 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 2002, 22(1):176-182
Jerky, a Protein Deficient in a Mouse Epilepsy Model, Is
Associated with Translationally Inactive mRNA in Neurons
Wencheng
Liu1,
Jeremy
Seto2,
Gerald
Donovan3, and
Miklos
Toth1, 2
1 Department of Pharmacology, Weill Medical College and
2 Graduate Program in Neuroscience, Weill Graduate School
of Medical Sciences, Cornell University, New York, New York 10021, and
3 Gene Expression, Progenics Pharmaceuticals, Tarrytown,
New York 10591
 |
ABSTRACT |
Temporal lobe epilepsy (TLE) is a common seizure disorder, but the
underlying molecular mechanisms are unknown. We reported previously
that inactivation of the jerky gene in mice causes recurrent limbic seizures highly similar to TLE. Electrophysiological studies showed abnormal firing in hippocampal neurons in these mice,
but it is not known how a deficiency in the Jerky protein leads to
neuronal hyperexcitability. Here we show that Jerky is a brain-specific
protein with a high expression level in neurons. Jerky binds mRNAs with
high affinity, and it is a component of messenger ribonucleoprotein
complexes in vivo. However, Jerky is not associated with
ribosomes and actively translating mRNAs. These data suggest that Jerky
may regulate mRNA use in neurons, and its deficiency could lead to
perturbations in the regulated use of preexisting mRNAs.
Key words:
Jerky; epilepsy; seizure; neuron; animal
model; RNA binding protein; RNA-protein interaction; mRNA; translation
 |
INTRODUCTION |
Temporal lobe epilepsy (TLE) is the
most common seizure disorder in adults. The typical form of TLE is
often severe and is associated with hippocampal atrophy. Members of
families with strong history of febrile seizures have an increased
susceptibility to TLE, but genetic factors are not known to play a
major role in the development of TLE (Falconer et al., 1964 ). Autosomal
dominant TLE and autosomal dominant lateral TLE are hereditary and
nonlesional forms of TLE with a relatively benign disease course
(Berkovic et al., 1994 , 1996 ; Saenz et al., 1999 ; Gambardella et al.,
2000 ; Ikeda et al., 2000 ; Picard et al., 2000 ). Genetic analysis found a linkage to chromosome 10q for autosomal dominant lateral TLE, but
these studies did not lead to the cloning of a gene (Poza et al.,
1999 ).
We reported previously that "jerky" mice have recurrent limbic
seizures (Toth et al., 1995 ; Donovan et al., 1997 ) that are highly reminiscent of those seen in familiar TLE (Berkovic et al.,
1994 , 1996 ; Cendes et al., 1998 ; Saenz et al., 1999 ; Gambardella et
al., 2000 ; Ikeda et al., 2000 ; Picard et al., 2000 ). First, the
inheritance of the seizure disorder is autosomal dominant in both human
and mouse. Second, penetrance of seizures in both human and mouse is
partial. Third, the symptoms usually disappear spontaneously by age in
both species.
Seizures in "jerky" mice are caused by the lack of the
jerky gene (Toth et al., 1995 ; Donovan et al., 1997 ). The
mouse Jerky protein is encoded by a single exon (Toth et al., 1995 ),
consisting of 557 amino acid (aa) residues (GenBank accession
number NM_008415). The similarity of Jerky to DNA transposons of the
TC1/Pogo/Tigger family has been recognized (Toth et al., 1995 ).
Although most DNA transposon copies are nonfunctional, transposon-like
genes encoding proteins such as jerky and CENP-B
(centromere binding protein-B) indicate that DNA transposons may have
become fixed in the genome as functional genes (International Human
Genome Sequencing Consortium, 2001 ). The human homolog of
jerky (JRK/JH8) has also been cloned (Morita et
al., 1998 ). A de novo nonconservative mutation to a
potential glycosylation site in JRK/JH8 has been described recently in
an epileptic patient (Moore et al., 2001 ).
Based on its similarity to CENP-B, a possible nuclear regulatory
function has been hypothesized for Jerky (Toth et al., 1995 ). CENP-B is
an abundant nuclear protein localized on the centromere (Earnshaw and
Rothfield, 1985 ; Earnshaw et al., 1987 ; Cooke et al., 1990 ; Sullivan
and Glass, 1991 ) and is implicated in the assembly of centromeric DNA
(Muro et al., 1992 ; Yoda et al., 1992 ). In contrast to CENP-B, Jerky is
not exclusively localized to the nucleus (see Results) and may have a
cytoplasmic function, in addition to a CENP-B-like nuclear role. Here
we show that cytoplasmic Jerky is a constituent of translationally
inactive messenger ribonucleoprotein (mRNP) particles in brain. Jerky
may retain and mask mRNAs within mRNPs, and Jerky deficiency could lead
to perturbations in the regulated use of preexisting mRNAs in neurons.
 |
MATERIALS AND METHODS |
Generation of glutathione S-transferase-Jerky
fusion protein and polyclonal antibodies against Jerky. Recent
sequence analysis of jerky mRNAs from brain indicated that the open
reading frame (Toth et al., 1995 ) can be extended by 48 aa (sequence
has been deposited to GenBank, accession number NM_008415), resulting
in a protein of 557 residues. A glutathione S-transferase
(GST)-tagged Jerky construct was generated by cloning a 1.65 kb cDNA,
corresponding to full-length Jerky (1-557) in frame with an N-terminal
GST tag. We first produced a jerky DNA fragment flanked by
EcoRI sites by PCR using a 5' primer (GGAATTCCCAT GGCCTCCAA
GCAGGCTGCA) encoding an EcoRI site and the first seven amino
acids of Jerky, and a 3' primer (CGGAATTCGTTGTCACCTGCAGTGGAAGA)
corresponding to an EcoRI site and the last seven amino
acids of Jerky. Then, the EcoRI fragment was
cloned into the expression vector pGEX-6P2 (Amersham Pharmacia
Biotech, Piscataway, NJ). This plasmid was transformed
into BL21 Escherichia coli, and protein expression was
induced by 1 mM
isopropyl- -D-thiogalactopyranoside.
GST-Jerky was purified as described by Guan and Dixon (1991) .
To produce antibodies in rabbits, 4 mg of GST-Jerky was produced and
sent to Strategic Biosolutions (Ramona, CA). These antibodies were
affinity-purified with Jerky covalently bound to Sepharose beads
(Amersham Pharmacia Biotech). The antibody recognized a 62 kDa protein
in brain (see Fig. 1A). The size of this
immunoreactive band is in a good agreement with the predicted molecular
mass of 62.5 kDa of the Jerky protein. The antibody also recognized Jerky expressed in HEK 293 cells as a protein tagged with Flag (see
Fig. 3C) and V5 (data not shown) epitopes.
