 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 2002, 22(1):156-166
Activation of Rac GTPase by p75 Is Necessary for
c-jun N-Terminal Kinase-Mediated Apoptosis
Anthony W.
Harrington1, 2,
Ju Young
Kim1, 3, and
Sung
Ok
Yoon1
1 Neurobiotech Center and Department of Neuroscience,
2 Biochemistry Program, and 3 Molecular,
Cellular, and Developmental Biology Program, Ohio State University,
Columbus, Ohio 43210
 |
ABSTRACT |
The neurotrophin receptor p75 can induce apoptosis both in
vitro and in vivo. The mechanisms by which p75
induces apoptosis have remained mostly unknown. Here, we report that
p75 activates Rac GTPase, which in turn activates c-jun
N-terminal kinase (JNK), including an injury-specific JNK3, in an
NGF-dependent manner. N17Rac blocks this JNK activation and subsequent
NGF-dependent apoptosis, indicating that activation of Rac GTPase is
required for JNK activation and apoptosis induced by p75. In addition, p75-mediated Rac activation is modulated by coactivation of Trk, identifying Rac GTPase as one of the key molecules whose activity is
critical for cell survival and death in neurotrophin signaling. The
crucial role of the JNK pathway in p75 signaling is further confirmed
by the results that blocking p75 from signaling via the JNK pathway or
suppressing the JNK activity itself led to inhibition of NGF-dependent
death. Together, these results indicate that the apoptotic machinery of
p75 comprises Rac GTPase and JNK.
Key words:
apoptosis; Rac GTPase; c-jun N-terminal
kinase; signal transduction; p75; NGF
 |
INTRODUCTION |
NGF belongs to a family of
neurotrophins whose primary role is the promotion of neuronal survival
and differentiation. NGF exerts its role by activating two distinct
types of receptors, TrkA, a receptor-tyrosine kinase, and p75, a member
of the tumor necrosis factor receptor family (Lewin and Barde, 1996 ;
Carter and Lewin, 1997 ). The role of TrkA is undisputed as a
survival-promoting receptor. The role of p75, however, still remains
controversial, in part because it is associated with the promotion of
both apoptosis and survival.
In the sympathetic system, p75 is involved in the death of superior
cervical ganglion neurons during development, but whether p75 also
plays a similar role in the adult is still unclear (Bamji et al., 1998 ;
Brennan et al., 1999 ). In the CNS, the role of p75 similarly remains
controversial, because the absence of p75 resulted contradictorily in
an increase, a decrease, and no change in the total number of basal
forebrain neurons (Yeo et al., 1997 ; Peterson et al., 1999 ; Ward and
Hagg, 1999 ). The difficulty of discerning the role of p75 in these
systems may continue, given the complexity of p75 action in the
presence of resident TrkA. One consistent piece of evidence emerging in
the literature from these data is that p75 can induce apoptosis when
activated by a neurotrophin in the absence of the Trk specific to that
neurotrophin (Dechant and Barde, 1997 ). Conversely, when coexpressed
with Trk, p75 augments Trk function.
These dichotomous roles for p75 are reflected in the signaling pathways
it activates. For its role in survival, p75 is known to activate
NF- B (Carter et al., 1996 ). For its role in apoptosis, it has been
shown to activate c-jun N-terminal kinase (JNK)
(Casaccia-Bonnefil et al., 1996 ; Yoon et al., 1998 ) and caspases (Gu et
al., 1999 ) and to induce ceramide production (Dobrowsky et al., 1994 ).
Of these apoptotic pathways, the JNK pathway has been shown to be necessary (Yoon et al., 1998 ), but the mechanisms whereby p75 activates
the JNK pathway are mostly unknown.
In this report, we present data demonstrating that p75 activates Rac
GTPase, which in turn activates JNK in an NGF-dependent manner. This
activation is required for p75-mediated apoptosis. As an experimental
system for studying the apoptotic pathway of p75 without the
interference of TrkA, we chose to use primary oligodendrocytes. In
oligodendrocytes, NGF induces cell death, and p75 activates all the
known apoptotic pathways, such as JNK, caspases, and ceramide
production (Casaccia-Bonnefil et al., 1996 ; Gu et al., 1999 ). Using
oligodendrocytes, we demonstrate that activation of Rac is prolonged by
NGF but not by BDNF or neurotrophin 3 (NT3). This prolonged
activation of Rac correlates with the ability of these neurotrophins to
induce apoptosis, suggesting that the kinetics of Rac activation may
determine the fate of a cell.
 |
MATERIALS AND METHODS |
Primary rat cortical oligodendrocyte culture
Primary oligodendrocyte cultures were obtained as described
previously (Yoon et al., 1998 ), except that the cells were subjected to
an immunopanning procedure using Ran2 antibody to remove astrocytes and
microglias after an overnight shakeoff. The purity of cultures was
determined based on staining with antibodies against galactocerebroside (O1), myelin basic protein (MBP), and glial fibrillary acidic protein
(GFAP). Staining procedures are described below. In these cultures,
47% of the cells were
O1+/MBP+,
17% were
O1+/MBP ,
28% were
O1 /MBP+,
and 6% were GFAP+. Of the
O1+ cells, 88% were
p75+, of the
MBP+ cells, 80% were
p75+, and none of the
GFAP+ cells was
p75+.
Primary mouse oligodendrocyte culture from the cortex
The p75 knock-out mice that carried the mutation in exon 3 of
the p75 gene (Lee et al., 1992 ) and the wild-type mice were obtained
from heterozygote mating as littermates. The mice were back-crossed to
C57/BL6 for 10 generations to make them congenic. Their genotype was
determined by PCR analyses of tail DNA according to the method of
Bentley and Lee (2000) . At postnatal days 16-18, the brain was
dissected, a triturated cell suspension was loaded onto a 36% Percoll
gradient, and oligodendrocytes were isolated after centrifugation at
10,000 × g according to the methods of Lubetzki et al.
(1991) and Fuss et al. (2000) . Isolated oligodendrocytes were
resuspended in 10% FBS in DMEM and plated onto
poly-D-lysine-coated four-well slide dishes at
0.1 × 106 per well. The following
day, the medium was changed to a differentiation medium with no serum
as described previously (Yoon et al., 1998 ). The culture was kept for
6 d before NGF was added at 100 ng/ml for the indicated time. In
these cultures, 40% of the cells were MBP+ and 7% were
GFAP+. Of the
MBP+ cells, 70% were
p75+; none of the
GFAP+ cells was
p75+.
Immunocytochemistry
The antibodies used for immunocytochemistry were 9651 (anti-p75;
Huber and Chao, 1995 ), O1 (a generous gift from Dr. Patrick Wood,
University of Miami, Miami, FL), anti-MBP (Roche Molecular Biochemicals, Indianapolis, IN), and anti-GFAP (Sigma, St. Louis, MO).
For double staining of mouse oligodendrocytes for p75 and MBP, mouse
oligodendrocytes were first stained live for p75 by incubating them for
1 hr at room temperature with 9651. To visualize the p75 stain, cells
were washed twice with the serum-free media and incubated at 37°C for
1 hr with Cy3-conjugated anti-rabbit secondary antibody (Jackson
ImmunoResearch, West Grove, PA). Cells were then fixed and
double-stained for MBP. MBP staining was visualized using an anti-mouse
secondary antibody conjugated to Alexa 488 (Molecular Probes, Eugene,
OR). For double staining of rat oligodendrocytes with anti-75 and MBP
or p75 and GFAP, cells were fixed and stained for p75 using 9651 without Triton X-100 and subsequently stained for MBP and GFAP after
permeabilization with Triton X-100. For double staining of rat
oligodendrocytes with O1 and p75, cells were stained live for O1 first,
fixed, and stained for p75.
Generation of recombinant adenoviruses
Dominant negative JNK2 virus. The cDNA for a dominant
negative (DN) mutant of JNK2 was isolated from SR 3-DN-JNK2 by
digesting it with HindIII and SmaI and subcloned
into a Track cytomegalovirus (CMV) shuttle vector (He et al., 1998 )
that was digested with HindIII and EcoRV. The
DN-JNK2 mutant contains two point mutations, T183A and Y185F (Kallunki
et al., 1994 ). The recombinant adenovirus construct was generated in
RecA+ bacteria using Track CMV-DN-JNK2 and
pAdEasy 1 according to the method of He et al. (1998) . The virus was
subsequently generated in 293 cells by transfection and further
purified using two rounds of CsCl centrifugation. The CsCl present in
the virus preparation was removed by dialysis.
DN-p75 virus. The construct comprises two domains: the
extracellular and transmembrane (TM) domains are from rat p75, and the
cytoplasmic domain is from human epidermal growth factor (EGF) receptor
that was rendered kinase-dead. To join the two chimeric domains
in-frame without altering any amino acid residues, a BstBI site was introduced at the junction between the p75 and EGF receptors. Introduction of the BstBI site results in the silent
mutation of phenylalanine, the last amino acid in the p75 TM domain
(TTC to TTT). The extracellular and TM domains of p75 were isolated by
PCR using pcDNA3 hemagglutinin (HA)-p75 as a template (Khursigara et
al., 1999 ). The sequence for the forward primer was
GGGGTACCACCATGTCTGCACTTCTGATC, and the sequence for the reverse primer
was gcttcgaAAAGCAATATAGGCCAC (the underline represents the
silent phenylalanine mutation, and the sequences in uppercase letters
represent those in rat p75). The PCR fragment was first cloned into
pCRII vector to generate pCRII-p75Ext/TM
(Invitrogen, Carlsbad, CA) and sequenced in its entirety for any
errors. The cytoplasmic domain of the human EGF receptor was isolated
by PCR using the pCMV5-EGF receptor as a template (Yoon et al., 1997 ).
