 |
Previous Article | Next Article 
The Journal of Neuroscience, January 1, 2002, 22(1):218-225
Zic2 Controls Cerebellar Development in Cooperation
with Zic1
Jun
Aruga1,
Takashi
Inoue1, 2,
Jun
Hoshino1, 2, and
Katsuhiko
Mikoshiba1, 2
1 Laboratory for Developmental Neurobiology,
RIKEN Brain Science Institute, Wako-shi, Saitama 351-0198, Japan, and 2 Department of Molecular Neurobiology,
Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo
108-8639, Japan
 |
ABSTRACT |
Mouse Zic genes encode zinc finger proteins and are
expressed in the developing and mature CNS. Reduced expression
of Zic2 in mice results in spina bifida and
holoprosencephaly. However, the disruption of Zic1, a
strong homolog of Zic2 that has an overlapping expression pattern, results in cerebellar malformation with no apparent
abnormalities in the forebrain or in posterior neuropore closure. Here
we revealed that Zic2 and Zic1
cooperatively control cerebellar development by regulating neuronal
differentiation. Both Zic1 and Zic2 are
expressed in the precursor cells of the granule neuron and the
neurons in cerebellar nuclei. Mice carrying one mutated
Zic1 allele together with one mutated
Zic2 allele (Zic1+/ Zic2+/kd)
showed a marked cerebellar folial abnormality similar to, but distinct
from that found in mice homozygous for the Zic1 mutation (Zic1 / ). The
Zic1+/ Zic2+/kd
cerebellum is missing a lobule in the anterior vermis and has a
truncation of the most posterior lobule. Expression of transverse zonal
markers is shifted anteriorly in the developing cerebellum, indicating
that the anterior part of the cerebellum is poorly developed.
Abnormalities in the developing
Zic1+/ Zic2+/kd
cerebellum share the following features with those of the
Zic1 / cerebellum: a
preceding reduction of cell proliferation in the anterior external
germinal layer, a reduction in cyclin D1 expression, and
enhanced expression of the mitosis inhibitors p27 and
p16, and enhancement of Wnt7a expression.
These results indicate that Zic1 and Zic2 may
have very similar functions in the regulation of cerebellar development.
Key words:
Zic1; Zic2; transcription
factor; cerebellum; cerebellar foliation; neuronal differentiation
 |
INTRODUCTION |
The mammalian cerebellum is composed
of multiple folia and fissures that show a uniform and predictable
pattern within a given species (Altman and Bayer, 1997 ; Voogd, 1998 ).
This elaborate pattern of foliation involves the coordinated expression
of genes within specific locations in the developing neural tube.
Recent studies using genetically modified mice have revealed several genes controlling cerebellar development (Hatten et al., 1997 ; Herrup
and Kuemerle, 1997 ; Wassef and Joyner, 1997 ; Goldowitz and Hamre,
1998 ).
Mouse Zic1 is one of the genes controlling cerebellar
development (Aruga et al., 1994 ; 1998 ). Zic1 is expressed in
the dorsal neural tube and its derivatives and is strongly expressed in
the developing and mature cerebellum. In the Zic1-deficient
(Zic1 / ) mice, the
cerebella are hypoplastic, and their folia are malformed. The
abnormalities are closely related to the loss of granule cells, which
is most dramatic in the anterior vermis.
Several other Zic-related genes have also been identified
and implicated in neural development in mice and other species. Among
the mouse Zic genes, Zic2 is most similar to
Zic1 (Aruga et al., 1996 ) and is expressed in overlapping
regions (Nagai et al., 1997 ). However, the phenotypes of the mutant
mice with reduced expression of Zic2
(Zic2kd/kd; kd,
knock-down) are rather different from those of
Zic1-defienct mice. The
Zic2kd/kd mice show holoprosencephaly and
spina bifida (Nagai et al., 2000 ), which derive from malformations in
the anterior and posterior ends of the neural tube, respectively. The
apparent differences in the mutant phenotypes raise the question of
whether Zic1 and Zic2 are functionally related.
To address this question, we first examined the cerebellar
abnormalities in the Zic2kd/kd mice.
Because these mice die just after birth with severe brain deformities,
we were not able to detect any abnormalities similar to those of
Zic1-deficient mice. As many vertebrate genes can be
functionally compensated by structurally related genes, we started
generating mice with Zic1/Zic2 compound
mutations. Mice carrying mutations in one allele of Zic1 and
one allele of Zic2 (Zic1+/ Zic2+/kd)
showed a behavioral abnormality with cerebellar malformation. This
indicates that mouse Zic2 is involved in cerebellar
patterning in cooperation with Zic1.
Furthermore, a number of genes controlling cell proliferation and
differentiation are deregulated in the cerebella of both Zic1+/ Zic2+/kd
and Zic1 / mice, suggesting
that both Zic1 and Zic2 function upstream of these genes to regulate cerebellar development.
 |
MATERIALS AND METHODS |
Mutant mice. Mice heterozygous for the
Zic1 "null" mutation (Aruga et al., 1998 ) were
backcrossed onto C57BL/6 mice 7-10 times, and mice heterozygous for
the Zic2 "knock-down" mutation (Nagai et al., 2000 ) were
backcrossed four or five times. These backcrossed mice were then used
in subsequent matings. Mice were genotyped and maintained as described
(Aruga et al., 1998 ; Nagai et al., 2000 ). Noon of the day on which
vaginal plugs were first observed in the morning was defined as
embryonic day 0.5 (E0.5). The mice were maintained by the Advanced
Technology Development Center, RIKEN Brain Science Institute and
Division of Experimental Animal Research, Tsukuba Life Science Center,
RIKEN. All animal experiments were done according to the guidelines for
animal experimentation in RIKEN.
Histology and morphometric analysis. For histological
examination, tissue was fixed in Bouin's fixative and processed for paraffin sections and stained with hematoxylin and eosin. The morphometric analysis was performed as described (Aruga et al., 1998 ).