RNA labeling. Labeled mRNA fragments were obtained by using
the RNA SELEX procedure of Dobbelstein and Shenk (1995) , modified in
our laboratory. Briefly, first-strand cDNA synthesis was
initiated from mouse brain mRNA (Clontech, Palo Alto, CA) by using a
primer with a random octamer at its 3' end (SELEX 1 primer,
5'-AGCAACAGCAAGACTACGAGTGANNNNNNNNN-3'). Second strand was generated by
using another primer containing a random hexamer at its 3' end
(SELEX 2 primer, 5'-GGGAGCTCAGAATAAACGCTCAANNNNNN-3'). The second
strand was PCR amplified with SELEX 1 primer without the random
sequence (SELEX 1b, 5'-AGCAACAGCAAGACTACGAGTGA-3') and SELEX 2 primer
without the random hexamer but with a T7 promoter sequence at the
5' end (SELEX2-T7,
5'-GACAGCATTAATACGACTCACTATAGGGAGCTCAGAATAAACGCTCAA-3'). The resulting
PCR products were used to synthesize RNA probes by T7 polymerase in the
presence of [ -32P]UTP (DuPont NEN,
Boston, MA). RNA homopolymers (Sigma, St. Louis, MO) were 5' end
labeled by T4 kinase and
[ -32P]ATP.
Gel electrophoresis and Western analysis. Mouse brains were
isolated and homogenized in hypotonic buffer (10 mM Tris, pH 7.5, 50 mM KCl,
5 mM MgCl2, and 0.1% NP40)
containing 1 mM PMSF, 0.2 µg/ml aprotinin, 40 µg/ml bestatin, and 0.5 µg/ml leupeptin (Roche, Indianapolis, IN).
The homogenate was centrifuged at 10,000 × g for 20 min, and the supernatant was collected. The protein concentration of
the supernatant was determined using BCA protein assay (Pierce, Rockford, IL). Samples (20 µg of the total protein) were separated on
7.5% polyacrylamide gels and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). Western analysis
was performed as described by Liu et al. (1995) . In these assays, a
dilution of 1:1000 of affinity-purified anti-Jerky antibodies was used,
and the signal was detected by enhanced chemiluminescence (Pierce).
Some of the blots were also probed by 1:1000 dilution of a human
autoimmune serum containing anti P0 antibody (obtained from Keith
Elkon, Hospital for Special Surgery, New York, NY).
Hippocampal primary neuronal cultures and
immunocytochemistry. Primary neuronal cultures were prepared from
the hippocampus of embryonic day 18 Sprague Dawley rat embryos
as described by Papa et al. (1995) . In brief, hippocampus was dissected
in cold Leibovitz's 15 (L15) medium. The tissue was mechanically
dissociated in L15 medium using polished Pasteur pipettes. Tissue was
then suspended in DMEM containing 10% fetal calf serum, 2% of
B27 supplement (Life Technologies, Gaithersburg, MD), 2 mM glutamine, and penicillin-streptomycin. Rat
hippocampal cells were plated on round glass coverslips coated with
poly-L-lysine. Four days after plating,
the medium was replaced with DMEM containing 5% fetal calf serum, and
incubation continued for an additional 3 d. Seven-day-old cultures
were processed for immunohistochemistry. Cells were incubated with
3.5% paraformaldehyde in PBS (in mM: 137 NaCl,
4.3 Na2HPO4, 2.7 KCl, and
1.4 KH2PO4) for 15 min,
washed with PBS three times, and then incubated with 5% goat serum in
PBS-0.2% Triton X-100 (PBST) for 1 hr. Incubation was followed by
adding primary antibodies [1:100 for affinity-purified anti-Jerky
antibodies and 1:500 for anti- -tubulin (TuJ1)] in PBST containing
1% goat serum at 4°C overnight. Next, cells were washed three times
with PBS and then incubated with anti-rabbit-FITC or biotinylated
anti-mouse antibodies in PBST for 1 hr at room temperature. Finally,
cells were washed with PBS and incubated with avidin-rhodamine (1:500;
Vector Laboratories, Burlingame, CA) in PBST for 1 hr at room
temperature and washed three times with PBS before mounting with
Fluoromount (Electron Microscopy Sciences, Ft. Washington, PA). Cells
were examined using a Zeiss (Oberkochen, Germany) confocal microscope.
Sucrose gradient centrifugation and Western analysis.
Cerebral cortices from mice were rapidly removed after decapitation and
placed into 0.32 M sucrose solution containing 4 mM HEPES, pH 7.3, 5 mM
MgCl2 (or 30 mM EDTA), 1 mM PMSF, 0.2 µg/ml aprotinin, 40 µg/ml
bestatin, 0.5 µg/ml leupeptin, 1 mM DTT ,and 30 U of RNasin (Promega, Madison, WI). In some experiments, 300 µg/ml RNaseA was added to the samples. To arrest polysome migration, tissue
was incubated on ice for 20 min in the presence of 200 µg/ml
cycloheximide. Samples were gently homogenized (10 strokes) with a
glass homogenizer, and homogenates were centrifuged at 4000 × g for 15 min. Supernatants were then collected and loaded onto 5-25% sucrose gradients, followed by centrifugation at 39,000 rpm for 100 min at 4°C. Twenty-three fractions were collected from
each gradient. Each fraction was divided into two equal portions, one
for RNA analysis and the other for protein analysis. For the RNA
analysis, samples were phenol-chloroform extracted once, and the RNA
was ethanol precipitated. The RNA was electrophoresed in a formaldehyde
agarose gel, and the rRNA was visualized with ethidium bromide. For
protein analysis, samples were first concentrated using Ultrafree-0.5
concentrators (Millipore). One-third of the concentrated sample was
loaded onto 12.5% acrylamide gels and transferred onto PVDF membranes.
Western analysis was performed as described above.
Isolation of mRNP complexes by oligo-dT beads. mRNP
complexes were isolated as described by Feng et al. (1997) . One mouse brain was homogenized in 1 ml of lysis buffer containing 20 mM Tris, pH7.5, 100 mM KCl,
5 mM MgCl2, 0.3% NP-40,
200 U of rRNasin (Promega), and Complete Protease inhibitor cocktail
(Roche). Post-mitochondrial supernatants were isolated by
centrifugation at 10,000 × g for 10 min. Aliquots (200 µl) were applied to 40 µl Oligotex beads (Qiagen, Valencia,
CA). Samples were incubated in binding buffer in the presence of either
competitive poly(A+) (40 pmol), RNaseA (30 U), and RNaseT1 (30 U), or
ddH20. After a 15 min incubation at 37°C,
samples were centrifuged at 10,000 × g and washed
three times in 500 µl of low-salt buffer. Samples were finally
thermo-eluted with preheated elution buffer. Aliquots, representing 1, 1, 3, and 50% of load, flow-through, combined washes, and eluate,
respectively, were used for Western analysis.
