 |
Previous Article | Next Article 
The Journal of Neuroscience, June 1, 2002, 22(11):4357-4363
A Negative Regulatory Element Required for Light-Dependent
pinopsin Gene Expression
Yoko
Takanaka,
Toshiyuki
Okano,
Kazuyuki
Yamamoto, and
Yoshitaka
Fukada
Department of Biophysics and Biochemistry, Graduate School of
Science, The University of Tokyo, and Japan Science and Technology,
Core Research for Evolutional Science and Technology, Tokyo 113-0033, Japan
 |
ABSTRACT |
In vertebrates, a variety of light-stimulated genes are distributed
in the retina, the pineal gland, and the suprachiasmatic nucleus, but a
cis-element(s) responsible for the light-dependent transcriptional regulation is left unexplored. Focusing on the pinopsin gene, a light-stimulated gene in the chick pineal
gland, we performed a transcriptional analysis in the primary culture of the chick pineal cells that were transiently transfected with a
luciferase reporter gene fused with various lengths of the 5' upstream
region of the pinopsin gene. Light-dependent enhancer activity was detectable in the construct with the upstream region between 1156 and +31. Introduction of mutations within the 18 bp
sequence at positions 1103 to 1086 (TGGCACGTGGGGTTCCTC), including
a CACGTG E-box sequence, elevated the transcriptional activity in the
dark and thereby abrogated the light dependency, suggesting that the 18 bp sequence is essential for a reduction of the transcriptional
activity in the dark. In an electrophoretic mobility-shift assay, we
identified a pineal nuclear factor(s) capable of binding to the 18 bp
element in a sequence-specific manner. When a 49 bp fragment ( 1122 to
1074) including the 18 bp sequence was placed upstream of the simian
virus 40 promoter, the transcriptional activity was dramatically
suppressed regardless of light conditions in the chick pineal cells,
and a more pronounced repression was observed in
nonpineal/nonphotosensory LMH and NIH 3T3 cells. These results
suggest that the 18 bp element in the pinopsin promoter
constitutes the binding site of a ubiquitous factor that serves for the
transcriptional repression that is required, although not sufficient,
for the light-dependent expression of pinopsin gene in the
chick pinealocytes.
Key words:
chicken; gene expression; light induction; pineal gland; pinopsin gene; transcriptional regulation
 |
INTRODUCTION |
In animals, light plays an important
role not only for vision but also for adaptation to changes in ambient
conditions that greatly influence the expression of many genes. For
example, light is a predominant time cue for entraining an endogenous
circadian clock, which autonomously oscillates with a period of ~24
hr (McWatters et al., 1999 ; King and Takahashi, 2000 ; Pando and
Sassone-Corsi, 2001 ). In resetting the phase of the circadian clock in
rodents, light stimulates the expression of a clock gene
period (Per) in the suprachiasmatic nucleus
(Albrecht et al., 1997 ; Shearman et al., 1997 ; Shigeyoshi et al.,
1997 ), suggesting involvement of the induction of the Per
gene in the phase-shift of the oscillator (Akiyama et al., 1999 ). The
transcription of the Per gene is positively regulated by a
heteromer of basic helix-loop-helix-Per-ARNT-Sim proteins,
CLOCK and BMAL, through a CACGTG sequence (E box) in the Per
promoter (Gekakis et al., 1998 ). Recent studies (King and Takahashi,
2000 ) have revealed a basic mechanism underlying the circadian
oscillation, but far less is known about the photic-entrainment pathway
in animal clock systems.
Light also regulates the transcription of genes for retinal
phototransduction proteins such as rhodopsin (Korenbrot and Fernald, 1989 ) and arrestin (McGinnis et al., 1994 ) to compensate for the protein degradation attributable to the circadian shedding of the
photoreceptor cells. Several cis elements and transcription factors responsible for the photoreceptor cell-specific gene expression have been identified (Rehemtulla et al., 1996 ; Furukawa et al., 1997 ),
whereas those important for light-dependent gene expression are
unexplored. However, in plants, the regulatory processes of light-controlled genes triggering various photic events have been well
characterized (Terzaghi and Cashmore, 1995 ; Heintzen et al., 2001 ).
Like those in plants, the light-responsive genes in animals would be
regulated through a cis-DNA element, light-responsive element (LRE). To understand the mechanism underlying the
light-dependent gene expression in the photosensory cells, we paid
special attention to gene regulation of pinopsin that was
identified in the chicken pineal gland as a pineal-specific
photoreceptive molecule (Okano et al., 1994 ). The chicken pineal gland
is a photosensitive neuroendocrine tissue; it has been widely used for
biochemical and pharmacological studies on the circadian clock because
it retains an intracellular phototransduction pathway regulating the
phase of the intrinsic clock oscillator and because these functions are
well maintained even in the dispersed cell culture (Deguchi, 1981 ; Zatz
et al., 1988 ). We found previously that mRNA levels of
pinopsin are kept low in the dark and increase approximately
sixfold with 6 hr of light exposure in chicks (Takanaka et al., 1998 ),
in a time course similar to that of light-dependent Per2
induction in the Xenopus retina (Steenhard and Besharse,
2000 ). Even in the isolated pineal organ culture, the expression of
pinopsin gene is upregulated by light, albeit to a less
pronounced degree (~1.5-fold) than in vivo. Here we show
that an 18 bp element at positions 1103 to 1086 in the upstream
region of pinopsin plays a key role in light responsiveness.