Serial sagittal sections (6 µm) were prepared, and the most
comparable sets of sections was selected for the analysis. All the
pictures were first digitized by Fuji HC-2500 3CCD camera. The areas
were measured using density slice function of NIH Image program
(developed at the National Institutes of Health, Bethesda, MD;
available on the Internet at http://rsb.info.nih.gov/nih-image/). EGL length was calculated by the same software, measuring manually fitted curves on the EGL. The subjects for the morphometric analysis in
this study were two sets of
(Zic1+/+,
Zic2+/+),
(Zic1+/ ,
Zic2+/+),
(Zic1+/+,
Zic2+/kd), and
(Zic1+/ ,
Zic2+/kd) at postnatal day 16 (P16), three pairs
of Zic2+/+ and
Zic2+/kd, and two pairs of
Zic2+/+ and
Zic2+/kd at 1 year old. Each set or pair
was derived from the same litter.
In situ hybridization and immunohistochemistry. In situ
hybridization was performed as described (Nagai et al., 1997 ) with Zic1, Zic2, and En2 probes (Aruga et
al., 1994 , 1998 ; Nagai et al., 1997 ). Cryosections were prepared at 10 µm. Adjacent sections were used in hybridizations to compare the
distribution of two different transcripts.
For immunohistochemical staining, cryosections were incubated for 12 hr
at 4°C with antibody binding solution consisting of primary antibody
[anti-calbindin (Chemicon, Temecula, CA), anti-Eph3 (Santa Cruz
Biotechnology, Santa Cruz, CA), anti- III tubulin (Promega, Madison,
WI), anti-p16 (Santa Cruz Biotechnology), and anti-phospho-histone H3
antibody (Upstate Biotechnology, Lake Placid, NY)], 2% normal goat
serum, and 0.1% Triton X-100 in PBS. The bound primary antibody was
detected by Cy3-conjugated anti-rabbit IgG, TRITC-conjugated anti-mouse
IgG (Jackson ImmunoResearch, West Grove, PA), or a vector stain ABC kit
(Vector Laboratories, Burlingame, CA). Immunohistochemical staining
with anti-phospho-histone H3 antibody was performed on four pairs of
(Zic1+/+,
Zic2+/+) and
(Zic1+/ ,
Zic2+/kd) embryos. Five comparable sections were
prepared from each embryo, and the mean number of the labeled cells
were calculated. Statistical significance was determined using a
t test. P values < 0.05 were considered significant.
RT-PCR analysis. E17.5 cerebella from each genotype were
excised and frozen in liquid nitrogen. Cerebellar peduncles were trimmed, and pia maters were peeled off before freezing. Total RNA was
isolated using Trizol reagent (Life Technologies, Gaithersburg, MD). After DNaseI treatment, reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies). Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) expression was measured to monitor RNA recovery. RT-PCR was performed after they were
in the log-linear phase of the amplification curve at the indicated
cycles. The PCR cycles, annealing temperature, and primer sequences
are: G3PDH, 23 cycles, 68°C, 5'
CCGGTGCTGAGTATGTCGTGGAGTCTAC 3' and 5' CTTTCCAGAGGGGCCATCCACAGTCTTC 3';
cyclin D1, 30 cycles, 55°C, 5' AACTACCTGGACCGCTTCCT 3' and
5' CCACTTGAGCTTGTTCACCA 3'; cyclin D2, 26 cycles, 55°C, 5'
AGACCCATCTTCAGCTCCTG 3' and 5' TGCTCAATGAAGTCGTGAGG 3'; p27,
30 cycles, 55°C, 5' CTGTGTGCAGTCGCAGAACT 3' and 5'
CCAGGGGCTTATGATTCTGA 3'; and Wnt7a, 32 cycles, 55°C, 5'
CACAGTTCCGAGAGCTAGGC 3' and 5' CCTGTCACTGGGTCCTCTTC 3'.
 |
RESULTS |
Expression of mouse Zic2 in the
developing cerebellum
We have previously shown the expression pattern of Zic2
at times earlier than E14 (Nagai et al., 1997 ). To clarify the role of
Zic2 in cerebellar development, we first examined the
expression of Zic2 at later stages (Fig.
1), compared with that of
Zic1. Sagittal sections of E16 and E18 brains showed very
similar expression patterns for the two genes (Fig.
1K,L,O,P), both being strongly expressed in the
external germinal layer (EGL) and rhombic lip of the cerebellum and
pons in the hindbrain structure. In the telencephalon and
mesencephalon, they are expressed in the medial septal nucleus, the
thalamic nuclei, and preoptic nucleus.

View larger version (111K):
[in this window]
[in a new window]
|
Figure 1.
The expression of Zic1 and
Zic2 in the developing cerebellum. In
situ hybridization was performed on coronal
(A-H), horizontal (I, J, M,
N), and sagittal (K, L, O, P) sections of
E16 (A, B, E, F, I, K, L, M, O, P) and E18 (C, D,
G, H, J, N) wild-type cerebella with Zic2
(A-D, I-L) and Zic1 (E-H,
M-P) probes. B, D,
F, and H are higher magnifications of
A, C, E, and
G, respectively. Zic1 and
Zic2 are expressed in a similar pattern. A significant
difference between Zic1 and Zic2
expression was found in the vermal (medial) intermediate region
(I, J, M, N). Asterisks in
K and O indicate midsagittal expression
in I and M, respectively.
EGL, External germinal cell layer; MS,
medial septum; PN, pontine nuclei; PO,
preoptic nuclei, TN, thalamic nuclei.
|
|
In coronal sections of the same stage, there was a region expressing
Zic1 and Zic2 in the midline of the cerebellum
that was widest at the ventral part of the cerebellar anlagen (Fig.
1A-H). In horizontal sections at E18,
Zic2 expression is composed of three lines, whereas
Zic1 was expressed in a single region that was strongest in
the midline (Fig. 1J,N). They are similarly
expressed at E16 (Fig. 1I,M). The midline
expression of Zic1 and Zic2 corresponds to a weak
but significant expression in the center of the cerebellar primordia in
the midsagittal sections (Fig. 1K,O, asterisk). Along the anterior-posterior (AP) axis, Zic1 is more specifically
expressed in the midline of the anterior region. In the mature brain,
Zic2 and Zic1 are expressed in almost identical
patterns (Aruga et al., 1998 ; data not shown).
