, rat, and mouse (GenBank accession numbers NM_003163, M95735, and D29743). Alignments were performed using the ClustalW program maintained on the web by EMBL-European Bioinformatics Institute. Primer designations are for bookkeeping purposes, and do not reflect any information. PCR protocols consisted of a hot start and touchdown (five cycles at 72°C, five cycles at 70°C, and 23 cycles at 68°C), using an Eppendorf MasterGradient thermocycler.

Cloning of rat syntaxin 1B. All reagents and primers were purchased from Life Technologies (Rockville, MD). The forward primer (with a 5' NotI restriction site) was (5'-CGAAGAAGGGGAGGAGGAGCTGCGGCCGCCATGAAGGATCGGACTCAGGAGC-3'), and the reverse primer (with a 5' XhoI restriction site) was (5'GGTCCTGGGCTCGAGAAGGGTAGGGGCCTACAAGCCCAGTGTCCC3'). Rat brain cDNA was kindly provided by Bob Winkfein (University of Calgary, Calgary, Alberta, Canada). The PCR reaction was performed in a volume of 50 µl and included 20 mM Tris-HCl, pH 8.4, 50 mM KCl, dNTPs (0.2 mM each), 3.5 mM MgCl₂, 2.5 U of platinum Taq DNA polymerase, 20 pmol of each primer, and 50 ng of cDNA. Using a PTC-100HB thermal-cycler (MJ Research, Watertown, MA), the reaction began with a hot start, and was held at 9°C for 2 min. Thirty cycles were conducted, consisting of denaturation for 30 sec at 94°C, annealing for 45 sec at 62°C, and extension for 1.5 min at 72°C. The resultant syntaxin 1B DNA product was run on a 0.8% agarose gel, extracted, and purified using QIAquick Gel Extraction (Qiagen, Mississauga, Ontario, Canada), ligated into a pGEM T-Easy vector (Promega, Madison, WI), and sequenced to rule out PCR errors. The syntaxin 1B-T-Easy construct was then digested by NotI and XhoI, and the syntaxin 1B fragment was ligated into pMT2sx (Genetics Institute, Andover, MA) for subsequent expression in tsA-201 cells. Rat syntaxin 1A cDNA was also subcloned into pMT2sx, and G₁ and G₂ were subcloned into pcDNA3 (Invitrogen, Carlsbad, CA).

Current recording and data analysis. Standard tight-seal, whole-cell recording methods were used to measure Ca²⁺ current through N-type channels using a List Biologic (Campbell, CA) EPC9 amplifier. Internal solution for recording from chick DRG neurons or tsA-201 cells expressing the recombinant chick N channel clones contained 150 mM CsCl, 10 mM HEPES, 5 mM BAPTA, and 5 mM MgATP, pH-adjusted to 7.2 with CsOH; external solution contained 93 mM NaCl, 50 mM tetraethylammonium chloride, 2 mM CaCl₂, 25 mM HEPES, 12.5 mM NaOH, 5 mM D-glucose, and 0.3 µ mM tetrodotoxin, pH-adjusted to 7.4 with TEA-OH.

Where noted, some experiments on recombinant chick and rat N channels expressed in tsA-201 cells used an external solution of 20 mM BaCl₂, 1 mM MgCl₂,10 mM HEPES, 40 mM TEA-Cl, 10 mM glucose, and 65 mM CsCl, pH 7.2 with TEA-OH, and an internal solution containing 108 mM Cs-methanesulfonate, 4 mM MgCl₂, 9 mM EGTA, and 9 mM HEPES, pH 7.2. Such solutions enhanced current amplitudes but otherwise did not alter fundamental properties of their modulation by G-protein subunits when compared with the Ca²⁺-based external solution.

For some experiments, purified bovine brain G was applied intracellularly via the patch pipette. The G preparation (kindly provided by John Hildebrandt, University of South Carolina Medical Center, Charleston, SC) was stored at 80°C as a stock solution of ~1 mg/ml in buffer containing 20 mM Tris, pH 8.0, 1 mM EDTA, 1 mM dithiothreitol, 100 mM NaCl, and either 0.7% CHAPS or 0.7% CHAPS and 0.1% polyoxyethylene-9-lauryl ether (Thesit). No differences were observed between the two storage buffers. On the day of the experiments, a sample was diluted into intracellular recording solution to a final concentration of 20 nM and applied by passive diffusion from the pipette to the cytoplasm. Heat-inactivated G served as negative control.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Purified G produces VI but not VD inhibition of N current

Tight-seal, whole-cell methods were used to record macroscopic, N-type Ca²⁺ channel currents from dissociated chick DRG neurons and from tsA-201 cells transfected with N channel clones (Lü and Dunlap, 1999). Currents were evoked by a 15 msec test pulse to 0 mV and were monitored during the intracellular application of purified, bovine brain G added to the recording pipette solution. In chick DRG neurons, a saturating concentration of G (20 nM; Diversé-Pierluissi et al., 1995, 2000) produced a maximal 49.7 ± 4.2% (n = 6) inhibition of N current after ~25 min of dialysis with G-containing solution as compared with control recordings with heat-inactivated G in the pipette (Fig. 1A). A three-pulse voltage protocolconsisting of two test pulses to 0 mV separated by a 15 msec conditioning depolarization to 80 mVwas used to assay for the relief of inhibition that is characteristic of VD inhibition by G-proteins (Elmslie et al., 1990). G-mediated inhibition was insensitive to the conditioning pulse (i.e., no prepulse-induced facilitation), indicating a distinct absence of VD inhibition (Fig. 1A). In contrast, intracellular application of 5 µM GTPS (to directly activate endogenous G-protein heterotrimers) inhibited N current even more strongly (82.0 ± 5.1%; n = 5; Fig. 1B) and produced the slowing of current activation that is characteristic of VD inhibition (Marchetti et al., 1986; Bean, 1989; Grassi and Lux, 1989; Elmslie et al., 1990). Furthermore, in the presence of GTPS, conditioning depolarizations evoked strong facilitation (Fig. 1Bc).

View larger version (25K): [in this window] [in a new window]   Figure 1.   G produces VI inhibition in chick DRG neurons. Whole-cell Ca2+ current evoked by a three-pulse stimulus paradigm was monitored over time during application of 20 nM G (A) or 5 µM GTPS (B) through the patch pipette solution. Controls contained heat-inactivated G (20 nM). Panels marked a each show two superimposed current traces taken at the start of whole-cell recording or after (*) maximal effect of G or GTPS (Aa and Ba, respectively). Panels marked b show the mean ± SEM Ca2+ charge entry (normalized to the maximum) as a function of time for control cells (filled circles) or during application of G (n = 6) or GTPS (n = 5) (open circles); panels marked c plot the time course of the facilitation ratio produced in the same cells by conditioning depolarization (defined as charge entry during test pulse II divided by charge entry during test pulse I).

