QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

HOME  |   SEARCH  |   ARCHIVE  |   SUBSCRIBE  |   CONTACT  |   HELP

This Article Abstract Full Text (PDF) Submit an eLetter Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (68) Citing Articles via Google Scholar Google Scholar Articles by Nabekura, J. Articles by Akaike, N. Search for Related Content PubMed PubMed Citation Articles by Nabekura, J. Articles by Akaike, N.

 Previous Article  |  Next Article 

The Journal of Neuroscience, June 1, 2002, 22(11):4412-4417

Reduction of KCC2 Expression and GABA_A Receptor-Mediated Excitation after In Vivo Axonal Injury

Junichi Nabekura¹, Tsuyoshi Ueno¹, Akihiko Okabe², Akiko Furuta³, Toru Iwaki³, Chigusa Shimizu-Okabe², Atsuo Fukuda², and Norio Akaike¹

¹ Department of Cellular and System Physiology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, 812-8582, Japan, ² Department of Physiology, Hamamatsu University School of Medicine, Hamamatsu, 431-3192, Japan, and ³ Department of Neuropathology, Neurological Institute, Graduate School of Medical Sciences, Kyushu University, Fukuoka, 812-8582, Japan

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

After axotomy, application of muscimol, a GABA_A receptor agonist, induced an increase in intracellular Ca²⁺ ([Ca²⁺]_i) in dorsal motor neurons of the vagus (DMV neurons). Elevation of [Ca²⁺]_i by muscimol was blocked by bicuculline, tetrodotoxin, and Ni²⁺. In axotomized DMV neurons measured with gramicidin perforated-patch recordings, reversal potentials of the GABA_A receptor-mediated response, presumably equal to the equilibrium potential of Cl, were more depolarized than that in intact neurons. Thus, GABA_A receptor-mediated excitation is suggested to be attributable to Cl efflux out of the cell because of increased intracellular Cl concentration ([Cl]_i) in axotomized neurons. Regulation of [Cl]_i in both control and injured neurons was disturbed by furosemide and bumetanide and by manipulating cation balance across the membrane, suggesting that functional alteration of furosemide-sensitive cation-Cl cotransporters is responsible for the increase of [Cl]_i after axotomy. In situ hybridization revealed that neuron-specific K⁺-Cl cotransporter (KCC2) mRNA was significantly reduced in the DMV after axotomy compared with that in control neurons. Similar expression of Na⁺, K⁺-Cl cotransporter mRNA was observed between axotomized and control DMV neurons. Thus, axotomy led to disruption of [Cl]_i regulation attributable to a decrease of KCC2 expression, elevation of intracellular Cl, and an excitatory response to GABA. A switch of GABA action from inhibitory to excitatory might be a mechanism contributing to excitotoxicity in injured neurons.

Key words: axotomy; GABA; excitation; motoneuron; NKCC1; Cl; Ca²⁺

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Many factors contribute to the diverse consequences of neuronal injury. Recently, attention has focused on elucidating the mechanisms contributing to the functional changes observed in neurons after injury and in vivo. However, most of the information regarding functional changes in injured neurons comes from peripheral neurons. In Aplysia sensory neurons, in vivo axotomy induced neuronal hyperexcitability (Gunstream et al., 1995). The reappearance of immature characteristics has been reported in injured neurons of vertebrates, such as 3, 4, and 5 ACh receptor subunits in chick ciliary ganglion (Levey and Jacob, 1996) and type III Na⁺ channels in spinal sensory neurons (Waxman et al., 1994). In contrast to peripheral neurons, less is known about the responses of mammalian central neurons to in vivo axon injury. Recent studies demonstrate that the expression and function of glutamate receptors are altered in injured CNS neurons. Reduction in the sensitivity of NMDA receptors to extracellular Mg²⁺ (Furukawa et al., 2000) and of NR2A subunit expression have been demonstrated in vagal motoneurons after in vivo axotomy (Nabekura et al., 2002). Glutamate receptor subtype 1 (GluR1) (Ginsberg et al., 1996) and GluR2/3 (Alvarez et al., 2000) are downregulated in cortical neurons with axotomy. Traumatic injury has been shown to decrease Na⁺-K⁺ ATPase activity, resulting in membrane depolarization (Ross and Soltesz, 2000). However, alterations of neuronal responses to inhibitory transmitters after injury remain unclear.