The cerebellar abnormalities in the
Zic1+/ Zic2+/kd
mice
We next examined cerebellar phenotypes of the Zic2
knock-down mice (Zic2kd/kd). In the
wild-type E16 cerebellum, the left and right cerebellar plates are
fusing at the midlines, and one can normally observe a shallow groove
at the ventral side of the cerebellar primordia in coronal section
(Fig. 2A). There was a
narrow groove at the midline of the
Zic2kd/kd cerebellum (Fig. 2C),
and the ventricular spaces and the subarachnoid space were markedly
reduced. In contrast to these gross morphological abnormalities, there
was no obvious histological abnormality (Fig. 2B,D).
Zic2kd/kd mice had shrinkage or dilatation
of the ventricles at the later embryonic stages, which may have been
caused by disturbed CSF circulation because of major neural tube
anomalies present (spina bifida, holoprosencephaly, and exencephaly)
(data not shown).

View larger version (163K):
[in this window]
[in a new window]
|
Figure 2.
Cerebellar phenotype in Zic2
knock-down mice. Coronal (A, C) and sagittal (B,
D) hematoxylin and eosin-stained sections were prepared
from E16 wild-type (Zic2+/+)
(A, B) and Zic2kd/kd
(C, D) embryos. The distorted shape suggests oppression,
which is probably caused by disturbed CSF circulation. It is difficult
to judge whether Zic2 has a primary role in the
cerebellar development, from Zic2kd/kd
phenotypes. CN, Cerebellar nuclei forming cells;
EGL, external germinal cell layer.
|
|
Because the Zic2kd/kd phenotype was less
informative about the role of Zic2 in cerebellar
development, we next asked whether Zic2 may act in
cooperation with Zic1. To address this question, we started
generating Zic1/Zic2 compound mutant mice. This
was possible because Zic1 and Zic2 are located on
different chromosomes (chromosome 9 and 14, respectively). Initially,
we had planned matings between Zic1+/ Zic2+/kd
mice to obtain double homozygous mutant mice. However, the
Zic1+/ Zic2+/kd
mice had a poor survival rate. The frequency of the genotypes obtained
by the mating between Zic1+/ and
Zic2+/kd mice were:
Zic1+/ Zic2+/kd,
8%;
Zic1+/ Zic2+/+,
29%;
Zic1+/+Zic2+/kd,
29% and
Zic1+/+Zic2+/+,
34% (n = 115) at 4 weeks after birth. In addition, the
Zic1+/ Zic2+/kd
mice frequently showed hydrocephalus (four of nine at 4 weeks) and
always showed a gait and postural abnormalities. We therefore gave up
mating between
Zic1+/ Zic2+/kd
mice and investigated the abnormalities appearing in the
Zic1+/ Zic2+/kd mice.
First, the mature brain was examined macroscopically. There was a
marked change in the fissure pattern in the cerebellum. The mutant
cerebellum apparently lacks the primary fissure in the vermis and
posterior superior fissure in the hemisphere (Fig. 3). Comparison of parasagittal sections
through the median vermis and the hemisphere indicated that a lobule in
the anterior lobe was missing (Fig. 4).
Although folial identities are not conclusive at this point, we
assigned presumable numbers to the lobules, as in Figures 2,
B and C, and 3D. The elongated lobule
VI covers the anterior lobe, whereas lobule IX is stubbed in comparison with the wild type. In Zic1+/
mice, lobule V was slightly smaller than the wild type, consistent with
a previous study (Aruga et al., 1998 ), whereas the
Zic2+/kd did not show any significant
alterations (Fig. 4C,E). Foliation patterning in the
cerebellar hemisphere was also altered in the Zic1+/ Zic2+/kd
mice (Fig. 4D, right). In this case, the position of
simple lobules shifted anteriorly, and the CrusI of the ansiform lobule
extended anteriorly in a similar manner to the change in lobule VI of
the vermis.

View larger version (57K):
[in this window]
[in a new window]
|
Figure 3.
Macroscopic observation of the
Zic1+/ Zic2+/kd
cerebella. Cerebella from wild-type
(Zic1+/+Zic2+/+)
(A) and
Zic1+/ Zic2+/kd
(B, C) at P17 are seen from dorsoposterior (A,
B) or posterior (C) direction. Folial
patterns are markedly altered in the
Zic1+/ Zic2+/kd,
different from that of
Zic1 / . Vermis lobules
are indicated by V-IX. a, Anterior
colliculus; p, posterior colliculus; CI,
CrusI lobule; CII, CrusII lobule; S,
simplex lobule; P, paramedian lobule. Scale bar, 5 mm.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
Figure 4.
Comparison of the cerebellar folial patterns
in sections. Sagittal sections through cerebellar vermis
(left) and hemisphere (right) from
Zic1+/+Zic2+/+
(A),
Zic1+/ Zic2+/+
(B),
Zic1+/+Zic2+/kd
(C),
Zic1+/ Zic2+/kd
(D), and
Zic1 / Zic2+/+
(E), at P16 (A-D) or 3 weeks (E) mice. Vermis lobules are indicated by
III-X. A, Anterior lobe;
CI, CrusI lobule; CII, CrusII lobule;
S, simplex lobule; PM, paramedian lobule;
P, pyramidis. Asterisks indicate dorsal
(*) and ventral (**) paraflocculus lobules. Circles
indicate abnormally located lobules, which are not assigned at this
point.
|
|
These features are essentially similar to the folial abnormality in the
Zic1 / cerebellum (Aruga et
al., 1998 ) in that a lobule in the anterior lobe is missing. However,
there are some differences. First, the cerebellum in the
Zic1+/ Zic2+/kd
mouse is not as small as that in the
Zic1 / mouse, which shows a
greater reduction in the medial to lateral aspect. Second, the
extension of lobule VI was greater than that seen in the
Zic1 / cerebellum. Third,
the truncation of lobule IX is observed only in
Zic1+/ Zic2+/kd
cerebella. This feature produces a steep posterior face of the cerebellar mass (Fig. 3B,C).