These results suggest that VI inhibition is mediated by G (confirming previous studies of Diversé-Pierluissi et al., 1995, 2000) but they imply that VD inhibition may be mediated by some other mechanism. Given, however, that VD inhibition of mammalian N channels is well accepted to involve direct binding of G to Ca²⁺ channel ₁ subunits (Herlitze et al., 1996; Ikeda, 1996; DeWaard et al., 1997; Qin et al., 1997; Zamponi et al., 1997; Furukawa et al., 1998), we sought an explanation for the apparent resistance to G of the VD pathway in chick DRG cells. Alternatively, (1) the VI pathway could be activated at lower concentrations of G, (2) the VD pathway could reside in a compartment of the cell that is inaccessible to applied G, and/or (3) other accessory proteins could be present in the primary cells that promote VI or suppress VD inhibition. To explore between these possibilities, experiments used recombinant Ca²⁺ channels expressed heterologously.

G-mediated inhibition of recombinant chick N channels

Chick N-type Ca²⁺ channel cDNAs were transiently expressed in tsA-201 cells, and G was applied via the patch pipette as for the primary cells above. Recombinant rat rn_1B-b (Lin et al., 1997) was studied for comparison. Four different, full-length ₁ subunit clones from chick (cdB1-4; Lü and Dunlap, 1999) were tested for their sensitivities to G. The chick channels differed from one another in their putative cytoplasmic linkers between membrane-spanning domains I and II and/or in an alternatively spliced C-terminal domain (Fig. 2A)both regions generally implicated in G-binding to mammalian Ca²⁺ channel ₁ subunits (Zhang et al., 1996; DeWaard et al., 1997; Qin et al., 1997; Zamponi et al., 1997). When applied for 20-30 min through the patch pipette, 20 nM G evoked only a small inhibition of the recombinant channel currents (23.2 ± 1.7%, n = 25 for chick; 24.8 ± 4.2%, n = 5 for rat); a conditioning depolarization relieved a small fraction of this inhibition (8.4%). No differences among any of the four cdB clones or the rat clone were observed (Fig. 2B).

View larger version (44K): [in this window] [in a new window]   Figure 2.   G-mediated inhibition is similar for all N channel clones tested. A contains diagrams summarizing key structural differences between a1B Ca2+ channel variants cloned from chick DRG (cdB; Lü and Dunlap, 1999) or rat (Dubel et al., 1992; Lin et al., 1997). The gray rectangles marked with roman numerals represent the four homologous membrane-spanning repeats; the white rectangles represent the putative intracellular domains. A is a 75 bp insert contained in some but not all chick clones; B is a 33 bp insert contained in all mammalian but not in some chick variants; C is a 5 bp insert found in some but not all chick variants (creating a premature stop codon and a channel subunit that is truncated by 175 amino acids in the C-terminal end). B is a histogram plotting the percentage inhibition of Ca2+ current produced by 20 nM G in tsA-201 cells transfected with the N channel 1 subunit clone designated on abscissa, coexpressed with rat 1b and 2 subunits. A three-pulse voltage protocol was used to identify the VD component of inhibition. White bars represent total inhibition in the absence of a prepulse (PP); black bars denote inhibition after prepulse to +80 mV (+PP). Number of cells noted in parentheses.

Given that G-mediated VD inhibition has been generally studied under conditions of G-protein overexpression (Ikeda and Dunlap, 1999), we sought to determine whether VD inhibition was promoted when cells were cotransfected with G and G cDNAs (because the biochemical preparation of purified G did not allow application of concentrations >20 nM). When G was overexpressed in tsA-201 cells, a robust, tonic VD inhibition was observed (Fig. 3). Ca²⁺ current amplitude was, on average, 62.2% of control cells transfected with channel subunits alone, and currents activated slowly, as expected for VD inhibition. Conditioning depolarizations produced an average 142% facilitation of Ca²⁺ current, because of a relief of the tonic inhibition (Fig. 3A), indicating that chick _1B Ca²⁺ channel subunits are inhibited by G in a manner similar to that of their mammalian counterparts. In addition, all four cdB clones behaved similarly to one another as well as to the rat clone, rn_1B-b, when cotransfected with G (Fig. 3B), further suggesting that the dominance of the VI pathway in native neurons is not because of the expression of a uniquely G-resistant _1B channel subunit.

View larger version (30K): [in this window] [in a new window]   Figure 3.   Overexpression of G enhances VD inhibition of N current. TsA-201 cells were cotransfected with 1 subunit clones designated on abscissa of B and either G12 or Gi2 (as marked). A, Ca2+ current evoked in cell expressing cdB1 by voltage pulse protocol used to estimate VD inhibition (top panel). B, Prepulse-induced facilitation (average ± SEM) for each of the Ca2+ channel clones studied. Numbers of cells in parentheses.

Overexpression of G produces VD inhibition of native N current

To explore whether native N currents in chick DRG neurons, unlike their mammalian counterparts, are refractory to G, we overexpressed G₁₂ in the cells by nuclear injection of the cDNAs. In 8 of 13 injected cells tested, Ca²⁺ currents activated slowly, peaked at a level 24.9% of currents measured from uninjected control cells, and facilitated in response to a conditioning depolarization (Fig. 4A). Such tonic inhibition and prepulse-induced facilitation is not observed in uninjected control cells. The remaining five injected cells were indistinguishable from control. The apparent lack of G₁₂-induced inhibition in these latter cells (Fig. 4B) is likely to result from an absence of G₁₂ expression (from ineffective injection), because basal Ca²⁺ currents were found to be no different between these cells and uninjected control cells (Fig. 4C); were G₁₂ actually overexpressed, robust VI inhibition would be expected, even in the absence of VD inhibition. These results demonstrate that G can evoke significant VD inhibition of chick DRG N channels (as with mammalian N channels), but apparently only when sufficiently high concentrations (and/or correct targeting of G) is achieved.