Isolation of Jerky-containing cytoplasmic complexes by
immunoprecipitation. Pull-down of Jerky complexes was performed
essentially as described by Ceman et al. (1999) . Briefly, 1 × 109 HEK 293T cells were transfected with a
Flag-tagged Jerky construct. After 24 hr, cells were harvested and
washed three times with 10 vol of PBS. Cells were then lysed mildly
with lysis buffer (50 mM Tris, pH7.5, 150 mM NaCl, 30 mM EDTA, and
0.5% Triton X-100) containing Complete Protease inhibitor cocktail for
45 min on ice. Nuclei were pelleted at 3000 × g for 10 min at 4°C. The cytoplasmic supernatant was precleared for 2 hr with
250 µl of Flag peptide (250 mg)-anti-Flag antibody complex
immobilized on agarose bead (Sigma). After centrifugation, the
supernatant was immunoprecipitated with 200 µl of anti-Flag agarose
bead for 3 hr. The immunoprecipitated material was recovered by
centrifugation and washed twice with 1 ml of lysis buffer for 15 min at
4°C. Then, the material was washed again with lysis buffer containing
50 U of RNase-free DNase I (Roche) in the presence of 200 U of rRNasin
(Promega). Finally, the immunoprecipitated material was washed with
lysis buffer containing 200 U of RNasin and pelleted by gravity
overnight. Protein-RNA complexes were eluted with a mixture of 150 µl of lysis buffer and 150 µl of Flag peptide (5 mg/ml) for 45 min.
The supernatant containing the eluted complexes was recovered by
centrifugation. Elution was continued with 500 µl of lysis buffer for
45 min. The eluates were combined, and 10% of this fraction was used
for protein analysis. To recover the RNA content from the complexes, the rest of the sample was incubated with lysis buffer containing 100 µg of proteinase K (Life Technologies) and 200 U of RNasin at 37°
for 15 min. The sample was then phenol-chloroform extracted, and the
mRNA was ethanol precipitated.
Assays to test Jerky-RNA interaction. Full-length GST-Jerky
(0.5 µg) in RNA binding buffer (150 mM LiCl, 10 mM Tris, pH 7.5, and 1 mM
EDTA) was loaded onto poly(A), poly(U), poly(C), or poly(G) agarose
columns (Sigma). The columns were washed with 20 column volume of RNA
binding buffer. Bound Jerky was eluted twice with 500 µl of elution
buffer (1 M NaCl, 10 mM
Tris, pH 7.5, 1 mM EDTA, and 0.1% Triton X-100).
Eluates were concentrated with Ultrafree-0.5 concentrators (Millipore).
Concentrated samples were subjected to SDS-PAGE and Western analysis
using anti-Jerky antibodies as described above.
In other experiments, mouse brain mRNA (Clontech) was incubated with
GST-Jerky immobilized on agarose beads for 20 min in RNA binding buffer
at room temperature. Beads were washed twice with RNA binding buffer
for 15 min. Bound mRNA was recovered by phenol-chloroform extraction,
followed by ethanol precipitation, and was used for first-strand cDNA
synthesis with oligo-dT primer in the present of
[ -32P]dCTP. Also, labeled mRNA was
interacted with Jerky immobilized on nitrocellulose membrane. GST-Jerky
(0.2 µg) was applied per well onto a 0.45 µM
nitrocellulose membrane in a slot blot system (BA85; Schleicher & Schuell, Keene, NH). Filters were incubated with
32P-labeled mRNA fragments (2 × 106 cpm/ml) in binding buffer (50 mM NaCl, 10 mM Tris, pH 7.5, 10 mM
MgCl2, 1 mM EDTA, 1 mM
DTT, and 0.02% BSA) for 2 hr at 25°C. After incubation, filters were
washed twice with binding buffer for 30 min each. Bound radioactivity
was visualized by autoradiography.
Filter binding assays were performed as described by Hall and Kranz
(1999) . First, mouse brain mRNAs were preselected with GST-Jerky
immobilized on glutathione beads, and the mRNA was labeled by the
modified RNA SELEX procedure as described above. Labeled mRNA fragments
were incubated with serial dilutions of purified GST-Jerky in a buffer
containing 50 mM LiCl, 10 mM
MgCl2, 10 mM Tris, pH 7.5, 20 µg/ml
BSA, and 1 mM EDTA for 30 min at room temperature. RNA-protein complexes were then filtered through a sandwich of a 0.45 µm nitrocellulose membrane (BA85; Schleicher & Schuell) on the top
and a nylon membrane (Nytran; Schleicher & Schuell) on the bottom.
Bound and unbound radioactivity on the nitrocellulose and nylon
filters, respectively, was measured by a STORM 860 phosphorimage analyzer (Molecular Dynamics, Sunnyvale, CA), and
KD was calculated as described by Hall
and Kranz (1999) .
 |
RESULTS |
The Jerky protein is exclusively expressed in brain
Antibody produced in rabbits against recombinant Jerky (see
Materials and Methods) was used to determine the tissue-specific expression of Jerky in mice. Tissue distribution of Jerky was studied
in both nuclear and cytoplasmic fractions of the tissues. Western blots
showed a 62 kDa immunoreactive band in brain in both the cytoplasmic
and nuclear fractions (Fig.
1A). The size of this
immunoreactive band is in a good agreement with the predicted molecular
mass of 62.5 kDa of the Jerky protein (GenBank accession number
NP_032441). The antibody also recognized Jerky in rat brain (data not
shown). Heart, liver, kidney, ovary, stomach, skeletal muscle, spleen,
and pancreas showed no detectable immunoreactivity. In testis and lung,
a weak immunoreactive band with an ~58 kDa mass was seen
occasionally. It is not clear whether these represent a Jerky isoform
or a cross-reactivity of the antibody in these tissues.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 1.
Expression of Jerky in mouse tissues and rat
hippocampal cultures. A, Western analysis of cytoplasmic
and nuclear fractions from mouse tissues by Jerky antibody.
Br, Brain; H, heart; Lu,
lung; Li, liver; K, kidney;
T, testes; O, ovary; St,
stomach; Sk, skeletal muscle; Sp, spleen;
Pn, pancreas. B, Double-immunostaining of
neuronal cultures by anti-Jerky (left panel;
green on the merged image on the right)
and anti- -tubulin (middle panel; red
on the merged image on the right) antibodies.
