 |
 Previous Article | Next Article 
The Journal of Neuroscience, May 15, 2002, 22(10):4163-4174
Elimination of the  1 Subunit Abolishes GABAC
Receptor Expression and Alters Visual Processing in the Mouse
Retina
Maureen A.
McCall1, 2,
Peter D.
Lukasiewicz4,
Ronald G.
Gregg2, 3, and
Neal S.
Peachey5, 6, 7
Departments of 1 Psychological and Brain Sciences,
2 Ophthalmology and Visual Sciences, and
3 Biochemistry and Molecular Biology, University of
Louisville, Louisville, Kentucky 40292, 4 Department of
Ophthalmology and Visual Sciences, Washington University, St. Louis,
Missouri 63110, 5 Cleveland Veterans Affairs Medical
Center, Cleveland, Ohio 44106, 6 Cole Eye Institute,
Cleveland Clinic Foundation, Cleveland, Ohio 44195, and
7 Department of Neurosciences, Case Western Reserve
University, Cleveland, Ohio 44106
 |
ABSTRACT |
Inhibition is crucial for normal function in the nervous system. In
the CNS, inhibition is mediated primarily by the amino acid
GABA via activation of two ionotropic GABA receptors,
GABAA and GABAC. GABAA receptor
composition and function have been well characterized, whereas much
less is known about native GABAC receptors. Differences in
molecular composition, anatomical distributions, and physiological
properties strongly suggest that GABAA receptors and
GABAC receptors have distinct functional roles in the CNS. To determine the functional role of GABAC receptors, we
eliminated their expression in mice using a knock-out strategy.
Although native rodent GABAC receptors are composed of  1
and 2 subunits, we show that after 1 subunit expression was
selectively eliminated there was no GABAC receptor
expression. We assessed GABAC receptor function in the
retina because GABAC receptors are highly expressed on the
axon terminals of rod bipolar cells and because this site modulates the
visual signal to amacrine and ganglion cells. In GABAC1
null mice, GABA-evoked responses, normally mediated by GABAC receptors, were eliminated, and signaling from rod
bipolar cells to third order cells was altered. These data demonstrate that elimination of the GABAC1 subunit, via gene
targeting, results in the absence of GABAC receptors in the
retina and selective alterations in normal visual processing.
Key words:
knock-out; rod bipolar cell; electroretinogram; IPSC; whole-cell patch clamp; TPMPA; ionotropic receptor; chloride channel; inhibition
| |
INTRODUCTION |
In the CNS, inhibition is mediated
primarily by GABA, which activates two ionotropic GABA receptors,
GABAA and GABAC (Sivilotti and Nistri, 1991 ). GABAA and
GABAC receptors are molecularly distinct, differing in both subunit composition and subunit complexity
(GABAA:  1-6,  1-3,  1-3,  ,  , and
 subunits; GABAC: 1-3 subunits) (for
review, see Enz, 2001; Moss and Smart, 2001; Zhang et al., 2001). In
addition, each receptor type or subtype forms a chloride channel whose
pharmacology, current kinetics, and affinities for GABA differ. Most
CNS neurons express GABAA receptors, and many express more than one subtype (Persohn et al., 1992; Wisden and Seeburg, 1992; Fritschy et al., 1998). In contrast,
GABAC receptors are simpler (Enz and Cutting,
1999a; Zhang et al., 2001), and their expression is more restricted
(Johnston, 1994; Boue-Grabot et al., 1998; Rozzo et al., 1999),
primarily to the terminals of a class of retinal interneurons, the
bipolar cells (Enz et al., 1996; Lukasiewicz, 1996; Koulen et al.,
1997; Boue-Grabot et al., 1998; Feigenspan and Bormann, 1998; Fletcher
et al., 1998; Wassle et al., 1998).
Both GABAA and GABAC
receptors modulate inhibition in the retina (Lukasiewicz and Shields,
1998). In particular, the GABAC receptors are
thought to modulate the response properties of retinal ganglion cells,
such as their center-surround antagonism, the sustained or transient
nature of their responses, and contrast gain (Thibos and Werblin, 1978;
Lukasiewicz and Werblin, 1994; Pan and Lipton, 1995; Cook and
McReynolds, 1998a,b; Dong and Werblin, 1998; Bloomfield and Xin, 2000;
Flores-Herr et al., 2001). The relatively restricted expression of
GABAC receptors and their late expression in
postnatal development (Greka et al., 2000) make them particularly
amenable for study using gene targeting.
We inactivated the gene encoding the GABAC1
subunit in mice and investigated the effects of the elimination of this
subunit in the retina. We assessed the specific roles of
GABAC receptors in the inhibitory circuit
mediated by the rod bipolar cell. Overall retinal and rod bipolar cells
to cell morphology were intact, and both electrophysiological and
immunohistochemical experiments showed that eliminating expression of
the 1 subunit eliminated expression of the
GABAC receptor. Electroretinogram (ERG)
measurements showed that only inner retinal function was altered in
GABAC1 null mice, a result consistent with an
alteration in the balance of excitation and inhibition between second
and third order retinal neurons. These data show that the
GABAC receptor is not expressed in the retina of
GABAC1 null mice and represent the first use of gene targeting to alter inhibition in a specific retinal circuit. These mice will allow us to enhance our understanding of the role of
GABAC receptor-mediated inhibition in visual processing.
| |
MATERIALS AND METHODS |
Production of GABAC1 null mice
Targeting vector
A P1 clone was identified using a PCR strategy with two
primers within the 3' end of the cDNA encoding the
GABAC1 subunit gene and was purchased from
IncyteGenomics. From this genomic clone, two fragments of the
GABAC1 subunit gene were isolated: an 18 kbp
HindIII fragment containing the promoter, exon 1, and a
portion of intron 1, and a 2.2 kbp EcoRI-XhoI
fragment containing exon 10 and part of the 3' untranslated region (see
Fig. 1A). These fragments were used to construct the
targeting vector (see Fig. 1B), which consisted of
four cassettes: a 4.4 kbp 5' homology unit, which included 4.0 kbp of
the GABAC1 promoter, exon 1 (220 bp) and 210 bp of intron 1; a 1.4 kbp 3' homology unit from the 3' untranslated
region of the gene, and two selectable markers, a neomycin resistance
gene (neo) and a thymidine kinase gene
(TK) in pBluescript (Stratagene, La Jolla, CA). When
homologous recombination occurs (see Fig. 1A, dashed
Xs), exons 2-9 are replaced with the neo cassette,
yielding the modified locus (see Fig. 1C).