This sequence represents the first example of elements that confer
light-responsive gene expression in animal cells.
 |
MATERIALS AND METHODS |
Isolation of the pinopsin upstream region. The
pinopsin upstream DNA fragment was isolated using a long and
accurate PCR in vitro cloning kit (TaKaRa, Otsu,
Japan) with specific pinopsin primers R7 (at
positions +320 to +336, relative to the transcription initiation site;
5'CGTGTTTGGCAGGAGGA3') and R9 (at positions +27 to +46;
5'CCGATGTCCTCCAACAGCTC3'). The isolated fragments (2.5 kb) were
subcloned into pCR 2.1 (Invitrogen, Carlsbad, CA) for sequence determination.
Animals and pineal cell culture. Animals were treated in
accordance with the guidelines of the University of Tokyo. Newly hatched chicks were housed under a 12 hr light/dark cycle; the next day
(day 1), the pineal glands were isolated from the chicks during the
light period. The pineal cells were dispersed by passing them through a
cell strainer (100 µm Nylon; Becton Dickinson, Franklin Lakes, NJ),
and placed in 48 well plates (1 × 106 cell/well) with 1 ml of Medium 199 (Invitrogen) supplemented with 10 mM HEPES, pH
7.3, 100 U/ml penicillin G, 100 µg/ml streptomycin, 0.9 mg/ml
NaHCO3, and 10% (v/v) fetal bovine serum
(Invitrogen). The pineal cells were cultured at 37°C in 5%
CO2 in a 12 hr light/dark cycle (lights on at
8:00 A.M. and off at 8:00 P.M.) with a light intensity of
250-300 lux at the level of culture plates in the CO2 incubator. The cultured cells were
transfected with plasmids at 4:00 P.M. on day 3 and were harvested at
12:00 P.M. on day 4.
Plasmid construction and transfection. Promoter/reporter
hybrid constructs were prepared by introducing each of several clones for the pinopsin upstream regions into the
NheI/XhoI site of pGL3-Basic or by linking
annealed oligonucleotide into the SmaI site of pGL3-promoter vector (Promega, Madison, WI). In vitro mutagenesis in the
pinopsin promoter region was performed using the QuikChange
site-directed mutagenesis kit (Stratagene, La Jolla, CA). The cells
were transfected with these plasmids using LipofectAmine Plus
(Invitrogen) according to the manufacturer's instructions. In every
experiment, pRL-TK (Promega) was cotransfected as a control measure,
and the luciferase activities were evaluated with the aid of the
Dual-Luciferase reporter assay system (Promega).
Oligonucleotides. The synthetic DNA oligonucleotides used
for the site-directed mutagenesis and for electrophoretic
mobility-shift assay (EMSA) were pinopsin 49 bp
(WT49) probe (at positions 1122 to 1074),
5'GATG-GAGCACATCCTGCTGTGGCACGTGGGGTTCCTCACTTTGTAC-GAA3'; -crystallin (DC5), 5'GATCTAAATATTCATTGTTGTTGCTCACCTACCATG3' (Kamachi
and Kondoh, 1993 ); DC5 mutation (mutDC5),
5'GATCTAAATATTCATTGTTGTTGCTCCAATACCATG3' (Kamachi and
Kondoh, 1993 ); arginine vasopressin (AVP),
5'GATCTCAGGCCCACGTGTGTCCCCAGGCCCACGTGTGTCCCCAGGCCCACGTGTGTCCCA3' (Jin et al., 1999 ); AVP mutation (mutAVP),
5'GATCTCAGGCCGGACCTTGTCCCCAGGCCGGACCTTGTCCCCAGGCCGGACCTTGTCCCA3' (Jin et al., 1999 ); chicken Per2 (cPer2),
5'GTGTCACACGTGAGGCTTA3' (Doi et al., 2001 ); and cPer 2 mutation (mutcPer2), 5'GTGTCAGGACCTAGGCTTA3' (Okano et al.,
2001 ).