The sequence for the forward primer was
agcgttCGAAGGCGCCACATC, and the sequence for the reverse
primer was tcaTGCTCCAATAAATTCACT (the underline represents
the BstBI site, and the sequence in italics represents the
stop codon introduced at the 3' end). The PCR fragment was first cloned
into pT7Blue 3 (Novagen, Madison, WI) and later mutated at the ATP
binding site (Lys to Phe) using primers
CCCGTCGCTATCGCGGAATTAAGAGAA and
TTCTCTTAATTCCGCGATAGCGACGGG (the underline represents the
Lys-to-Ala mutation: AAG to GCG). The fragment was sequenced in its
entirety for the presence of point mutations and for any PCR errors. To
join the two domains, the cytoplasmic domain of the kinase-dead EGF
receptor was first cut with XhoI, blunted with T4 DNA
polymerase, and subsequently digested with BstBI. The
digested fragment was ligated into the BstBI and
EcoRV sites in the
pCRII-p75Ext/TM. The resulting chimeric
molecule has GCT TTT CGA AGC at the junction (the underline represents the silent mutation, and the italics represent the sequences from the EGF receptor). The chimera was cloned
into the Track CMV shuttle vector using KpnI and
HindIII sites. The virus was generated as described for the
DN-JNK2.
N17Rac1 virus. The fragment containing human Rac1 was
prepared by PCR using SR -N17Rac1 as a template. The PCR fragment was cloned into the pCRII vector (Invitrogen) and sequenced in its entirety
for the presence of a point mutation (The to Asn) and for any PCR
errors. The confirmed N17Rac1 was digested with XhoI and
HindIII and introduced to the SalI and
HindIII sites in the Track CMV vector. The recombinant
adenovirus was generated as described for the DN-JNK2 virus.
Adenovirus infection
Mature oligodendrocytes were infected with recombinant
adenoviruses at 100-150 pfu/cell. After 18-24 hr of infection, cells were treated with NGF for 4 hr, and lysates were prepared for immunoprecipitation/kinase (IP/K) assays and Western blot analyses as
described below.
Quantification of apoptotic oligodendrocytes
Rat oligodendrocytes. After a 4 hr NGF treatment,
cells were fixed with 3% paraformaldehyde, stained for terminal
deoxynucleotidyl transferase-mediated biotinylated UTP nick end
labeling (TUNEL; tetra-methyl rhodamine red; Roche Molecular
Biochemicals) and mounted with Vectashield containing
4,6-diamidino-2-phenylindole (DAPI) to label the nuclei (Vector
Laboratories, Burlingame, CA). Cells expressing the mutant genes were
identified by green fluorescent protein (GFP), because all the
recombinant adenoviruses express GFP as well as the mutant genes. The
apoptotic oligodendrocytes were quantified by counting
TUNEL+ cells among
GFP+ oligodendrocytes. The quantitation
data are from two to four independent experiments, each with 200-300
cells counted for a total of 400-1200 cells.
Mouse oligodendrocytes. At indicated times after NGF
treatment, cells were fixed and incubated with anti-MBP antibody. Cells were then stained for TUNEL and processed for visualization of MBP
stain using an anti-mouse secondary antibody conjugated to Alexa 488 (Molecular Probes). For quantification of apoptotic cells after BDNF
and NT3 treatment, the number of pyknotic cells among
MBP+ cells was quantified. The
quantitation data are from two to six independent experiments, each
with 100-200 cells counted for a total of 200-1200 cells.
Immunoprecipitation
To detect the active form of TrkB and TrkC, oligodendrocytes
were untreated or treated with BDNF or NT3 for 5 min, and the resulting
lysates (1 mg) were subjected to immunoprecipitation using pan-Trk
antibody (C14 and B3; Santa Cruz Biotechnologies, Santa Cruz, CA). The
active forms of the receptors were detected using phospho-Trk-Y490
antibody (Cell Signaling Technology, Beverly, MA).
JNK kinase assay and Western blot analyses
The procedures for IP/K assays were identical to those described
previously (Yoon et al., 1998 ). For IP/K assays with JNK2 and JNK3
antibodies 100-300 µg and for JNK1 antibodies 25-50 µg of lysates
were used. For solid-phase kinase assays, bacterial cell lysates
containing glutathione S-transferase (GST)-c-jun were first bound to glutathione beads in 50 mM
NaCl, 5 mM MgCl2, 0.1 mM EDTA, 0.05% Triton X-100, and 20 mM HEPES, pH 8.0. After three washes of the beads
in the binding buffer, oligodendrocyte lysates were added for a 2 hr
binding at 4°C. This step was to bring down active JNKs that are
known to bind its substrates (Derijard et al., 1994 ). The subsequent
kinase reaction was the same as described previously (Yoon et al.,
1998 ).
Western blot analyses were identical to what was described previously
(Yoon et al., 1998 )
Immunodepletion
The oligodendrocyte lysates were subjected to
immunoprecipitation reactions twice using Affigel beads that were
conjugated with anti-JNK1 (G151; PharMingen, San Diego, CA) and JNK2
antibodies (Santa Cruz Biotechnologies). To confirm the extent of
depletion, ~5 ng of 35S-labeled JNK1 and
~5 ng of 35S-labeled JNK2 proteins were
added to the oligodendrocyte lysates as tracers before immunodepletion.
After immunodepletion, 10% of the total depleted or undepleted lysates
were analyzed for the presence or absence of
35S-labeled JNK1 and JNK2. The rest of the
lysates were used for the solid-phase kinase assays.
In vitro translation of JNK1 and 2 proteins
The cDNAs of JNK1 and 2 were prepared by PCR and cloned into
pCRII vector (Invitrogen) and subsequently sequenced in their entirety
for any PCR errors. The JNK1 and 2 proteins were synthesized in
vitro in the presence of
[35S]methionine using the T7
transcription- and translation-coupled system (Promega, Madison, WI).
The amount of each protein synthesized was estimated to be ~200
ng/reaction at a 90% incorporation rate. As a tracer in
immunodepletion, ~5 ng of each protein was added to the
oligodendrocyte lysates.
Rac activity assay
For samples loaded with GDP or GTP S as specificity
controls, lysates were incubated at 30°C for 15 min with either 100 µM GTP S or 1 mM GDP in the presence of 10 mM EDTA. Samples were then placed on ice, and
MgCl2 was added to a final concentration of 60 mM. GST-p21 binding domain (PBD)-Sepharose beads were added to the samples and rotated for 30 min at 4°C. The beads were washed, and Rac protein was detected using anti-Rac1 antibody (Upstate Biotechnology, Lake Placid, NY) as described previously (Benard et al.,
1999 ).
For Rac activity assays using oligodendrocyte lysates, oligodendrocytes
were either untreated or treated with neurotrophins at 100 ng/ml for 5 min and 1 and 4 hr. Dishes were then placed on ice, and cells were
washed once with ice-cold PBS. After removal of PBS, cells were lysed
in a lysis buffer, containing 25 mM HEPES, pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 10% glycerol, 1% NP-40, 0.25% sodium
deoxycholate, 1 mM sodium orthovanadate, 25 mM
NaF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 2 mM
PMSF. Lysates were rotated for 5 min at 4°C and clarified by
centrifugation at 14,000 rpm for 5 min at 4°C. Ten percent of the
supernatant of each sample was saved for Western blot analysis as a
control for the total Rac protein using anti-Rac1 antibody (Upstate
Biotechnology), whereas the remainder was incubated with ~30 µg of
GST-PBD bound to glutathione-Sepharose beads. Lysates were rotated with
beads for 1 hr at 4°C and washed three times with lysis buffer. Bound Rac-GTP protein was detected by Western blot analysis using anti-Rac1 antibody (Upstate Biotechnology).
Affinity cross-linking
Affinity cross-linking was performed as described using
125I-NT3 as the ligand (Yoon et al.,
1996 ), except that the full-length p75-NT3 complex was
immunoprecipitated with 9992, an anti-p75 antibody, and the mutant
p75-NT3 was immunoprecipitated with anti-HA antibody.
 |
RESULTS |
p75 protein is required for NGF-dependent apoptosis
in oligodendrocytes
We asked whether oligodendrocytes undergo apoptosis in the absence
of p75. For this, cortical oligodendrocytes were prepared from 16- to
18-d-old p75 knock-out mice and their wild-type littermates, and the
responses of each to NGF were assessed. It should be stressed here that
mouse oligodendrocytes were isolated by Percoll gradient immediately
after dissection (Lubetzki et al., 1991 ; Fuss et al., 2000 ) and
cultured in differentiation medium for 6 d before the analyses.
This procedure differs from rat cultures, which are prepared by the
shake-off method developed by McCarthy and de Vellis (1980) . In the
shake-off method, oligodendrocytes are expanded as a mixed culture
during an 8-9 d incubation period, before they are isolated from
astrocytes and microglia, and allowed to differentiate for 5-7 d. As
shown in Figure 1A,
MBP+ mouse oligodendrocytes express p75 in
culture as do their rat counterparts. By the sixth day in culture, the
proportion of MBP+ cells reached ~40%,
and the proportion of p75-expressing cells reached ~70% among
MBP+ cells. NGF induced apoptosis in these
cultures based on TUNEL assays, the extent of which increased from
8-9% at 4 hr after NGF to 32-34% at 48 hr after NGF (Fig. 1C). In
the knock-out mouse cultures, there was no increase in the number of
TUNEL+ cells for the entire 48 hr period
of NGF treatment (Fig. 1C). A representative picture of
apoptotic cells bearing pyknotic nuclei is shown in Figure
1B. These data therefore indicate that NGF-dependent death of oligodendrocytes requires the p75 protein.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
Oligodendrocytes from p75 null mice fail to die
after NGF treatment. A, Mouse oligodendrocytes express
p75 in culture, as do their rat counterparts. A representative picture
shows a mouse oligodendrocyte culture taken from the wild-type mice at
postnatal day 16 cortex. p75 expression on the cell surface was
detected using 9651 anti-p75 antibody (red), and
oligodendrocytes were identified by MBP stain
(green). Scale bar, 8 µm. B,
Oligodendrocytes fail to die in the absence of p75 when NGF is added.