Arrows and arrowheads indicate neuronal
( -tubulin-positive) and non-neuronal ( -tubulin-negative) cells,
respectively.
|
|
Jerky is highly expressed in primary neurons
Jerky was immunolocalized with the polyclonal antibody in
1-week-old primary rat hippocampal cultures (Fig.
1B). Neurons were identified by staining with a
-tubulin antibody. Jerky immunostaining was strong in neurons and
appeared to be granular. Consistent with the Western analysis shown in
Figure 1A, Jerky was present in both the nucleus and
cytoplasm (Fig. 1B). Immunostaining was also seen in
the nucleus and the cytoplasm of non-neuronal ( -tubulin-negative) cells, but it was considerably weaker than in neurons.
Jerky comigrates with mRNP complexes in sucrose
density gradient
Because of the similarities between Jerky and the
heterochromatin-associated CENP-B (see introductory remarks),
the presence of Jerky in nuclear brain fraction and in the nuclei of
neurons was not surprising. However, the presence of Jerky
immunoreactivity in cytoplasmic brain fractions and in the cytoplasm of
primary neurons was unexpected, and we further studied this unique
feature of Jerky. Specifically, a possible association of Jerky with
macromolecular complexes in brain cytoplasmic lysates was investigated
by sedimentation analysis in 5-25% sucrose gradients (Fig.
2A, top
panel). A significant portion of Jerky entered the gradient
(fractions 1 and 2 represent soluble Jerky
remaining on the top of the gradient) and was found in complexes with a
sedimentation up to the 80S monosomes. The position of monosomes in the
gradient was indicated by the presence of the 18 and 28S rRNAs, as well
as the large ribosome subunit protein P0 (Fig. 2A,
middle and bottom panels). Jerky was not detected
in fractions containing polysomes (fractions 15-23; not shown in
figure). Jerky was not found in association with polysomes either when
polysomes were better resolved on 25-47% gradients (data not shown).
A small fraction of the Jerky protein (Fig. 2A, top panel, fraction
7) cosedimented with the 40S small ribosomal subunit
(indicated by the presence of the 18S ribosomal RNA in Fig.
2A, bottom panel). However, Jerky
is probably not associated with the 40S ribosomal subunit because
immunoprecipitation of these complexes via S3 (a small ribosomal
subunit protein) did not pull down Jerky (data not shown). We concluded
that Jerky was positioned in the gradient in fractions that contain
complexes characterized by a sedimentation of <80S. Typically, these
fractions contain translationally inactive mRNP complexes but also
other macromolecular complexes, such as proteasomes. We also concluded that Jerky is not associated with ribosomes.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2.
Jerky comigrates with mRNP in 5-25% sucrose
gradient. A, Jerky (top panel) and
P0 (middle panel) immunoreactivity in gradient
fractions derived from mouse brain cytoplasmic extracts. The
bottom panel shows the distribution of rRNA in the
fractions. Analysis of the top 14 fractions of the total of 23 fractions is displayed. B, Jerky (top
panel) and P0 (middle panel)
immunoreactivity in gradient fractions derived from RNase-digested
cytoplasmic extract. No intact 18 and 28S rRNAs were seen after RNase
treatment (data not shown).
|
|
Enzymatic treatment of brain cytoplasmic lysates with RNaseA before
sedimentation resulted in a shift toward lower sedimentation of Jerky
(Fig. 2, compare A, B), indicating that RNA is
present and has a vital structural role in Jerky-containing
macromolecular complexes. The RNaseA-induced leftward shift (2 fractions, representing 1 ml of the 11.5 ml gradient) of Jerky
immunoreactivity was reproducible in three independent experiments. The
level of P0 protein was increased in monosomal fractions in
RNase-treated samples, indicating that polysomes were also disrupted by
the enzyme (Fig. 1B, middle panel).
Also, P0 protein appeared in soluble and low sedimentation fractions,
indicating some disintegration of the monosomes and/or ribosome subunits.
Jerky is present in mRNA-containing cytoplasmic complexes
To further test the presence of Jerky in mRNPs, these particles
were captured from brain extract (Fig.
3A). Although with low
efficiency, mRNPs can be isolated by oligo-dT beads from cellular extract (Feng et al., 1997 ). As shown in Figure 3A,
lane 7, Jerky was captured from cytoplasmic brain extract by
oligo-dT polystyrene latex beads. Preincubation of oligo-dT beads with
poly(A+) prevented the binding of
Jerky-containing cytoplasmic complexes to the beads (Fig.
3A, lane 8), demonstrating that Jerky was
captured via mRNA and not by another interaction. As expected, Jerky
was not present in the eluate when the brain lysate was pretreated with
RNaseA and RNaseT1 (Fig. 3A,
lane 16). These data indicate that Jerky is present
in mRNP particles in mouse brain.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 3.
Association of Jerky with mRNP. A,
Western analysis of brain lysates subjected to a selection with
oligo-dT polystyrene latex beads. Selection was performed in the
absence ( ) and presence (+; top panel) of
poly(A+) or after RNaseA or RNaseT1
treatment (+; bottom panel). Samples from load
(lanes 1, 2, 9,
10; 1% of total load), flow-through (lanes
3, 4, 11, 12; 1%
of total), combined wash fractions (lanes
5, 6, 13,
14; 3% of total), and eluate (lanes 7,
8, 15, 16; 50% of total)
were analyzed by anti-Jerky antibodies. B, Jerky content
of brain and HEK 293T cytoplasmic extracts. Western blots containing
cytoplasmic extracts from brain and HEK 293T cells expressing
Flag-tagged Jerky were probed by anti-Jerky antibody. C,
Immunoprecipitation from cytoplasmic extract of Flag-Jerky-expressing
HEK 293T cells by an anti-Flag monoclonal antibody (left
lane). Control immunoprecipitation from cytoplasmic extract of
HEK 293T cells transfected with a Flag peptide expressing plasmid
(right lane). Five percent of the immunoprecipitated
materials was analyzed by Western blotting using anti-Jerky antibodies.