View larger version (23K): [in this window] [in a new window]   Figure 4.   Overexpression of G enhances VD inhibition in chick DRG neurons. G1 and G2 cDNAs were injected into chick DRG cell nuclei, and Ca2+ currents were studied 18-24 hr later. A, B, Two superimposed Ca2+ currents evoked by test pulses to 0 mV with (*) or without a preceding conditioning pulse to +80 mV. Traces in A taken from an injected cell with tonic VD inhibition; traces in B from an injected cell (identified by fluorescence) without tonic inhibition. C, Histogram of average total Ca2+ charge entry (±SEM) for the sample showing tonic inhibition (group A), the sample of injected cells without tonic inhibition (group B), and control (noninjected) cells. Effect of conditioning depolarization (+PP) shown in black bars; number of cells shown in parentheses.

The notion that concentration plays an important role in the selective activation of VI and VD pathways is supported by previous results from our laboratory. Lower concentrations of NE (10 µM) preferentially activate the VI pathway, with 10 µM producing a total inhibition of 25 ± 7%, most of which is resistant to depolarizing prepulses. Higher concentrations of NE (100 µM) recruit a VD component to the inhibition, producing a total inhibition of 30%, a third of which is reversed by conditioning depolarizations (Diversé-Pierluissi et al., 1995). It makes further sense that VI inhibition would be preferentially activated by lower concentrations of G, because G binds PLC at higher affinity (Myung et al., 1999) than that to which it binds the Ca²⁺ channel (DeWaard et al., 1997).

Syntaxin 1A potentiates VD inhibition by G

The strength of the G-protein-Ca²⁺ channel interaction is known to be modulated by accessory proteins, such as syntaxin 1A (Stanley and Mirotznik, 1997; Jarvis et al., 2000) and Ca²⁺ channel  subunits (Roche et al., 1995; Roche and Triestman, 1998; Meir et al., 2000). We focused our studies on syntaxin 1A to explore whether the predominance of VI inhibition in chick DRG neurons could be influenced by the expression level of this protein, known to directly interact with Ca²⁺ channel ₁ subunits (Sheng et al., 1998; Catterall, 1999). In particular, we tested whether overexpression of syntaxin 1A in chick DRG cells would support VD inhibition by 20 nM applied G. The cDNA for rat syntaxin 1A was injected into DRG cell nuclei, and Ca²⁺ currents were recorded 16-24 hr later. Among a total of 39 injected cells (identified by the presence of coinjected fluorescent dextran), 18 showed tonic VD inhibition (Fig. 5A) in the absence of G application (facilitation ratio of 1.14 vs 1.02 for control and the other 21 injected cells). Total charge entry for these 18 cells (12.07 ± 1.22 pC) was 70% of that measured from cells showing no tonic inhibition. This result suggests that syntaxin 1A expression increases the sensitivity of N channels to modulation by endogenous free G. Moreover, whole-cell recordings from 11 of these 18 cells lasted long enough to detect further inhibition by 20 nM G applied through the recording pipette. Six of the eleven responded with significantly more VD inhibition during exposure to G (additional inhibition, 46%; final facilitation ratio, 1.38 Fig. 5B). Given that uninjected control cells do not respond to 20 nM G with VD inhibition (Fig. 1), voltage-dependent responses observed in these six injected neurons argue strongly that syntaxin 1A shifts the equilibrium in favor of VD inhibition. In the remaining five cells, G produced a mean 50 ± 6.3% inhibition over 12-27 min of dialysis; the additional inhibition was purely VI, however, showing no prepulse-induced facilitation over that associated with tonic inhibition (Fig. 5B). These results confirm recent reports of syntaxin 1A-induced enhancement of G-mediated inhibition of recombinant rat N channels expressed in tsA-201 cells (Jarvis et al., 2000; Jarvis and Zamponi, 2001) and provide additional data supporting the similarity between avian and mammalian N channels.

View larger version (26K): [in this window] [in a new window]   Figure 5.   Syntaxin 1A expression in chick DRG neurons enhances VD inhibition by G. Rat syntaxin 1A cDNA was injected into nuclei of chick DRG neurons, and Ca2+ currents were studied 16-24 hr later. Three-pulse voltage protocol was used to measure prepulse-induced facilitation. A, Histogram of facilitation induced by prepulse in three groups of cells: group A (injected and demonstrating facilitation), group B (injected but without facilitation), and control (uninjected). B, Histogram showing responsiveness of Ca2+ currents in group A injected cells to intracellular application of 20 nM G through the patch pipette. White bars represent mean prepulse-induced facilitation seen immediately after achieving whole-cell access; black bars represent mean facilitation after ~20 min of dialysis with 20 nM G. The two data sets are from cells in which additional VD inhibition was observed (left) or not (right). Number of cells shown in parentheses. Inset, Two superimposed current traces before and after application of G (taken from one of the cells in the left-hand group). Dotted line marks level of peak current during first test pulse. Calibration: 1 nA, 20 msec.

Chick DRG neurons do not express syntaxin 1A but do express syntaxin 1B

An absence of syntaxin 1A expression in chick DRG neurons could explain why purified G does not produce VD inhibition of N currents in these cells. RT-PCR was used to explore this issue, using primers (Table 1) designed against three domains that are tightly conserved among distantly related species (Drosophila, rat, and human). Primer pair designated 301/302 consisted of a sense primer specific to syntaxin 1A and an antisense primer across a domain conserved between syntaxins 1A and 1B. A second pair (303/302) consisted of sense and antisense sequences common to syntaxins 1A and 1B. Both primer pairs amplified the expected products from rat and Drosophila nervous tissue, but only the primer pair with homology to both syntaxins 1A and 1B amplified a product from chick brain or DRG (Fig. 6), suggesting that syntaxin 1A is not expressed in chick. Sequence analysis of the 303/302 product from chicken revealed homology to syntaxin 1B, which is a separate gene and not a splice variant of syntaxin 1A (Bennett et al., 1993). To confirm that syntaxin 1B was present, separate RT-PCR reactions were performed using specific primers to syntaxin 1B (pair 304/305). This pair amplified the expected product, confirmed as a syntaxin 1B homolog by sequence analysis.

View larger version (54K): [in this window] [in a new window]   Figure 6.   Chick neurons do not express syntaxin 1A. RT-PCR was used to assay for the expression of syntaxin 1A or syntaxin 1B in chick and rat nervous tissue (noted at the bottom of the gel). Specificity of primer pairs used and the presence (+) or absence () of RT is noted at the top and the bottom of the gel, respectively. Expected product sizes for syntaxin 1A and syntaxin 1B noted by arrows on the right. The plasmid carrying rat syntaxin 1A that was used for injection was used here as a positive control (rat stx-1A).