Preparation of nuclear proteins. Newly hatched chicks were
housed under 12 hr light/dark cycles for 2 d and the pineal glands were isolated during the light period ("light" sample), whereas the
"dark" sample was prepared from chicks that were raised under constant dark conditions for 2 d and the pineal glands were
isolated in the dark. The nuclear extracts were prepared according to
the method of Gorski et al. (1986) , with modifications. Briefly, 100 pineal glands (light or dark samples) or liver slices (~1 gm; isolated from the chicks in the light) were homogenized with a glass-glass homogenizer on ice in 5 ml of ice-cold sucrose buffer I
(10 mM HEPES-KOH, 15 mM
KCl, 0.15 mM spermine, 0.5 mM spermidine, 1 mM EDTA,
2.2 M sucrose, 5% v/v glycerol, 0.5 mM DTT, 0.5 mM PMSF, and 14 µg/ml aprotinin, pH 7.6). These procedures for the dark sample were
performed under dim red light (>640 nm) and subsequent manipulations
were performed in the light. The homogenate was layered over a 6 ml
cushion of ice-cold sucrose buffer II (10 mM
HEPES-KOH, 15 mM KCl, 0.15 mM spermine, 0.5 mM
spermidine, 1 mM EDTA, 2 M
sucrose, 10% v/v glycerol, 0.5 mM DTT, 0.5 mM PMSF, and 14 µg/ml aprotinin, pH 7.6) and
centrifuged in an SW41Ti rotor (Beckman Coulter, Fullerton, CA) at
100,000 × g for 1 hr at 4°C. Then the pellet was
resuspended in 240 µl of a nuclear lysis buffer (10 mM HEPES-KOH, 0.55 M KCl,
0.1 mM EDTA, 10% v/v glycerol, 3 mM MgCl2, 0.5 mM DTT, 0.1 mM PMSF, and 14 µg/ml aprotinin, pH 7.6). After gentle mixing for 30 min, the
suspension was centrifuged in a TLA 100.3 rotor (Beckman
Coulter) at 200,000 × g for 1 hr at 4°C. Solid
(NH4)2SO4
was added to the supernatant (0.3 gm/ml), followed by gentle mixing for
30 min. The proteins sedimented by centrifugation in a TLA 100.3 at
150,000 × g for 30 min at 4°C were dissolved in a
dialysis buffer (25 mM HEPES-KOH, 50 mM KCl, 0.1 mM EDTA, 10%
v/v glycerol, and 1 mM DTT, pH 7.6) for dialysis
against the buffer at 4°C. This nuclear protein fraction was stored
in liquid nitrogen until use.
Electrophoretic mobility-shift assay. The double-stranded
oligonucleotide prepared as described by Okano et al. (2001) was radiolabeled at the 5' end with
[ -32P]ATP using Megalabel (TaKaRa)
and then incubated with 2.5 µg of nuclear proteins and 0.5 µg of
poly(deoxyinosinic-deoxycytidylic) for 30 min at 37°C in a
reaction buffer (25 mM HEPES-KOH, 50 mM KCl, 2.5 mM
MgCl2, 0.1 mM EDTA, 10%
v/v glycerol, and 1 mM DTT, pH 7.6) before
electrophoresis. Competition EMSAs were performed by premixing nuclear
proteins with a 50-fold molar excess of unlabeled double-stranded
oligonucleotides (competitor). In the experiment shown in Figure
5C, 1 µg of nuclear protein was incubated with radiolabeled WT49 probe and 2 µg of salmon sperm DNA in a reaction buffer (25 mM HEPES-KOH, 100 mM KCl, 7.5 mM
MgCl2, 0.1 mM EDTA, 10%
v/v glycerol, and 1 mM DTT, pH 7.6) in the
presence or absence of competitors. These reaction mixtures were
electrophoresed in a 6% w/v polyacrylamide gel with 0.5×
Tris-borate-EDTA buffer containing (in
mM): 44.5 Tris, 44.5 boric acid, and 1 EDTA; the radioactivity in the gel was detected by an image analyzer (FLA 2000;
Fujifilm, Tokyo, Japan).
 |
RESULTS |
Functional characterization of the pinopsin
promoter region
Using oligonucleotide cassette-mediated PCR, we cloned a 2.5 kb
chick genomic fragment including the pinopsin gene upstream region (Fig. 1A), in
which a TATA box was found at positions 39 to 34 upstream from its
transcription initiation site described in the GenBank database
(accession number U87449). We also found at positions 94 to 90 an
inverted pineal regulatory element (PIRE, TAATC/A) (Li et al., 1998 ),
to which CRX (cone rod homeobox protein) binds for transactivation of
photoreceptor cell-specific genes (Furukawa et al., 1997 ). Three copies
of CACGTG E boxes were present at positions 1100 to 1095, 2009
to 2004, and 2023 to 2018 (Fig. 1A).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 1.
Transcriptional analysis of the
pinopsin promoter region in cultured chick pineal cells
under dark/light conditions. A, Schematic of the
pinopsin promoter region. B, C, Luciferase
(luc) reporter assays performed with constructs
harboring various lengths of the pinopsin promoter region.