GABA and glycine are major inhibitory transmitters in the brain and are altered in various physiological and pathophysiological conditions. In immature neurons, GABA and glycine have excitatory actions (Cherubini et al., 1990; Kakazu et al., 1999; Ehrlich et al., 1999) because of a high intracellular Cl concentration ([Cl]_i). With maturation, the effect of these transmitters switches to inhibitory, resulting from a decrease of [Cl]_i attributable to a developmental change of [Cl]_i regulation, such as an increase of K⁺-Cl cotransporter (KCC) (Plotkin et al., 1997; Kakazu et al., 1999; Rivera et al., 1999) and a decrease of Na⁺-dependent Cl transport (Kakazu et al., 1999). In mature neurons, a diversity of KCC function is closely linked to maintenance of GABAergic inhibitory synaptic potentials during repetitive stimulation (Ueno et al., 2002). In various pathophysiological conditions, GABA has been reported to alter neuronal excitation. In cultured hypothalamic neurons injured by scraping, GABA evoked an increase in intracellular Ca²⁺ ([Ca²⁺]_i) (van den Pol et al., 1996). In brain slice preparation, tetanic stimulation switched GABA response to excitation as a result of an increase in [K⁺]_o, which probably disturbs Cl extrusion (Taira et al., 1997). Furosemide-sensitive mechanisms are also upregulated in global ischemia (Reid et al., 2000).

In the present study, we focused on elucidating the alterations of [Cl]_i and GABA function and its underlying mechanisms in vagal motoneurons receiving in vivo axotomy.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Surgical procedures. All experiments conformed to the Guiding Principles for the Care and Use of Animal approved by the Council of the Physiological Society of Japan, and all efforts were made to minimize the number of animals used and their suffering.

Unilateral cervical vagus was cut in 16- to 18-d-old rats (n = 28) deeply anesthetized with diethyl ether as described previously (Furukawa et al., 2000). Axotomy of vagal motoneurons was made with fine scissors by cutting unilaterally the vagal bundle at the neck along the vagus nerve. For experiments using acutely dissociated neurons of the dorsal motor nucleus of the vagus (DMV neurons), a piece of DiI or rhodamine-conjugated dextran was placed on proximal cut site of the nerve bundle to identify axotomized DMV neurons (Nabekura et al., 1995). The skin incision was repaired, and rats were returned to the cage after awakening from the anesthetic.

Preparation of DMV neurons. DMV neurons were acutely dissociated 1-3 d after in vivo axotomy as described previously (Furukawa et al., 2000). Briefly, rats were deeply anesthetized with pentobarbital sodium (50 mg/kg, i.p.), and coronal sections of brainstem (400-µm-thick) were made with a microslicer (VT-1000; Leica, Nussloch, Germany). Thereafter, DMV neurons were mechanically dissociated with fire-polished glass pipettes in a small plastic culture dish (Nabekura et al., 1996). The neurons receiving axonal injury were identified as DiI or rhodamine positive under epifluorescence microscope (Nabekura et al., 1995) (see Fig. 2A).

Solutions. Incubation extracellular solution contained (in mM): 124 NaCl, 5 KCl, 1.2 KH₂PO₄, 1.3 MgSO₄, 2.4 CaCl₂, 10 glucose, and 24 NaHCO₃ (well oxygenated with 95% O₂-5% CO₂ gas mixture). The pH was 7.4. Incubation solution was used as extracellular solution for slices before cell dissociation and also used as perfusate in some recordings as indicated. Standard external solution contained (in mM): 150 NaCl, 5 KCl, 1 MgCl₂, 2 CaCl₂, 10 HEPES, and 10 glucose. The pH was adjusted to 7.4 with Tris base. The patch pipette solution for gramicidin perforated-patch recording contained (in mM): 150 KCl and 10 HEPES. Pipette solutions were buffered to pH 7.2 with Tris-OH. Gramicidin was first dissolved in methanol to prepare a stock solution of 10 mg/ml and then diluted to a final concentration of 100 µg/ml in pipette solutions. Rapid change of external solutions with and without drugs was performed with the "Y-tube" method described previously (Nabekura et al., 1993). Physiological measurements were mainly performed in the standard solution at room temperature (23-26°C), but some were performed at 33°C as stated.

[Ca²⁺]_i measurement. Coronal brain slices, including the DMV neurons, were loaded with fura-2 in an incubation solution containing 50 µM fura-2 AM with 0.01% cremophore EL (Sigma, St. Louis, MO) at 28°C for 1 hr. After washing fura-2 AM, slices were placed on glass-bottomed recording chamber on the stage of inverted microscope (TMD-300; Nikon, Tokyo, Japan). Ratiometric excitation was provided by a xenon lamp filtered sequentially using microscopic fluorometer (CAM 230; Jasco, Tokyo, Japan).

Electrical measurements. Electrical measurements were performed with gramicidin perforated-patch recording (Kakazu et al., 2000). The resistance between the patch pipette filled with the internal solution and the reference electrode in the normal external solution was 3-5 M. Ionic currents were measured with a patch-clamp amplifier (EPC-7; List Biologic, Campbell, CA). The membrane potential was held at 50 mV throughout the experiment, except as otherwise stated. The voltage ramps (±10-30 mV) consisted of a linear depolarizing voltage command with a frequency of 0.25 Hz (Nabekura et al., 1996). The E_GABA-A was obtained as the membrane potential at which current responses to voltage ramps applied just before and during GABA_A receptor activation intersected each other in each neuron in the presence of 10⁷ M TTX and 10⁴ M La³⁺ (Kakazu et al., 1999) (see Fig. 2B). To obtain the relationship between resting potentials and resting E_GABA-A in each neuron (see Fig. 2C,D), first, resting membrane potential (V_rest) was measured and then membrane was clamped at V_rest, and voltage ramps were applied in each neuron.