Because rat syntaxin 1A levels in cerebellum (Veeranna and Pant, 1997) and retina (Dhingra et al., 1997) have been shown to be tightly regulated during development, we looked for variation in syntaxin 1A expression during neuronal embryogenesis in chick using RT-PCR. No syntaxin 1A was found in DRG cells at any embryonic stage (days 12, 15, 18, and 21) or in adult chicken brain (data not shown). No products were amplified from syntaxin 1A-specific primers, but primers 303/302 with homology to both syntaxins 1A and 1B amplified a product.

To confirm that this product was amplified from syntaxin 1B RNA, PCR was used with a new primer pair (304/305) based on regions homologous among syntaxin 1B clones (mouse, human, rat), but differing from syntaxin 1A. This primer pair amplified the expected length product, which was confirmed as a syntaxin 1B homolog by sequence analysis. Thus, chick DRG cells express syntaxin 1B but not syntaxin 1A. To evaluate whether this could explain the lack of VD inhibition by applied G, we compared effects of syntaxin 1B with those of syntaxin 1A on inhibition of N channels by G in tsA-201 cells.

Syntaxin 1B does not support VD inhibition of recombinant N channels

A full-length syntaxin 1B cDNA was cloned from rat mRNA using RT-PCR (see Materials and Methods), subcloned into pMT2sx, and expressed in tsA-201 cells along with N channel ₁ subunits from rat (rbBII) or chick (cdB1) and with rat _1b, and ₂-. Comparisons were made between cells transfected with syntaxin 1A or syntaxin 1B cDNAs. Overexpression of syntaxin 1A promoted tonic, VD inhibition in these cells expressing the rat and chick N channels, exhibiting facilitation ratios of 1.75 ± 0.08 (rbBII; n = 8) and 1.56 ± 0.11 (cdB1; n = 20). In such experiments, the VD pathway is saturated by basal concentrations of G; additional G (through overexpression) produces no additional effect on Ca²⁺ current (Jarvis et al., 2000). In contrast, N currents in cells transfected with syntaxin 1B showed little or no tonic inhibition, with facilitation ratios near 1 (Fig. 7A). Western blot analysis of the syntaxin 1B-transfected cells using an antibody that recognizes both forms of syntaxin demonstrated the expression of syntaxin 1B protein (Fig. 7B). Furthermore, when cells were cotransfected with syntaxin 1B and syntaxin 1A (at 1:1), the facilitation ratio was reduced from 1.75 ± 0.08 to 1.2 ± 0.05 (rbBII; n = 8), confirming that syntaxin 1B was expressed in the transfected cells and suggesting that it binds the synprint motif in the II-III linker of the N channel ₁ subunit. This dominant-negative effect of syntaxin 1B is likely to be specific, because overexpression of other proteins (e.g., the II-III linker from _1C Ca²⁺ channels) does not alter the ability of syntaxin 1A to promote VD inhibition by G (Magga et al., 2000). Thus, overexpression of a second protein does not, per se, reduce syntaxin 1A expression. These results suggest that, despite their significant sequence identities, the two syntaxins differ from one another in their abilities to support VD inhibition. Low levels of syntaxin 1A expression are likely to be one reason why low concentrations of G (either applied or produced by submaximal activation of G-protein-coupled receptors), do not naturally promote VD inhibition in chick DRG cells.

View larger version (43K): [in this window] [in a new window]   Figure 7.   Syntaxin 1A but not syntaxin 1B potentiates VD inhibition by G. TsA-201 cells were transfected with chick cdB1 (white bars) or rat rbBII (gray bars) Ca2+ channel 1B subunit clones and calcium currents isolated using whole-cell recording. A, Histogram of tonic VD inhibition plotted as mean facilitation ratio ± SEM (measured with three-pulse voltage protocol) in control cells or in cells transfected with syntaxin 1A (stx-1A) or syntaxin 1B (stx-1B), as marked on abscissa. Numbers of cells noted in parentheses. B, Western blot of control cells or cells transfected with syntaxin 1B cDNA, probed with anti-syntaxin antibody [methods per Jarvis et al. (2000)].

View this table: [in this window] [in a new window]   Table 1.   Pan-species primer sequences for syntaxins 1A and 1B

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Results presented here provide an explanation for the observation that both the form and extent of G-mediated inhibition of N channels vary among preparations and/or with different experimental approaches. By comparing the inhibition of recombinant and native N channels produced by purified or overexpressed G, we have shown that VI inhibition is preferentially evoked in chick DRG neurons with direct applications of low G concentrations, whereas VD inhibition is evoked strongly only when G is either overexpressed or when syntaxin 1A (but not syntaxin 1B) is present. Our results further demonstrate that four _1B channel splice variants cloned from chick DRG cells are all modulated similarly to one another as well as to rat _1B channels. Thus, these data argue that cell-to-cell variations in the ratio of VI to VD inhibition of N channels are more likely to result from variations in concentration and targeting of the signaling molecules than from differences in primary structure of the _1B subunits present.

That being said, however, it should be noted that saturating concentrations of NE and/or overexpression of G in chick DRG neurons produce less VD inhibition (as assayed by prepulse-induced facilitation) than that typically reported, for example, in superior cervical ganglion cell somata (Hille, 1994; Ikeda and Dunlap, 1999; Delmas et al., 1999). That is, G-mediated inhibition of N channels in chick DRG neurons appears to be less sensitive to voltage, even under conditions optimized to produce VD inhibition. Side-by-side comparisons of G-mediated inhibition of recombinant chick _1B subunit variants with the rn_1Bb variant showed no quantitative differences in tsA-201 cells, however, so the differences in voltage dependence of G action on native chick and rat neurons may be the result of differences in other accessory proteins expressed by the cells. Results of others demonstrate that the extent of Ca²⁺ current inhibition by G-proteins can be regulated by the type of Ca²⁺ channel  subunit associated with the channel (Roche et al., 1995; Roche and Triestman, 1998; Meir et al., 2000), and we demonstrate here that syntaxin 1A can enhance the ability of G to produce VD inhibition as well. In addition, Delmas et al. (2000) have identified N channels in somata and dendrites of sympathetic neurons that are differentially sensitive to G, suggesting that, in vivo, the N channel family might exhibit a range of responsiveness to G.