At 4-6 d after plating, mouse oligodendrocytes were treated with 100 ng/ml of NGF for 4 hr, fixed, and stained for MBP. Pyknotic cells among
the MBP+ cells are indicated by
arrows and also shown at higher magnification in the
inset. Scale bar, 20 µm. C,
Quantification of TUNEL+ cells among
MBP+ cells. The quantitation data are from two to
four independent experiments, each with 100-150 cells counted for a
total of 200-600 cells. WT, Wild-type;
KO, knock-out.
|
|
The ability to activate the JNK pathway is required for
p75-mediated apoptosis in rat oligodendrocytes
NGF-dependent apoptosis in primary rat oligodendrocytes was
inhibited when a p75-blocking antibody was used, suggesting that the
apoptosis was mediated by NGF binding to p75 (Casaccia-Bonnefil et al.,
1996 ). To further confirm that the apoptosis was indeed attributable to
the action of p75, we sought to inhibit the signaling capacity of
endogenous p75 using a mutant p75 that lacks its cytoplasmic signaling
domain in adenovirus. The mutant p75 contains the extracellular and
transmembrane domains of rat p75, but its cytoplasmic domain was
replaced with that of the human EGF receptor (Fig.
2A). The cytoplasmic
domain of the EGF receptor was rendered inactive in its tyrosine kinase
function by mutating its ATP-binding lysine residue to alanine. We
expected the resulting construct to compete effectively for binding to
NGF against the endogenous p75 but be incapable of its own signaling.
To facilitate the detection of the chimeric receptor, an HA tag was
placed at the N terminus of rat p75 cDNA after the signal peptide
sequence (Khursigara et al., 1999 ). Because the adenovirus contains GFP
under a separate promoter (Fig. 2A), all the infected
cells also express GFP as well as the mutant p75 receptor (Fig.
2E).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 2.
The signaling ability of p75 is required for
NGF-dependent apoptosis in oligodendrocytes. A,
Schematic diagram of the mutant-p75 lacking the cytoplasmic domain. The
cytoplasmic domain of this mutant receptor was replaced with the
corresponding domain of the kinase-dead EGF receptor. The
arrows indicate two independent CMV promoters, one
directing expression of the mutant p75 and the other directing the
expression of GFP. All the adenoviruses used in this study coexpress
GFP. B, The mutant p75 binds 125I-NT3. Cos
cells were infected with the full-length (FL) p75 or the
mutant (Mut) p75 adenovirus and subjected to
cross-linking with 125I-NT3. PC12 cells were used as a
positive control (lane 1), and uninfected Cos cells were
used as a negative control (lane 2). The FL-p75 was
immunoprecipitated with 9992 antibody (lane 3), and the
mutant p75 was immunoprecipitated with HA antibody (lane
4). C, The mutant p75 protects
oligodendrocytes from NGF-dependent apoptosis. Oligodendrocytes were
infected with GFP control or the mutant p75 adenovirus in four-well
slide dishes for 24 hr at 150 pfu/cell. After 4 hr of NGF treatment,
cells were stained for TUNEL. The number of TUNEL+
cells was determined among GFP+ cells. The
quantitation data are from three to five independent experiments, each
with 200-300 cells counted for a total of 600-1500 cells.
D, The mutant-p75 inhibits JNK activation in
oligodendrocytes. Twenty-four hours after infection with the viruses,
oligodendrocytes were treated with NGF at 100 ng/ml for 4 hr. The
changes in JNK activity were measured by solid-phase kinase assays. The
presence of the mutant-p75 was detected with anti-HA antibody, and the
presence of the JNK protein was detected with anti-JNK antibody.
E, Representative picture of oligodendrocytes quantified
after infection with adenoviruses and NGF treatment. The cells
expressing the mutant p75 were identified by GFP fluorescence, because
the virus also expresses GFP as well as the mutant p75 cDNA. The
arrows indicate the TUNEL+ cells
among GFP+ cells. Scale bars, 20 µm.
EGFR-kin , A kinase-dead EGF receptor;
Ext, extracellular domain.
|
|
The mutant receptor was first tested for surface expression and its
ability to bind neurotrophins in affinity cross-linking experiments
using 125I-NT3 (Fig.
2B). 125I-NT3 was chosen
instead of 125I-NGF, because NT3 is more
resistant than NGF to degradation after iodination. The mutant p75
yielded an NT3-receptor complex of ~130 kDa in molecular weight,
consistent with the increase in its size in chimeric form. This result
suggests that the mutant p75 is expressed on the cell surface and binds
neurotrophins as efficiently as the full-length p75.
The mutant p75 receptor was then introduced via infection into rat
oligodendrocytes, and its effect on NGF-dependent apoptosis was
assessed. The control cultures were infected with the GFP adenovirus.
Twenty-four hours after infection, cells were treated with NGF for 4 hr
at 100 ng/ml, and the extent of apoptosis was measured by counting the
number of TUNEL+ oligodendrocytes among
GFP+ infected cells. A representative
picture is shown in Figure 2E. In cultures infected
with the control GFP virus, the proportion of
TUNEL+ cells increased sixfold to
eightfold after a 4 hr NGF treatment. In the presence of the mutant
p75, however, the number of TUNEL+
oligodendrocytes remained at the basal level of 3-4%, (Fig.
2C). This result suggests that the mutant p75 receptor
inhibited the action of endogenous p75 in rat oligodendrocytes.
We have reported previously that inhibition of JNK activity by
CEP-1347 resulted in rescue of rat oligodendrocytes from
NGF-dependent apoptosis (Yoon et al., 1998 ). Because the mutant p75
receptor blocked NGF-dependent apoptosis, we asked whether the JNK
activity was altered in the presence of the mutant p75. For this, cells were infected for 24 hr either with the control GFP or the mutant p75
receptor adenovirus, and the resulting lysates were subjected to a
solid-phase JNK kinase assay to measure the total JNK activation (Derijard et al., 1994 ) (Fig. 2D). In control
cultures, NGF addition led to an increase in total JNK activity,
whereas activation of JNK was no longer observed in the presence of the
mutant p75 (Fig. 2D). These data therefore indicate
that not only the binding of p75 to NGF but also the ability of p75 to
signal and activate JNK is necessary for its action in inducing
apoptosis in oligodendrocytes.
p75 activates JNK1 and 3 in oligodendrocytes
JNK activity has been shown to increase as PC12 cells
differentiate (Eilers et al., 1998 ) and to remain elevated after
axotomy of adult dorsal root ganglion neurons (Kenney and Kocsis,
1998 ). Similarly, cerebellar granule neurons exhibit a high basal level of JNK activity (Coffey et al., 2000 ). These data suggest that JNK
activity may be involved in axonal outgrowth or regeneration. In
contrast, JNK activities have also been linked to apoptosis of a
variety of neurons. The death of motor and sympathetic neurons as well
as PC12 cells was prevented when JNK activity was inhibited (Xia et
al., 1995 ; Eilers et al., 1998 ; Maroney et al., 1998 , 1999 ).
This apparent dichotomy may be attributable to distinct actions among
different JNK isoforms. An example is found in a recent report in which
only JNK3, and not JNK1 or 2, was implicated in arsenite-induced
apoptosis (Namgung and Xia, 2000 ). We therefore sought to identify the
types of JNK activated by p75 in oligodendrocytes, which undergo
apoptosis in an NGF-dependent manner. To address this question, the
specificity of various JNK antibodies was first tested in 293 cells.
293 cells were transfected with HA-tagged JNK1 or 2 or Flag-tagged 3, and these JNK proteins were immunoprecipitated with commercial
antibodies against JNK1-3. The presence of each transfected JNK
protein in the immunoprecipitates was later detected using either HA or
Flag antibodies in Western blot analyses. The JNK3 antibody (Upstate
Biotechnology) immunoprecipitated both JNK1 and 3 efficiently (Fig.
3A). JNK2 antibody (Santa Cruz
Biotechnologies) immunoprecipitated JNK1 and 2 but not JNK3. For JNK1,
we tested two different antibodies, C17 polyclonal (Santa Cruz
Biotechnologies) and G151 monoclonal antibodies (PharMingen). The C17
JNK1 antibody brought down JNK1 and 3 but not JNK2, and the G151 JNK1
antibody immunoprecipitated JNK1 and 2 but not JNK3. These results are tabulated in Figure 3B.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3.
p75 activates JNK1 and 3. A,
Specificity of antibodies used in IP/K assays. 293 cells were
transfected with HA-JNK1, HA-JNK2, or Flag-JNK3 cDNAs. The lysates from
each transfected dish were subjected to immunoprecipitation reactions
using anti-JNK1 (C17, polyclonal; Santa Cruz Biotechnologies),
anti-JNK1 (G151, monoclonal; PharMingen), anti-JNK2 (Santa Cruz
Biotechnologies), and anti-JNK3 (Upstate Biotechnology) antibodies. The
immunoprecipitated proteins were detected using either anti-HA (JNK1
and 2) or anti-Flag (JNK3) antibody. B, Summary of the
data presented in Figure 4. C, The lysates from
rat oligodendrocytes were subjected to IP/K assays using the four
antibodies. p75 activates JNK1, based on C17 and G151 antibodies, and
JNK3, based on C17 and JNK3 antibodies.