The cultured chick pineal cells were transfected with each construct
shown at the left and incubated in the light/dark cycles
(light, open bars) or in constant darkness (dark,
filled bars). Then the cells were harvested under the
light or dark condition to measure the luciferase activities. A typical
set of data out of three independent experiments is shown in this
figure. Error bars indicate means ± SD of four replicated cell
cultures. *p < 0.05; Student's t
test.
|
|
To search for the cis-DNA element(s) responsible for the
light-dependent gene expression, we prepared five kinds of reporter constructs with various lengths of the 5'-flanking genomic fragments of
pinopsin gene each linked with the luciferase reporter gene (Fig. 1B). Chick pineal cells were cultured under 12 hr light/dark cycle conditions (lights on at 8:00 A.M. and off at 8:00
P.M.) for 2 d; they were transfected at 4:00 P.M. on the following
day with each construct. One group of the cell plates was transferred to the constant dark at 8:00 P.M. (dark sample); the other was maintained under the light/dark cycle (light sample). After 16 hr
(12:00 P.M. the next day) the cells were harvested under the dark or
light conditions to measure the luciferase activities. We found that
the construct harboring the region between position 1156 and +31
( 1156/+31) exhibited a light-stimulated reporter activity (Fig.
1B), whereas the longer constructs ( 2102/+31 and 1773/+31) showed no significant difference in reporter activity between the light and the dark conditions, suggesting regulation by an
element(s) between position 2102 and 1156 that apparently masks the
effect of light. Such a light-insensitive reporter activity was also
observed for the shorter constructs 805/+31 and 290/+31; this
suggests that at least one of the LREs indispensable for the
light-dependent pinopsin gene expression is present in the region between position 1156 and 805. The shortest construct 290/+31 retains a PIRE-like sequence (Li et al., 1998 ) and a TATA
box, but the reporter activity was very low and similar to that of a
promoterless construct, indicating that these elements are insufficient
not only for the light-dependent expression but also for the basal
expression of the pinopsin gene.
To localize an LRE(s) between position 1156 and 805, we prepared
another construct, 1040/+31. This construct no longer displayed the
light-sensitive promoter activity (Fig. 1C), localizing the
putative LRE(s) between 1156 and 1040. This region was also analyzed using three constructs ( 1122/+31, 1097/+31, and
1078/+31), among which only the longest construct ( 1122/+31) was
capable of conferring the light responsiveness (Fig. 1C),
suggesting the presence of the LRE in the vicinity of position
1122/ 1097.
To determine the critical sequence for the light-dependent
transactivation, mutations were introduced into the construct
1156/+31 at a region between position 1121 and 1082, producing
eight constructs (Fig.
2A, M1-M8), in the
form of six consecutive base substitutions (M1-M7) or four base
substitutions (M8). As shown in Figure 2B, M1,
M2, M3, and M8 displayed light-sensitive reporter activities, whereas
the activities of M4-M7 were insensitive to light (Fig.
2B). Notably, M1-M3 showed reporter activities
markedly higher than the wild-type 1156/+31 construct in the light
and dark, suggesting that a transcriptional inhibitor(s) binds to this
region (between 1121 and 1104) to suppress the basal
transcriptional activity. More importantly, the light-insensitive
reporter activities of the mutants M4-M7 were more comparable with
that of the wild type detected in the light than that in the dark (Fig.
2B); hence the 18 bp element at positions 1103 to
1086 (TGGCACGTGGGGTTCCTC) seemed to elicit transcriptional repression
in the dark (see below).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 2.
Scan of critical sequences for LRE gene
expression. A, Positions of mutations introduced into
the 1156/+31 construct. The numbers on the
top refer to base positions relative to the
transcription initiation site. B, Luciferase assays
performed with constructs harboring various mutations of the
pinopsin promoter region. The cells were transfected with
each construct and harvested in the light (open bars) or
in the dark (filled bars). In each
panel, a typical set of data out of three independent
experiments is shown. Error bars indicate means ± SD of four
replicated cell cultures. *p < 0.05; Student's
t test.
|
|
Electrophoretic mobility-shift assay
Using a probe of the 49 bp DNA fragment [ 1122/ 1074, (WT49)]
containing the 18 bp LRE, an EMSA was performed to explore a specific
DNA binding protein(s) in the chick pineal nuclear extract. We detected
a retarded band (Fig. 3, lanes
2 and 12, arrowhead), and the formation of
this band was completely blocked by the addition of an excess amount of
unlabeled WT49 (Fig. 3, lanes 3 and 13). The DNA
sequence specificity of the interaction was examined by assessing the
competitive effects of mutated WT49 fragments. The addition of an
excess amount of M4-M7 had no competitive effect on the EMSA band,
whereas M1, M2, M3, and M8 fragments retained significant binding
capacities (Fig. 3, lanes 4-11). These binding patterns are
in good agreement with the effects of mutations on the light
responsiveness of the transcription evaluated by the luciferase assay
(Fig. 2B). The recognition sequence of the
WT49-binding factor lies in the 18 bp pinopsin LRE.