Given the observation by Jarvis et al. (2000), that syntaxin 1A binds both N channel ₁ subunits and G, a reasonable interpretation of the results reported here is that syntaxin 1A promotes G-mediated VD inhibition by increasing the local G concentration near its binding site or sites on _1B subunits. When syntaxin 1A concentration is low, therefore, VI inhibition predominates, as we see in chick DRG neurons. By contrast, in neurons expressing syntaxin 1A, VD inhibition would be expected to dominate. The targeting, by syntaxin 1A, of G to its binding sites on Ca²⁺ channels may be the reason why some cells (e.g., rat sympathetic neurons) (1) exhibit prominent basal (or tonic) inhibition and (2) show preferential VD inhibition when stimulated by even very low concentrations of transmitter (Delmas et al., 1999). Thus, the differential expression of such regulatory molecules may promote unique functional states for neurons.

The issue of targeting is an important one and could complicate the interpretation of our results. Molecules applied to the bulk cytoplasm may not have full access to signaling complexes, particularly if such complexes are sequestered in membrane compartments. Because of this, our results do not eliminate the possibility that spatial inaccessibility accounts, in part, for the inability of G to promote VD inhibition. Incomplete access may also provide an explanation for our observation that activation of G-proteins via intracellular application of GTPS evokes stronger VD inhibition of N channels than does direct application of G. That is, should N channels exist in a complex with G-protein heterotrimers, G released during activation of the heterotrimer may have more ready access to the channel than would G applied to the cytoplasm. Because G evokes VD inhibition in chick DRG neurons when syntaxin 1A is expressed, however, a putative spatially restricted signaling compartment must be amenable to alteration by syntaxin 1A.

Our results raise the possibility that variations in syntaxin expression might underlie differences in N channel modulation among cells or as a result of changes in physiological stimuli. Although our RT-PCR results demonstrate that syntaxin 1A expression is absent from chick DRGs at all stages of development and absent from adult chicken brain, rat syntaxin 1A levels in both cerebellum (Veeranna and Pant, 1997) and retina (Dhingra et al., 1997) have been shown to be low at birth and increase substantially during development. Furthermore, after long-term potentiation-inducing stimulation in the hippocampus, syntaxin 1B expression is upregulated, and the ratio of splice variants syntaxin 3A-to-3B is reversed (Helme-Guizon et al., 1998; Rodger et al., 1998). Additionally, a recent study has demonstrated that syntaxin 1A gene expression is controlled by Ca²⁺ influx through _1A (or P-type) Ca²⁺ channels (Sutton et al., 1999). Thus, differential expression of P-type Ca²⁺ channels is likely to lead to differences in syntaxin 1A content in tissues. It is interesting in this regard that embryonic chick DRG neurons do not express P-type channels at the ages studied (Cox and Dunlap, 1992) (AtKisson, unpublished observations), suggesting an explanation for their low syntaxin 1A levels.

Results reported here are the first to suggest that syntaxins 1A and 1B are functionally distinct. These two proteins, products of separate genes (Bennett et al., 1993), are 82% identical over the 288 amino acid residues constituting the full-length proteins, with only 10 residues (scattered throughout the proteins) representing nonconservative differences. It is, thus, not surprising that both serve as substrates for botulinum toxin C1, and competitive interactions (such as those reported here) would be expected. That syntaxin 1B cannot substitute for syntaxin 1A to enhance G-mediated VD inhibition offers a powerful tool for identifying residues critical for the enhancement of G action by syntaxin 1A.

Given that syntaxin 1A is an integral component of the secretory apparatus and is thought to interact directly with exocytotic Ca²⁺ channels at sites of transmitter release (Sheng et al., 1998; Catterall, 1999), VD inhibition of Ca²⁺ channels would be predicted to dominate in nerve terminals. This is supported by direct recordings from presynaptic calyces innervating chick ciliary ganglion neurons, where intracellular application of GTPS evokes VD inhibition of Ca²⁺ currentsan effect abrogated by proteolysis of syntaxin with botulinum toxin C1 (Stanley and Mirotznik, 1997). This latter result is at odds, however, with the findings presented here in that (1) chick nervous tissue expresses syntaxin 1B, but not syntaxin 1A, and the former cannot support VD inhibition of somatic N currents by G, and (2) even in the absence of syntaxin 1A, GTPS evokes VD inhibition in chick neurons lacking syntaxin 1A. Although we do not have an explanation for this discrepancy, it is possible that nerve terminal N channels differ from their somatic counterparts in their regulation by G (Delmas et al., 2000). Our RT-PCR results demonstrate that, in addition to syntaxin 1B, for example, chick nervous tissue expresses syntaxin 3 (data not shown). Because this latter isoform is also a substrate for botulinum toxin C1 (Schiavo et al., 1995), it might play a role similar to that of syntaxin 1A to potentiate VD inhibition in ciliary ganglion calyx terminals. Alternatively, chick ciliary neurons might express an N channel variant different from those we have tested in our studies. It is interesting in this regard that biophysical studies of the calyx N channel demonstrate currents that inactivate more slowly than their somatic counterparts (Stanley and Goping, 1991; Stanley and Mirotznik, 1997). In addition, the ability of syntaxin 1A to enhance voltage-dependent inactivation of some N channel types (Bezprozvanny et al., 1995; Degtiar et al., 2000; Jarvis and Zamponi, 2001) is not observed for the calyx N channels (Stanley and Mirotznik, 1997), arguing for their uniqueness. That different N channel types might be differentially regulated by G is an idea that has received support recently. Delmas et al. (2000) identified an N-type Ca²⁺ channel (uniquely targeted to the dendrites of sympathetic neurons) that is more susceptible to G-mediated VD inhibition than are somatic N channels in the same cells.

In addition to potentiating receptor-mediated inhibition of Ca²⁺ current, syntaxin 1A clearly also plays a role in tonic modulation of Ca²⁺ channels under basal conditions, as demonstrated by Jarvis et al. (2000) and confirmed here. Many Ca²⁺ channels are tonically modulated under basal conditions (Ikeda, 1991; Kasai, 1991). The VD component of such tonic inhibition can be reversed by a conditioning prepulse (Elmslie et al., 1990; Ikeda, 1991) or (under more natural physiological conditions) during action potential trains (Brody et al., 1997; Patil et al., 1998; Park and Dunlap, 1998; Brody and Yue, 2000). In addition, tonic inhibition can be reversed by activation of protein kinase C (PKC) through a mechanism thought to involve PKC-dependent phosphorylation of the Ca²⁺ channel ₁ subunit, thereby preventing the binding of G (Swartz, 1993; Yang and Tsien, 1993; Hamid et al., 1999; Cooper et al., 2001). Thus, syntaxin 1A and PKC are antagonistic regulators of VD inhibition in mammalian neurons. By contrast, in cells that lack syntaxin 1A (such as the embryonic chick DRG neurons studied here), PKC may be freed to play a different modulatory role. These neurons do not show tonic inhibition under normal circumstances, and it has long been recognized that activators of PKC produce strong VI inhibition of chick N current (Rane et al., 1989; Diversé-Pierluissi et al., 1995). Syntaxin 1A expression levels might, thus, set the ratio of VD-to-VI inhibition differentially among cell types. In addition, given that Ca²⁺ influx plays a number of physiological and/or biochemical roles in neurons, targeting of syntaxin 1A to particular cellular domains might allow differential or region-specific regulation of Ca²⁺ influx.