Production of targeted embryonic stem cells and
GABAC1 null mice
The general strategy for the production of targeted
embryonic stem (ES) cells has been described previously (McCall et al., 1996a). Five micrograms of the GABAC1
targeting vector was linearized by digestion with SalI and
introduced via electroporation into 5 × 106 HM-1 ES cells. Two hundred and
thirty-two G418 and
1-(2'-deoxy-2'-fluoro--D-arabinofuranosyl)-5-iodouracil-resistant ES cell clones were analyzed by PCR to determine which were
correctly targeted on the 3' end. The primers (indicated by
arrows, labeled 3F and 3R) were
located in the neo gene and in the 3' end of the GABAC1 cognate gene (see Fig. 1C).
Their sequences were 3F: 5' CGTTGGCTACCCGTGATATT 3'; 3R: 5'
GAATTCCAGACTGACCCGCTTCT 3'. PCRs contained: 1× Gitschier buffer (Kogan
et al., 1987) and Taq Enhancer, 1 U Taq
polymerase (Eppendorf, Hamburg, Germany), 0.5 µM of each primer, 0.15 mM dNTP, and 25-50 ng of DNA in a final volume
of 25 µl. Cycling conditions for all PCRs were determined
empirically, but in general were: 2 min at 94°C, followed by 30 cycles of 1 min at 94°C, 1 min at the annealing temperature, and 2 min at 72°C, followed by a final incubation for 10 min at 72°C.
Amplified samples were analyzed by agarose gel electrophoresis. A 2.2 kbp fragment was amplified in three of the 232 ES cell clones,
indicating correct targeting at the 3' end of the gene (see Fig.
2B).
Southern blotting was used to determine which of the three ES cell
clones were correctly targeted on the 5' end (see Fig. 2A). Genomic DNA from each ES cell was digested with
HindIII, size separated by agarose gel electrophoresis,
denatured, and transferred to a nylon membrane. The membrane was
hybridized at 65°C with a 32P
radioactively labeled probe from the 5' end of the gene, outside of the
region of homology. One correctly targeted ES cell clone, E11 (see Fig.
2A) was identified and contained an 18 kbp
HindIII fragment from the cognate gene [wild-type
(WT)] and a 12 kbp HindIII fragment representing the
targeted allele (Target). This clone was expanded and used for
blastocyst injections.
Production of GABAC1 null mice
All procedures using animals were approved by the Institutional
Animal Care and Use Committees at each institution. The expanded ES
cell clone was injected into C57BL/6J blastocysts at the Transgenic Facility at the University of Wisconsin. Three male chimeric founders transmitted the GABAC1 targeted allele through
the germline and were crossed to C57BL/6J females to produce mice
heterozygous for the targeted allele. The heterozygotes were
intercrossed, and their offspring were genotyped by PCR for the deleted
(WT) and targeted (Target) alleles (see Fig. 2C). DNA for
the PCRs was isolated from tail biopsies of each offspring using
Chelex 100 resin (Bio-Rad, Hercules, CA) (McCall et al., 1996b).
The location of the primers (indicated by arrows) for the WT
allele are shown in Figure 1A and for the targeted
allele (Target) in Figure 1C. Their sequences were WT F: 5'
CAGGGACAATCGGCTGTAGG 3' and R: 5'TTGTTGGAGCTGGGGAAAGA3' and
Target F: 5'CCACATGAAGCAGCACGA 3' and R: 5'AGGATGTTGCCGTCCTCCTT3'. The
composition of the PCR solution and cycling conditions are described above.
Histology
Light microscopy
Retinal tissue was prepared as described previously
(McCall et al., 1996b). Mice were killed by anesthetic
overdose, and their eyes were removed and fixed by immersion in 4%
paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4, for 18 min, and the fixed eyecups were rinsed (three times for 10 min
each) in 0.1 M PB. For plastic sections, eyecups were
dehydrated through a graded series of alcohols (70, 80, 90, and 95%)
for 1 hr each and infiltrated overnight in JB-4 (Electron Microscopy
Sciences, Fort Washington, PA). The eyecups were then submerged in JB-4
plus polymerizer in BEEM capsules. After the plastic had
hardened, 1 µm transverse sections were cut on an ultramicrotome,
stained with cresyl violet, and coverslipped. Images were captured on a
Nikon Optiphot-2 with a cooled CCD camera and associated software (Spot
2; Diagnostic Instruments, Sterling Heights, MI).
Immunohistochemistry
Eyecups were prepared and fixed as described above. The retinas
were dissected out of the eyecup, cryoprotected through a graded series
of sucrose, and frozen in OCT-20% sucrose (at a ratio of 2:1)
(Barthel and Raymond, 1990). For most experiments the retinas from WT
and GABAC1 null littermates were sandwiched together, embedded in the same mold, and when cut and mounted onto
slides were separated at most by 150 µm. Sixteen micrometer sections
were cut on a cryostat and mounted onto slides and stored at  70°C.
Before immunohistochemistry the slides were warmed to 37°C and washed
in 0.1 M PB three times for 15 min. Sections were incubated
in 0.5% Triton X-100 in 0.1 M PB (PBX), followed by incubation at room temperature (RT) for 1 hr in a blocking solution consisting of 10% normal goat serum in PBX. Sections were
incubated overnight at RT in one of the following primary antibodies
diluted in blocking solution: anti-PKC [1:1000 (rabbit polyclonal
antibody to isoenzymes (Amersham Biosciences, Arlington Heights,
IL) and anti-GABAC [1:100 (rabbit polyclonal
antibody to GABAC1, 2, and 3 subunits of
the receptor (Enz et al., 1995)]. The sections were rinsed in 0.5%
PBX for 1 hr at RT before incubation with fluorescent secondary
antibody (either anti-rabbit Alexa 488 or 546; Molecular Probes,
Eugene, OR) diluted 1:1000 in blocking solution for 1 hr at RT. The
sections were rinsed three times for 5 min in PB and then coverslipped
with Immumount (Shandon, Pittsburgh, PA). As a control, primary
antibodies were omitted from sections on one slide. The protocols for
double labeling were similar to those described above, with each
primary and secondary antibody incubated sequentially.
Confocal images were acquired using the Zeiss (Oberkochen, Germany) LSM
510 laser-scanning microscope equipped with an Argon and a HeNe laser.
Images were captured using a Plan-Apochromat 63×/1.4 water immersion
objective. Laser lines and emission filters were optimized with the
Zeiss LSM510 software. High-resolution scanning was performed at
1024 × 1024 pixels. Confocal images were analyzed, and brightness
and contrast were adjusted using the LSM510 analysis package. Serial
optical sections (n = 5), collapsed into a single
plane, are shown in Figure 4A-C (z-axis step size, 0.6 µm).
Electrophysiology
Patch-clamp experiments
Preparation of mouse retinal slices. The experimental
techniques were identical to those described for studies in ferret
retinal slices (Lukasiewicz and Wong, 1997; Shields et al., 2000).