In situ hybridization. One to 2 d after receiving ipsilateral vagal axotomy, rats were anesthetized with 50 mg/kg pentobarbital, and brains were quickly removed and frozen using isopentane and stored at 70°C. Ten micrometer sections were cut on a sliding microtome. To detect KCC2 transcripts, two independent methods were used. One used an 189 bp cDNA fragment of rat KCC2 (GenBank accession number U55816; position 197-385) amplified by reverse transcription-PCR from adult rat cerebral RNA (5' primer, TTCATCAACAGCACGGACAC; 3' primer, CTTCTTCTTTCCGCCCTCAT). cRNA probes were labeled with digoxigenin (DIG) using standard methods, and in situ hybridization was performed. In the second method, a probe for KCC2 mRNA (GenBank accession number U55816) was complementary to bases 2981-3016 (5'-TGGCTTCTCCTCGTTGTCACAAGCTGTCTCTTCGGG-3') of rat KCC2 mRNA sequence (GenBank). A probe for Na⁺, K⁺-Cl cotransporter (NKCC1) mRNA (GenBank accession number AF051561) complementary to bases 2981-3016 (5'-ACATCCTTGGTACCAGGTGAC-TTTTCTTGTGATGAC-3') was also used. In situ hybridization histochemical technique was described previously (Kanaka et al., 2001). Briefly, probes were labeled at the 3' end using [-³⁵S]dATP [1000-1500 Ci/mmol (37-55.5 TBq/mmol); NEN, Boston, MA) and terminal deoxynucleotidyl transferase (TaKaRa, Tokyo, Japan) to obtain a specific activity of ~1.4-2.0 U × 10⁹ dpm/ml. Tissue sections were coated with Kodak NBT-2 emulsion (Eastman Kodak, Rochester, NY) diluted 1:1 with water and exposed at 4°C for 2-4 weeks in a tightly sealed dark box. After being developed in D-19 (Eastman Kodak), fixed with photographic fixer, and washed with tap water, the sections were counterstained with thionin solution to allow morphological identification. The number of grains over each neuron was counted.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Coronal brainstem slices of 400 µm thickness, including the bilateral DMV neurons, were obtained from rats 1-3 d after unilateral vagal axotomy. In slices treated with 50 µM fura-2 AM, application of 10⁴ M muscimol increased [Ca²⁺]_i in the DMV neurons ipsilateral to the axotomy in HEPES-buffered standard extracellular solution (nominally HCO₃ free; n = 8) (Fig. 1A). This muscimol-induced [Ca²⁺]_i increase was completely blocked by 10⁶ M bicuculline (n = 2), 10³ M Ni⁺ (n = 4), and the removal of extracellular Ca²⁺ (n = 2). In the presence of 3 × 10⁷ M TTX, 10³ M muscimol did not increase [Ca²⁺]_i (n = 3). Indeed, muscimol generated action potentials in dissociated axotomized DMV neurons (three of eight cells examined) (Fig. 1B). In contrast, muscimol did not increase [Ca²⁺]_i in the DMV neurons contralateral to axotomy, but glutamate (10⁴ M) did elevate [Ca²⁺]_i (n = 5). Thus, muscimol-evoked action potentials activated voltage-dependent Ca²⁺ entry and increased [Ca²⁺]_i. Furthermore, when 10⁴ M muscimol was applied to brainstem slices prepared 6 hr after axotomy, it failed to elevate [Ca²⁺]_i in the injured DMV neurons (n = 4), suggesting that >6 hr are required for GABA to induce neuronal excitation in the DMV neurons after cervical axotomy.

View larger version (19K): [in this window] [in a new window]   Figure 1.   GABAA receptor mediated-excitation in axotomized DMV neurons. A, 104 M muscimol increased [Ca2+]i in the DMV neurons ipsilateral (Ipsi.) to axotomy (hatched square) at 1 d after vagal axotomy. On the other hand, 104 M glutamate, but not muscimol, increased [Ca2+]i in the DMV neurons contralateral (contra.) to axotomy (open square). Both recordings were obtained from same slice. XII, Hypoglossal nucleus. B, Typical example of muscimol-induced action potentials in an acutely dissociated DMV neuron with axotomy.

Muscimol-induced membrane depolarization might be attributable to a Cl efflux through GABA_A receptor if [Cl]_i increases after injury. The direction of Cl flux through Cl channel is set by an electrochemical gradient of Cl. To better understand Cl efflux through Cl channels in injured neurons, we first examined the relationship between the resting membrane potentials (V_rest) and the reversal potentials for GABA_A receptor-mediated response (E_GABA-A) in axotomized DMV neurons.