Morphometric analysis was used to quantitatively evaluate differences
in the mutants. In young adults, there was a reduction in the area of
the granule cell layer in Zic1+/
(Fig. 5), consistent with a previous
study (Aruga et al., 1998 ). In the
Zic2+/kd, there was a slight reduction of
the granule cell layer area of the hemisphere. A slight reduction in
the hemisphere was also observed in 1-year-old
Zic2+/kd cerebellum (data not shown). In
contrast to the cerebella of single mutants, the
Zic1+/ Zic2+/kd
cerebella showed a marked reduction in the area of both granule cell
layer and molecular layer. The reduction was more than that of single
mutants. The area (mass) reduction reflected a decrease in the number
of granule cells because the cell density of the granule cell layer was
not changed
(Zic1+/+Zic2+/+,
4.4 × 105 ± 2.5 × 104
(cells/mm2);
Zic1+/ Zic2+/+,
4.3 × 105 ± 4.9 × 104;
Zic1+/+Zic2+/kd,
4.3 × 105 ± 5.0 × 104;
Zic1+/ Zic2+/kd,
4.2 × 105 ± 5.0 × 104).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5.
Morphometric analyses of the mutant cerebella. The
areas of the granular cell layer (GCL) and the molecular
layer (ML) in midsagittal (vermis) and
parasagittal sections through hemisphere (hemisphere) were
measured. The cerebella were derived from P16 single litter. The areas
are indicated in square millimeters. The error bars indicate SD.
White bar,
Zic1+/+Zic2+/+
(+/+); black bar,
Zic1+/ Zic2+/kd
(Z1/Z2); hatched bar,
Zic1+/ Zic2+/+
(Z1/+); stippled bar,
Zic1+/+Zic2+/kd
(+/Z2); *p < 0.05; **p < 0.01.
|
|
In contrast to the folial pattern abnormalities, laminar organization
of the cerebellar cortex is not disturbed, and the Purkinje and granule
cell markers were expressed properly (data not shown), indicating that
lineage-specific differentiation occurs normally in
Zic1+/ Zic2+/kd mice.
Abnormalities in the developing cerebella
To understand how these malformations occurred, we examined
the developing cerebella. At E18, the folial pattern of the
Zic1+/ Zic2+/kd
was distinct from the wild type (Fig.
6C,D). The primary
fissure was located anteriorly in the cerebellum. Correspondingly, the immature Purkinje cells, which were aligned in a defined pattern along
the AP axis, were shifted anteriorly, resulting in the shorter anterior
segment (Fig. 6E,F). These features are
similar to those of Zic1 /
mice (Fig. 6A,B). The folial pattern abnormality
could be traced back to E17.5 when the position of the initial primary
fissure was located more anteriorly in the
Zic1+/ Zic2+/kd
(data not shown). Ephrin receptors are differentially expressed along
the AP axis in the cerebellar primordium (Rogers et al., 1999 ). The
EphA3 receptor, which is usually expressed in the lobule VI region, was
detected more anteriorly at E16.5 (Fig. 6G,H). We
therefore concluded that the cerebellar patterning along AP axis had
been differentially established at this point.

View larger version (80K):
[in this window]
[in a new window]
|
Figure 6.
Anterior to posterior patterning abnormality found
in the
Zic1+/ Zic2+/kd
cerebella. Sagittal sections from E18 (A-F) and
E16 (G, H) cerebella of
Zic1+/+Zic2+/+
(A, C, E, G),
Zic1 / Zic2+/+
(B), and
Zic1+/ Zic2+/kd
(D, F, H). A, C,
E, and G are the littermates of
B, D, F, and
H, respectively. A-D, Hematoxylin and
eosin staining; E, F, immunohistochemical
staining using anti-calbindin antibody (immature Purkinje cells).
Arrowheads indicate the corresponding posterior and
anterior boundaries of the clusters of Purkinje cells.
G, H, Anti-EphA3 antibody staining, which
stains a transversal zone corresponding to prospective lobule VII.
Arrowheads indicate the strongly stained zone in each
panel. I, J, Coronal sections of E18
Zic1+/+Zic2+/+
(I) and
Zic1+/ Zic2+/kd
(J) embryos. K, L, En2
expression in the E17 horizontal section of
Zic1+/+Zic2+/+
(K) and
Zic1+/ Zic2+/kd
(L) are shown by in situ
hybridization. Note that the anterior region is reduced, as indicated
by the folial and the marker expression patterns, whereas there are no
apparent abnormalities in the medial to lateral patterning.
|
|
We also examined the patterning abnormality along the medial to
lateral axis. At E18, a comparison of coronal sections revealed poorly
formed foliations in the hemisphere of the
Zic1+/ Zic2+/kd
cerebella without obvious alteration in medial to lateral extension of
the cerebellar mass or the location of the cerebellar nuclei (Fig.
6I,J). En2 is expressed in three
parasagittal stripes in horizontal sections of the cerebellar
primordium (Millen et al., 1995 ). This three-striped pattern was also
evident in the
Zic1+/ Zic2+/kd
cerebellum (Fig. 6K,L), suggesting that the medial to
lateral pattern was not grossly affected in the cerebellar primordium. Taken together, these findings indicate a definite patterning abnormality along the AP axis in the
Zic1+/ Zic2+/kd cerebellum.
The reduced proliferation in the EGL underlies the
Zic1+/ Zic2+/kd
cerebellar abnormality
Our previous study on
Zic1 / mice showed that
proliferating granule cell precursor levels were decreased in the EGL
(Aruga et al., 1998 ). To examine whether a similar change occurs in
Zic1+/ Zic2+/kd,
numbers of mitotic cells were compared. At E16, mitotic cells were
decreased in the EGL, but not in the intermediate zone or the
ventricular zone (Fig. 7A). At
E17.5, the greatest difference was seen in the EGL anterior to the
primary fissure (Fig. 7B). In contrast to the anterior EGL
segment, the reductions in the posterior segment were slight. Mitotic
cell number per a unit length (1 mm) was significantly decreased only
in the E16 EGL (Fig. 7C), suggesting that the reduction of
the total mitotic cell numbers at E17 reflects an impaired cell
proliferation at the preceding stage. In contrast to the abnormality in
cell proliferation, there was no change in cell death frequency (data
not shown). These results indicate that a reduction in proliferating
granule cell precursors is a notable feature in the
Zic1+/ Zic2+/kd
cerebellum.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 7.