Briefly, mice aged postnatal day 28 to adult were killed using carbon
dioxide, and their eyes were enucleated. The cornea, lens, and the
vitreous were removed, and the retina was dissected in cold, oxygenated extracellular medium (see Electrode and bath solutions). Slices were
prepared as previously described and maintained in oxygenated media at
room temperature (Werblin, 1978; Lukasiewicz and Wong, 1997).
Whole-cell patch recordings. Whole-cell patch recordings
were obtained from rod bipolar cells in the mouse retinal slices. IPSCs
were recorded when rod bipolar cells were voltage clamped to 0 mV, the
reversal potential for nonspecific cation currents. Rod bipolar cells
were identified by their characteristic morphology after filling them
with Lucifer yellow (0.015%), which was included in the recording
electrode (Euler and Wassle, 1998; Shields et al., 2000) (see Fig.
4D,E). The recording procedures and microscope system
have been described in detail previously (Lukasiewicz and Roeder,
1995). Electrodes were pulled from borosilicate glass (1B150F-4; World
Precision Instruments, Sarasota, FL) on a P97 Flaming-Brown puller
(Sutter Instruments, Novato, CA) and had measured resistances of <5
M . Patchit software (White Perch Software, Somerville, MA) was used
to generate voltage command outputs, acquire data, gate the drug
perfusion valves, and trigger the Picospritzer (General Valve,
Fairfield, NH). The data were digitized and stored with a Pentium
personal computer using a Labmaster DMA data acquisition board
(Scientific Solutions, Solon, OH). Responses were filtered at 1 kHz
with the four-pole Bessel low-pass filter on the Axopatch 200B (Axon
Instruments, Foster City, CA) and sampled at 1-2 kHz.
Data analysis. Tack software (White Perch Software) was used
to average records and to measure the peak amplitude, decay time, and
charge transfer for each cell. The decay time was measured by computing
the D37, the time at which the current has
declined to 37% of its peak amplitude. Student's t tests
(two-tailed, unequal variance) were used to compare these aspects of
the current from WT and GABAC1 null rod
bipolar cells. To obtain the mean current for each cell, three to five
leak-subtracted responses were averaged. Data in the text and figure
legends are expressed as mean ± SE. Measures of the current from
individual cells obtained in the presence of
GABAA and GABAC receptor
antagonists and after drug wash out were normalized to the predrug,
control current.
Solutions and drugs. The standard bathing medium (normal
mouse Ringer's solution) contained (in
mM): 137 NaCl, 5 KCl, 1 MgCl2, 2.5 CaCl2, 28 glucose, and 10 HEPES. The standard intracellular electrode solution
for puff experiments consisted of (in mM): 120 Cs
gluconate, 1 CaCl2, 2 MgCl2, 10 Na HEPES, 11 EGTA, and 30 glucose,
adjusted to a pH of 7.2 with CsOH. Unless otherwise indicated, all
chemicals were obtained from Sigma (St. Louis, MO).
The control bathing solution used in these slice experiments was
formulated to pharmacologically isolate rod bipolar cell responses to
GABA. In all experiments, glycine receptors were antagonized with
strychnine (10 µM), AMPA-kainate (AMPA-KA) receptors were blocked with 6-cyano-7-nitroquinoxaline-2,3-dione (10 µM) (NBQX), and NMDA receptors were blocked with
D-2-amino-5-phosphonopentenoic acid
(D-AP5) (50 µM). NBQX and D-AP5
were both obtained from Precision Biochemicals (Vancouver, British
Columbia, Canada). GABAA receptors were
antagonized with bicuculline methbromide (either 200 or 500 µM), and bicuculline-resistant GABA responses were
blocked with (1,2,5,6-tetrahydropyridine-4yl) methyphosphinic acid (50 or 100 µM) (TPMPA; RBI, Natick, MA). Antagonists were
applied to a region of the slice under study (several millimeters in
width) by a gravity-driven superfusion system described previously
(Lukasiewicz and Roeder, 1995).
Puffing agonist onto bipolar cell terminals. GABA (100-300
µM) was puffed onto the terminals of
bipolar cells in the inner plexiform layer (IPL) in the slice
preparation with a Picospritzer at 45 or 60 sec intervals. The pipette
was positioned near the Lucifer yellow-labeled axon terminal to
optimize the response of the cell to the puff, by minimizing
response rise time and maximizing response amplitude. The puff pressure
and duration (typically 10-30 msec) were then adjusted to give no
larger than a half-maximal response. Because the slice was continuously
superfused, which diluted the puff, and because puff duration and
pressure were submaximal, the GABA concentration at the receptors was
most likely much lower than the pipette concentration.
Electroretinography. The methods used to prepare the mice
for electroretinography are similar to those described in detail previously (Pardue et al., 1998; Xu et al., 2000). After overnight dark
adaptation, anesthesia was induced with an intramuscular injection of a
mixture of ketamine-xylazine in saline (80 mg/kg; 16 mg/kg,
respectively). Eye drops were used to dilate the pupils (2.5%
phenylephrine HCl, 1% mydriacyl, 1% cyclopentolate). For ERG
recordings, body temperature was maintained using a heating pad.
Retinal responses were recorded using a stainless steel wire contacting
the corneal surface through a layer of 1% methylcellulose, and
electrodes were placed in the cheek and tail to serve as reference and
ground leads, respectively. ERG responses were obtained to strobe flash
stimuli presented in the dark. Flash intensities ranged from 4.4 to
5.0 log cd sec/m2 and interstimulus
intervals increased from 1.4 sec at lower intensities to 45 sec at the
highest stimulus levels. Stimuli were presented in order of increasing
intensity, and at least two responses were averaged at each flash
intensity. ERG responses were differentially amplified using a
frequency bandpass setting of 0.5-1500 Hz, and the frequency bandpass
was changed to 30-1500 Hz to isolate the oscillatory potentials (OPs).
Responses were averaged and stored using an LKC UTAS E-2000
(Gaithersburg, MD) signal averaging system. The amplitude of the a-wave
was measured from the prestimulus baseline to the a-wave trough. The
amplitude of the b-wave was measured from the a-wave trough to the peak
of the b-wave. Time-to-peak (implicit time) was measured from the time
of flash onset to the a-wave trough or the b-wave peak. Individual OP
wavelets were measured from the initial negative trough to the positive
peak. An ANOVA with repeated measures was used to determine
statistical significance between these measures in the ERGs of WT and
GABAC1 null mice.
| |
RESULTS |
Homologous recombination disrupts the expression of the
GABAC1 subunit
Figure 1 illustrates the targeting
scheme used to eliminate the expression of the
GABAC1 subunit gene. After homologous
recombination, ES cells that were heterozygous for the modified
locus were identified, using Southern blotting, for the 5' homology
unit (Fig. 2A) and PCR
for the 3' homology unit (Fig. 2B). Injections of the
expanded ES clone into C57BL/6J blastocysts generated three male
germline chimeras that were crossed to C57BL/6J mice and produced
heterozygous offspring. These heterozygous mice were intercrossed, and
their progeny were genotyped by PCR (Fig. 2C). The
GABAC1 null offspring resulting from these
crosses were viable and fertile. Because the genetic background of
these mice is a mixture of C57BL/6J and SV129 Olah, all comparisons are
made between GABAC1 null mice and their WT
littermates.