|
|
Each of these antibodies was then used in IP/K assays using lysates
from oligodendrocytes that were treated with NGF for 4 hr at 100 ng/ml
(Fig. 3C). p75 activated JNK1 based on G151 and C17 antibody
data, but it did not activate JNK2 robustly. There appeared to be
activation of JNK3 by p75 based on anti-JNK3 data, but the data were
not conclusive, because JNK3 antibody detected both JNK1 and 3 efficiently (Fig. 3A). We therefore performed immunodepletion with oligodendrocyte lysates using the G151 JNK1 antibody and tested whether p75 still activated JNK on NGF treatment. To monitor the extent of depletion,
35S-JNK1 and 2 were added to the lysates
as tracers before depletion. As shown in the Figure
4, top panel, there was robust
JNK activation after depletion of JNK1 and 2 from oligodendrocyte
extracts. On the basis of the tracers, there was very little JNK1 and 2 protein left after depletion (Fig. 4, bottom panel),
suggesting that the JNK activation observed after immunodepletion
represents activation of JNK3. We therefore conclude that p75 activates
JNK1 and 3 in oligodendrocytes.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 4.
p75 activates JNK3 after depletion of JNK1 and 2. The oligodendrocyte lysates were subjected to immunodepletion to remove
JNK1 and 2 using JNK1 and 2 antibodies. The depleted lysates were used
in solid-phase kinase assays (top panel). The
efficiency of immunodepletion is shown in the bottom
panel. The extent of immunodepletion of JNK1 and 2 proteins was
determined using 35S-JNK1 and JNK2 that were added together
as a tracer to the oligodendrocyte lysates.
|
|
Activation of JNK is required for p75-mediated apoptosis
We have previously used an inhibitor of the JNK pathway, CEP-1347,
to demonstrate that JNK activity was necessary for the death of
oligodendrocytes (Yoon et al., 1998 ). Similarly, the mutant p75
receptor that is incapable of signaling via the JNK pathway inhibited
NGF-dependent apoptosis in oligodendrocytes. With CEP-1347, however,
the possibility exists that the drug may have affected other pathways
that were not measured. With the mutant p75, it is also likely that
another pathway that is required for survival, such as the
NF- B pathway, was concurrently blocked. Therefore, we tested
whether direct inhibition of endogenous JNK could lead to suppression
of p75-mediated apoptosis by introducing a DN JNK into
oligodendrocytes. Because there is >70% sequence homology among the
three JNK isoforms, it is likely that a DN mutant of one isoform will
inhibit all three isoforms. We chose DN-JNK2 because it is regulated
similarly to the other JNKs but has a higher affinity to
c-jun than JNK1, and JNK2 activates the c-jun
promoter, whereas JNK1 does not (Kallunki et al., 1994 ). The DN mutant
contains two point mutations, T183A and Y185F, at the phosphorylation
sites that are required for its activity (Kallunki et al., 1994 ).
The DN-JNK2 virus was first tested for its action against JNK1 and 3 as
well as for the total JNK activity in rat primary oligodendrocytes by
infecting the cells with either the GFP control or the DN-JNK2 virus.
Twenty-four hours after infection, cells were treated with NGF for 4 hr
at 100 ng/ml, and the lysates were subjected to a solid-phase JNK assay
to measure the total JNK activation (Fig.
5A, top
panel). NGF addition led to an increase in the total JNK
activity in the control GFP virus-infected cells, whereas there was no
increase in the DN-JNK2-infected cells. The DN-JNK2 was also effective
against individual JNK1 and JNK3, as demonstrated in IP/K assays, using
either JNK1 or JNK3 antibodies (Fig. 5A, middle
panels). These results confirm that the mutant JNK2 was effective
in inhibiting NGF-dependent JNK activation.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 5.
JNK activation is necessary for NGF-dependent
apoptosis in oligodendrocytes. A, DN-JNK2 inhibits
NGF-dependent activation of JNK in oligodendrocytes. Oligodendrocytes
were infected with GFP control or DN-JNK2 adenovirus for 24 hr at 150 pfu/cell. Infected cells were untreated or treated with NGF for 4 hr,
and the lysates were subjected to solid-phase kinase as well as IP/K
assays. The presence of DN-JNK2 is shown in an HA Western blot, and the
JNK protein is shown in a JNK Western blot. B, DN-JNK2
rescues oligodendrocytes from NGF-mediated apoptosis. The
quantification procedure was identical to what was described in the
legend of Figure 2.
|
|
To test whether the DN-JNK2 could rescue the death of oligodendrocytes,
cell viability was determined by counting the number of
TUNEL+ cells among the
GFP+ oligodendrocytes. When NGF was added
at 100 ng/ml for 4 hr, the number of
TUNEL+ cells among
GFP+ oligodendrocytes increased fourfold
to fivefold in the GFP virus-infected cells, whereas it did
not increase in the DN-JNK2 virus-infected cells (Fig. 5B).
Therefore, these results together with the data from CEP-1347 and the
data with the mutant p75 receptor indicate that JNK activation is
indeed necessary for NGF-dependent apoptosis in oligodendrocytes.
Rac1 is an upstream regulator in p75-mediated
JNK activation
p75 has been shown to activate the JNK pathway in several cell
types other than oligodendrocytes. These include superior cervical ganglion (SCG) neurons (Bamji et al., 1998 ) and the Schwannoma cell
line (Gentry et al., 2000 ). In SCG neurons (Mazzoni et al., 1999 ) and
oligodendrocytes (Fig. 5), JNK activation is causally linked to
p75-mediated apoptosis. The observation that p75 activates JNK in
several different systems may imply that JNK activation by p75 is a
central feature in p75 signaling. The mechanism by which p75 activates
JNK is still unknown. Although nine different molecules are known to
interact with p75 to date, none of them has been linked to the JNK
pathway (Casademunt et al., 1999 ; Chittka and Chao, 1999 ; Irie et al.,
1999 ; Khursigara et al., 1999 ; Yamashita et al., 1999 ; Ye et al., 1999 ;
Salehi et al., 2000 ). We therefore sought to find an upstream regulator
that may be most proximal to the receptor. A candidate molecule is Rac,
a GTPase belonging to the Rho family of small G-proteins. Rac has been
shown to function as the upstream regulator in the JNK pathway in cell
lines as well as in neurons (Coso et al., 1995 ; Minden et al.,
1995 ; Bazenet et al., 1998 ). In addition, p75 was recently reported to
interact with another member of the Rho family of small G-proteins,
RhoA (Yamashita et al., 1999 ). Binding of p75 to NGF led to suppression of Rho activity in 293 cells (Yamashita et al., 1999 ).
We first tested whether p75 modulates Rac activity in oligodendrocytes
in an NGF-dependent manner, using the GST-PBD of PAK 1. PAK 1 binds Rac only when Rac is bound to GTP via PBD. The activated,
GTP-bound Rac can then be detected in Western blot analyses after
pull-down assays using the GST-PBD (Benard et al., 1999 ). The
specificity of this assay was tested using the unhydrolyzable GTP
analog GTP- S or GDP. As shown in Figure
6A, the GST-PBD pulled down only the GTP- S-bound Rac and not the GDP-bound Rac. Using the
assay, we examined whether p75 can modulate Rac activity in oligodendrocytes. In oligodendrocytes, NGF induced Rac activation starting 5 min after NGF addition at 100 ng/ml, and its activation lasted for 4 hr after NGF treatment (Fig. 6B). In
contrast to NGF, BDNF failed to activate Rac, whereas NT3 addition led
to transient activation of Rac. We next asked whether the different temporal pattern of activation of Rac observed with the different neurotrophins correlates with their ability to activate JNK. NGF addition led to robust JNK activation starting 1 hr after NGF, lasting
up to 4 hr, whereas BDNF did not during a 4 hr treatment (Fig.
7A). There was a small
increase in JNK activity after a 4 hr NT3 treatment, but this
activation was not sufficient to lead to apoptosis, because only NGF
could induce apoptosis in oligodendrocytes, whereas BDNF or NT3 could
not (Fig. 7B). These results suggest that prolonged Rac
activation by p75 may be one of the key steps required for
NGF-dependent apoptosis.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 6.
p75 activates Rac1 in an NGF-dependent manner.
A, Specificity of the pull-down Rac assay. The lysates
from 293 cells were incubated with either 1 mM GDP or 0.1 mM GTP S and subjected to a pull-down assay using
GST-PBD. The bound Rac protein was detected in a Western blot analysis
with anti-Rac1 antibody. B, NGF addition led to a
prolonged activation of Rac1 in oligodendrocytes. Oligodendrocytes were
treated for the indicated time with NGF, BDNF, or NT3 at 100 ng/ml. The
lysates were subjected to Rac activity assays. Note that BDNF does not
activate Rac1, whereas NT3 activates it transiently.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Figure 7.
Trk activation intercepts p75-mediated JNK
activity at or upstream of Rac GTPase. A, Temporal
course of JNK activation by neurotrophins. Rat oligodendrocytes were
treated with neurotrophins for the indicated time at 100 ng/ml. The
lysates were subjected to solid-phase kinase assays. B,
Only NGF is capable of inducing cell death among oligodendrocytes.
Mouse oligodendrocytes were treated with 100 ng/ml NGF, BDNF, or NT3
for 4-5 hr, and the number of pyknotic cells was counted among
MBP+ cells. The quantitation data are from three
independent experiments, each with 100-200 cells counted for a total
of 300-600 cells. C, Rat oligodendrocytes express TrkB
and TrkC. Rat oligodendrocytes were untreated or treated with 100 ng/ml
BDNF or NT3 for 5 min. The activated receptors were detected using
phospho-TrkY490 antibody. Active TrkA from PC12 cells was used as a
positive control (lanes 4, 5).
|
|
It was reported recently that NGF induced Rac activation in PC12 cells
(Yamaguchi et al., 2001 ; Yasui et al., 2001 ). In those studies, Rac
activation subsided 3 min after NGF treatment. These results suggest
that in rat oligodendrocyte cultures, transience or absence of Rac
activation, with NT3 or BDNF, respectively, is attributable to
concomitant activation of resident TrkB and TrkC. The rat
oligodendrocytes expressed TrkB and TrkC, because BDNF and NT3
treatment resulted in tyrosine phosphorylation of the receptors, based
on Western blot analyses with the phospho-TrkY490 antibody (Fig.