Proliferating cell numbers in the
Zic1/Zic2 cerebellum. Cells stained with
anti-phospho-histone H3 antibodies (mitotic cells) were counted in the
indicated regions of the E16 (A) and E17
(B) cerebellar sagittal sections. The ordinate
indicates the mean number of the labeled cells per section. In
C, mean numbers of the labeled cells in 1 mm of the EGL
are indicated. The error bars indicate SD. ant EGL,
Anterior EGL; post EGL, posterior EGL;
VL, ventricular layer; int
(intermed), intermediate zone that includes the area in
the cerebellar primorium except EGL and VL; +/+,
Zic1+/+Zic2+/+;
Z1/Z2,
Zic1+/ Zic2+/kd;
**p < 0.01
|
|
Progression of neuronal cell differentiation is de-regulated in the
Zic1 / and
Zic1+/ Zic2+/kd cerebella
Recent studies revealed several genes controlling cerebellar
development. We tested their expression in the
Zic1 / and
Zic1+/ Zic2+/kd
mice to evaluate their relationship with Zic proteins. Transcript levels of cyclin D1, cyclin D2, p27,
and Wnt7a were quantitated in the cerebella of E17.5
Zic1+/ Zic2+/kd,
Zic1 / and their littermate
wild-type controls (Fig. 8).
D-cyclins are thought to drive cell cycle
progression by regulating the phosphorylation of cellular substrates by
the cyclin-dependent kinases Cdk4 and Cdk6 (Sherr and Roberts, 1999 ).
Cyclin D1 levels were clearly decreased both in the
Zic1+/ Zic2+/kd
and Zic1 / cerebella,
whereas the amount of cyclin D2 was not significantly changed. On the other hand, the Cdk inhibitor p27, which
stops proliferation of granule cell precursors (Miyazawa et al., 2000 ), was increased in Zic1 / and
slightly increased in
Zic1+/ Zic2+/kd.
In addition, expression of Wnt7a, which is usually expressed in the granule neurons postnatally (Lucas and Salinas, 1997 ), was
prematurely enhanced both in
Zic1+/ Zic2+/kd
and Zic1 / .

View larger version (47K):
[in this window]
[in a new window]
|
Figure 8.
Genes controlling cerebellar development are
deregulated in the
Zic1 / and
Zic1+/ Zic2+/kd
cerebella. RT-PCR analysis was performed on cDNAs prepared from
cerebella of E17.5
Zic1 / and
Zic1+/ Zic2+/kd
and their littermate wild-type controls. G3PDH is a
ubiquitously expressed gene. In the absence of reverse transcriptase
[G3PDH (-RT)], no bands are detected, ensuring the
absence of DNA. Amounts of cyclin D1, cyclin
D2, p27, and Wnt7a transcripts
were compared.
|
|
To further examine whether neuronal differentiation is affected, we
performed immunohistochemical staining on the E15 cerebella. We
detected a significant change in the distribution of the III tubulin
protein, which is a marker of the differentiated neuron. In the
Zic1 / cerebellum, the region of clustered
cerebellar nuclei forming cells where both the Zic1 and
Zic2 transcripts were detected (Fig. 1K,O)
was more strongly stained with the anti- III tubulin antibody than
the wild-type control (Fig.
9A,B). Corresponding
areas contained more strongly p16-immunopositive cells (Fig.
9C,D). The
Zic1+/ Zic2+/kd
cerebella showed a slightly enhanced distribution of III tubulin protein in the corresponding region (data not shown). These results indicate that premature neuronal differentiation occurs in both Zic1+/ Zic2+/kd
and Zic1 / cerebella at
this stage.

View larger version (152K):
[in this window]
[in a new window]
|
Figure 9.
Premature neuronal differentiation occurs in the
Zic1 / cerebella.
Immunohistochemical staining showing localization of III tubulin
(A, B) and p16 (C, D) proteins were
examined in the in E16 cerebella of
Zic1 / . Wild-type
littermates (A, C) are shown as controls for
B and D, respectively. The area
surrounded by the arrowheads indicates the corresponding
region between the mutants and wild-type controls, which showed
significant differences.
|
|
 |
DISCUSSION |
Functional cooperation between Zic1 and
Zic2 in cerebellar development
This study investigated the involvement of Zic2 in
cerebellar development by generating
Zic1+/ Zic2+/kd
mutant mice. The Zic1+/ and
Zic2+/kd cerebella were almost
indistinguishable from wild type, although a subtle reduction of the
size was observed in both the
Zic1+/ and
Zic2+/kd. In contrast, the
Zic1+/ Zic2+/kd
cerebellum was abnormal and distinct from wild type. This is the first
evidence for the cooperative role of the Zic family of genes in
vertebrate development. Besides the cerebellar abnormality, Zic1+/ Zic2+/kd
mice also showed changes in the septum, which was not affected either
in Zic1+/ or
Zic2+/kd (J. Aruga, unpublished
observation). These findings are consistent with the idea that
Zic1 and Zic2 proteins have essentially similar functions. This idea is
also supported by a recent study revealing that both Zic1 and Zic2 have
similar DNA-binding properties and that both activate reporter genes in
cultured cells (Mizugishi et al., 2001 ).
How can we explain the phenotypic difference between
Zic1 / and
Zic2kd/kd mice? The difference may be
attributed to the difference in the spatiotemporal expression patterns.
At a primitive streak stage, Zic2 expression is strong in
the forebrain region while Zic1 expression occurs later in
the neuroectoderm and is enhanced in the hindbrain and the spinal cord
(Nagai et al., 1997 ). This may explain the absence of apparent
forebrain abnormality in the Zic1 mutant. It remains
inconclusive as to whether the cerebellar phenotype of the
Zic2kd/kd mice reflects the lack of
intrinsic Zic2 function in the cerebellum. Because the
malformation of the posterior neuropore and forebrain is obvious as
early as E9.5 and E10.5, respectively, cerebellar development may be
secondarily affected by the preceding malformation.
Although Zic1 and Zic2 appear to have largely
redundant functions, there remains the possibility that specific
Zic1/Zic2 interactions are required for
cerebellar development. This could explain why the folial pattern in
the trans-heterozygote is not identical to that found in
Zic1 / . A "swapping"
experiment (Hanks et al., 1995 ) is required to further investigate the
functional equivalency of both proteins.