View larger version (71K):
[in this window]
[in a new window]
|
Figure 3.
Competition EMSA of WT49 probe with the chick
pineal nuclear proteins. Before mixing with end-labeled WT49 probe,
pineal nuclear proteins prepared from light-adapted chicks were
preincubated with the competitor shown on the top of
each lane. The sequences of M1-M8 are shown in Figure
2A; WT49 represents DNA fragment 1122 to 1074
of the pinopsin promoter region. An arrowhead
indicates the position of a band representing an LRE-specific
interaction.
|
|
Transcriptional repression through the
pinopsin light-responsive element
To investigate whether the short stretch of the
pinopsin upstream region at positions 1122 to 1074
(WT49) can confer light-dependent gene expression, we generated
a WT49/simian virus 40 (SV40) construct (Fig.
4A) in which WT49
( 1122 to 1074) was linked to SV40 promoter (pGL3 promoter;
Promega). The WT49/SV40 construct failed to show light-dependent
promoter activity in the chick pineal cells (Fig. 4B), but we found that the WT49 sequence strikingly
suppressed the reporter activity governed by SV40 promoter regardless
of light conditions (83-85% inhibition of the SV40 promoter activity) (Fig. 4B); this repression was completely restored by
mutating the core CACGTG sequence (M5/SV40 construct in Fig.
4B). These observations indicate that the
pinopsin LRE by itself is insufficient for conferring
light-dependent gene expression but is required for it by repressing
the basal transcriptional activity. A similar or more pronounced
inhibitory effect of WT49 on the reporter activity was seen not only in
chicken hepatoma LMH cells (99% inhibition) (Fig.
4C) but also in mammalian cells such as NIH 3T3 cells (83% inhibition) (Fig. 4D) and 293 Epstein-Barr nuclear
antigen cells (79% inhibition) (data not shown), suggesting
strongly that the pinopsin LRE is required for
transcriptional repression mediated by a factor(s) that is widely
distributed in nonphotosensory cells.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
Transcriptional repression through the
pinopsin LRE ( 1122 to 1074). A, Schematic
of the promoter/reporter constructs used in this experiment.
luc, Luciferase. B-D, The reporter
activities measured in the chick pineal cells
(B), LMH cells (C), and NIH
3T3 cells (D). The cells transfected with each
construct were harvested in the light (open bars in
B) or in the dark (filled bars in
B-D) to measure the luciferase activities. A typical
set of data from three independent experiments is shown in
B-D. Error bars indicate means ± SD of three
replicated cell cultures.
|
|
Characterization of the nuclear protein bound to the
pinopsin light-responsive element
We investigated whether the pinopsin LRE-binding
protein(s) in the chick pineal nuclear extract varies quantitatively
and/or qualitatively between the light and dark conditions. The EMSA revealed no significant difference in band pattern between the shifted
bands derived from nuclear proteins in the light (Fig. 5A, lane 2) and
dark (Fig. 5A, lane 3).

View larger version (71K):
[in this window]
[in a new window]
|
Figure 5.
Characterization of the pinopsin
LRE-binding protein by EMSA. A, EMSA using the WT49
probe in the presence of the pineal nuclear proteins prepared from
light- or dark-adapted chicks. B, Competition EMSA with
pineal nuclear proteins in the presence of competitors:
WT49, M5, DC5, mutDC5, AVP, and mutAVP. C,
Competition EMSA with pineal nuclear proteins in the presence of
competitors: WT49, cPer2, and mutcPer2. D, Sequence
comparison of the vicinity of the E-box region from chicken
pinopsin, cPer2, and mouse AVP (mAVP).
E, EMSA using the chick pineal and liver nuclear
proteins. In each panel, the position of a band
representing a specific interaction with the LRE is indicated by an
arrowhead.
|
|
One of the candidates for the pinopsin LRE-binding factor is
-crystallin enhancer binding protein ( EF1)/zinc finger, E-box binding protein (ZEB), which was identified as a
ubiquitous transcriptional repressor acting through the CACCT(G) E2 box
(Funahashi et al., 1993 ; Genetta et al., 1994 ). This possibility was
tested by the EMSA, in which the reaction mixture was supplied with
-crystallin oligonucleotide harboring the
EF1/ZEB-binding site (DC5; Kamachi and Kondoh, 1993 ) or with its
mutated oligonucleotide (mutDC5). However, these oligonucleotides had
almost no effect on the formation of the retarded band (Fig.
5B, lanes 5 and 6), indicating
no functional relationship between the pinopsin LRE-binding
factor(s) and EF1/ZEB. In contrast, we observed competitive effects
of E-box (CACGTG)-containing oligonucleotides corresponding to regions
upstream of the mouse arginine vasopressin (mAvp) gene and
cPer2 gene, each of which is transactivated through the E
box by positive regulators, CLOCK and BMAL1 (Jin et al., 1999 ; Okano et
al., 2001 ). These competitive effects were completely dependent on the
CACGTG sequence (Fig. 5B, lanes 7 and
8; C, lanes 4 and 5),
indicating that the pinopsin LRE-binding factor can bind to
these E boxes. The flanking sequences of these E boxes showed only weak
similarities to each other (Fig. 5D); therefore, the core
CACGTG sequence may be critical for the binding of the factor.