After acute dissociation of DMV neurons, gramicidin perforated-patch recording, allowing electrical recording with [Cl]_i undisturbed, was performed on identified neurons. Current responses to 3 × 10⁵ M GABA in control (n = 4) and axotomized (n = 6) neurons were completely blocked by 10⁵ M bicuculline, suggesting that the GABA responses observed were mediated by GABA_A receptor activation. In 9 of 14 axotomized DMV neurons tested in standard extracellular solution, E_GABA-A was more depolarized than the resting membrane potential (Fig. 2D, open and double circles). The resting membrane potential and E_GABA-A averaged 53.9 ± 4.9 mV (mean ± SD; n = 14) and 46.7 ± 9.8 mV (n = 14) in injured DMV neurons compared with 56.2 ± 4.9 mV (n = 12) and 60.1 ± 6.2 mV (n = 12) in controls, respectively. Thus, E_GABA-A was significantly depolarized in axotomized neurons compared with control DMV neurons (p < 0.01; unpaired t test), whereas resting membrane potentials were similar (p > 0.1). Because [Cl]_o is constant in our perfusate, we calculated [Cl]_i in each neuron based on the Nernst equation using measured E_GABA-A and the [Cl]_o. [Cl]_I values were calculated to be 17.1. ± 7.3 mM (mean ± SD) in axotomized DMV neurons (n = 14) (Fig. 2F) and 10.1 ± 2.7 mM in control neurons (n = 12) (Fig. 2E). A significant difference was observed between the two values (p < 0.01; unpaired t test). Thus, with elevated [Cl]_i, an opening of Cl channel induces an efflux of Cl out of the cell, resulting in membrane depolarization in axotomized DMV neurons.

View larger version (51K): [in this window] [in a new window]   Figure 2.   Relationship between resting membrane potential (Vrest) and reversal potential of GABAA receptor response (EGABA-A) in control and axotomized neurons. A, Epifluorescent image of injured DMV neurons stained with DiI. NTS, Nucleus of tractus solitarius; XII, hypoglossal nucleus. B, Gramicidin perforated-patch recording was used on the acutely dissociated injured DMV neurons stained with DiI. B, Left, Voltage ramps were applied before (i) and during muscimol application (ii). Right, Membrane potential at which current responses to voltage ramps intersected with each other (i, ii) was defined as the EGABA-A. C, D, EGABA-A values measured in HEPES-buffered extracellular solution at room temperature (open circles, double circles) and in HCO3-buffered extracellular solution at 33°C (filled circles) were plotted as a function of Vrest in DMV neurons with (n = 20) and without (n = 18) axonal injury. Open and double circles were obtained by using muscimol and GABA applications, respectively. Filled circles were obtained by muscimol application. Note the number of neurons with EGABA-A > Vrest increases in the injured group. E, F, [Cl]i was calculated by using a Nernst equation with knowing [Cl]o and EGABA-A measured in standard (HEPES-buffered) solution in each neuron.

To confirm more depolarized E_GABA-A in injured neurons under more physiological conditions, we also measured E_GABA-A in the incubation solution (HCO₃ buffered) at 33°C. E_GABA-A was more depolarized in the injured neurons (51.7 ± 9.2 mV; mean ± SD; n = 6) than in the control (61.7 ± 3.7 mV; n = 6; p < 0.05) (Fig. 2C,D, filled circles), whereas the resting potential was not significantly affected after axotomy (p > 0.1). No significant difference in E_GABA-A was observed between HEPES-buffered and HCO₃-buffered extracellular solutions in the control and axotomized neurons (p > 0.1 in each group; unpaired t test).

Alteration of cation-Cl cotransporters after axonal injury

In central neurons, the regulation of [Cl]_i is primarily driven by cation-Cl cotransport processes, e.g., KCC and NKCC (Kakazu et al., 1999; Rivera et al., 1999; Ueno et al., 2002). Indeed, 1 mM furosemide, an inhibitor of the transporters, almost completely eliminated the differences in E_GABA-A, which were near the holding potential (V_h of  50 mV) in both control (n = 6) and axotomized (n = 6) neurons (Fig. 3A). This result suggests an active role for the furosemide-sensitive transporters, e.g., KCC and NKCC, in maintaining [Cl]_i low in control DMV neurons and high in injured neurons. In addition, reducing the driving force for K⁺ by raising [K⁺]_o from 5 to 20 mM ([K⁺]_i, 150 mM) induced a positive shift of E_GABA-A in the control (n = 3) (Fig. 3B), suggesting that a furosemide- and K⁺-sensitive mechanism, e.g., KCC, maintains a low [Cl]_i in control neurons.