The role of Zic1 and Zic2 in
cerebellar development
We suggest that Zic1 and Zic2 proteins may have following
roles in cerebellar development. One is the regulation of granule cell
expansion by Zic proteins. Our previous study showed that decrease in
granule cell number is the most significant change in the
Zic1 / cerebella. This was
partly explained by the reduction in cell proliferation of the granule
cell precursors. In the
Zic1+/ Zic2+/kd
cerebella, the level of proliferating cells was significantly reduced
at the beginning of phenotypic expression in the EGL. Because both
Zic1 and Zic2 are expressed in the granule cell
precursors in a similar manner, it is likely that Zic2
controls granule cell proliferation in a similar manner to
Zic1.
The stimulation of granule cell proliferation by Zic1 and
Zic2 proteins may be regulated via the expression of cell
cycle regulatory genes. cyclin D1, which was decreased in
the mutant mouse cerebella, is known to drive cell proliferation in
multiple tissues (Fantl et al., 1995 ; Sicinski et al., 1995 ). In
addition, another member of the D-cyclin family,
cyclin D2, which is predominantly expressed in the postnatal
EGL (Ross et al., 1996 ), was shown to control cerebellar histogenesis
(Huard et al., 1999 ). Although cerebellar abnormalities have not been
reported in cyclin D1-deficient mice (Fantl et al., 1995 ; Sicinski et
al., 1995 ), it is possible that cyclin D1 normally
contributes to the control of granule cell proliferation and that its
function is compensated for by other related molecules. The enhanced
expression of p27 may be acting synergistically in the
reduction of cell proliferation in the granule cell precursors, because
deletion of the p27 gene restores normal development in
cyclin D1-deficient mice (Geng et al., 2001 ).
In addition to their expression in granule cells and their precursors,
both Zic1 and Zic2 are also expressed in the
midline and anterior part of the vermal region of the cerebellar
primordia at E16 and E18. This region contains clusters of cerebellar
nuclei forming cells. The progression of neuronal differentiation in this region was affected in the
Zic1+/ Zic2+/kd
and Zic1 / cerebella. In
addition, there was a difference in the expression pattern between
Zic1 and Zic2, which also may participate in
generating the difference in the folial pattern between these two mutants.
We recently observed an inhibitory effect of mis-expressed
Zic1 in the neuronal differentiation in chick spinal cord
(J. Aruga, T. Tohmonda, S. Homma, and K. Mikoshiba, unpublished
observations). In addition, Brewster et al. (1998) showed that
neuronal differentiation, as indicated by N-tubulin expression, is
inhibited by Xenopus Zic2 expression. These facts
suggest that the Zic family of proteins may play a general role in the
inhibition of neuronal differentiation, via their effect on the
expression of regulatory cell cycle genes. It is interesting that the
Zic proteins are able to promote the differentiation of neuroectoderm
from ectoderm in the Xenopus embryo (Nakata et al., 1997 ,
1998 ), while at the same time inhibit neuronal differentiation. Zic
proteins are also expected to have another role in the adult granule
neuron, whereas all Zic genes are abundantly expressed.
Although this study showed that cyclin D1, p27,
and Wnt7a are possible targets of the Zic proteins as
transcriptional regulators, it is not clear how the Zic proteins act in
the regulatory process. A comprehensive analysis of the downstream
target genes and the assessment of possible relationships with other
regulatory molecules are necessary for further understanding. Recent
studies have indicated a functional interaction between Zic proteins
and Gli proteins, which share a highly conserved zinc finger domain
(Aruga et al., 1996 , 1999 ; Brewster et al., 1998 ; Koyabu et al., 2001 ;
Mizugishi et al., 2001 ). Gli genes are also expressed in
developing cerebella and mediate Shh signaling which enhances
proliferation of granule cell precursors (Wechsler-Reya and Scott,
1999 ). The role of the Gli proteins in cerebellar development has not
yet been shown, and the intriguing question of their relevance to Zic
proteins is still to be answered.
 |
FOOTNOTES |
Received April 30, 2001; revised Sept. 26, 2001; accepted Oct. 8, 2001.
This work was supported by Special Coordination Funds for Promoting
Science and Technology and grants from the Japanese Ministry of
Education, Science, and Culture (to J.A. and K.M.) We thank Dr. Takaki
Miyata for critical reading of this manuscript.
Correspondence should be addressed to Jun Aruga, Laboratory for
Developmental Neurobiology, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198, Japan. E-mail:
jaruga{at}brain.riken.go.jp.
 |
REFERENCES |
-
Altman J,
Bayer SA
(1997)
Comparative anatomy of the cerebellum, an evolutionally perspective.
In: Development of the cerebellar system, pp 3-20 New York: CRC.
-
Aruga J,
Yokota N,
Hashimoto M,
Furuichi T,
Fukuda M,
Mikoshiba K
(1994)
A novel zinc finger protein, Zic, is involved in neurogenesis, especially in the cell lineage of cerebellar granule cells.
J Neurochem
63:1880-1890[Web of Science][Medline].
-
Aruga J,
Nagai T,
Tokuyama T,
Hayashizaki Y,
Okazaki Y,
Chapman VM,
Mikoshiba K
(1996)
The mouse Zic gene family: homologues of Drosophila pair-rule gene odd-paired.
J Biol Chem
271:1043-1047[Abstract/Free Full Text].
-
Aruga J,
Minowa O,
Yaginuma H,
Kuno J,
Nagai T,
Noda T,
Mikoshiba K
(1998)
Mouse Zic1 is involved in cerebellar development.
J Neurosci
18:284-293[Abstract/Free Full Text].
-
Aruga J,
Mizugishi K,
Koseki H,
Imai K,
Balling R,
Noda T,
Mikoshiba K
(1999)
Zic1 regulates the patterning of vertebral arches in cooperation with Gli3.
Mech Dev
89:141-150[Web of Science][Medline].
-
Brewster R,
Lee J,
Ruiz I,
Altaba A
(1998)
Gli/Zic factors pattern the neural plate by defining domains of cell differentiation.
Nature
393:579-583[Medline].
-
Fantl V,
Stamp G,
Andrews A,
Rosewell I,
Dickson C
(1995)
Mice lacking cyclin D1 are small and show defects in eye and mammary gland development.
Genes Dev
9:2364-2372[Abstract/Free Full Text].
-
Geng Y,
Yu Q,
Sicinska E,
Das M,
Bronson RT,
Sicinski P
(2001)
Deletion of the p27/Kip1 gene restores normal development in cyclin D1-deficient mice.