Using chick liver nuclear proteins, we detected a
CACGTG-dependent formation of a retarded band with a mobility identical to that observed with the chick pineal nuclear proteins (Fig. 5E). This is consistent with E-box-mediated transcriptional
repression observed in chicken hepatoma-derived LMH cells (Fig.
4C); it also supports the notion that the nuclear protein
capable of binding to the pinopsin LRE functions as a
ubiquitous repressor.
 |
DISCUSSION |
We found that an LRE for pinopsin gene regulation is
present at positions 1103 to 1086 in the promoter region and that
the light dependency of the promoter activity is completely lost by introducing mutations within these positions. Interestingly, the CACGTG
sequence found in the pinopsin LRE completely matches the G
box (CACGTGG), one of the LREs identified in plants (Donald and
Cashmore, 1990 ), in which the element is not effective by itself and a
combination with its specific minimal promoter is indispensable for the
expression of light responsiveness. Such sequence conservation implies
a mechanism for the light-dependent gene expression common to animal
and plant cells. Among several transcription factors in plants,
photomorphogenesis-promoting factor (HY5) (Chattopadhyay et
al., 1998 ) and phytochrome interacting factor 3 (Martínez-García et al., 2000 ) in
Arabidopsis are well characterized as G-box-binding
transcriptional activators in light-regulated gene expression. However,
to date no example has been reported for a G-box-binding
transcriptional repressor involved in light-dependent gene expression
even in plants.
Although the pinopsin LRE in the construct
1156/+31 was required for the light dependency (Fig. 2), the 49 bp
stretch encompassing the LRE was unable to confer light responsiveness
even in the cultured pineal cells (Fig. 4B),
indicating that the pinopsin LRE by itself is insufficient
for conferring the light-dependent gene expression. One possible
mechanism is that an additional LRE(s) within the region between 1156
and +31 would cooperatively function with the pinopsin LRE. In this
case, another factor acting on this additional LRE would be required
for light-dependent transactivation of the pinopsin promoter
that is suppressed by the pinopsin LRE-binding protein. We
have tried to identify this putative (second) LRE by transcriptional
analyses of the other systematic series of deletion constructs in the
pinopsin promoter region ( 314 to +31), but this search was
unsuccessful (data not shown). We now assume a contribution of multiple
elements. Alternatively, the specific location of the LRE or its
distance from the promoter region may absolutely be required for
light-dependent transcriptional regulation.
In animals, a CACGTG E box has been shown to play a key role in the
transcription/translation-based autoregulatory feedback loop of the
circadian oscillator (Hao et al., 1997 ; Gekakis et al., 1998 ; Jin et
al., 1999 ). Multiple copies of CACGTG E box were found in mouse
Per1 (mPer1) and human Per1 promoter,
and each E box was shown to recruit the CLOCK-BMAL1 heteromer (Hida et
al., 2000 ). At least a single copy of an E box with a similar function
is present in the promoter region of cPer2 expressed in the
pineal gland (Okano et al., 2001 ). Transcription of both mPer1 and cPer2 genes is regulated by a circadian
clock through the E box; it is also stimulated by light (Albrecht et
al., 1997 ; Shearman et al., 1997 ; Akiyama et al., 1999 ; Okano et al.,
2001 ), but very little information is available about the
Per gene transcriptional regulation contributing to its
light-dependent expression (Crosio et al., 2000 ). Our results clearly
demonstrate that cPer2 and AVP oligonucleotides
both harboring the E box have a competitive effect on the interaction
between the pinopsin LRE and the pineal nuclear protein
(Fig. 5B,C). This raised the possibility that a CACGTG E
box(es) in the promoter region of cPer2 and AVP
genes may contribute to a light-regulatory mechanism similar to that underlying the light-dependent regulation of pinopsin gene
expression through its LRE.
With respect to the transcriptional repressor in animals, EF1/ZEB is
known to bind directly to a subset of the CACCT(G) E box (Funahashi et
al., 1993 ; Genetta et al., 1994 ), but EF1/ZEB-like binding activity
would not be involved in the pinopsin LRE-mediated negative
regulation (Fig. 5B). Considering recent observations that
the BMAL2 homodimer or the CLOCK-BMAL1 heterodimer potentially acts as
a transcriptional inhibitor (Okano et al., 2001 ; Yu et al., 2002 ), a
CLOCK-BMAL-containing complex might be involved in the light-dependent
transcriptional regulation through the pinopsin LRE.