View larger version (29K): [in this window] [in a new window]   Figure 3.   Furosemide-sensitive and K+-dependent [Cl]i regulation. A, Furosemide at 1 mM reversibly decreased the amplitudes of GABA responses (current traces) and shifted EGABA-A to a Vh in the DMV neurons with (filled circles) and without (open circles) axotomy (bottom graphs). Thus, EGABA-A values in both groups were maintained mainly by furosemide-sensitive mechanisms. Representative three of six control and two of six injured neurons were shown in the graph. B, An increase of [K+]o from 5 to 20 mM to decrease K+-driving force across the membrane decreased the outward amplitude of GABA response (top traces) and depolarized EGABA-A in the control neurons (bottom graph). Vertical lines in the current traces were current responses to ramp voltage commands applied. [K+]i, 150 mM. Vh was 50mV. GABA (105 M) was applied at an interval of 15 min.

To examine the functional involvement of NKCC, another furosemide-sensitive Cl cotransport, the effect of bumetanide on [Cl]_i was examined in control and injured neurons. In the presence of 10 µM bumetanide, [Cl]_i decreased by 3.9 ± 1.2 mM (n = 5) in the injured neurons and 2.1 ± 0.8 mM (n = 5) in the control neurons. Removal of extracellular Na⁺ (n = 4) with the aim to inhibit Na⁺-dependent Cl transport, e.g., NKCC, gradually decreased [Cl]_i in injured neurons (Fig. 4). Thus, NKCC seems to play an important role in keeping high [Cl]_i in injured neurons.

View larger version (24K): [in this window] [in a new window]   Figure 4.   Cl accumulation by bumetanide- and Na+-sensitive mechanism in injured neurons. A, Top traces, In the presence of 105 M bumetanide, the amplitude of inward current response to 105 M GABA gradually decreased in injured neurons. After the end of bumetanide, inward GABA response gradually restored (top current traces). Disruption of current trace during each GABA application is attributable to rapid current response to voltage ramp to measure the EGABA-A. GABA was applied at an interval of 10 min. Vh was 50mV. Bottom graph, In this neuron, a reversible disturbance of Cl accumulation by 105 M bumetanide was demonstrated. Axotomy was performed 2 d before making preparation. B, Decreases of [Cl]i resulted from disturbance of Cl accumulation by 105 M bumetanide in the control (cont.; n = 5) and injured (inj.; n = 5) neurons and by a removal of extracellular Na+ in injured neurons (n = 4).

Of the cation-Cl transporters, KCC2 (Payne et al., 1996) and NKCC1 (Plotkin et al., 1997) are predominately expressed in the CNS. In situ hybridization revealed that mRNA for KCC2 was significantly less prevalent in axotomized DMV compared with the control side at 1-3 d after axotomy (Fig. 5). Reduction in KCC2 mRNA expression was also observed in the hypoglossal (n = 5) and facial nuclei (n = 3) ipsilateral to axotomy performed at XII and VII cranial nerves, respectively. Thus, reduction of KCC2 mRNA after axotomy was not restricted to the DMV neurons, but may be a common phenomenon in the motor neurons. In addition, "crush" injury of vagal bundle at the neck mimicked cut injury regarding reduced KCC2 mRNA expression in DMV neurons (n = 6). On the other hand, the density of NKCC1 mRNA did not change between the DMV neurons ipsilateral and contralateral to axotomy (Fig. 6). Thus, the increase of Cl over the holding potential or resting potential is attributable to a decrease of Cl extrusion by KCC and to a lesser affected Cl accumulation mechanism attributable to NKCC, resulting in excess Cl accumulation.

View larger version (67K): [in this window] [in a new window]   Figure 5.   In situ hybridization of KCC2 mRNA in the DMV neurons with and without axotomy by using DIG-labeled probe (A) and 35S-labeled probe (B). Cut injury of X nerve at the neck was performed 2 d before making preparation. A, In situ hybridization by using DIG-labeled probe revealed less density of KCC2 mRNA expressions in the DMV neurons ipsilateral to axotomy (Injured side) than that contralateral to axotomy (Control side). DMV neurons are surrounded by dotted lines. XII, Hypoglossal nucleus; NTS, nucleus tractus solitarius; CC, central canal. B, KCC2 mRNA hybridization signals by using 35S-labeled probe (small black dots) were severely downregulated in injured DMV neurons. The sections were counterstained with thionin solution to allow morphological identification of cells (gray areas). Bottom graph, Comparisons of the number of grains in the DMV neuron expressing KCC2 mRNA. All data are means ± SD (n = 4). Statistics were performed with Student's t test. Marked decrease in the numbers of grains in the DVM neuron with axotomy. Scale bars: A, 80 µm; B, 20 µm.