D, mRNA content of Flag immunocomplexes (30% of total)
from HEK 293T cells transfected with Flag-Jerky and Flag-expressing
plasmids. mRNA is visualized by reverse transcribing the RNA purified
from the immunocomplexes.
|
|
We also determined whether mRNAs can be detected in cytoplasmic Jerky
complexes. HEK 293T cells were transfected with plasmids expressing
Flag-tagged Jerky. Similar to the subcellular compartmentalization of
Jerky in brain (Fig. 1A), Flag-Jerky showed an
approximately equal distribution in 293T cytoplasmic and nuclear
extracts (data not shown). As a control, an expression vector
containing the Flag tag alone was used. Importantly, Jerky was not
expressed in an exceedingly large amount in HEK 293T cells that could
produce artificial interactions, because 16 µg of brain cytoplasmic
extract contained more Jerky than 40 µg (normalized to the 40%
transfection efficiency) of HEK 293T cell extract (Fig. 3B).
Indeed, HEK 293T cells expressed Jerky at a relatively low level,
especially when considering that neurons with high Jerky expression
represent only a fraction of cells in brain. After transfection of HEK
293T cells, Flag-containing complexes were pulled down from cytoplasmic extracts by a monoclonal anti-Flag antibody. The presence of Jerky in
Flag immunocomplexes derived from Flag-Jerky but not Flag-expressing cells was verified by polyclonal Jerky antibody (Fig. 3C).
The mRNA content of these complexes was tested by reverse transcription initiated by oligo-dT primer in the presence of labeled dATP. As Figure
3D shows, mRNA was detected in Flag-Jerky but not in Flag immunocomplexes.
Jerky can directly bind mRNAs
Although the presence of Jerky in mRNP particles indicated an
association between Jerky and mRNA, it was not known whether this
interaction is direct or indirect. RNA binding of Jerky was assessed by
incubating mouse brain mRNAs with Jerky immobilized on agarose beads
(Fig. 4A). Recombinant
and purified Jerky (GST-Jerky) was used in these experiments to
ascertain that RNA binding does not occur via contaminating proteins.
Bound mRNA was detected by reverse transcription. As Figure
4A shows, labeled cDNA was obtained from Jerky but
not control beads that contained cytosolic retinol binding protein
(CRBP), a protein not known to bind RNA.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 4.
Direct interaction of Jerky with mRNA.
A, Interaction of brain mRNA with GST-Jerky immobilized
on beads. Bound mRNA is visualized by reverse transcription. GST-CRBP
is the control protein. B, Interaction of labeled brain
mRNA fragments and end-labeled ribopolymers with GST-Jerky immobilized
on a nitrocellulose membrane. Bottom panel is a Western
analysis of immobilized GST-Jerky and GST-CRBP by anti-GST antibodies
to demonstrate the presence of proteins on the filter.
C, Interaction of GST-Jerky with ribopolymers
immobilized on beads. , , ,
, and of the available materials from load,
flow-through, wash, final wash, and eluate, respectively, are analyzed
by Western blot using anti-GST antibodies. GST-CRBP is used as the
negative control.
|
|
In a similar experiment, labeled RNAs were incubated with
Jerky immobilized on nitrocellulose filters. RNA fragments copied from
mouse brain mRNAs (see Materials and Methods), as well as synthetic RNA
homopolymers [poly(A), poly(C), poly(G), and poly(U)] were
used (Fig. 4B). Similar to the previous experiment
(Fig. 4A), mRNAs were retained on immobilized Jerky,
suggesting again that brain mRNA can directly bind to Jerky.
Homopolymers, except poly(C), were also retained by Jerky. CRBP, which
was immobilized in comparable amounts as Jerky on the filters (Fig.
4B, bottom, Anti-GST),
retained no RNA (Fig. 4B, right
lanes).
Finally, we performed the reverse experiment when Jerky was in solution
and the RNA was immobilized. Specifically, GST-Jerky was incubated with
each of the four RNA homopolymers [poly(A), poly(C), poly(G), and
poly(U)] covalently linked to agarose (Fig. 4C). At least
15% of Jerky was retained on poly(A) and poly(G) and somewhat more on
poly(U) ( of the eluates contained equal amounts or more
Jerky than of the loads). Binding to poly(C) was
not detected. These data indicated that the affinity of Jerky to RNA
homopolymers is U > G = A (Fig. 4C). GST-CRBP,
used as a control, was not retained by poly(G) (Fig. 4C,
bottom panel).
Although these experiments suggested that Jerky can directly bind mRNA,
the tests used were not suitable to determine whether the affinity of
the binding is high enough to be considered physiologically relevant.
To address this question, filter binding assays were performed with
labeled mRNA fragments and recombinant Jerky. Increasing amounts of
GST-Jerky were incubated with constant amounts of
32P-labeled mRNA fragments in solution and
filtered through a sandwich consisting of a nitrocellulose membrane
that retained RNA-protein complexes [bound fraction
(B)] and a nylon membrane that retained unbound
[free (F)] RNA (Fig.
5, inset at top
left). The purity of the Jerky preparation was assessed by
staining the gel with Coomasssie blue (Fig. 5, inset at
bottom right), which showed an ~90 kDa protein (62 kDa
Jerky fused to the 26 kDa GST) but not other proteins. Measuring both
bound and free radioactivity allowed us to calculate binding affinity.
As Figure 5 shows, the KD of the
binding by Jerky was ~5 nM, representing
a high-affinity binding. This is comparable with the binding of other
RNA binding proteins with known biological function in RNA processing,
such as HIV-1 tat (Dingwall et al., 1990 ), HuR (Nabors et al., 2001 ), Sam68 (Lin et al., 1997 ), and many others.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5.
High-affinity binding of mRNA by Jerky. Filter
binding assay with GST-Jerky and labeled mouse brain mRNA fragments.
GST-CRBP is used as a control. The result is from four independent
experiments, three of them performed in duplicate. Dotted
lines represent 50% binding. Autoradiography of a
representative set of filters with bound (B) and
free (F) RNA is displayed on the top left
corner. Coomassie blue staining of the GST-Jerky preparation
after PAGE is displayed on the bottom right
corner.
|
|
 |
DISCUSSION |
Jerky is a brain-specific protein, with a preferential expression
in neurons
In agreement with the neurological phenotype of the
"jerky" mice, the Jerky protein is expressed in the brain.
The brain-specific expression of the Jerky protein was unexpected
because we found previously that, besides the brain, jerky mRNA was
also detectable in various other mouse tissues by reverse
transcription-PCR (Donovan et al., 1997 ). Northern analysis
with poly(A+) mRNA confirmed the
widespread expression of jerky mRNA in mouse tissues
(data not shown). These data suggest that the brain-specific expression
of the Jerky protein is controlled at the translational level.
Additional studies will be needed to clarify the nature of this
regulation. Presence of the Jerky protein in brain is primarily
attributable to neuronal expression, although a
lower expression was also detectable in non-neuronal cells. No other tissue expressed the 62 kDa Jerky protein in detectable amount, suggesting that the function(s) of the protein is limited to the nervous system.