View larger version (21K):
[in this window]
[in a new window]
|
Figure 1.
The GABAC1 subunit gene structure,
targeting vector design, and the GABAC1 subunit gene
modified by homologous recombination. Schematic representations of the
wild-type locus of the GABAC1 subunit gene
(A), the targeting vector used to inactivate the
GABAC1 subunit gene (B), and the
modified locus for this gene that results from homologous recombination
between the targeting vector and the cognate GABAC1
subunit gene (C). (Diagrams are not drawn to scale.) The
targeting vector (B) consists of two selection
cassettes: the neomycin gene (neo) and the thymidine
kinase gene (TK) as well as a 4.4 kbp 5' homology
unit that included the GABAC1 subunit promoter, exon 1, and a portion of intron 1 and a 1.4 kbp 3' homology unit that included
the 3'UTR of the gene. When homologous recombination occurs between the
targeting vector and the cognate gene (large Xs) exons
2-9 are replaced by the neo cassette resulting in the modified allele
(C).
|
|
View larger version (78K):
[in this window]
[in a new window]
|
Figure 2.
Characterization of embryonic stem cells
and mice that carry the GABAC1 targeted allele.
A, Scanned images of Southern blots of genomic DNA
isolated from WT and from WT ES cells (HM1), a targeted
ES cell line (E11), a wild-type
(WT), and a GABAC1 null
(Null) mouse. Genomic DNAs were digested with
HindIII and separated by size using agarose gel
electrophoresis. DNA was transferred to nylon membrane and hybridized
to radiolabeled Probe 1 (Fig. 1A). The probe
hybridizes to an 18 kbp HindIII fragment from the WT
locus in DNA from untransfected ES cells and the WT mouse. The probe
hybridizes to both the 18 kbp WT allele and a 12 kbp fragment in DNA
from ES cell clone (E11) representing the presence of a
targeted allele. Thus, E11 is correctly targeted on the 5' end of the
gene. A single 12 kbp fragment in the DNA from the
GABAC1 null mouse indicates the presence of only
targeted alleles. B, PCR results indicating that ES cell
clone, E11, is correctly targeted on the 3' end of the
GABAC1 subunit gene. Arrows on the
drawing of the modified locus (Fig. 1C) indicate the
positions of the primers 3F/3R for this PCR, which amplified a 2.2 kbp
fragment from within the neo gene through the 3'
UTR of the GABAC1 subunit gene, indicative of correct
targeting on the 3' end. mm, Molecular weight marker;
A10, non-targeted ES cell clone; E11,
targeted ES cell clone; , negative control, no DNA added to the
reaction. C, PCR results indicating the genotypes of
five littermates resulting from a cross between two mice heterozygous
for the targeted allele. The primers for these PCRs are indicated in
Figure 1A (WT F/R: located in intron 4 and exon
5) and Figure 1C (Target F/R: located in exon 1 and the
neo gene) and amplify only wild-type (WT)
fragments in WT mice, only targeted fragments (Target) in
GABAC1 null (Null) mice, and both
fragments in heterozygous (Het) mice.
|
|
Retinal morphology is normal in GABAC1
null mice
Experimental manipulations that eliminate a particular cell class
or signaling pathway frequently cause neuronal loss and/or developmental abnormalities (McCall et al., 1996b; Peachey et al.,
1997; Jiang et al., 1998; Rohrer et al., 1999). To determine if
elimination of the GABAC1 subunit altered
retinal anatomy, we examined transverse sections of the retina of WT
(Fig. 3A) and
GABAC1 null (Fig. 3B) mice at the
light microscopic level. We found no differences in the overall
morphology or laminar thickness between of the retinas of these mice,
indicating that eliminating the expression of the GABAC1
subunit did not alter retinal neurons or their processes.
View larger version (101K):
[in this window]
[in a new window]
|
Figure 3.
Retinal morphology in GABAC1 null
mice is normal. Representative photomicrographs of 1 µm transverse,
plastic sections of retina stained with cresyl violet from a WT
littermate (A) and a GABAC1 null
mouse (B). No obvious differences are seen in the
overall structure of any of the retinal layers or in the gross
morphology of the cell bodies within the retinal layers.
PE, Pigment epithelium; IS/OS, inner
segments and outer segments of the photoreceptors; ONL,
outer nuclear layer; OPL, outer plexiform layer;
INL, inner nuclear layer; IPL, inner
plexiform layer; GCL, ganglion cell layer.
|
|
Elimination of the GABAC1 subunit results in the
absence of retinal GABAC receptors
The GABAC receptor in rodent retina is
thought to be a hetero-oligomeric channel, comprised of both 1 and
2 subunits, and is expressed primarily on the axon terminals of the
rod bipolar cells (Enz et al., 1995; Zhang et al., 1995). To confirm
that gene targeting eliminated expression of the 1 subunit and to determine if expression of any other subunits was present, we compared the expression of the GABAC receptors in
the retinas of GABAC1 null and WT mice. Rod
bipolar cells were identified using an antibody to protein kinase C
(PKC) (Wassle et al., 1991), and the expression of
GABAC receptor was characterized using a rabbit
polyclonal antibody that recognizes all three of the
GABAC subunits (Enz et al., 1995). Figure
4A is a confocal image
of a transverse section through a WT mouse retina. PKC immunoreactivity (green) outlines the entire rod bipolar cell and
GABAC receptor-immunoreactivity (red) produces a
characteristic punctate staining pattern in the IPL. These puncta
decorate the axon terminals of rod bipolar cells in the IPL, and to a
lesser extent, their dendritic processes in the outer plexiform layer
(OPL) (Enz et al., 1995; Koulen et al., 1998; Haverkamp and Wassle,
2000). The presence of GABAC receptors on the
dendrites of the bipolar cells in the OPL, evident in the WT mice, also
has been observed previously (Picaud et al., 1998; Haverkamp and
Wassle, 2000; Vitanova et al., 2001). The rod bipolar cells in
GABAC1 null mice also are immunoreactive for
PKC and have a similar morphology to that seen in WT mice. In contrast,
no GABAC receptor immunoreactivity was evident in the GABAC1 null mouse retina (Fig.
4B). Figure 4C shows that there is little
nonspecific GABAC receptor immunoreactivity in WT
control sections when the GABAC receptor primary
antibody is omitted from the reaction. These data indicate that the
absence of the GABAC1 subunit eliminates the
expression of the 2 subunit and the GABAC
receptor in both plexiform layers of the retina (IPL and OPL), but does
not alter the gross morphology or PKC expression of rod bipolar cells.