7C). We have reported previously that coactivation of TrkA
and p75 after introduction of ectopic TrkA into rat oligodendrocytes led to suppression of JNK (Yoon et al., 1998 ). Our data here with BDNF
and NT3, in addition to the reports by Yasui et al. (2001) and
Yamaguchi et al. (2001) , indicate that one of the key points where Trk
activation intercepts p75 signaling is at or upstream of Rac.
Because temporal activation of Rac correlated with cell death in
oligodendrocytes, we next investigated whether Rac activation was
required for NGF-dependent apoptosis. For this purpose, we generated an
adenovirus carrying the cDNA for the DN-Rac1. The DN-Rac1 contains a
mutation at residue 17 (threonine to asparagine). After infection with
either GFP or the DN-Rac1 virus, cell viability was determined by
counting the number of TUNEL+ cells among
the GFP+ oligodendrocytes after a 4 hr NGF
treatment at 100 ng/ml. In the presence of the DN-Rac1, the number of
apoptotic oligodendrocytes was reduced compared with the control GFP
virus-infected cells after NGF treatment (Fig.
8A). To test whether
Rac activation was required for NGF-dependent JNK activity, the lysates
from either GFP or the DN-Rac1 virus-infected cultures were subjected to solid-phase kinase assays. In oligodendrocytes infected with the
control GFP virus, there was activation of JNK on NGF addition, but in
cells infected with DN-Rac1, JNK activation was no longer observed
(Fig. 8B). These data, therefore, indicate that p75
uses Rac1 to activate JNK, and Rac activation is an obligatory step in
the NGF-dependent apoptotic machinery activated by p75. This Rac
activation is under competitive regulation by Trk signaling, thereby
governing cell survival and death.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 8.
Rac1 is the upstream regulator of the p75-mediated
JNK pathway. A, DN-Rac1 protects oligodendrocytes from
NGF-dependent apoptosis. The procedure is identical to the one
described in the legend of Figure 2. B, DN-Rac1 inhibits
NGF-dependent JNK activation. Oligodendrocytes were infected with
either GFP or DN-Rac1 for 24 hr and either left untreated or treated
with 100 ng/ml NGF for 4 hr. The resulting lysates were used in
solid-phase kinase assays.
|
|
 |
DISCUSSION |
In this report, we present the data that p75 activates Rac GTPase
in an NGF-dependent manner. This Rac activation is causally linked to
apoptotic action by p75, because N17Rac1 inhibits NGF-dependent JNK
activation, which in turn leads to suppression of apoptosis. Coactivation of Trk modulates p75-mediated Rac activation, thereby identifying Rac GTPase as one of the key molecules whose activity is
critical for cell survival and death in neurotrophin signaling. The
crucial role of the JNK pathway in p75 signaling is further confirmed
by the fact that blocking p75 from signaling via the JNK pathway or
suppressing the JNK activity itself led to inhibition of NGF-dependent
death. We also report that p75 activates JNK3, an injury-specific JNK,
in a system in which it induces apoptosis.
p75 is required for NGF-dependent death of oligodendrocytes
in culture
We demonstrate here that mouse oligodendrocytes expressed p75 as
early as the second day in culture, and they did not die in the absence
of p75 when NGF was added (Fig. 1). In addition, blocking the signaling
ability of p75 in rat oligodendrocytes also resulted in reversal of the
death effect of NGF (Fig. 2). These results directly confirm the
apoptotic role of p75 in oligodendrocytes. It is not clear, however,
whether p75 plays a similar role in oligodendrocyte biology in
vivo. The current literature strongly indicates that p75 is
induced among oligodendrocytes by an injury or disease state. For
instance, in the white matter plaques of multiple sclerosis (MS)
patients, p75 was induced among oligodendrocytes and their precursors
(Dowling et al., 1999 ; Chang et al., 2000 ). Direct infliction of
injuries to the white matter in the cortex and the spinal cord can also
induce p75 expression among oligodendrocytes (S. O. Yoon, J. Bresnahan, and M. Beattie, unpublished data). This correlation between
p75 expression in vitro and in vivo suggests that
culture conditions can model injury or stress situations these cells
encounter in vivo. Our data demonstrating that p75 activates
an injury-specific JNK3 in cultured oligodendrocytes also support this
notion (Fig. 4).
What is the consequence of p75 induction in an injury or a disease
state? On the basis of our culture data, one might suggest that p75
plays a proapoptotic role, perhaps serving to eliminate diseased cell
populations. In support of this notion, Dowling et al. (1999) reported
that 47% of TUNEL-positive oligodendrocytes expressed p75 in MS
lesions. Contrary to these data, Chang et al. (2000) found no
TUNEL-positive cells among NG2+
oligodendrocyte precursors in MS lesions. These data may be interpreted as indicating that p75 plays an opposing, antiapoptotic role in developing oligodendrocytes when the greater population is injured and
in this way may contribute to regeneration. Alternatively, p75 may
still be involved in inducing apoptosis in
NG2+ oligodendrocytes, but its expression
is not sufficient to induce apoptosis. It is quite possible that
induction of p75 is one of many factors required for these cells to
undergo apoptosis but not sufficient to induce death in
vivo. In support of this notion, Ladiwala et al. (1998) reported
that although human oligodendrocytes do express p75 in culture, they
failed to die when NGF was added. NGF did not induce the JNK pathway in
human oligodendrocytes, indicating that some component of the
p75-mediated JNK signaling pathway is not present in these cells, or
its activation was somehow inhibited. Analyses of p75 knock-out mice in
an injury or disease paradigm will help answer the question of whether
the induced expression of p75 among oligodendrocytes in vivo
presages their fate as it does in culture.
P75 activates JNK1 and JNK3
Our results demonstrate that p75 activates JNK1 in addition to
JNK3, and their activation is required for NGF-dependent apoptosis. The
involvement of JNK1 in apoptosis of oligodendrocytes is different from
that revealed by the data for cortical cultures, in which JNK1 was not
implicated in arsenite-induced apoptosis (Namgung and Xia, 2000 ). In
cortical neurons, the basal level of JNK1 activity was high, suggesting
that JNK1 may be involved in differentiation (Namgung and Xia, 2000 ).
JNK activity has been shown to increase as PC12 cells or cerebellar
granule neurons differentiate, although the specific JNK isoform
responsible for this increase was not determined (Yao et al., 1997 ;
Eilers et al., 1998 ; Coffey et al., 2000 ). This dual role of JNK has
also been demonstrated in the analyses of JNK1 and 2 double-knock-out
mice. Loss of JNK1 and 2 resulted in increased apoptosis in the
forebrain region, whereas it inhibited apoptosis in the hindbrain area
during embryonic development (Kuan et al., 1999 ). In oligodendrocytes
in culture, JNK1 plays a role in inducing cell death, because total JNK
activity as well as JNK1 activity was suppressed with the mutant p75,
the DN-JNK2, and N17Rac (Figs. 2, 5, 8).
Although JNK1 and 2 may play diverse roles, it appears that the role of
JNK3 is in inducing apoptosis after injuries to the nervous system
(Yang et al., 1997 ; Namgung and Xia, 2000 ). It is highly relevant in
this regard that p75 activates an injury-specific JNK3 in a system in
which it induces cell death (Fig. 4). It is well documented in the
literature that p75 is robustly induced in neurons, Schwann cells, and
oligodendrocytes after injuries (Taniuchi et al., 1986 ; Koliatsos et
al., 1991 ; Hayes et al., 1992 ; Roux et al., 1999 ). For instance, p75
has been reported to be induced in dying neurons after a seizure (Roux
et al., 1999 ) and ischemia (Park et al., 2000 ) and in cortical neurons
after experimental allergic encephalomyelitis (Calza et al., 1997 ;
Nataf et al., 1998 ). It remains to be seen whether JNK3 activation is indeed required for p75-mediated apoptosis in vivo.
P75 activates Rac GTPase persistently
We demonstrated that p75 activates Rac GTPase in an NGF-dependent
manner (Fig. 6). These results differ from those for RhoA activity, in
which NGF binding to p75 led to suppression rather than activation
(Yamashita et al., 1999 ). The suppression of RhoA activity by p75 was
implicated in the promotion of process outgrowth in ciliary neurons
(Yamashita et al., 1999 ). In oligodendrocytes that undergo apoptosis in
an NGF-dependent manner, Rac activation is causally linked to apoptosis
(Fig. 8). As a member of the Rho family of small G-proteins, Rac plays
a role in cytoskeletal reorganization as well as being the upstream
regulator in the JNK pathway (Coso et al., 1995 ; Minden et al., 1995 ).
In NGF signaling, Rac activity is distinctly involved in activation of
the JNK pathway, as we demonstrated by the effect of DN-Rac1 in
oligodendrocytes. The dual roles for Rac have been more clearly
demonstrated by a single point mutation (tyrosine at residue 40 to
cysteine) that resulted in the loss of JNK activation but a continued
effect on cytoskeletal reorganization (Lamarche et al., 1996 ). These
results suggest that distinct effector molecules are involved in
eliciting these diverse, Rac-mediated effects, although it is not known
what regulates the process that determines whether Rac activation would
lead to cell death or to cytoskeletal reorganization.
Our data suggest that the kinetics of Rac activation may be a
determinant in this process. In oligodendrocytes, NGF induced long-term
Rac activation, lasting up to 4 hr after NGF (Fig.
6B). In PC12 cells in which NGF activated Rac
transiently (Yasui et al., 2001 ), this activation was linked to neurite
extension and differentiation, rather than cell death (Yamaguchi et
al., 2001 ). Similarly to the data from PC12 cells, NT3 activated Rac
only transiently in oligodendrocytes that expressed TrkC (Fig.
6B) and did not induce cell death (Fig.