Based on sequence similarity between Jerky and the
heterochromatin-associated CENP-B, Jerky was expected to be an
exclusively nuclear protein. Instead, we found that Jerky is
approximately equally distributed between the nucleus and cytoplasm in
hippocampal neurons. A similar distribution was found in HEK 293 cells
expressing Flag-Jerky and V5-Jerky (data not shown). The presence of
Jerky in the cytoplasm was not attributable to leakage from the nucleus during the immunostaining procedure because a nucleocytoplasmic distribution was also seen in vivo in GFP-Jerky-expressing
HEK 293 cells (data not shown). Furthermore, Jerky showed a similar compartmentalization in brain in fractionation studies whether in the
presence or absence of detergents. These data raised the possibility
that Jerky may have a CENP-B-like function in the nucleus and an
entirely new function in the cytoplasm.
CENP-B is believed to play a role in mitosis and/or meiosis. However,
deletion of CENP-B in mice causes no apparent defect in mitosis and
meiosis. Phenotypically, a moderate impairment in growth rate and
disturbances in sexual functions have been found on some but not other
genetic backgrounds (Hudson et al., 1998 ; Kapoor et al., 1998 ;
Perez-Castro et al., 1998 ; Fowler et al. 2000 ). The mild phenotype of
CENP-B knock-out mice is surprising because deletion of other
centromeric proteins, such as Cenpa and Incenp, leads to embryonic
lethality (Cutts et al., 1999 ; Howman et al., 2000 ). Interestingly,
homozygote Jerky-deficient mice also show growth retardation and sexual
dysfunction. These data would also be consistent with the idea of an
overlapping CENP-B and nuclear Jerky function. A deficiency in Jerky,
however, results in recurrent seizures, a unique phenotype not noticed in CENP-B knock-out mice. Moreover, this phenotype is related to a
dosage-dependent (haplo-insufficient) function of Jerky because heterozygotes already display seizures. We reasoned that, whereas a
deficiency in nuclear Jerky may be effectively compensated by CENP-B,
an uncompensated loss of cytoplasmic Jerky could result in seizures.
Although a role for nuclear Jerky cannot be excluded in seizure
induction, we first focused on the role of Jerky in the cytoplasm.
Jerky is part of mRNP particles
mRNAs in cells are either translationally active or inactive.
Whereas translationally active mRNAs are associated with ribosomes, translationally inactive mRNAs are found in mRNPs. mRNP particles have
a slower sedimentation than the 80S monosomes in sucrose gradients and
are believed to represent stored mRNA or mRNA in transit to the
ribosome. Several lines of evidence indicate that Jerky is part of
mRNPs in brain. First, Jerky-containing macromolecular complexes
cosediment with mRNP particles in sucrose gradients. Second, RNase
treatment disrupts the integrity of these Jerky-containing particles.
Third, mRNP complexes captured on oligo-dT beads contain Jerky.
Together, these data indicate that Jerky is associated with mRNP
particles containing translationally inactive mRNAs.
Although these data indicated the coexistence of mRNAs and Jerky in
mRNPs, it was not known whether Jerky is directly involved in mRNA
binding within these particles. Various in vitro binding assays with purified recombinant Jerky demonstrated that Jerky can bind
mRNAs, as well as RNA homopolymers, with the exception of poly(C).
Additional filter binding experiments with Jerky-preselected mRNAs
showed a high-affinity interaction between Jerky and mRNA, suggesting
that this interaction can be biologically relevant. The low nanomolar
binding affinity of Jerky for selected mRNAs is comparable with or
exceeds the binding affinity of known RNA binding proteins, such as
HIV-1 tat (Dingwall et al., 1990 ), HuR (Nabors et al., 2001 ), and Sam68
(Lin et al., 1997 ). It is important to note that only a fraction of
mRNAs was observed to be bound to Jerky, even if the protein was in
large excess (data not shown). This indicates that Jerky is not a
"global" mRNA binding protein that binds nearly all mRNAs.
Jerky may be a "group specific" mRNA binding protein (Keene, 2001 )
that associates with a subset of the global mRNA population and that
have some sequence preference but no unique mRNA sequence recognition.
Consistent with these data, Jerky has a high affinity to poly(U) and
somewhat less to poly(G) and poly(A). Domain searches revealed no known
RNA binding motif within Jerky, and studies are under way to map the
Jerky domain(s) involved in mRNA binding.
In summary, we describe a novel function for Jerky, a protein deficient
in an animal model of inherited TLE. Specifically, Jerky is associated
with translationally inactive mRNAs in the cytoplasm of neurons, and we
hypothesize that a deficiency in Jerky leads to perturbations in the
use of a currently unknown set of mRNAs. Even small changes in the use
of mRNAs encoding channel and receptor proteins may result in
hyperexcitability and seizures. Alternatively, mRNAs of developmentally
important genes may be perturbed in Jerky-deficient mice resulting in
the formation of intrinsically hyperexcitable neuronal networks.
Indeed, it has been shown that alterations in gene expression in the
hippocampus precede and accompany the manifestation of seizures in
human and animal models of TLE (Blumcke et al., 2000 ; Murray et al.
2000 ; Brooks-Kayal et al., 2001 ). Data described here implicate that perturbations in the use of a subset of mRNAs in neurons may be a
disease mechanism in focal epilepsies.
 |
FOOTNOTES |
Received Sept. 17, 2001; revised Oct. 10, 2001; accepted Oct. 11, 2001.
This work was supported by National Institutes of Health Grant
R01NS34151 (M.T.), Cancer Pharmacology Training Grant T32 CA62948 (W.L.), and National Institute on Drug Abuse Grant DA 07274 (J.S.). We
thank Drs. J. W. Hershey (Department of Biological Chemistry, School of Medicine, University of California, Davis, Davis, CA), K. Elkon (Hospital for Special Surgery, New York, NY), and M. Wiedmann
(Cell Biology and Genetics, Sloan Kettering Institute, New York, NY)
for the eIF3, P0, and S3 antibodies, respectively. We also thank C. Li
(Rockefeller University, New York, NY) and S.W. Yun (Weill
Medical College of Cornell University) for providing us primary rat and
mouse neuronal cultures, respectively.
Correspondence should be addressed to Miklos Toth, Department of
Pharmacology, Weill Medical College of Cornell University, 1300 York
Avenue, LC 522, New York, NY 10021. E-mail:
mtoth{at}mail.med.cornell.edu.
 |
REFERENCES |
-
Berkovic SF,
Howell RA,
Hopper JL
(1994)
Familial temporal lobe epilepsy: a new syndrome with adolescent/adult onset and a benign course.