View larger version (59K): [in this window] [in a new window]   Figure 6.   In situ hybridization of NKCC1 mRNA in the DMV neurons with and without axotomy. Top, Bright-field photomicrographs of a counterstained section shows that no remarkable difference of NKCC1 mRNA (black dots) was observed between the DMV neurons with (Injured side) and without (Control side) axotomy. Scale bar, 20 µm. Bottom, Comparisons of the number of grains in the DMV neuron expressing NKCC1 mRNA. All data are means ± SD (n = 4). Statistics were performed with Student's t test. No significant difference was obtained between two groups (p > 0.1).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

GABA-induced excitation in injured neurons

In the present study, an increase of [Ca²⁺]_i evoked by GABA_A receptor activation appeared after 6 hr after in vivo axonal injury. In cultured neurons, a rapid alteration of [Cl]_i with a latency of <3 hr after scraping injury applied directly to the soma has been reported previously (van den Pol et al., 1996). Increases of [Ca²⁺]_i induced by GABA_A receptor activation after injury are blocked by Ni²⁺ in both preparations, suggesting that GABA-induced [Ca²⁺]_i increase is mediated by Ca²⁺ channel activation in the plasma membrane of neurons with in vivo and in vitro injuries.

Difference in distance between the site of injury and soma might contribute to the discrepancy in the onset of GABA excitation after neuronal injury. In Aplysia, the axonal "injury signals" move to the soma at a rate of 36 mm/d (Gunstream et al., 1995). Slow conduction of an injury signal from the injured site to the soma might account for the delayed onset in the present experiment. Alternatively, soma scraping might be a more potent injury than axonal injury regarding alterations in Cl regulation.

GABA-elevated [Ca²⁺]_i in the DMV neurons ipsilateral to axotomy was mediated by voltage-dependent Na⁺ channel activation because TTX blocked GABA-induced neuronal excitation. Thus, GABA-induced depolarization possibly elicits Na⁺ channel activation and further membrane depolarization, resulting in activation of voltage-dependent Ca²⁺ channel. Muscimol induced membrane depolarization in a majority of injured motoneurons (Fig. 2D) and was also able to elicit action potentials in injured neurons (Fig. 1B).

Alteration of intracellular Cl regulators

Activation of GABA_A receptors allows Cl movement mainly according to the difference between E_Cl and membrane potential. In the present result, no significant difference in the resting membrane potential was obtained between control and injured neurons. Thus, alteration of GABA action is attributable to a change of [Cl]_i because of the constant [Cl]_o in our experimental condition. Increase of [Cl]_i over the V_h and resting potential is caused by net [Cl]_i accumulation with or without a decrease of Cl extrusion in injured neurons. At present, various [Cl]_i regulators, such as KCC, NKCC, Cl-HCO₃ exchange, and Na⁺-dependent Cl-HCO3 exchange, are known to be involved in the regulation of [Cl]_i in the central neurons (Kaila, 1994). Because our solution is HEPES based, changes of Cl-HCO₃ exchange and Na⁺-dependent Cl-HCO₃ exchange are not required for regulating [Cl]_i during our responses. Of these regulators, KCC, which normally carries Cl out of the cell with K⁺, primarily contributes to keep low [Cl]_i in the mature neurons (Fig. 3) (Kakazu et al., 2000; Ueno et al., 2002). Indeed, developmental increase of KCC2 mRNA primarily contributes to switch GABA response from the excitation to the inhibition in the hippocampal neurons (Rivera et al., 1999). Neuronal diversity in KCC2 expression is closely linked to that of Cl extrusion efficacy (Ueno et al., 2002). On the other hand, NKCC carries Cl into the cell by using cationic driving forces, which helps to keep a high [Cl]_i in immature neurons (Plotkin et al., 1997; Kakazu et al., 1999). In the DMV neurons, furosemide- and cation-sensitive mechanisms contributed substantially to maintain [Cl]_i constant in control and injured DMV neurons (Figs. 3, 4).

Functional alteration of furosemide-sensitive cation-Cl cotransporters in the injured neurons could be accounted for by changes in either (1) activity of existing KCC and NKCC or (2) KCC and NKCC expression. In several non-neuronal cell types, NKCC and KCC activities are modulated by phosphorylation-dephosphorylation mechanisms (Krarup et al., 1998; Jennings 1999; Lauf and Adragna, 2000; Russell, 2000) by cAMP-dependent processes (Greger et al., 1999) and by myosin chain kinase (Kelley et al., 2000). Thus, it cannot be ruled out that changes in various intracellular substances, such as protein kinases, after axotomy might affect existing cation-Cl cotransporter activities. Our in situ hybridization studies demonstrated a decrease in KCC2 mRNA (Fig. 5), whereas NKCC1 mRNA was unchanged in the axotomized DMV neurons (Fig. 6). A significant role of NKCC1 in keeping high [Cl]_i has been clearly demonstrated in sensory afferent neurons (Sung et al., 2000). In our hands, 10 µM bumetanide, a potent NKCC inhibitor, as well as removal of extracellular Na⁺ decreased [Cl]_i in injured neurons, as evidenced by GABA-induced inward currents recorded in our standard extracellular solution (Fig. 4). Thus, we conclude that, in injured neurons, the Cl accumulation is attributable to a decrease in Cl extrusion, which is mediated by reduced KCC2 expression, whereas influx of Cl through NKCC1 remained unchanged. As a consequence, this is likely to be responsible for switching GABA action to excitation.