Similar observations were made in retinas of seven other WT and eight
other GABAC1 null mice.
View larger version (103K):
[in this window]
[in a new window]
|
Figure 4.
Eliminating the expression of the
GABAC1 subunit results in the absence of expression of
the GABAC receptor. Confocal images of transverse frozen
sections of retina from a WT (A) and a
GABAC1 null (B) mouse reacted with
antibodies to protein kinase C (green
fluorescence) and all GABAC receptor subunits
(red fluorescence). In retinas from both the WT and
GABAC1 null mice, protein kinase C immunoreactivity
outlines the cell bodies of the rod bipolar cells, their dendritic
processes in the OPL, and their axons and axon terminals in the IPL. In
the WT animal, the punctate labeling that is characteristic of the
GABAC receptors is distributed throughout the IPL and also
found on the dendrites in the OPL. This immunoreactivity is completely
absent in the retinas of the GABAC1 null mice
(B). This observation is the same in the other
seven WT and eight GABAC1 null retinas that we analyzed.
A control WT retina (C) was reacted as described
for the retinas shown in A and B, but the
GABAC receptor primary antibody was omitted. The labeling
pattern of this control is virtually identical to the
GABAC1 null mouse reacted with antibodies to both PKC
and the GABAC receptor. D, E, Fluorescence
photomicrographs of two Lucifer yellow-filled rod bipolar cells whose
responses to GABA puffs were recorded intracellularly. These cells were
classified as rod bipolars because their cell bodies were located in
the top part of the INL, and their axon terminals were found in the IPL
near its border with the ganglion cell bodies. (D,
GABAC1 null; E, WT rod bipolar cells.)
|
|
GABA responses from GABAC1 null rod bipolar cells
lack a GABAC receptor component
GABA current kinetics
Rod bipolar cells have the largest GABAC
receptor-mediated currents in the retina (Euler and Wassle, 1998;
Shields et al., 2000). Therefore, we examined the effects of
eliminating the expression of the GABAC1
subunit on GABA evoked responses in these cells. We targeted rod
bipolar cells, using the locations of their somas in the INL near its
border with the OPL. After each cell was filled with Lucifer yellow,
its morphological identity was verified by the location of its cell
body in the INL and its axon terminals in substratum 5 of the IPL, near
the border with the ganglion cells (Euler and Wassle, 1998; Shields et
al., 2000). Fluorescence images of filled cells from both groups of
mice were examined under the light microscope, and no morphological
differences in the dendritic or axonal arbors were found between WT and
GABAC1 null rod bipolar cells (see Fig.
4D,E, for representative cells), which is consistent
with our light microscopic observations described above.
In retinal slices of GABAC1 null and WT mice,
we recorded and averaged the responses of rod bipolar cells to focally
applied GABA at their axon terminals in control bath solution. From the averaged response of each cell, we measured three aspects of current kinetics: charge transfer (measured by integrating the current response), peak amplitude, and decay time (time to decline to 37% of
peak amplitude) and obtained mean values for WT and
GABAC1 null cells. In WT slices, rod bipolar
cells responded to a brief puff (30 msec) of GABA with a rapidly rising
but sustained current (Fig.
5A). In
GABAC1 null retinas, rod bipolar cells
responded to the GABA puff, but the duration of the GABA evoked current was significantly briefer, and their charge transfer and peak amplitudes were significantly smaller (Fig. 5B). The mean
values for these parameters and the p values from the
t tests comparing the means between the two groups of mice
are shown in Table 1. The kinetics of the
current evoked in the rod bipolar cells in the
GABAC1 null mice were identical to the GABA
responses, which are mediated by only GABAA
receptors in ganglion cells of ferret (Lukasiewicz and Shields, 1998)
and rat (Euler and Wassle, 1998; Euler and Masland, 2000), and in
ganglion cells that we recorded in both WT and null retinas (data not
shown). Each of the changes in current kinetics is consistent with the
interpretation that a slow, sustained
GABAC-mediated response is absent in
GABAC1 null cells.
View larger version (24K):
[in this window]
[in a new window]
|
Figure 5.
GABA currents are mediated by only
GABAA receptors in GABAC1 null mice.
A, Representative WT current responses to brief puffs
(30 msec) of GABA delivered focally onto the axon terminals of rod
bipolar cells (Control) and in the presence
of antagonists to GABAA receptors
(Bicuculline) or both GABAC and
GABAA receptors (TPMPA & Bicuculline).
Bicuculline (500 µM) reduced the amplitude of the WT GABA
current slightly and delayed its time to peak. TPMPA (50 µM) combined with bicuculline eliminated this GABA
current, indicating that both GABAA and GABAC
receptors mediate the WT GABA response in the mouse. B,
Representative GABAC1 null current responses to brief
GABA puffs delivered focally onto the axon terminals of rod bipolar
cells in the presence of bicuculline or bicuculline and TPMPA. The
response to GABA in GABAC1 null bipolar cells is
different in its kinetics and pharmacology compared with WT. In
GABAC1 null rod bipolar cells, the decay of the GABA
response was much more rapid than in WT (compare Control
traces, A, B). Addition of bicuculline
(500 µM) eliminated the GABA current () and the
addition of TPMPA (100 µM) had no further effect ( ),
indicating that GABAC receptors did not contribute to
the response. C, D, Responses to GABA in
WT and GABAC1 null rod bipolar cells were quantified by
measuring charge transfer and changes in these responses in the
presence of bicuculline or bicuculline + TPMPA expressed as a
percentage of the response in the control bath solution
(Q/Qmax).
C, WT rod bipolar cell responses were reduced slightly
by addition of bicuculline to the bath (86 ± 3%;
n = 13). WT responses were almost completely
eliminated when both TPMPA and bicuculline were added to the bath (6 ± 2%; n = 13). D, In contrast,
GABAC1 null responses were substantially reduced in the
presence of only bicuculline (12 ± 3%; n = 9) and the addition of TPMPA had no further effect (10 ± 2%;
n = 9), indicating that the residual current was
not mediated by GABAC receptors.