7B). These results may be interpreted as suggesting that the
kinetics of Rac activation determine whether Rac plays a role in
apoptosis or in differentiation in neurotrophin signaling. This is
reminiscent of the data that prolonged ERK activation correlated with
differentiation, whereas transient ERK activation correlated with
proliferation in PC12 cells (Qui and Green, 1992 ). On the basis of the
correlation that we observed with NGF, between apoptosis and prolonged
Rac activation, we hypothesize that additional effector molecules may
be recruited to Rac-GTP at later points in NGF induction. Recruitment
of these effector molecules may also be responsible for the differences in temporal regulation of Rac GTPase, perhaps by providing stabilizing scaffolds.
Although NT3 activated Rac transiently and induced JNK, it did not
induce apoptosis in oligodendrocytes (Figs. 6, 7). This NT3 response in
oligodendrocytes is similar to the NGF response in PC12 cells. In PC12
cells, NGF induced JNK (Minden et al., 1994 ; Eilers et al., 1998 ) as
well as transient Rac activation (Yamaguchi et al., 2001 ; Yasui et al.,
2001 ). We interpret these data as suggesting that JNK activation may
not be sufficient to induce apoptosis in oligodendrocytes, although it
is indeed necessary, because blocking JNK activity prevented
NGF-dependent apoptosis. To induce apoptosis, p75 may need to activate
a proapoptotic pathway(s) other than the JNK pathway or to suppress an
antiapoptotic pathway(s). Alternatively, TrkC may activate a pathway
that intercepts p75 signaling downstream from JNK in oligodendrocytes.
In conclusion, we report that p75 activates Rac GTPase persistently,
and this activation is essential for p75 to induce JNK and apoptosis.
Simultaneous activation of Trk counteracts apoptotic action by p75 by
modulating the kinetics of p75-mediated Rac activation.
 |
FOOTNOTES |
Received May 1, 2001; revised Sept. 25, 2001; accepted Oct. 9, 2001.
This project was supported by grants to S.O.Y. from the American Cancer
Society, Whitehall Foundation, Ohio Cancer Research Associate,
National Alliance for Research on Schizophrenia and Depression (Maltz
Family Foundation), and National Institutes of Health (Grant RO1
NS39472-01). We thank Drs. Tong-Chuan He and Bert Vogelstein for
providing adenoviral constructs, Dr. Michael Karin for the DN-JNK2
cDNA, Dr. Audrey Minden for the N17Rac1 cDNA, Dr. Gary Bokoch
for GST-PBD, and Dr. Patrick Wood for the monoclonal line for O1. We
especially thank Dr. Lino Tessarollo for providing breeding pairs of
p75 knock-out and wild-type mice. We also thank Drs. James K. T. Wang, Bruce Carter, Pilar Perez, John Oberdick, Moses Chao, and
Pappachan Kolattukudy for providing advice and reading this manuscript.
Correspondence should be addressed to Sung Ok Yoon, Neurobiotech Center
and Department of Neuroscience, Ohio State University, 184 Rightmire
Hall, 1060 Carmack Road, Columbus, OH 43210. E-mail: yoon.84{at}osu.edu.
 |
REFERENCES |
-
Bamji SX,
Majdan M,
Pozniak CD,
Belliveau DJ,
Aloyz R,
Kohn J,
Causing CG,
Miller FD
(1998)
The p75 neurotrophin receptor mediates neuronal apoptosis and is essential for naturally occurring sympathetic neuron death.
J Cell Biol
140:911-923[Abstract/Free Full Text].
-
Bazenet CE,
Mota MA,
Rubin LL
(1998)
The small GTP-binding protein Cdc42 is required for nerve growth factor withdrawal-induced neuronal death.
Proc Natl Acad Sci USA
95:3984-3989[Abstract/Free Full Text].
-
Benard V,
Bohl BP,
Bokoch GM
(1999)
Characterization of rac and cdc42 activation in chemoattractant-stimulated human neutrophils using a novel assay for active GTPases.
J Biol Chem
274:13198-13204[Abstract/Free Full Text].
-
Bentley CA,
Lee KF
(2000)
p75 is important for axon growth, Schwann cell migration during development.
J Neurosci
20:7706-7715[Abstract/Free Full Text].
-
Brennan C,
Rivas-Plata K,
Landis SC
(1999)
The p75 neurotrophin receptor influences NT-3 responsiveness of sympathetic neurons in vivo.
Nat Neurosci
2:699-705[Web of Science][Medline].
-
Calza L,
Giardino L,
Pozza M,
Micera A,
Aloe L
(1997)
Time-course changes of nerve growth factor, corticotropin-releasing hormone, and nitric oxide synthase isoforms and their possible role in the development of inflammatory response in experimental allergic encephalomyelitis.
Proc Natl Acad Sci USA
94:3368-3373[Abstract/Free Full Text].
-
Carter BD,
Lewin GR
(1997)
Neurotrophins live or let die: does p75NTR decide?
Neuron
18:187-190[Web of Science][Medline].
-
Carter BD,
Kaltschmidt C,
Kaltschmidt B,
Offenhauser N,
Bohm-Matthaei R,
Baeuerle PA,
Barde YA
(1996)
Selective activation of NF-kappa B by nerve growth factor through the neurotrophin receptor p75 [see comments].
Science
272:542-545[Abstract].
-
Casaccia-Bonnefil P,
Carter BD,
Dobrowsky RT,
Chao MV
(1996)
Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75.
Nature
383:716-719[Medline].
-
Casademunt E,
Carter BD,
Benzel I,
Frade JM,
Dechant G,
Barde YA
(1999)
The zinc finger protein NRIF interacts with the neurotrophin receptor p75(NTR) and participates in programmed cell death.
EMBO J
18:6050-6061[Web of Science][Medline].
-
Chang A,
Nishiyama A,
Peterson J,
Prineas J,
Trapp BD
(2000)
NG2-positive oligodendrocyte progenitor cells in adult human brain, multiple sclerosis lesions.
J Neurosci
20:6404-6412[Abstract/Free Full Text].
-
Chittka A,
Chao MV
(1999)
Identification of a zinc finger protein whose subcellular distribution is regulated by serum and nerve growth factor.
Proc Natl Acad Sci USA
96:10705-10710[Abstract/Free Full Text].
-
Coffey ET,
Hongisto V,
Dickens M,
Davis RJ,
Courtney MJ
(2000)
Dual roles for c-Jun N-terminal kinase in developmental and stress responses in cerebellar granule neurons.
J Neurosci
20:7602-7613[Abstract/Free Full Text].
-
Coso OA,
Chiarielo M,
Yu J-C,
Teramoto H,
Crespo P,
Xu N,
Miki T,
Gutkind JS
(1995)
The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway.
Cell
81:1137-1146[Web of Science][Medline].
-
Dechant G,
Barde YA
(1997)
Signalling through the neurotrophin receptor p75NTR.
Curr Opin Neurobiol
7:413-418[Web of Science][Medline].
-
Derijard B,
Hibi M,
Wu I-H,
Barrett T,
Su B,
Deng T,
Karin M,
Davis R
(1994)
JNK1: a protein kinase stimulated by UV light and Ha-ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:1025-1037[Web of Science][Medline].
-
Dobrowsky RT,
Werner MH,
Castellino AM,
Chao MV,
Hannun YA
(1994)
Activation of the sphingomyelin cycle through the low-affinity neurotrophin receptor.
Science
265:1596-1599[Abstract/Free Full Text].
-
Dowling P,
Ming X,
Raval S,
Husar W,
Casaccia-Bonnefil P,
Chao M,
Cook S,
Blumberg B
(1999)
Up-regulated p75NTR neurotrophin receptor on glial cells in MS plaques [see comments].
Neurology
53:1676-1682[Abstract/Free Full Text].
-
Eilers A,
Whitfield J,
Babij C,
Rubin LL,
Ham J
(1998)
Role of the Jun kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons.
J Neurosci
18:1713-1724[Abstract/Free Full Text].
-
Fuss B,
Mallon B,
Phan T,
Ohlemeyer C,
Kirchhoff F,
Nishiyama A,
Macklin WB
(2000)
Purification and analysis of in vivo-differentiated oligodendrocytes expressing the green fluorescent protein.
Dev Biol
218:259-274[Web of Science][Medline].
-
Gentry JJ,
Casaccia-Bonnefil P,
Carter BD
(2000)
Nerve growth factor activation of nuclear factor kappaB through its p75 receptor is an anti-apoptotic signal in RN22 Schwannoma cells.
J Biol Chem
275:7558-7565[Abstract/Free Full Text].
-
Gu C,
Casaccia-Bonnefil P,
Srinivasan A,
Chao MV
(1999)
Oligodendrocyte apoptosis mediated by caspase activation.
J Neurosci
19:3043-3049[Abstract/Free Full Text].
-
Hayes RC,
Wiley RG,
Armstrong DM
(1992)
Induction of nerve growth factor receptor (p75NGFr) mRNA within hypoglossal motoneurons following axonal injury.
Brain Res Mol Brain Res
15:291-297[Medline].
-
He TC,
Zhou S,
da Costa LT,
Yu J,
Kinzler KW,
Vogelstein B
(1998)
A simplified system for generating recombinant adenoviruses.
Proc Natl Acad Sci USA
95:2509-2514[Abstract/Free Full Text].
-
Huber LJ,
Chao MV
(1995)
Mesenchymal and neuronal cell expression of the p75 neurotrophin receptor gene occur by different mechanisms.
Dev Biol
167:227-238[Web of Science][Medline].
-
Irie S,
Hachiya T,
Rabizadeh S,
Maruyama W,
Mukai J,
Li Y,
Reed JC,
Bredesen DE,
Sato TA
(1999)
Functional interaction of Fas-associated phosphatase-1 (FAP-1) with p75(NTR) and their effect on NF-kappaB activation.
FEBS Lett
460:191-198[Web of Science][Medline].
-
Kallunki T,
Su B,
Tsigelny I,
Sluss HK,
Derijard B,
Moore G,
Davis R,
Karin M
(1994)
JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation.