Functional significance of injury-induced alteration of GABA responses

Reappearance of immature characteristics after in vivo axonal injury has been observed for 3, 4, and 5 ACh receptor subunits in the ciliary ganglion (Levey and Jacob, 1996) and type III Na⁺ channels in dorsal root ganglion neurons (Waxman et al., 1994). As for [Cl]_i regulation, lack of KCC and maintenance of NKCC function in the lateral superior olive neurons (Kakazu et al., 1999) and less KCC2 mRNA expression in the hippocampus (Rivera et al., 1999) have been demonstrated in immature animals. In DMV neurons, immature characteristics of GABA responses (present results), as well as NMDA responses (Furukawa et al., 2000), appear soon after axonal injury. GABA enhances neurite outgrowth and induces synaptic maturation in immature animals (Spoerri, 1988; Barbin et al., 1993). Thus, in this sense, neuronal injury might result in neurons reacquiring more plastic characteristics. On the contrary, it is possible that GABA-induced depolarization in injured neurons activates voltage-dependent Ca²⁺ channels and relieves the voltage-dependent Mg²⁺ block of NMDA receptors (Furukawa et al., 2000). An increase of intracellular Ca²⁺ via these mechanisms might be related to neuronal Ca²⁺-dependent excitotoxicity, such as phospholipases, endonucleases (Choi, 1992), and calpain (Siman et al., 1989).

	FOOTNOTES

Received Jan. 14, 2002; revised March 15, 2002; accepted March 21, 2002.

This work was supported by Grants-in-Aid for Scientific Research on Priority Areas (C)-Advanced Brain Project Grant 13210108, Priority Areas (A)-Integrated Brain Research Grant 13035036, and Priority Areas (A)-Neuronal Circuit Grant 12053256 from the Ministry of Education, Culture, Sports, Science, and Technology, Japan (J.N.). We give our appreciation to Drs. M. Andressen at the Oregon Health Science University and R. Balice-Gordon at the University of Pennsylvania for critical reading of this manuscript.

Correspondence should be addressed to Dr. Junichi Nabekura, Department of Cellular and System Physiology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi Higashi-ku Fukuoka, 812-8582, Japan. E-mail: nabekura{at}physiol2.med.kyushu-u.ac.jp.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