|
|
GABA current pharmacology
We characterized the pharmacology of the GABA response using
GABAA and GABAC antagonists
for all 13 WT and 9/18 GABAC1 null rod bipolar
cells, whose current kinetics were evaluated in control solution. To
quantify changes in the current, we measured the charge transfer in the
presence of antagonist and normalized this response to the charge
transfer obtained in the control bath solution. When the
GABAA receptor antagonist, bicuculline, was
included in the bath, the peak amplitude of the GABA response in WT
cells was smaller (Fig. 5A), although its decay was not
significantly altered (control, 1394.5 ± 111.55 msec vs
bicuculline, 1359.0 ± 112.92 msec). The charge transfer of the
GABA response in WT bipolar cells in the presence of bicuculline was
reduced to 86% of control (Fig. 5C). This indicates that
the GABAA receptor contribution to the total GABA
response is ~14%, which is similar to results in rat (Euler and
Wassle, 1995; Euler and Masland, 2000), rabbit (McGillem et al., 2000),
and ferret rod bipolar cells (Shields et al., 2000). We found that when
the GABAC antagonist, TPMPA, was administered
alone to WT mouse ganglion cells, which express GABAA receptors but do not express
GABAC receptors (M. A. McCall, unpublished
observations), the drug reduced GABA responses by ~15% of
control. Therefore, we only assessed the effects of TPMPA on the
bicuculline-insensitive component (GABAC-mediated
component) of the GABA current in rod bipolar cells. When TPMPA was
added in combination with bicuculline, the GABA response in WT rod
bipolar cells was almost completely eliminated (Fig. 5A). On
average, only 6% of the control current remained in the presence of
both bicuculline and TPMPA (Fig. 5C), in agreement with
findings in rabbit rod bipolar cells (McGillem et al., 2000). GABA
responses recovered to their control levels (79 ± 5%) after wash
out of the antagonists (data not shown). These data indicate that in WT
mouse rod bipolar cells, the response to GABA at the axon terminal is
composed primarily of a GABAC receptor component
with a small GABAA receptor component and a third
component that is neither GABAA or
GABAC receptor-mediated.
In GABAC1 null retinas, when the
GABAA receptor antagonist, bicuculline, was added
to the bath, the GABA response was almost completely eliminated, with
the charge transfer reduced by 88% of control values (Fig.
5B,D). Addition of TPMPA to the bath had no additional
effect on this current (reduced by 90% of control), indicating that
this small remaining current also was not mediated by
GABAA or GABAC receptors.
These responses recovered to their pretreatment levels after wash out
of the antagonists from the bathing solution (81% of control). Thus,
the pharmacology of the current in the GABAC1
null cells also is identical to the GABA responses mediated by
GABAA receptors in ferret (Lukasiewicz and Shields, 1998), rat (Euler and Wassle, 1998; Euler and Masland, 2000),
and in ganglion cells that we recorded in both WT and null retinas
(data not shown). These data indicate that in
GABAC1 null rod bipolar cells the response to
GABA at the axon terminal is composed primarily of a
GABAA receptor component.
Whether the GABAC receptor contributes to the
GABA response is best illustrated by comparing the effects of TPMPA on
the bicuculline-resistant component of the response from WT and
GABAC1 null rod bipolar cells. In WT cells,
the bicuculline-resistant response was virtually eliminated by TPMPA
(Fig. 5C) (reduced by 92 ± 3% of control values). In
contrast, the very small bicuculline-resistant component that was
observed in some of the GABAC1 null rod
bipolar cells was unaffected by TPMPA (Fig. 5D) (reduced by
4 ± 9% of control values). These data also indicate that in
GABAC1 null rod bipolar cells, the response to
GABA is comprised almost exclusively of a GABAA receptor-mediated current. The very small bicuculline and
TPMPA-resistant current found in cells in both groups of mice could be
mediated by a GABA transporter (Yang et al., 1997).
There is little evidence of interactions between the
GABAA and GABAC receptors.
However, whether there is a compensatory upregulation by
GABAA receptors in the absence of
GABAC receptors remains an important question.
Our data indicate that the GABA current in WT rod bipolar cells is
mediated by a combination of GABAA and GABAC receptors. Our results also demonstrate
that the GABAC receptors are absent in rod
bipolar cells of GABAC1 null mice and that their GABA response is almost exclusively mediated by
GABAA receptors. There is no direct way to
determine the absolute numbers of GABAA receptors
on rod bipolar cells from our data. However, we can use the charge
transfer of the GABA response from WT and
GABAC1 null bipolar cells in the control bath
solution and in the presence of bicuculline to estimate the relative
contribution of the GABAA receptors to the total
GABA current. The GABAA receptor contribution in
WT bipolar cells can be estimated from the percentage reduction in the
mean charge transfer in the presence of bicuculline relative to
control. In the presence of bicuculline, WT charge transfer is reduced
to 86% of the control (Fig. 5C), indicating that
GABAA receptors contribute ~14% of the total
current. The GABAA receptor contribution in
GABAC1 null bipolar cells, which only express GABAA receptors, can be estimated from the
percent reduction in the mean charge transfer in control solution
relative to WT bipolar cells in control bath solution (Table 1). This
ratio yields an estimate of 18% of the total WT current contributed by
GABAA receptors in
GABAC1 null bipolar cells. Thus, these
comparisons suggest that the GABAA receptor
contribution to the total GABA current in bipolar cells is similar in
the two groups of mice and that no compensation by
GABAA receptors occurs in the absence of
GABAC receptors.
Retinal function is altered in GABAC1 null mice
Overall function of the rod pathway in the retina can be assessed
by evaluating the dark-adapted ERG (Robson and Frishman, 1995). To
assess the impact of the elimination of the GABAC
receptor and its inhibitory modulation on visual signaling through the rod bipolar cells, we compared dark-adapted ERGs obtained from GABAC1 null and WT mice. Figure
6A shows representative
dark-adapted ERGs recorded from a WT and a
GABAC1 null mouse to full-field, flash stimuli
at nine different stimulus intensities. The ERGs from seven other WT
and six other GABAC1 null mice showed the same
general shape. Under these stimulus conditions, the responses reflect
rod-driven activity, with little or no contribution from cone
photoreceptors (Xu et al., 2000). The responses to low-intensity stimuli (4.4 to 1.9 log cd sec/m2)
were dominated by the cornea-positive b-wave, which reflects depolarizing (ON) rod bipolar cell function (Masu et al., 1995; Robson
and Frishman, 1995). Oscillatory potentials, seen as rhythmic oscillations superimposed on the b-wave, were present in ERGs in both
groups of mice. The OPs are thought to reflect the feedback loops
involving bipolar cell axon terminals, amacrine cell processes, and
ganglion cell dendrites in the IPL (Wachtmeister, 1998). As flash
intensity increased (1.4 to 0.5 log cd
sec/m2), the amplitudes of both the b-wave
and the OPs increased, and a negative polarity a-wave appeared in
advance of the b-wave. The a-wave reflects rod outer segment function
(Hood and Birch, 1996; Lamb, 1996). We measured several aspects of the
ERG waveform to determine if there were differences in signal
processing between the WT and GABAC1 null
retinas. Figure 6, B and C, plots intensity response functions for peak amplitude and time-to-peak (implicit time)
for the ERG a- and b-waves in the WT and
GABAC1 null mice. At all flash intensities,
both measures of the a-wave were identical between the two groups of
mice (Fig. 6B,C) (p = 0.99 and
p = 0.24, respectively), as is the peak amplitude of
their b-waves (Fig. 6C) ( p = 0.42). In
contrast, the time-to-peak of the b-wave was significantly faster in
GABAC1 null mice (p = 0.001).