Genes Dev
8:2996-3007[Abstract/Free Full Text].
-
Kenney AM,
Kocsis JD
(1998)
Perpheral axotomy induces long-term c-Jun amino-terminal kinase-1 activation and activator protein-1 binding activity by c-Jun and junD in adult rat dorsal root ganglia in vivo.
J Neurosci
18:1318-1328[Abstract/Free Full Text].
-
Khursigara G,
Orlinick JR,
Chao MV
(1999)
Association of the p75 neurotrophin receptor with TRAF6.
J Biol Chem
274:2597-2600[Abstract/Free Full Text].
-
Koliatsos VE,
Crawford TO,
Price DL
(1991)
Axotomy induces nerve growth factor receptor immunoreactivity in spinal motor neurons.
Brain Res
549:297-304[Web of Science][Medline].
-
Kuan CY,
Yang DD,
Samanta Roy DR,
Davis RJ,
Rakic P,
Flavell RA
(1999)
The Jnk1 and Jnk2 protein kinases are required for regional specific apoptosis during early brain development.
Neuron
22:667-676[Web of Science][Medline].
-
Ladiwala U,
Lachance C,
Simoneau SJ,
Bhakar A,
Barker PA,
Antel JP
(1998)
p75 neurotrophin receptor expression on adult human oligodendrocytes: signaling without cell death in response to NGF.
J Neurosci
18:1297-1304[Abstract/Free Full Text].
-
Lamarche N,
Tapon N,
Stowers L,
Burbelo PD,
Aspenstrom P,
Bridges T,
Chant J,
Hall A
(1996)
Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade.
Cell
87:519-529[Web of Science][Medline].
-
Lee KF,
Li E,
Huber LJ,
Landis SC,
Sharpe AH,
Chao MV,
Jaenisch R
(1992)
Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system.
Cell
69:737-749[Web of Science][Medline].
-
Lewin GR,
Barde YA
(1996)
Physiology of the neurotrophins.
Annu Rev Neurosci
19:289-317[Web of Science][Medline].
-
Lubetzki C,
Goujet-Zalc C,
Gansmuller A,
Monge M,
Brillat A,
Zalc B
(1991)
Morphological, biochemical, and functional characterization of bulk isolated glial progenitor cells.
J Neurochem
56:671-680[Web of Science][Medline].
-
Maroney AC,
Glicksman MA,
Basma AN,
Walton KM,
Knight Jr E,
Murphy CA,
Bartlett BA,
Finn JP,
Angeles T,
Matsuda Y,
Neff NT,
Dionne CA
(1998)
Motoneuron apoptosis is blocked by CEP-1347 (KT 7515), a novel inhibitor of the JNK signaling pathway.
J Neurosci
18:104-111[Abstract/Free Full Text].
-
Maroney AC,
Finn JP,
Bozyczko-Coyne D,
O'Kane TM,
Neff NT,
Tolkovsky AM,
Park DS,
Yan CY,
Troy CM,
Greene LA
(1999)
CEP-1347 (KT7515), an inhibitor of JNK activation, rescues sympathetic neurons and neuronally differentiated PC12 cells from death evoked by three distinct insults.
J Neurochem
73:1901-1912[Web of Science][Medline].
-
Mazzoni IE,
Said FA,
Aloyz R,
Miller FD,
Kaplan D
(1999)
Ras regulates sympathetic neuron survival by suppressing the p53-mediated cell death pathway.
J Neurosci
19:9716-9727[Abstract/Free Full Text].
-
McCarthy KD,
de Vellis J
(1980)
Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue.
J Cell Biol
85:890-902[Abstract/Free Full Text].
-
Minden A,
Lin A,
McMahon M,
Lange-Carter C,
Derijard B,
Davis RJ,
Johnson GL,
Karin M
(1994)
Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK.
Science
266:1719-1723[Abstract/Free Full Text].
-
Minden A,
Lin A,
Claret F-X,
Abo A,
Karin M
(1995)
Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and CdC42Hs.
Cell
81:1147-1157[Web of Science][Medline].
-
Namgung U,
Xia Z
(2000)
Arsenite-induced apoptosis in cortical neurons is mediated by c-Jun N-terminal protein kinase 3 and p38 mitogen-activated protein kinase.
J Neurosci
20:6442-6451[Abstract/Free Full Text].
-
Nataf S,
Naveilhan P,
Sindji L,
Darcy F,
Brachet P,
Montero-Menei CN
(1998)
Low affinity NGF receptor expression in the central nervous system during experimental allergic encephalomyelitis.
J Neurosci Res
52:83-92[Medline].
-
Park JA,
Lee JY,
Sato TA,
Koh JY
(2000)
Co-induction of p75NTR, p75NTR-associated death executor in neurons after zinc exposure in cortical culture or transient ischemia in the rat.
J Neurosci
20:9096-9103[Abstract/Free Full Text].
-
Peterson DA,
Dickinson-Anson HA,
Leppert JT,
Lee KF,
Gage FH
(1999)
Central neuronal loss and behavioral impairment in mice lacking neurotrophin receptor p75.
J Comp Neurol
404:1-20[Web of Science][Medline].
-
Qui MS,
Green SH
(1992)
PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity.
Neuron
9:705-717[Web of Science][Medline].
-
Roux PP,
Colicos MA,
Barker PA,
Kennedy TE
(1999)
p75 neurotrophin receptor expression is induced in apoptotic neurons after seizure.
J Neurosci
19:6887-6896[Abstract/Free Full Text].
-
Salehi AH,
Roux PP,
Kubu CJ,
Zeindler C,
Bhakar A,
Tannis LL,
Verdi JM,
Barker PA
(2000)
NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor, facilitates nerve growth factor-dependent apoptosis.
Neuron
27:279-288[Web of Science][Medline].
-
Taniuchi M,
Clark HB,
Johnson EM
(1986)
Induction of nerve growth factor receptor in Schwann cells after axotomy.
Proc Natl Acad Sci USA
83:4094-4098[Abstract/Free Full Text].
-
Ward NL,
Hagg T
(1999)
p75(NGFR) and cholinergic neurons in the developing forebrain: a re-examination.
Brain Res Dev Brain Res
118:79-91[Medline].
-
Xia Z,
Dickens M,
Raingeaud J,
Davis RJ,
Greenberg ME
(1995)
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
-
Yamaguchi Y,
Katoh H,
Yasui H,
Mori K,
Negishi M
(2001)
RhoA inhibits the nerve growth factor-induced Rac1 activation through a Rho-associated kinase-dependent pathway.
J Biol Chem
276:18977-18983[Abstract/Free Full Text].
-
Yamashita T,
Tucker KL,
Barde YA
(1999)
Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth.
Neuron
24:585-593[Web of Science][Medline].
-
Yang DD,
Kuan CY,
Whitmarsh AJ,
Rincon M,
Zheng TS,
Davis RJ,
Rakic P,
Flavell RA
(1997)
Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the Jnk3 gene.
Nature
389:865-870[Medline].
-
Yao R,
Yoshihara M,
Osada H
(1997)
Specific activation of a c-Jun NH2-terminal kinase isoform and induction of neurite outgrowth in PC-12 cells by staurosporine.
J Biol Chem
272:18261-18266[Abstract/Free Full Text].
-
Yasui H,
Katoh H,
Yamaguchi Y,
Aoki J,
Fujita H,
Mori K,
Negishi M
(2001)
Differential responses to nerve growth factor and epidermal growth factor in neurite outgrowth of PC12 cells are determined by Rac1 activation systems.
J Biol Chem
276:15298-15305[Abstract/Free Full Text].
-
Ye X,
Mehlen P,
Rabizadeh S,
VanArsdale T,
Zhang H,
Shin H,
Wang JJ,
Leo E,
Zapata J,
Hauser CA,
Reed JC,
Bredesen DE
(1999)
TRAF family proteins interact with the common neurotrophin receptor and modulate apoptosis induction.
J Biol Chem
274:30202-30208[Abstract/Free Full Text].
-
Yeo TT,
Chua-Couzens J,
Butcher LL,
Bredesen DE,
Cooper JD,
Valletta JS,
Mobley WC,
Longo FM
(1997)
Absence of p75NTR causes increased basal forebrain cholinergic neuron size, choline acetyltransferase activity, and target innervation.
J Neurosci
17:7594-7605[Abstract/Free Full Text].
-
Yoon SO,
Lois C,
Alvirez M,
Alvarez-Buylla A,
Falck-Pedersen E,
Chao MV
(1996)
Adenovirus-mediated gene delivery into neuronal precursors of the adult mouse brain.
Proc Natl Acad Sci USA
93:11974-11979[Abstract/Free Full Text].
-
Yoon SO,
Soltoff SP,
Chao MV
(1997)
A dominant role of the juxtamembrane region of the TrkA nerve growth factor receptor during neuronal cell differentiation.
J Biol Chem
272:23231-23238[Abstract/Free Full Text].
-
Yoon SO,
Casaccia-Bonnefil P,
Carter BD,
Chao MV
(1998)
Competitive signaling between TrkA and p75 determines cell survival.
J Neurosci
18:3273-3281[Abstract/Free Full Text].