In: Epileptic seizures and syndromes (Wolf P,
ed), pp 257-263. London: Libbey.
-
Berkovic SF,
McIntosh A,
Howell RA,
Mitchell A,
Sheffield LJ,
Hopper JL
(1996)
Familial temporal lobe epilepsy: a common disorder identified in twins.
Ann Neurol
40:227-235[Web of Science][Medline].
-
Blumcke I,
Becker AJ,
Klein C,
Scheiwe C,
Lie AA,
Beck H,
Waha A,
Friedl MG,
Kuhn R,
Emson P,
Elger C,
Wiestler OD
(2000)
Temporal lobe epilepsy associated up-regulation of metabotropic glutamate receptors: correlated changes in mGluR1 mRNA and protein expression in experimental animals and human patients.
J Neuropathol Exp Neurol
59:1-10[Web of Science][Medline].
-
Brooks-Kayal AR,
Shumate MD,
Jin H,
Rikhter TY,
Kelly ME,
Coulter DA
(2001)
-Aminobutyric acid (A) receptor subunit expression predicts functional changes in hippocampal dentate granule cells during postnatal development.
J Neurochem
77:1266-1278[Web of Science][Medline]. -
Ceman S,
Brown V,
Warren ST
(1999)
Isolation of an FMRP-associated messenger ribonucleoprotein particle and identification of nucleolin and the fragile X-related proteins as components of the complex.
Mol Cell Biol
19:7925-7932[Abstract/Free Full Text].
-
Cendes F,
Lopes-Cendes I,
Andermann E,
Andermann F
(1998)
Familial temporal lobe epilepsy: a clinically heterogeneous syndrome.
Neurology
50:554-557[Abstract].
-
Cooke CA,
Bernat RL,
Earnshaw WC
(1990)
CENP-B: a major human centromere protein located beneath the kinetochore.
J Cell Biol
110:1475-1488[Abstract/Free Full Text].
-
Cutts SM,
Fowler KJ,
Kile BT,
Hii LL,
O'Dowd RA,
Hudson DF,
Saffery R,
Kalitsis P,
Earle E,
Choo KH
(1999)
Defective chromosome segregation, microtubule bundling, and nuclear bridging in inner centromere protein gene (Incenp)-disrupted mice.
Hum Mol Genet
8:1145-1155[Abstract/Free Full Text].
-
Dingwall C,
Ernberg I,
Gait MJ,
Green SM,
Heaphy S,
Karn J,
Lowe AD,
Singh M,
Skinner MA
(1990)
HIV-1 tat protein stimulates transcription by binding to a U-rich bulge in the stem of the TAR RNA structure.
EMBO J
9:4145-4153[Web of Science][Medline].
-
Dobbelstein M,
Shenk T
(1995)
In vitro selection of RNA ligands for the ribosomal L22 protein associated with Epstein-Barr virus-expressed RNA by using randomized and cDNA-derived RNA libraries.
J Virol
69:8027-8034[Abstract].
-
Donovan GP,
Harden C,
Gal J,
Ho L,
Sibille E,
Trifiletti R,
Gudas LJ,
Toth M
(1997)
Sensitivity to jerky gene dosage underlies epileptic seizures mice.
J Neurosci
17:4562-4569[Abstract/Free Full Text].
-
Earnshaw WC,
Rothfield N
(1985)
Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma.
Chromosoma
91:313-321[Web of Science][Medline].
-
Earnshaw WC,
Sullivan KF,
Machlin PS,
Cooke CA,
Kaiser DA,
Pollard TD,
Rothfield NF,
Cleveland DW
(1987)
Molecular cloning of cDNA for CENP-B, the major human centromere autoantigen.
J Cell Biol
104:817-829[Abstract/Free Full Text].
-
Falconer MA,
Serafetinides EA,
Corsellis JA
(1964)
Etiology and pathogenesis of temporal lobe epilepsy.
Arch Neurol
10:233-348.
-
Feng Y,
Absher D,
Eberhart DE,
Brown V,
Malter HE,
Warren ST
(1997)
FMRP associates with polyribosomes as an mRNP, and the I304N mutation of severe fragile X syndrome abolishes this association.
Mol Cell
1:109-118[Web of Science][Medline].
-
Fowler KJ,
Hudson DF,
Salamonsen LA,
Edmondson SR,
Earle E,
Sibson MC,
Choo KH
(2000)
Uterine dysfunction and genetic modifiers in centromere protein B-deficient mice.
Genome Res
10:30-41[Abstract/Free Full Text].
-
Gambardella A,
Annesi G,
De Fusco M,
Patrignani A,
Aguglia U,
Annesi F,
Pasqua AA,
Spadafora P,
Oliveri RL,
Valentino P,
Zappia M,
Ballabio A,
Casari G,
Quattrone A
(2000)
A new locus for autosomal dominant nocturnal frontal lobe epilepsy maps to chromosome 1.
Neurology
55:1467-1471[Abstract/Free Full Text].
-
Guan KL,
Dixon JE
(1991)
Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal Biochem
192:262-267[Web of Science][Medline].
-
Hall KB,
Kranz JK
(1999)
Nitrocellulose filter binding for determination of dissociation constants.
Methods Mol Biol
118:105-114[Medline].
-
Howman EV,
Fowler KJ,
Newson AJ,
Redward S,
MacDonald AC,
Kalitsis P,
Choo KH
(2000)
Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice.
Proc Natl Acad Sci USA
97:1148-1153[Abstract/Free Full Text].
-
Hudson DF,
Fowler KJ,
Earle E,
Saffery R,
Kalitsis P,
Trowell H,
Hill J,
Wreford NG,
de Kretser DM,
Cancilla MR,
Howman E,
Hii L,
Cutts SM,
Irvine DV,
Choo KH
(1998)
Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.
J Cell Biol
141:309-319[Abstract/Free Full Text].
-
Ikeda A,
Kunieda T,
Miyamoto S,
Fukuyama H,
Shibasaki H
(2000)
Autosomal dominant temporal lobe epilepsy in a Japanese family.
J Neurol Sci
176:162-165[Web of Science][Medline].
-
International Human Genome Sequencing Consortium
(2001)
Initial sequencing and analysis of the human genome.
Nature
409:860-921[Medline].
-
Kapoor M,
Montes de Oca Luna R,
Liu G,
Lozano G,
Cummings C,
Mancini M,
Ouspenski I,
Brinkley BR,
May GS
(1998)
The cenpB gene is not essential in mice.
Chromosoma
107:570-576[Web of Science][Medline].