View larger version (27K):
[in this window]
[in a new window]
|
Figure 6.
Dark-adapted photoreceptor function and synaptic
transmission to bipolar cells are normal in GABAC1 null
mice. A, Representative dark-adapted ERG responses
recorded from one wild-type (WT) and one
GABAC1 null (Null) mouse to brief
full-field light flashes. The traces from top to
bottom represent the responses of each mouse from the
dimmest (4.4 log cd sec/m2) to the brightest (0.5 log cd sec/m2) flash. At all intensities, the number
and amplitude of the OPs are larger in GABAC1 null mice
than in WT mice (see Fig. 7 for quantification). The ERGs from seven
other WT and six other GABAC1 null mice were similar.
B, The mean peak amplitudes (± 1 SEM) of the a- and
b-waves of the dark-adapted ERG are plotted as a function of flash
intensity for all WT () and GABAC1 null
( ) mice. No significant difference in the peak amplitude of either
wave was observed when WT and GABAC1 null data were
compared. C, The mean time-to-peak (implicit time) for
the a- and b-waves of the dark-adapted ERG are plotted as a function of
flash intensity for all WT and GABAC1 null mice.
Conventions are the same as in B. Although no
significant difference in the implicit time of the a-wave was observed,
the implicit times of the b-wave in GABAC1 null mice
were significantly more rapid than in WT mice.
|
|
We isolated the OPs from the rest of the ERG using a high pass filter,
and Figure 7A shows the
resulting waveforms recorded at the highest flash intensity from eight
WT and seven GABAC1 null mice. Two aspects of
this response were different between the WT and null mice. As shown in
Figure 7B, at all flash intensities we found a significant
increase in the number of OP wavelets in the ERGs of
GABAC1 null mice compared to WT mice
(p < 0.0001). In addition, with the exception
of the first wavelet (OP1), the mean peak amplitudes of the remaining
wavelets were significantly larger in GABAC1
null mice (Fig. 7C) (p < 0.0001).
These results indicate that elimination of the
GABAC receptor does not compromise rod
photoreceptor signal transduction (a-wave), the transmission of this
signal to the rod bipolar cells or the amplification of this signal by
the rod bipolar cells (b-wave peak amplitude). However, the elimination
of the GABAC receptor does alter transmission of
the visual signal from the rod bipolar cells to third order neurons in
the retina.
View larger version (30K):
[in this window]
[in a new window]
|
Figure 7.
Dark-adapted ERG components that reflect bipolar
cell output are altered in GABAC1 null mice.
A, Dark-adapted ERGs to the brightest flash stimulus,
filtered to isolate the OPs, in eight WT and seven
GABAC1 null mice. In the filtered responses from every
GABAC1 null mouse, there were more OPs, and their
amplitude was larger than the number and amplitude of the response in
WT mice. B, Mean number of OP wavelets (± 1 SEM) as a
function of stimulus intensity in WT (open bars) and in
GABAC1 null mice (filled bars). At
all stimulus intensities, significantly more OPs are observed in
responses of GABAC1 null mice. C, Mean
peak amplitude of each of the individual OPs from WT and
GABAC1 null mice elicited by the brightest flash (0.5 log cd sec/m2). Conventions are the same as in
B. Note that OP5 is present in all GABAC1
null mice but absent in all WT mice.
|
|
In summary, although rodent GABAC receptors are
thought to be comprised of 1 and 2 subunits, we found that in
GABAC1 null mice, deletion of exons 2 through
9 of the GABAC1 subunit gene eliminated the
GABAC receptors in the retina. Using an antibody that recognizes all of the GABAC subunits (Enz
et al., 1995), we showed that there was no subunit labeling in the
retinas of GABAC1 null mice. Our patch-clamp
recordings showed that the normally large GABAC
receptor current present in WT rod bipolar cells was completely absent
in GABAC1 null rod bipolar cells. Although a
GABAA receptor current was present in the
GABAC1 null rod bipolar cells, this did not
compensate for the loss of GABAC receptors
because our ERG recordings showed that inner retinal function was
altered in GABAC1 null mice.
| |
DISCUSSION |
Is expression of the GABAC1 subunit required for
expression of GABAC receptors?
Although initial studies indicated that native retinal
GABAC receptors were homomeric channels, more
recent results suggest that they are heteromeric channels, composed of
1 and 2 subunits (Yeh et al., 1990; Shimada et al., 1992; Enz et
al., 1995; Zhang et al., 1995; Shingai et al., 1996; Boue-Grabot et
al., 1998; Wegelius et al., 1998; Qian and Ripps, 1999; Wotring et al.,
1999). Thus, the absence of GABAC receptor
expression in GABAC1 null mice is probably not
caused by the loss of expression of homomeric 1 channels, but to one
of several other possibilities. Our gene-targeting strategy deleted
~30 kbp between intron 1 and exon 10 of the 1 subunit gene. It is
possible that this change alters 2 expression, because it is located
~40 kbp upstream of 1 (McCall, unpublished observations) on
chromosome 4 (Cutting et al., 1992; Greka et al., 2000). Such an
alteration in neighboring gene expression has been observed for both
the GABAA1 and 2 subunits after gene targeting of the GABAA6 subunit, which are all
clustered on chromosome 11 (Garrett et al., 1997; Uusi-Oukari et al.,
2000). The absence of GABAC receptor expression
also could occur if a domain within the GABAC1
subunit protein is required for the correct assembly or targeting of
functional GABAC receptors into the bipolar cell terminals in vivo. Although little is known about the
control of GABAC receptor targeting in
vivo, in vitro, separate domains on 1 and 2
subunits have been found to control homomeric and heteromeric receptor
assembly (Enz and Cutting, 1999b). Thus, the exact nature of the
interactions that form and target the GABAC
receptor both between the 1 and 2 subunits and with other proteins remains to be determined. Regardless of the mechanism of
receptor loss, the GABAC1 null mice lack the
GABAC receptor and they provide a powerful
background on which to express recombinant subunits to study the
structure and function of these receptors in vivo.
The GABAC receptor does not play a role in
retinal development
Alterations in the expression of genes sometimes change either the
development or maintenance of CNS structures. In the retina, there is
evidence that GABA, via GABAA receptors, plays a
trophic role during development (Redburn, 1992). Because the
GABAC1 subunit is not expressed until
postnatal day 9 (Greka et al., 2000; Wu and Cutting, 2001), we
hypothesized that its elimination would not effect overall retinal
development. We compared the gross anatomy of the retina and Lucifer
yellow-labeled rod bipolar cells of GABAC1
null and WT mice at the light microscopic level and found no
qualitative differences. The overall lamination pattern and thickness
of each lamina are comparable and the morphology of
GABAC1 null rod bipolar cell processes appear
normal. These data strongly suggest that the absence of the
GABAC1 subunit does not alter general retinal development.