Proc Natl Acad Sci USA
98:194-199[Abstract/Free Full Text].
-
Goldowitz D,
Hamre K
(1998)
The cells and molecules that make a cerebellum.
Trends Neurosci
21:375-382[Web of Science][Medline].
-
Hanks M,
Wurst W,
Anson-Cartwright L,
Auerbach AB,
Joyner AL
(1995)
Rescue of the En-1 mutant phenotype by replacement of En-1 with En-2.
Science
269:679-682[Abstract/Free Full Text].
-
Hatten ME,
Alder J,
Zimmerman K,
Heintz N
(1997)
Genes involved in cerebellar cell specification and differentiation.
Curr Opin Neurobiol
7:40-47[Web of Science][Medline].
-
Herrup K,
Kuemerle B
(1997)
The compartmentalization of the cerebellum.
Annu Rev Neurosci
20:61-90[Web of Science][Medline].
-
Huard JM,
Forster CC,
Carter ML,
Sicinski P,
Ross ME
(1999)
Cerebellar histogenesis is disturbed in mice lacking cyclin D2.
Development
126:1927-1935[Abstract].
-
Koyabu Y,
Nakata K,
Mizugishi K,
Aruga J,
Mikoshiba K
(2001)
Physical and functional interactions between Zic and Gli proteins.
J Biol Chem
276:6889-6892[Abstract/Free Full Text].
-
Lucas FR,
Salinas PC
(1997)
WNT-7a induces axonal remodeling and increases synapsin I levels in cerebellar neurons.
Dev Biol
192:31-44[Web of Science][Medline].
-
Millen KJ,
Hui C-c,
Joyner AL
(1995)
A role for En-2 and other murine homologues of Drosophila segment polarity genes in regulating positional information in the developing cerebellum.
Development
121:3935-3945[Abstract].
-
Miyazawa K,
Himi T,
Garcia V,
Yamagishi H,
Sato S,
Ishizaki Y
(2000)
A role for p27/Kip1 in the control of cerebellar granule cell precursor proliferation.
J Neurosci
20:5756-5763[Abstract/Free Full Text].
-
Mizugishi K,
Aruga J,
Nakata K,
Mikoshiba K
(2001)
Molecular properties of Zic proteins as transcriptional regulators and their relationship to GLI proteins.
J Biol Chem
276:2180-2188[Abstract/Free Full Text].
-
Nagai T,
Aruga J,
Takada S,
Gunther T,
Sporle R,
Schughart K,
Mikoshiba K
(1997)
The expression of the mouse Zic1, Zic2 and Zic3 gene suggests an essential role for Zic gene in body pattern formation.
Dev Biol
182:299-313[Web of Science][Medline].
-
Nagai T,
Aruga J,
Minowa O,
Sugimoto T,
Ohno Y,
Noda T,
Mikoshiba K
(2000)
Zic2 regulates the kinetics of neurulation.
Proc Natl Acad Sci USA
97:1618-1623[Abstract/Free Full Text].
-
Nakata K,
Nagai T,
Aruga J,
Mikoshiba K
(1997)
Xenopus Zic3, a primary regulator both in neural and neural crest development.
Proc Natl Acad Sci USA
94:11980-11985[Abstract/Free Full Text].
-
Nakata K,
Nagai T,
Aruga J,
Mikoshiba K
(1998)
Xenopus Zic family and its role in neural and neural crest development.
Mech Dev
75:43-51[Medline].
-
Rogers JH,
Ciossek T,
Menzel P,
Pasquale EB
(1999)
Eph receptors and ephrins demarcate cerebellar lobules before and during their formation.
Mech Dev
87:119-128[Medline].
-
Ross ME,
Carter ML,
Lee JH
(1996)
MN20, a D2 cyclin, is transiently expressed in selected neural populations during embryogenesis.
J Neurosci
16:210-219[Abstract/Free Full Text].
-
Sherr CJ,
Roberts JM
(1999)
CDK inhibitors, positive and negative regulators of G1-phase progression.
Genes Dev
13:1501-1512[Free Full Text].
-
Sicinski P,
Donaher JL,
Parker SB,
Li T,
Fazeli A,
Gardner H,
Haslam SZ,
Bronson RT,
Elledge SJ,
Weinberg RA
(1995)
Cyclin D1 provides a link between development and oncogenesis in the retina and breast.
Cell
82:621-630[Web of Science][Medline].
-
Wassef M,
Joyner AL
(1997)
Early mesencephalon/metencephalon patterning and development of the cerebellum.
Perspect Dev Neurobiol
5:3-16[Web of Science][Medline].
-
Wechsler-Reya RJ,
Scott MP
(1999)
Control of neuronal precursor proliferation in the cerebellum by sonic hedgehog.
Neuron
22:103-114[Web of Science][Medline].
-
Voogd J
(1998)
Cerebellum and precerebellar nuclei.
In: The central nervous system of vertebrates (Nieuwenhuys R, ten Donkelaar HJ, Nicholson C), pp 1724-1753 Berlin: Springer.