Alternatively, as seen in Neurospora (Heintzen et al.,
2001 ), a novel negative factor might modulate the transcription of
light-regulated clock genes through the CACGTG E box. Like EF1/ZEB
and CLOCK-BMALs, the pinopsin LRE-binding factor seems to
be expressed in a variety of cells not only for light-dependent gene
expression but also for various aspects of gene regulation. Identification of this factor would be one of the ways to understand how the transcriptional apparatus in animal cells responds to light by
using this general repressor through the pinopsin LRE.
 |
FOOTNOTES |
Received Nov. 27, 2001; revised Feb. 27, 2002; accepted March 12, 2002.
This work was supported in part by grants-in-aid from the Japanese
Ministry of Education, Culture, Sports, Science, and Technology. Y.T.
is supported by Research Fellowships of the Japanese Society for the
Promotion of Science for Young Scientists. We thank Prof. H. Kondoh and
Dr. Y. Kamachi (Institute for Molecular and Cellular Biology, Osaka
University, Osaka, Japan) for their kind gift of -crystallin
oligonucleotides (DC5 and mutDC5) and for helpful advice and comments
on this manuscript.
Correspondence should be addressed to Dr. Yoshitaka Fukada, Hongo
7-3-1, Bunkyo-ku, Tokyo 113, Japan. E-mail:
sfukada{at}mail.ecc.u-tokyo.ac.jp.
 |
REFERENCES |
-
Akiyama M,
Kouzu Y,
Takahashi S,
Wakamatsu H,
Moriya T,
Maetani M,
Watanabe S,
Tei H,
Sakaki Y,
Shibata S
(1999)
Inhibition of light- or glutamate-induced mPer1 expression represses the phase shifts into the mouse circadian locomotor and suprachiasmatic firing rhythms.
J Neurosci
19:1115-1121[Abstract/Free Full Text].
-
Albrecht U,
Sun ZS,
Eichele G,
Lee CC
(1997)
A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light.
Cell
91:1055-1064[ISI][Medline].
-
Chattopadhyay S,
Ang LH,
Puente P,
Deng XW,
Wei N
(1998)
Arabidopsis bZIP protein HY5 directly interacts with light-responsive promoters in mediating light control of gene expression.
Plant Cell
10:673-683[Abstract/Free Full Text].
-
Crosio C,
Cermakian N,
Allis CD,
Sassone-Corsi P
(2000)
Light induces chromatin modification in cells of the mammalian circadian clock.
Nat Neurosci
3:1241-1247[ISI][Medline].
-
Deguchi T
(1981)
Rhodopsin-like photosensitivity of isolated chicken pineal gland.
Nature
290:706-707[Medline].
-
Doi M,
Nakajima Y,
Okano T,
Fukada Y
(2001)
Light-induced phase-delay of the chicken pineal circadian clock is associated with the induction of cE4bp4, a potential transcriptional repressor of cPer2 gene.
Proc Natl Acad Sci USA
98:8089-8094[Abstract/Free Full Text].
-
Donald RG,
Cashmore AR
(1990)
Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS-1A promoter.
EMBO J
9:1717-1726[ISI][Medline].
-
Funahashi J,
Sekido R,
Murai K,
Kamachi Y,
Kondoh H
(1993)
-crystallin enhancer binding protein EF1 is a zinc finger-home-odomain protein implicated in postgastrulation embryogenesis.
Development
119:433-446[Abstract]. -
Furukawa T,
Morrow EM,
Cepko CL
(1997)
Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation.
Cell
91:531-541[ISI][Medline].
-
Gekakis N,
Staknis D,
Nguyen HB,
Davis FC,
Wilsbacher LD,
King DP,
Takahashi JS,
Weitz CJ
(1998)
Role of the CLOCK protein in the mammalian circadian mechanism.
Science
280:1564-1569[Abstract/Free Full Text].
-
Genetta T,
Ruezinsky D,
Kadesch T
(1994)
Displacement of an E-box-binding repressor by basic helix-loop-helix proteins: implications for B-cell specificity of the immunoglobulin heavy-chain enhancer.
Mol Cell Biol
14:6153-6163[Abstract/Free Full Text].
-
Gorski K,
Carneiro M,
Schibler U
(1986)
Tissue-specific in vitro transcription from the mouse albumin promoter.
Cell
47:767-776[ISI][Medline].
-
Hao HL,
Allen D,
Hardin PE
(1997)
A circadian enhancer mediates PER-dependent mRNA cycling in Drosophila melanogaster.
Mol Cell Biol
17:3687-3693[Abstract].
-
Heintzen C,
Loros JJ,
Dunlap JC
(2001)
The PAS protein VIVID defines a clock-associated feedback loop that represses light input, modulates gating, and regulates clock resetting.
Cell
104:453-464[ISI][Medline].
-
Hida A,
Koike N,
Hirose M,
Hattori M,
Sakaki Y,
Tei H
(2000)
The human and mouse Period1 genes: five well-conserved E-boxes additively contribute to the enhancement of mPer1 transcription.