The absence of the GABAC receptor alters inhibitory
processing in the retina
Rod bipolar cells
The GABAC receptors are localized primarily
on the axon terminals of the bipolar cells in the IPL (Enz et al.,
1996; Euler and Wassle, 1998; Koulen et al., 1998; Euler and Masland,
2000) where they mediate a chloride current in response to focally
applied GABA (Shields et al., 2000) or light stimulation of the retina (Roska et al., 1998; Euler and Masland, 2000). Pharmacological characterizations have established that this GABA current is a combination of GABAA and
GABAC receptor-mediated responses, with GABAC dominating the combined current (Euler and
Wassle, 1998; McGillem et al., 2000; Shields et al., 2000). In
GABAC1 null rod bipolar cells, GABA evoked a
current that exhibited channel kinetics and pharmacology typical of a
GABAA receptor channel (Feigenspan et al., 1993;
Lukasiewicz et al., 1994; Lukasiewicz and Werblin, 1994; Lukasiewicz
and Wong, 1997; Lukasiewicz and Shields, 1998). Thus, these data also
clearly demonstrate that the 1 subunit eliminates expression of the
GABAC receptors in rod bipolar cells.
In GABAC1 null mice, the kinetics and
pharmacology of the response to GABA are very different from WT
responses. The total charge transfer of the GABA response in
GABAC1 null cells is significantly reduced to
~20% of the WT response, which is mediated by both
GABAA and GABAC receptors.
In addition, the peak amplitude of the response in
GABAC1 null cells is significantly reduced. These data indicate that the inhibitory signal is reduced in
GABAC1 null rod bipolar cells by approximately
the same proportion that we estimate for the
GABAC receptor contribution to the WT GABA response (Fig. 5A-D, Table 1). As a consequence, these
estimates suggest that compensation by GABAA
receptors in the absence of GABAC receptors is
unlikely. Results from other studies support this conclusion. First,
there is no evidence of interactions between any
GABAA and GABAC receptors.
Native GABAA and GABAC
subunits do not combine in mammals either in vivo or
in vitro (Shimada et al., 1992; Hackam et al., 1998; Koulen
et al., 1998), although in vitro mutant rat 1 subunits
(Pan et al., 2000) and variants of a perch subunit, 1B, can
assemble with the GABAA2 subunit (Qian and
Ripps, 1999). Our preliminary immunohistochemistry experiments in the
retinas of GABAC1 null and WT mice indicate
that the location and expression levels of the most common
GABAA subunits, 1 and 2, are normal (data
not shown). Finally, GABAA and
GABAC receptors form distinct clusters in the IPL
(Koulen et al., 1998), which suggests that these receptors may use
different membrane localization mechanisms (Moss and Smart, 2001).
GABA-mediated inhibition is critical to normal processing of the visual
signal through the bipolar cells to the amacrine and ganglion cells in
the retina of most vertebrates (for review, see Lukasiewicz, 1996). For
example, bipolar cell GABAC receptors reduce the
depolarization-induced influx of Ca2+ ions
through voltage-dependent calcium channels (Pan and Lipton, 1995),
which in turn reduces both neurotransmitter release (Lukasiewicz and
Werblin, 1994) and postsynaptic activity (Wellis and Werblin, 1995).
The inhibitory feedback mediated by the GABAC
receptors also has been suggested to modify the temporal tuning of this visual signal, making it more transient (Zhang et al., 1997; Dong and
Werblin, 1998), and these cellular mechanisms may account for a
significant proportion of surround inhibition (Cook and McReynolds,
1998a; Bloomfield and Xin, 2000; Flores-Herr et al., 2001).
The electroretinogram
Although the ERG does not pinpoint the functional role of the
GABAC receptor in vision, we used this technique
because it is the best tool to assess alterations in overall retinal
processing. The ERG evaluates phototransduction and transmission of
this signal to the bipolar cells. It also assesses the
G-protein-mediated amplification of the signal that occurs in the
bipolar cells and aspects of inner retinal function (Robson and
Frishman, 1998). Dark-adapted conditions were chosen because they
limited our assessment of retinal function to the rod pathway (Xu et
al., 2000), where our patch-clamp experiments also had assessed the
GABA currents in rod bipolar cells and where the role of the
GABAC receptor has been most thoroughly
characterized (Euler and Wassle, 1998; Fletcher et al., 1998; Euler and
Masland, 2000). Specifically, its role at the feedback synapse between
the A17 amacrine and the rod bipolar cell terminal has been examined
(Kolb and Nelson, 1983; Fletcher and Wassle, 1999) and has been
proposed to create the robust surround inhibition that is found in
dark-adapted AII amacrine cells (Bloomfield and Xin, 2000).
Our results are consistent with previous evidence that the
photoreceptor response is unaffected by exogenous GABA application (Wachtmeister and Dowling, 1978; Wachtmeister, 1980; Dick and Miller,
1985; Naarendorp and Sieving, 1991; Verweij et al., 1996; Arnarsson and
Eysteinsson, 1997; Vitanova et al., 2001). The amplitude of the b-wave,
which corresponds to the transmission of the visual signal from the
photoreceptors to the depolarizing bipolar cells, also was unaffected.
This result was somewhat unexpected because b-wave changes have been
reported after application of exogenous GABA or GABAergic agents
(Wachtmeister and Dowling, 1978; Wachtmeister, 1980; Dick and Miller,
1985; Naarendorp and Sieving, 1991; Arnarsson and Eysteinsson, 1997;
Vitanova et al., 2001). These reports on the effects of GABA are
however, variable and probably reflect differences in species,
recording techniques, and concentrations of pharmacological agents. Of
particular importance is the lack of a selective
GABAC receptor antagonist, one that does not also act as a weak agonist or antagonist of GABAA
receptors and GABAB receptors (Ragozzino et al.,
1996; Flores-Herr et al., 2001).
The decreased time-to-peak (implicit time) of the b-wave is our most
unexpected ERG result, particularly in light of its normal amplitude.
The explanation for this result is unclear and requires further
investigation, but could reflect a functional role for the
GABAC receptor in the OPL where we, and others,
have observed its presence (Wassle et al., 1998; Picaud et al., 1998;
Pattnaik et al., 2000; Du and Yang, 2000; Vitanova et al., 2001). It is possible that the GABAC receptors provide tonic
inhibition that contributes to setting the light adaptation level in
the outer retina. In the absence of the GABAC
receptor, the functional equivalent of a more light-adapted retina
could occur and would shorten the b-wave time-to-peak.
In GABAC1 null mice, both the amplitude and
number of OPs are increased. These data confirm a role for the
GABAC receptors in inner retinal circuitry of the
rod pathway that |
TOP
ABSTRACT
INTRODUCTION