Copyright © 2002 Society for Neuroscience 0270-6474/02/221218-08$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
D. Maurus and W. A. Harris
Zic-associated holoprosencephaly: zebrafish Zic1 controls midline formation and forebrain patterning by regulating Nodal, Hedgehog, and retinoic acid signaling
Genes & Dev.,
June 15, 2009;
23(12):
1461 - 1473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Nyholm, S. Abdelilah-Seyfried, and Y. Grinblat
A novel genetic mechanism regulates dorsolateral hinge-point formation during zebrafish cranial neurulation
J. Cell Sci.,
June 15, 2009;
122(12):
2137 - 2148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Parathath, L. A. Mainwaring, A. Fernandez-L, D. O. Campbell, and A. M. Kenney
Insulin receptor substrate 1 is an effector of sonic hedgehog mitogenic signaling in cerebellar neural precursors
Development,
October 1, 2008;
135(19):
3291 - 3300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Lee, T. J. Petros, and C. A. Mason
Zic2 Regulates Retinal Ganglion Cell Axon Avoidance of ephrinB2 through Inducing Expression of the Guidance Receptor EphB1
J. Neurosci.,
June 4, 2008;
28(23):
5910 - 5919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Garcia-Frigola, M. I. Carreres, C. Vegar, C. Mason, and E. Herrera
Zic2 promotes axonal divergence at the optic chiasm midline by EphB1-dependent and -independent mechanisms
Development,
May 15, 2008;
135(10):
1833 - 1841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Inoue, M. Ogawa, K. Mikoshiba, and J. Aruga
Zic Deficiency in the Cortical Marginal Zone and Meninges Results in Cortical Lamination Defects Resembling Those in Type II Lissencephaly
J. Neurosci.,
April 30, 2008;
28(18):
4712 - 4725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhao, K.-M. Kwan, C. M. Mailloux, W.-K. Lee, A. Grinberg, W. Wurst, R. R. Behringer, and H. Westphal
LIM-homeodomain proteins Lhx1 and Lhx5, and their cofactor Ldb1, control Purkinje cell differentiation in the developing cerebellum
PNAS,
August 7, 2007;
104(32):
13182 - 13186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wang, D. Mullikin-Kilpatrick, J. E. Crandall, R. M. Gronostajski, E. D. Litwack, and D. L. Kilpatrick
Nuclear Factor I Coordinates Multiple Phases of Cerebellar Granule Cell Development via Regulation of Cell Adhesion Molecules
J. Neurosci.,
June 6, 2007;
27(23):
6115 - 6127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Inoue, M. Ota, M. Ogawa, K. Mikoshiba, and J. Aruga
Zic1 and Zic3 Regulate Medial Forebrain Development through Expansion of Neuronal Progenitors
J. Neurosci.,
May 16, 2007;
27(20):
5461 - 5473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Friedel, G. Kerjan, H. Rayburn, U. Schuller, C. Sotelo, M. Tessier-Lavigne, and A. Chedotal
Plexin-B2 Controls the Development of Cerebellar Granule Cells
J. Neurosci.,
April 4, 2007;
27(14):
3921 - 3932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ishiguro, M. Ideta, K. Mikoshiba, D. J. Chen, and J. Aruga
ZIC2-dependent Transcriptional Regulation Is Mediated by DNA-dependent Protein Kinase, Poly(ADP-ribose) Polymerase, and RNA Helicase A
J. Biol. Chem.,
March 30, 2007;
282(13):
9983 - 9995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pascual, I. Abasolo, A. Mingorance-Le Meur, A. Martinez, J. A. Del Rio, C. V. E. Wright, F. X. Real, and E. Soriano
Cerebellar GABAergic progenitors adopt an external granule cell-like phenotype in the absence of Ptf1a transcription factor expression
PNAS,
March 20, 2007;
104(12):
5193 - 5198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Nyholm, S.-F. Wu, R. I. Dorsky, and Y. Grinblat
The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum
Development,
February 15, 2007;
134(4):
735 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D.R.H. de Bruijn, W.J.M. Peters, S.M. Chuva de Sousa Lopes, A.H.A. van Dijk, M.P. Willemse, R. Pfundt, P. de Boer, and A. Geurts van Kessel
Targeted disruption of the synovial sarcoma-associated SS18 gene causes early embryonic lethality and affects PPARBP expression
Hum. Mol. Genet.,
October 1, 2006;
15(19):
2936 - 2944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Bidus, J. I. Risinger, G. V.R. Chandramouli, L. A. Dainty, T. J. Litzi, A. Berchuck, J. C. Barrett, and G. L. Maxwell
Prediction of Lymph Node Metastasis in Patients with Endometrioid Endometrial Cancer Using Expression Microarray
Clin. Cancer Res.,
January 1, 2006;
12(1):
83 - 88.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Son, S. Bilke, S. Davis, B. T. Greer, J. S. Wei, C. C. Whiteford, Q.-R. Chen, N. Cenacchi, and J. Khan
Database of mRNA gene expression profiles of multiple human organs
Genome Res.,
March 1, 2005;
15(3):
443 - 450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawasaki, J. C. Crowley, F. J. Livesey, and L. C. Katz
Molecular Organization of the Ferret Visual Thalamus
J. Neurosci.,
November 3, 2004;
24(44):
9962 - 9970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. F. Barald and M. W. Kelley
From placode to polarization: new tunes in inner ear development
Development,
September 1, 2004;
131(17):
4119 - 4130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-Q. Ding, J. Yin, A. Kania, Z.-Q. Zhao, R. L. Johnson, and Z.-F. Chen
Lmx1b controls the differentiation and migration of the superficial dorsal horn neurons of the spinal cord
Development,
August 1, 2004;
131(15):
3693 - 3703.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Bataller, D. F. Wade, F. Graus, H. D. Stacey, M. R. Rosenfeld, and J. Dalmau
Antibodies to Zic4 in paraneoplastic neurologic disorders and small-cell lung cancer
Neurology,
March 9, 2004;
62(5):
778 - 782.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Lindgens, T. W. Holstein, and U. Technau
Hyzic, the Hydra homolog of the zic/odd-paired gene, is involved in the early specification of the sensory nematocytes
Development,
January 1, 2004;
131(1):
191 - 201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Kim, G. Nakanishi, M. Lewandoski, and A. M. Jetten
GLIS3, a novel member of the GLIS subfamily of Kruppel-like zinc finger proteins with repressor and activation functions
Nucleic Acids Res.,
October 1, 2003;
31(19):
5513 - 5525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Bagutti, G. Forro, J. Ferralli, B. Rubin, and R. Chiquet-Ehrismann
The intracellular domain of teneurin-2 has a nuclear function and represses zic-1-mediated transcription
J. Cell Sci.,
July 15, 2003;
116(14):
2957 - 2966.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Ebert, J. R. Timmer, Y. Nakada, A. W. Helms, P. B. Parab, Y. Liu, T. L. Hunsaker, and J. E. Johnson
Zic1 represses Math1 expression via interactions with the Math1 enhancer and modulation of Math1 autoregulation
Development,
May 1, 2003;
130(9):
1949 - 1959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Roessler and M. Muenke
How a Hedgehog might see holoprosencephaly
Hum. Mol. Genet.,
April 2, 2003;
12(90001):
R15 - 25.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Bataller, D.F. Wade, G.N. Fuller, M.R. Rosenfeld, and J. Dalmau
Cerebellar degeneration and autoimmunity to zinc-finger proteins of the cerebellum
Neurology,
December 24, 2002;
59(12):
1985 - 1987.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|