	FOOTNOTES

Received Oct. 5, 2000; revised Feb. 22, 2001; accepted Feb. 23, 2001.

This work was supported by United States Public Health Service Grant NS16483 (K.D.), a Medical Foundation Fellowship (Q.L.), the Canadian Institutes of Health Research (G.W.Z.), the EJLB Foundation (G.W.Z.), the Alberta Heritage Foundation for Medical Research (G.Z., S.E.J.), and the Natural Science and Engineering Research Council (Z.P.F.). We gratefully acknowledge John Hildebrandt and coworkers (Department of Pharmacology, University of South Carolina) for their kind gifts of purified bovine brain G. We also thank Michael Goy for his critical comments on this manuscript.

Correspondence should be addressed to Kathleen Dunlap, Department of Neuroscience, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111. E-mail: kathleen.dunlap{at}tufts.edu.

Dr. Lü's present address: Department of Neuroscience, Wyeth-Ayerst Research, CN8000, Princeton, NJ 08543.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

• Arnot MI, Stotz SC, Jarvis SE, Zamponi GW (2000) Differential modulation of N-type _1B and P/Q-type _1A calcium channels by different G protein  subunit isoforms. J Physiol (Lond) 527:203-212[Abstract/Free Full Text].
• Bean BP (1989) Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence. Nature 340:153-156[Medline].
• Bennett MK, García-Arrarás JE, Elferink LA, Peterson K, Fleming AM, Hazuka CD, Scheller RH (1993) The syntaxin family of vesicular transport receptors. Cell 74:863-873[Web of Science][Medline].
• Bezprozvanny I, Scheller RH, Tsien RW (1995) Functional impact of syntaxin on gating of N-type and Q-type calcium channels. 378:623-626.
• Brody DL, Yue DT (2000) Relief of G-protein inhibition of calcium channels and short-term synaptic facilitation in cultured hippocampal neurons. J Neurosci 20:889-898[Abstract/Free Full Text].
• Brody DL, Patil PG, Mulle JG, Snutch TP, Yue DT (1997) Bursts of action potential waveforms relieve G-protein inhibition of recombinant P/Q-type Ca²⁺ channels in HEK 293 cells. J Physiol (Lond) 499:637-644[Abstract/Free Full Text].
• Catterall WA (1999) Interactions of presynaptic Ca²⁺ channels and snare proteins in neurotransmitter release. Ann NY Acad Sci 868:144-159[Web of Science][Medline].
• Cooper CB, Arnot MI, Feng ZP, Jarvis SE, Hamid J, Zamponi GW (2000) Crosstalk between G protein and PKC modulation of N-type calcium channels is dependent on the G protein subunit isoform. J Biol Chem 275:40777-40781[Abstract/Free Full Text].
• Cox DH, Dunlap K (1992) Pharmacological discrimination of N-type from L-type calcium current and its selective modulation by transmitters. J Neurosci 12:906-914[Abstract].
• Degtiar VE, Scheller RH, Tsien RW (2000) Syntaxin modulation of slow inactivation of N-type calcium channels. J Neurosci 20:4355-4367[Abstract/Free Full Text].
• Delmas P, Abogadie FC, Milligan G, Buckley NJ, Brown DA (1999) dimers derived from G_o and G_i proteins contribute different components of adrenergic inhibition of Ca²⁺ channels in rat sympathetic neurones. J Physiol (Lond) 518:23-36[Abstract/Free Full Text].
• Delmas P, Abogadie FC, Buckley NJ, Brown DA (2000) Calcium channel gating and modulation by transmitters depend on cellular compartmentalization. Nat Neurosci 3:670-678[Web of Science][Medline].
• DeWaard M, Liu H, Walker D, Scott VES, Gurnett CA, Campbell KP (1997) Direct binding of G-protein complex to voltage-dependent calcium channels. Nature 385:446-450[Medline].
• Dhallan RS, Yau KW, Schrader KA, Reed RR (1990) Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons. Nature 347:184-187[Medline].
• Dhingra NK, Ramamohan Y, Raju TR (1997) Developmental expression of synaptophysin, synapsin I, and syntaxin in the rat retina. Dev Brain Res 102:267-273[Medline].
• Diversé-Pierluissi M, Dunlap K (1993) Distinct, convergent second messenger pathways modulate neuronal calcium currents. Neuron 10:753-760[Web of Science][Medline].
• Diversé-Pierluissi M, Goldsmith PK, Dunlap K (1995) Transmitter-mediated inhibition of N-type calcium channels in sensory neurons involves multiple GTP-binding proteins and subunits. Neuron 14:191-200[Web of Science][Medline].
• Diversé-Pierluissi M, McIntire WE, Myung CS, Linforfer MA, Garrison JC, Goy MG, Dunlap K (2000) Selective coupling of specific G protein complexes to inhibition of Ca²⁺ channels. J Biol Chem 275:28380-28385[Abstract/Free Full Text].
• Dolphin AC (1998) Mechanisms of modulation of voltage-dependent calcium channels by G proteins. J Physiol (Lond) 50:3-11.
• Dubel SJ, Starr TVB, Hell J, Ahlijanian MK, Enyeart JJ, Catterall WA, Snutch TP (1992) Molecular cloning of the -1 subunit of an w-conotoxin-sensitive calcium channel. Proc Natl Acad Sci USA 89:5058-5062[Abstract/Free Full Text].
• Dunlap K, Ikeda SR (1998) Receptor-mediated pathways that modulate calcium channels. Semin Neurosci 9:198-208.
• Elmslie KS, Zhou W, Jones SW (1990) LHRH and GTP--S modify calcium current activation in bullfrog sympathetic neurons. Neuron 5:75-80[Web of Science][Medline].
• Furukawa T, Miura R, Mori Y, Strobeck M, Suzuki K, Ogihara Y, Asano T, Morishita R, Hashii M, Higashida H, Yoshii M, Nukada T (1998) Differential interactions of the C terminus and the cytoplasmic I-II loop of neuronal Ca²⁺ channels with G-protein  and subunits. II. Evidence for direct binding. J Biol Chem 273:17595-603[Abstract/Free Full Text].
• Grassi F, Lux HD (1989) Voltage-dependent GABA-induced modulation of calcium currents in chick sensory neurons. Neurosci Lett 105:113-119[Web of Science][Medline].
• Hamid J, Nelson D, Spaetgens R, Dubel SJ, Snutch TP, Zamponi GW (1999) Identification of an integration center for cross-talk between protein kinase C and G protein modulation of N-type calcium channels. J Biol Chem 274:6195-6202[Abstract/Free Full Text].
• Helme-Guizon A, Davis S, Israel M, Lesbats B, Mallet J, Laroche S, Hicks A (1998) Increase in syntaxin 1B and glutamate release in mossy fibre terminals after induction of LTP in the dentate gyrus: a candidate molecular mechanism underlying transsynaptic plasticity. Eur J Neurosci 10:2231-2237[Web of Science][Medline].
• Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca²⁺ channels by G-protein subunits. Nature 380:258-262[Medline].
• Hille B (1994) Modulation of ion-channel function by G-protein-coupled receptors. Trends Neurosci 17:531-536[Web of Science][Medline].
• Ikeda SR (1991) Double-pulse calcium channel current facilitation in adult rat sympathetic neurones. J Physiol (Lond) 439:181-214[Abstract/Free Full Text].
• Ikeda SR (1996) Voltage-dependent modulation of N-type calcium channels by G-protein subunits. Nature 380:255-258[Medline].
• Ikeda SR, Dunlap K (1999) Voltage-dependent modulation of N-type calcium channels: role of G protein subunits. Adv Second Messenger Phosphoprotein Res 33:131-151[Web of Science][Medline].
• Jarvis SE, Zamponi GW (2001) Distinct molecular determinants govern syntaxin 1A-mediated inactivation and G-protein inhibition of N-type calcium channels. J Neurosci 21:2939-2948[Abstract/Free Full Text].
• Jarvis SE, Magga JM, Beedle AM, Braun JEA, Zamponi GW (2000) G protein modulation of N-type calcium channels is facilitated by physical interactions between syntaxin 1A and G. J Biol Chem 275:6388-6394[Abstract/Free Full Text].
• Kasai H (1991) Tonic inhibition and rebound facilitation of a neuronal calcium channel by a GTP-binding protein. Proc Natl Acad Sci USA 88:8855-8859[Abstract/Free Full Text].
• Lin Z, Haus S, Edgerton J, Lipscombe D (1997) Identification of functionally distinct isoforms of the N-type Ca²⁺ channel in rat sympathetic ganglia and brain. Neuron 18:153-166[Web of Science][Medline].
• Lü Q, Dunlap K (1999) Cloning and functional expression of novel N-type Ca²⁺ channel variants. J Biol Chem 274:34566-75[Abstract/Free Full Text].
• Luebke JI, Dunlap K (1994) Sensory neuron N-type calcium currents are inhibited by both voltage-dependent and -independent mechanisms. Pflügers Arch 428:499-507[Web of Science][Medline].
• Marchetti C, Carbone E, Lux HD (1986) Effects of dopamine and noradrenaline on Ca channels of cultured sensory and sympathetic neurons of chick. Pflügers Arch 406:104-111[Web of Science][Medline].
• Magga J, Jarvis SE, Arnot MI, Zamponi GW, Braun JEA (2000) Cysteine string protein regulates G protein modulation of N-type calcium channels. Neuron 28:195-204[Web of Science][Medline].
• Meir A, Bell DC, Stephens GJ, Page KM, Dolphin AC (2000) Calcium channel  subunit promotes voltage-dependent modulation of _1B by G. Biophys J 79:731-746[Web of Science][Medline].
• Myung CS, Paterson A, Harden TK, Garrison JC (1999) Development of an assay for phospholipase C using column-reconstituted, extruded phospholipid vesicles. Anal Biochem 270:303-313[Web of Science][Medline].
• Park D, Dunlap K (1998) Dynamic regulation of calcium influx by G-proteins, action potential waveform, and neuronal firing frequency. J Neurosci 18:6757-6766[Abstract/Free Full Text].
• Patil PG, Brody DL, Yue DT (1998) Preferential closed-state inactivation of neuronal calcium channels. Neuron 20:1027-1038[Web of Science][Medline].
• Qin N, Platano D, Olcese R, Stefani E, Birnbaumer L (1997) Direct interaction of G with a C-terminal G-binding domain of the Ca²⁺ channel ₁ subunit is responsible for channel inhibition by G protein-coupled receptors. Proc Natl Acad Sci USA 94:8866-8871[Abstract/Free Full Text].
• Rane SR, Walsh MP, McDonald JR, Dunlap K (1989) Specific inhibitors of protein kinase C block transmitter-induced modulation of sensory neuron calcium current. Neuron 3:239-245[Web of Science][Medline].
• Roche JP, Triestman SN (1998) The Ca²⁺ channel ₃ subunit differentially modulates G-protein sensitivity of _1A and _1B Ca²⁺ channels. J Neurosci 18:876-886.
• Roche JP, Anantharam V, Triestman SN (1995) Abolition of G protein inhibition of _1A and _1B calcium channels by co-expression of the ₃ subunit. FEBS Lett 371:43-46[Web of Science][Medline].
• Rodger J, Davis S, Laroche S, Mallet J, Hicks A (1998) Induction of long-term potentiation in vivo regulates alternative splicing to alter syntaxin 3 isoform expression in rat dentate gyrus. J Neurochem 71:666-675[Web of Science][Medline].
• Schiavo G, Shone CC, Bennett MK, Scheller RH, Montecucco C (1995) Botulinum neurotoxin type C cleaves a single Lys-Ala bond within the carboxyl-terminal region of syntaxins. J Biol Chem 270:10566-70[Abstract/Free Full Text].
• Sheng ZH, Westenbroek RE, Catterall WA (1998) Physical link and functional coupling of presynaptic calcium channels and the synaptic vesicle docking/fusion machinery. J Bioenerg Biomembr 30:335-345[Web of Science][Medline].
• Stanley EF, Goping G (1991) Characterization of a calcium current in a vertebrate cholinergic presynaptic nerve terminal. J Neurosci 11:985-993[Abstract].
• Stanley EF, Mirotznik RR (1997) Cleavage of syntaxin prevents G-protein regulation of presynaptic calcium channels. Nature 385:340-343[Medline].
• Sutton KG, McRory JE, Guthrie H, Murphy TH, Snutch TP (1999) P/Q-type Ca²⁺ channels mediate the activity dependent feedback of syntaxin-1A. Nature 401:800-804[Medline].
• Swartz KJ (1993) Modulation of Ca²⁺ channels by protein kinase C in rat central and peripheral neurons: disruption of G protein-mediated inhibition. Neuron 11:305-320[Web of Science][Medline].
• Veeranna GP, Pant HC (1997) Expression of p67 (Munc-18), Cdk5, P-NFH and syntaxin during development of the rat cerebellum. Dev Neurosci 19:172-183[Web of Science][Medline].
• Yang J, Tsien RW (1993) Enhancement of N- and L-type calcium channel currents by protein kinase C in frog sympathetic neurons. J Neurophysiol 72:1549-1560[Abstract/Free Full Text].
• Zamponi GW, Bourinet E, Nelson D, Nargeot J, Snutch TP (1997) Crosstalk between G proteins and protein kinase C mediated by the calcium channel ₁ subunit. Nature 385:442-446[Medline].
• Zhang JF, Ellinor PT, Aldrich RW, Tsien RW (1996) Multiple structural elements in voltage-dependent Ca²⁺ channels support their inhibition by G proteins. Neuron 17:991-1003[Web of Science][Medline].