Genomics
65:224-233[ISI][Medline].
-
Jin X,
Shearman LP,
Weaver DR,
Zylka MJ,
de Vries GJ,
Reppert SM
(1999)
A molecular mechanism regulating rhythmic output from the suprachiasmatic circadian clock.
Cell
96:57-68[ISI][Medline].
-
Kamachi Y,
Kondoh H
(1993)
Overlapping positive and negative regulatory elements determine lens-specific activity of the
1-crystallin enhancer.
Mol Cell Biol
13:5206-5215[Abstract/Free Full Text]. -
King DP,
Takahashi JS
(2000)
Molecular genetics of circadian rhythms in mammals.
Annu Rev Neurosci
23:713-742[ISI][Medline].
-
Korenbrot JI,
Fernald RD
(1989)
Circadian rhythm and light regulate opsin mRNA in rod photoreceptors.
Nature
337:454-457[Medline].
-
Li X,
Chen S,
Wang Q,
Zack DJ,
Snyder SH,
Borjigin J
(1998)
A pineal regulatory element (PIRE) mediates transactivation by the pineal/retina-specific transcription factor CRX.
Proc Natl Acad Sci USA
95:1876-1881[Abstract/Free Full Text].
-
Martínez-García JF,
Huq E,
Quail PH
(2000)
Direct targeting of light signals to a promoter element-bound transcription factor.
Science
288:859-863[Abstract/Free Full Text].
-
McGinnis JF,
Austin BL,
Stepanik PL,
Lerious V
(1994)
Light-dependent regulation of the transcriptional activity of the mammalian gene for arrestin.
J Neurosci Res
38:479-482[Medline].
-
McWatters H,
Dunlap JC,
Millar AJ
(1999)
Circadian biology: clocks for the real world.
Curr Biol
9:R633-R635[ISI][Medline].
-
Okano T,
Yoshizawa T,
Fukada Y
(1994)
Pinopsin is a chicken pineal photoreceptive molecule.
Nature
372:94-97[Medline].
-
Okano T,
Yamamoto K,
Okano K,
Hirota T,
Kasahara T,
Sasaki M,
Takanaka Y,
Fukada Y
(2001)
Chicken pineal clock genes: implication of BMAL2 as a bidirectional regulator in circadian clock oscillation.
Genes Cells
6:825-836[Abstract].
-
Pando MP,
Sassone-Corsi P
(2001)
Molecular clocks: a vivid loop of light.
Nature
410:311-313[Medline].
-
Rehemtulla A,
Warwar R,
Kumar R,
Ji X,
Zack DJ,
Swaroop A
(1996)
The basic motif-leucine Zipper transcription factor Nrl can positively regulate rhodopsin gene expression.
Proc Natl Acad Sci USA
93:191-195[Abstract/Free Full Text].
-
Shearman LP,
Zylka MJ,
Weaver DR,
Kolakowski Jr LF,
Reppert SM
(1997)
Two period homologs: circadian expression and photic regulation in the suprachiasmatic nuclei.
Neuron
19:1261-1269[ISI][Medline].
-
Shigeyoshi Y,
Taguchi K,
Yamamoto S,
Takekida S,
Yan L,
Tei H,
Moriya T,
Shibata S,
Loros JJ,
Dunlap JC,
Okamura H
(1997)
Light-induced resetting of a mammalian circadian clock is associated with rapid induction of the mPer1 transcript.
Cell
91:1043-1053[ISI][Medline].
-
Steenhard BM,
Besharse JC
(2000)
Phase shifting the retinal circadian clock: xPer2 mRNA induction by light and dopamine.
J Neurosci
20:8572-8577[Abstract/Free Full Text].
-
Takanaka Y,
Okano T,
Iigo M,
Fukada Y
(1998)
Light-dependent expression of pinopsin gene in chicken pineal gland.
J Neurochem
70:908-913[ISI][Medline].
-
Terzaghi WB,
Cashmore AR
(1995)
Light-regulated transcription.
Annu Rev Plant Physiol Plant Mol Biol
5:445-475.
-
Yu W,
Nomura M,
Ikeda M
(2002)
Interactivating feedback loops within the mammalian clock: BMAL1 is negatively autoregulated and upregulated by CRY1, CRY2, and PER2.
Biochem Biophys Res Commun
290:933-941[ISI][Medline].
-
Zatz M,
Mullen DA,
Moskal JR
(1988)
Photoendocrine transduction in cultured chick pineal cells: effects of light, dark, and potassium on the melatonin rhythm.
Brain Res
438:199-215[ISI][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22114357-07$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
Y. Asaoka, H. Mano, D. Kojima, and Y. Fukada
Pineal expression-promoting element (PIPE), a cis-acting element, directs pineal-specific gene expression in zebrafish
PNAS,
November 26, 2002;
99(24):
15456 - 15461.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|