Copyright © 2002 Society for Neuroscience 0270-6474/02/221156-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
T. G. Bengoechea, Z. Chen, D. O'Leary, E. Masliah, and K.-F. Lee
p75 reduces {beta}-amyloid-induced sympathetic innervation deficits in an Alzheimer's disease mouse model
PNAS,
May 12, 2009;
106(19):
7870 - 7875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, L. A. R. Rosado, S. Y. Moon, and B. Zhang
Silencing of D4-GDI Inhibits Growth and Invasive Behavior in MDA-MB-231 Cells by Activation of Rac-dependent p38 and JNK Signaling
J. Biol. Chem.,
May 8, 2009;
284(19):
12956 - 12965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shifrin, P. D. Arora, Y. Ohta, D. A. Calderwood, and C. A. McCulloch
The Role of FilGAP-Filamin A Interactions in Mechanoprotection
Mol. Biol. Cell,
March 1, 2009;
20(5):
1269 - 1279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Caporali and C. Emanueli
Cardiovascular Actions of Neurotrophins
Physiol Rev,
January 1, 2009;
89(1):
279 - 308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Volosin, C. Trotter, A. Cragnolini, R. S. Kenchappa, M. Light, B. L. Hempstead, B. D. Carter, and W. J. Friedman
Induction of Proneurotrophins and Activation of p75NTR-Mediated Apoptosis via Neurotrophin Receptor-Interacting Factor in Hippocampal Neurons after Seizures
J. Neurosci.,
September 24, 2008;
28(39):
9870 - 9879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Caporali, E. Pani, A. J.G. Horrevoets, N. Kraenkel, A. Oikawa, G. B. Sala-Newby, M. Meloni, B. Cristofaro, G. Graiani, A. S. Leroyer, et al.
Neurotrophin p75 Receptor (p75NTR) Promotes Endothelial Cell Apoptosis and Inhibits Angiogenesis: Implications for Diabetes-Induced Impaired Neovascularization in Ischemic Limb Muscles
Circ. Res.,
July 18, 2008;
103(2):
e15 - e26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Coulson, L. M. May, S. L. Osborne, K. Reid, C. K. Underwood, F. A. Meunier, P. F. Bartlett, and P. Sah
p75 Neurotrophin Receptor Mediates Neuronal Cell Death by Activating GIRK Channels through Phosphatidylinositol 4,5-Bisphosphate
J. Neurosci.,
January 2, 2008;
28(1):
315 - 324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. M. Li, C. Tep, T. Y. Yune, X. Z. Zhou, T. Uchida, K. P. Lu, and S. O. Yoon
Opposite Regulation of Oligodendrocyte Apoptosis by JNK3 and Pin1 after Spinal Cord Injury
J. Neurosci.,
August 1, 2007;
27(31):
8395 - 8404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Miraglia, S. Travaglione, S. Meschini, L. Falzano, P. Matarrese, M. G. Quaranta, M. Viora, C. Fiorentini, and A. Fabbri
Cytotoxic Necrotizing Factor 1 Prevents Apoptosis via the Akt/I{kappa}B Kinase Pathway: Role of Nuclear Factor-{kappa}B and Bcl-2
Mol. Biol. Cell,
July 1, 2007;
18(7):
2735 - 2744.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jin, R. M. Ray, and L. R. Johnson
Rac1 mediates intestinal epithelial cell apoptosis via JNK
Am J Physiol Gastrointest Liver Physiol,
December 1, 2006;
291(6):
G1137 - G1147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Obata, H. Katsura, J. Sakurai, K. Kobayashi, H. Yamanaka, Y. Dai, T. Fukuoka, and K. Noguchi
Suppression of the p75 Neurotrophin Receptor in Uninjured Sensory Neurons Reduces Neuropathic Pain after Nerve Injury.
J. Neurosci.,
November 15, 2006;
26(46):
11974 - 11986.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. F Reichardt
Neurotrophin-regulated signalling pathways
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1545 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Tan and R. K. Shepherd
Aminoglycoside-Induced Degeneration of Adult Spiral Ganglion Neurons Involves Differential Modulation of Tyrosine Kinase B and p75 Neurotrophin Receptor Signaling
Am. J. Pathol.,
August 1, 2006;
169(2):
528 - 543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Massa, Y. Xie, T. Yang, A. W. Harrington, M. L. Kim, S. O. Yoon, R. Kraemer, L. A. Moore, B. L. Hempstead, and F. M. Longo
Small, nonpeptide p75NTR ligands induce survival signaling and inhibit proNGF-induced death.
J. Neurosci.,
May 17, 2006;
26(20):
5288 - 5300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Belmonte, M. F. Santos, A. H. Kihara, C. Y. I. Yan, and D. E. Hamassaki
Light-Induced Photoreceptor Degeneration in the Mouse Involves Activation of the Small GTPase Rac1.
Invest. Ophthalmol. Vis. Sci.,
March 1, 2006;
47(3):
1193 - 1200.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. S. Jeon, H. Y. Song, M. R. Kim, H. J. Moon, Y. C. Bae, J. S. Jung, and J. H. Kim
Sphingosylphosphorylcholine induces proliferation of human adipose tissue-derived mesenchymal stem cells via activation of JNK
J. Lipid Res.,
March 1, 2006;
47(3):
653 - 664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. He, I. Gomes, T. Nguyen, G. Jayaram, P. T. Ram, L. A. Devi, and R. Iyengar
The G{alpha}o/i-coupled Cannabinoid Receptor-mediated Neurite Outgrowth Involves Rap Regulation of Src and Stat3
J. Biol. Chem.,
September 30, 2005;
280(39):
33426 - 33434.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Linggi, T. L. Burke, B. B. Williams, A. Harrington, R. Kraemer, B. L. Hempstead, S. O. Yoon, and B. D. Carter
Neurotrophin Receptor Interacting Factor (NRIF) Is an Essential Mediator of Apoptotic Signaling by the p75 Neurotrophin Receptor
J. Biol. Chem.,
April 8, 2005;
280(14):
13801 - 13808.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kanekura, Y. Hashimoto, Y. Kita, J. Sasabe, S. Aiso, I. Nishimoto, and M. Matsuoka
A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death
J. Biol. Chem.,
February 11, 2005;
280(6):
4532 - 4543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Yeiser, N. J. Rutkoski, A. Naito, J.-i. Inoue, and B. D. Carter
Neurotrophin Signaling through the p75 Receptor Is Deficient in traf6-/- Mice
J. Neurosci.,
November 17, 2004;
24(46):
10521 - 10529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. E. Becker, J. Howell, Y. Kodama, P. A. Barker, and A. Bonni
Characterization of the c-Jun N-Terminal Kinase-BimEL Signaling Pathway in Neuronal Apoptosis
J. Neurosci.,
October 6, 2004;
24(40):
8762 - 8770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bandtlow and G. Dechant
From Cell Death to Neuronal Regeneration, Effects of the p75 Neurotrophin Receptor Depend on Interactions with Partner Subunits
Sci. Signal.,
June 1, 2004;
2004(235):
pe24 - pe24.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Gentry, N. J. Rutkoski, T. L. Burke, and B. D. Carter
A Functional Interaction between the p75 Neurotrophin Receptor Interacting Factors, TRAF6 and NRIF
J. Biol. Chem.,
April 16, 2004;
279(16):
16646 - 16656.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Paul, E. Vereker, K. M. Dickson, and P. A. Barker
A Pro-Apoptotic Fragment of the p75 Neurotrophin Receptor Is Expressed in p75NTRExonIV Null Mice
J. Neurosci.,
February 25, 2004;
24(8):
1917 - 1923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Bhakar, J. L. Howell, C. E. Paul, A. H. Salehi, E. B. E. Becker, F. Said, A. Bonni, and P. A. Barker
Apoptosis Induced by p75NTR Overexpression Requires Jun Kinase-Dependent Phosphorylation of Bad
J. Neurosci.,
December 10, 2003;
23(36):
11373 - 11381.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Zhang, Y. Zhang, and E. Shacter
Caspase 3-Mediated Inactivation of Rac GTPases Promotes Drug-Induced Apoptosis in Human Lymphoma Cells
Mol. Cell. Biol.,
August 15, 2003;
23(16):
5716 - 5725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Y. Kim, Q. Sun, M. Oglesbee, and S. O. Yoon
The Role of ErbB2 Signaling in the Onset of Terminal Differentiation of Oligodendrocytes In Vivo
J. Neurosci.,
July 2, 2003;
23(13):
5561 - 5571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Middlemas, J.-D. Delcroix, N. M. Sayers, D. R. Tomlinson, and P. Fernyhough
Enhanced activation of axonally transported stress-activated protein kinases in peripheral nerve in diabetic neuropathy is prevented by neurotrophin-3
Brain,
July 1, 2003;
126(7):
1671 - 1682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Tan, S. Rouen, K. M. Barkus, Y. S. Dremina, D. Hui, J. A. Christianson, D. E. Wright, S. O. Yoon, and R. T. Dobrowsky
Nerve Growth Factor Blocks the Glucose-induced Down-regulation of Caveolin-1 Expression in Schwann Cells via p75 Neurotrophin Receptor Signaling
J. Biol. Chem.,
June 13, 2003;
278(25):
23151 - 23162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Dziennis and B. A. Habecker
Cytokine Suppression of Dopamine-beta -hydroxylase by Extracellular Signal-regulated Kinase-dependent and -independent Pathways
J. Biol. Chem.,
April 25, 2003;
278(18):
15897 - 15904.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Waetzig and T. Herdegen
A Single c-Jun N-terminal Kinase Isoform (JNK3-p54) Is an Effector in Both Neuronal Differentiation and Cell Death
J. Biol. Chem.,
January 3, 2003;
278(1):
567 - 572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Salehi, S. Xanthoudakis, and P. A. Barker
NRAGE, a p75 Neurotrophin Receptor-interacting Protein, Induces Caspase Activation and Cell Death through a JNK-dependent Mitochondrial Pathway
J. Biol. Chem.,
December 6, 2002;
277(50):
48043 - 48050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yan, Y. Liang, K. D. Nylander, and N. F. Schor
TrkA as a Life and Death Receptor: Receptor Dose as a Mediator of Function
Cancer Res.,
September 1, 2002;
62(17):
4867 - 4875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Palmada, S. Kanwal, N.J. Rutkoski, C. Gustafson-Brown, R.S. Johnson, R. Wisdom, and B.D. Carter
c-jun is essential for sympathetic neuronal death induced by NGF withdrawal but not by p75 activation
J. Cell Biol.,
August 5, 2002;
158(3):
453 - 461.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|