---

Copyright © 2001 Society for Neuroscience  0270-6474/01/2192949-09$05.00/0

This article has been cited by other articles:

				E. M. Silinsky Selective disruption of the mammalian secretory apparatus enhances or eliminates calcium current modulation in nerve endings PNAS, April 29, 2008; 105(17): 6427 - 6432. [Abstract] [Full Text] [PDF]

				B. Ng, Y. Kang, C. L. Elias, Y. He, H. Xie, J. B. Hansen, P. Wahl, and H. Y. Gaisano The Actions of a Novel Potent Islet {beta}-Cell Specific ATP-Sensitive K+ Channel Opener Can Be Modulated by Syntaxin-1A Acting on Sulfonylurea Receptor 1 Diabetes, August 1, 2007; 56(8): 2124 - 2134. [Abstract] [Full Text] [PDF]

				H. W. Tedford and G. W. Zamponi Direct G Protein Modulation of Cav2 Calcium Channels Pharmacol. Rev., December 1, 2006; 58(4): 837 - 862. [Abstract] [Full Text] [PDF]

				E. M Silinsky Modulation of calcium currents is eliminated after cleavage of a strategic component of the mammalian secretory apparatus J. Physiol., August 1, 2005; 566(3): 681 - 688. [Abstract] [Full Text] [PDF]

				D. Li, F. Wang, M. Lai, Y. Chen, and J.-f. Zhang A Protein Phosphatase 2c{alpha}-Ca2+ Channel Complex for Dephosphorylation of Neuronal Ca2+ Channels Phosphorylated by Protein Kinase C J. Neurosci., February 23, 2005; 25(8): 1914 - 1923. [Abstract] [Full Text] [PDF]

				J. H Hurley, A. L Cahill, M. Wang, and A. P Fox Syntaxin 1A regulation of weakly inactivating N-type Ca2+ channels J. Physiol., October 15, 2004; 560(2): 351 - 363. [Abstract] [Full Text] [PDF]

				S. E. Gladycheva, C. S. Ho, Y. Y. F. Lee, and E. L. Stuenkel Regulation of syntaxin1A-munc18 complex for SNARE pairing in HEK293 cells J. Physiol., August 1, 2004; 558(3): 857 - 871. [Abstract] [Full Text] [PDF]

				Q. Li, A. Lau, T. J. Morris, L. Guo, C. B. Fordyce, and E. F. Stanley A Syntaxin 1, G{alpha}o, and N-Type Calcium Channel Complex at a Presynaptic Nerve Terminal: Analysis by Quantitative Immunocolocalization J. Neurosci., April 21, 2004; 24(16): 4070 - 4081. [Abstract] [Full Text] [PDF]

				K. Jurkat-Rott and F. Lehmann-Horn The impact of splice isoforms on voltage-gated calcium channel {alpha}1 subunits J. Physiol., February 1, 2004; 554(3): 609 - 619. [Abstract] [Full Text] [PDF]

				P. Tosetti, T. Turner, Q. Lu, and K. Dunlap Unique Isoform of Galpha -interacting Protein (RGS-GAIP) Selectively Discriminates between Two Go-mediated Pathways That Inhibit Ca2+ Channels J. Biol. Chem., November 22, 2002; 277(48): 46001 - 46009. [Abstract] [Full Text] [PDF]

				S. E. Jarvis, W. Barr, Z.-P. Feng, J. Hamid, and G. W. Zamponi Molecular Determinants of Syntaxin 1 Modulation of N-type Calcium Channels J. Biol. Chem., November 8, 2002; 277(46): 44399 - 44407. [Abstract] [Full Text] [PDF]

				F. Kawasaki, S. C. Collins, and R. W. Ordway Synaptic Calcium-Channel Function in Drosophila: Analysis and Transformation Rescue of Temperature-Sensitive Paralytic and Lethal Mutations of Cacophony J. Neurosci., July 15, 2002; 22(14): 5856 - 5864. [Abstract] [Full Text] [PDF]

				S. Kaneko, C. B. Cooper, N. Nishioka, H. Yamasaki, A. Suzuki, S. E. Jarvis, A. Akaike, M. Satoh, and G. W. Zamponi Identification and Characterization of Novel Human Cav2.2 (alpha 1B) Calcium Channel Variants Lacking the Synaptic Protein Interaction Site J. Neurosci., January 1, 2002; 22(1): 82 - 92. [Abstract] [Full Text] [PDF]

				S. E. Jarvis and G. W. Zamponi Distinct Molecular Determinants Govern Syntaxin 1A-Mediated Inactivation and G-Protein Inhibition of N-Type Calcium Channels J. Neurosci., May 1, 2001; 21(9): 2939 - 2948. [Abstract] [Full Text] [PDF]

				Z.-P. Feng, M. I. Arnot, C. J. Doering, and G. W. Zamponi Calcium Channel beta Subunits Differentially Regulate the Inhibition of N-type Channels by Individual Gbeta Isoforms J. Biol. Chem., November 21, 2001; 276(48): 45051 - 45058. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (26) Citing Articles via Google Scholar Google Scholar Articles by Lü, Q. Articles by Dunlap, K. Search for Related Content PubMed PubMed Citation Articles by Lü, Q. Articles by Dunlap, K.

Home  |   Search  |   Archive  |   Subscribe  |   Contact  |   Help