-
Keene JD
(2001)
Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome, the proteome.
Proc Natl Acad Sci USA
98:7018-7024[Abstract/Free Full Text].
-
Lin Q,
Taylor SJ,
Shalloway D
(1997)
Specificity and determinants of Sam68 RNA binding: implications for the biological function of K homology domain.
J Biol Chem
272:27274-27280[Abstract/Free Full Text].
-
Liu W,
Yoon J,
Burg M,
Chen L,
Pak WL
(1995)
Molecular characterization of two Drosophila guanylate cyclases expressed in the nervous system.
J Biol Chem
270:12418-12427[Abstract/Free Full Text].
-
Moore T,
Hecquet S,
McLellann A,
Ville D,
Grid D,
Picard F,
Moulard B,
Asherson P,
Makoff AJ,
McCormick D,
Nashef L,
Froguel P,
Arzimanoglou A,
LeGuern E,
Bailleul B
(2001)
Polymorphism analysis of JRK/JH8, the human homologue of mouse jerky, and description of a rare mutation in a case of CAE evolving to JME.
Epilepsy Res
46:157-167[Web of Science][Medline].
-
Morita R,
Miyazaki E,
Fong CY,
Chen XN,
Korenberg JR,
Delgado-Escueta AV,
Yamakawa K
(1998)
JH8, a gene highly homologous to the mouse jerky gene, maps to the region for childhood absence epilepsy on 8q24.
Biochem Biophys Res Commun
248:307-314[Medline].
-
Muro Y,
Masumoto H,
Yoda K,
Nozaki N,
Ohashi M,
Okazaki T
(1992)
Centromere protein B assembles human centromeric alpha-satellite DNA at the 17-bp sequence, CENP-B box.
J Cell Biol
116:585-596[Abstract/Free Full Text].
-
Murray KD,
Isackson PJ,
Eskin TA,
King MA,
Montesinos SP,
Abraham LA,
Roper SN
(2000)
Altered mRNA expression for brain-derived neurotrophic factor and type II calcium/calmodulin-dependent protein kinase in the hippocampus of patients with intractable temporal lobe epilepsy.
J Comp Neurol
418:411-422[Web of Science][Medline].
-
Nabors LB,
Gillespie GY,
Harkins L,
King PH
(2001)
HuR, a RNA stability factor, is expressed in malignant brain tumors, binds to adenine-, uridine-rich elements within the 3' untranslated regions of cytokine, angiogenic factor mRNAs
Cancer Res
61:2154-2161[Abstract/Free Full Text].
-
Papa M,
Bundman MC,
Greenberger V,
Segal M
(1995)
Morphological analysis of dendritic spine development in primary cultures of hippocampal neurons.
J Neurosci
15:1-11[Abstract].
-
Perez-Castro AV,
Shamanski FL,
Meneses JJ,
Lovato TL,
Vogel KG,
Moyzis RK,
Pedersen R
(1998)
Centromeric protein B null mice are viable with no apparent abnormalities.
Dev Biol
201:135-143[Web of Science][Medline].
-
Picard F,
Baulac S,
Kahane P,
Hirsch E,
Sebastianelli R,
Thomas P,
Vigevano F,
Genton P,
Guerrini R,
Gericke CA,
An I,
Rudolf G,
Herman A,
Brice A,
Marescaux C,
LeGuern E
(2000)
Dominant partial epilepsies: a clinical, electrophysiological and genetic study of 19 Eur families.
Brain
123:1247-1262[Abstract/Free Full Text].
-
Poza JJ,
Saenz A,
Martinez-Gil A,
Cheron N,
Cobo AM,
Urtasun M,
Marti-Masso JF,
Grid D,
Beckmann JS,
Prud'homme JF,
Lopez de Munain A
(1999)
Autosomal dominant lateral temporal epilepsy: clinical and genetic study of a large Basque pedigree linked to chromosome 10q.
Ann Neurol
45:182-188[Web of Science][Medline].
-
Saenz A,
Galan J,
Caloustian C,
Lorenzo F,
Marquez C,
Rodriguez N,
Jimenez MD,
Poza JJ,
Cobo AM,
Grid D,
Prud'homme JF,
Lopez de Munain A
(1999)
Autosomal dominant nocturnal frontal lobe epilepsy in a Spanish family with a Ser252Phe mutation in the CHRNA4 gene.
Arch Neurol
56:1004-1009[Abstract/Free Full Text].
-
Sullivan KF,
Glass CA
(1991)
CENP-B is a highly conserved mammalian centromere protein with homology to the helix-loop-helix family of proteins.
Chromosoma
100:360-370[Web of Science][Medline].
-
Toth M,
Grimsby J,
Buzsaki G,
Donovan GP
(1995)
Epileptic seizures caused by inactivation of a novel gene, jerky, related to centromere binding protein-B in transgenic mice.
Nat Genet
11:71-75[Web of Science][Medline].
-
Yoda K,
Kitagawa K,
Masumoto H,
Muro Y,
Okazaki T
(1992)
A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity.
J Cell Biol
119:1413-1427[Abstract/Free Full Text].
Copyright © 2002 Society for Neuroscience 0270-6474/02/221176-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
G. L. Cavalleri, J. M. Lynch, C. Depondt, M.-W. Burley, N. W. Wood, S. M. Sisodiya, and D. B. Goldstein
Failure to replicate previously reported genetic associations with sporadic temporal lobe epilepsy: where to from here?
Brain,
August 1, 2005;
128(8):
1832 - 1840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Glasscock and M. A. Tanouye
Drosophila couch potato Mutants Exhibit Complex Neurological Abnormalities Including Epilepsy Phenotypes
Genetics,
April 1, 2005;
169(4):
2137 - 2149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Zdobnov, Món. Campillos, E. D. Harrington, D. Torrents, and P. Bork
Protein coding potential of retroviruses and other transposable elements in vertebrate genomes
Nucleic Acids Res.,
February 16, 2005;
33(3):
946 - 954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Bailey and M. Toth
Variability in the Benzodiazepine Response of Serotonin 5-HT1A Receptor Null Mice Displaying Anxiety-Like Phenotype: Evidence for Genetic Modifiers in the 5-HT-Mediated Regulation of GABAA Receptors
J. Neurosci.,
July 14, 2004;
24(28):
6343 - 6351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Liu, J. Seto, E. Sibille, and M. Toth
The RNA Binding Domain of Jerky Consists of Tandemly Arranged Helix-Turn-Helix/Homeodomain-Like Motifs and Binds Specific Sets of mRNAs
Mol. Cell. Biol.,
June 15, 2003;
23(12):
4083 - 4093.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|