• Alvarez FJ, Fyffe RE, Dewey DE, Haftel VK, Cope TC (2000) Factors regulating AMPA-type glutamate receptor subunit changes induced by sciatic nerve injury in rats. J Comp Neurol 426:229-242[Medline].
• Barbin G, Pollard H, Gaiarsa JL, Ben-Ari Y (1993) Involvement of GABA_A receptors in the outgrowth of cultured hippocampal neurons. Neurosci Lett 152:150-154[ISI][Medline].
• Cherubini El, Rovira C, Gaiarsa JL, Corradetti R, Ben-Ari Y (1990) GABA mediated excitation in immature rat CA3 hippocampal neurons. Int J Dev Neurosci 8:481-490[ISI][Medline].
• Choi DW (1992) Excitotoxic cell death. J Neurobiol 23:1261-1276[ISI][Medline].
• Ehrlich I, Lohrke S, Friauf E (1999) Shift from depolarizing to hyperpolarizing glycine action in rat auditory neurons is due to age-dependent Cl regulation. J Physiol (Lond) 520:121-137[Abstract/Free Full Text].
• Furukawa Y, Okada M, Akaike N, Hayashi T, Nabekura J (2000) Reduction of voltage-dependent magnesium block of N-methyl-D-aspartate receptor-mediated current by in vivo axonal injury. Neuroscience 96:385-392[ISI][Medline].
• Ginsberg SD, Rothstein JD, Price DL, Martin LJ (1996) Fimbria-fornix transections selectively downregulate subtypes of glutamate transporter and glutamate receptor proteins in septum and hippocampus. J Neurochem 67:1208-1216[ISI][Medline].
• Greger R, Heitzmann D, Hug MJ, Hoffmann EK, Bleich M (1999) The Na⁺ 2Cl K⁺ cotransporter in the rectal gland of Squalus acanthias is activated by cell shrinkage. Pflügers Arch 438:165-176[ISI][Medline].
• Gunstream JD, Castro GA, Walters ET (1995) Retrograde transport of plasticity signals in Aplysia sensory neurons following axonal injury. J Neurosci 15:439-448[Abstract].
• Jennings ML (1999) Volume-sensitive K⁺/Cl cotransport in rabbit erythrocytes. Analysis of the rate-limiting activation and inactivation events. J Gen Physiol 114:743-758[Abstract/Free Full Text].
• Kaila K (1994) Ionic basis of GABA_A receptor channel function in the nervous system. Prog Neurobiol 42:489-537[ISI][Medline].
• Kakazu Y, Akaike N, Komiyama S, Nabekura J (1999) Regulation of intracellular chloride by cotransporters in developing lateral superior olive neurons. J Neurosci 19:2843-2851[Abstract/Free Full Text].
• Kakazu Y, Uchida S, Nakagawa T, Akaike N, Nabekura J (2000) Reversibility and cation selectivity of the K⁺-Cl cotransport in rat central neurons. J Neurophysiol 84:281-288[Abstract/Free Full Text].
• Kanaka C, Ohno K, Okabe A, Kuriyama T, Itoh A, Fukuda A, Sato K (2001) The differential expression patterns of messenger RNAs encoding K-Cl cotransporters [KCC1, 2] and Na-K-2Cl cotransporter [NKCC1] in the rat nervous system. Neuroscience 104:933-946[ISI][Medline].
• Kelley SJ, Thomas R, Dunham PB (2000) Candidate inhibitor of the volume-sensitive kinase regulating K-Cl cotransport: the myosin light chain kinase inhibitor ML-7. J Membr Biol 178:31-41[ISI][Medline].
• Krarup T, Jakobsen LD, Jensen BS, Hoffmann EK (1998) Na⁺-K⁺-2Cl cotransport in Ehrlich cells: regulation by protein phosphatases and kinases. Am J Physiol 275:C239-C250[Abstract/Free Full Text].
• Lauf PK, Adragna NC (2000) K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem 10:341-354[ISI][Medline].
• Levey MS, Jacob MH (1996) Changes in the regulatory effects of cell-cell interactions on neuronal AChR subunit transcript levels after synapse formation. J Neurosci 16:6878-6885[Abstract/Free Full Text].
• Nabekura J, Ebihara S, Akaike N (1993) Muscarinic receptor activation of potassium channels in rat dentate gyrus neurons. J Neurophysiol 70:1544-1552[Abstract/Free Full Text].
• Nabekura J, Ueno S, Ogawa T, Akaike N (1995) Colocalization of ATP, nicotinic ACh receptors in the identified vagal preganglionic neurone of rat. J Physiol (Lond) 489:519-527[ISI][Medline].
• Nabekura J, Omura T, Akaike N (1996) Alpha 2 adrenoceptor potentiates glycine receptor-mediated taurine response through protein kinase A in rat substantia nigra neurons. J Neurophysiol 76:2447-2454[Abstract/Free Full Text].
• Nabekura J, Ueno T, Katsurabayashi S, Furuta A, Akaike N, Okada M (2002) Reduced NR2A expression and prolonged decay of NMDA receptor-mediated synaptic current in rat vagal motoneurons following axotomy. J Physiol (Lond) 539:735-741[Abstract/Free Full Text].
• Payne JA, Stevenson TJ, Donaldson LF (1996) Molecular characterization of a putative K-Cl cotransporter in rat brain. A neuronal-specific isoform. J Biol Chem 271:16245-16252[Abstract/Free Full Text].
• Plotkin MD, Kaplan MR, Peterson LN, Gullans SR, Hebert SC, Delpire E (1997) Expression of the Na⁺-K⁺-2Cl cotransporter BSC2 in the nervous system. Am J Physiol 272:C173-C183[Abstract/Free Full Text].
• Reid KH, Guo SZ, Iyer VG (2000) Agents which block potassium-chloride cotransporter prevent sound-triggered seizures in post-ischemic audiogenic seizure-prone rats. Brain Res 864:134-137[Medline].
• Rivera C, Voipio J, Payne JA, Ruusuvuori E, Lahtinen H, Lamsa K, Pirvola U, Saarma M, Kaila K (1999) The K⁺/Cl co-transporter KCC2 renders GABA hyperpolarizing during neuronal maturation. Nature 397:251-255[Medline].
• Ross ST, Soltesz I (2000) Selective depolarization of interneurons in the early posttraumatic dentate gyrus: involvement of the Na⁺/K⁺ ATPase. J Neurophysiol 83:2916-2930[Abstract/Free Full Text].
• Russell JN (2000) Sodium-potassium-chloride cotransport. Physiol Rev 80:211-276[Abstract/Free Full Text].
• Siman R, Noszek JC, Kegerise C (1989) Calpain I activation is specifically related to excitatory amino acid induction of hippocampal damage. J Neurosci 9:1579-1590[Abstract].
• Spoerri PE (1988) Neurotrophic effects of GABA in cultures of embryonic chick brain and retina. Synapse 2:11-22[ISI][Medline].
• Sung KW, Kirby M, McDonald MP, Lovinger DM, Delpire E (2000) Abnormal GABA_A receptor-mediated currents in dorsal root ganglion neurons isolated from Na-K-2Cl cotransporter null mice. J Neurosci 20:7531-7538[Abstract/Free Full Text].
• Taira T, Lamsa K, Kaila K (1997) Posttetanic excitation mediated by GABA_A receptors in rat CA1 pyramidal neurons. J Neurophysiol 77:2213-2218[Abstract/Free Full Text].
• Ueno T, Okabe A, Fukuda A, Akaike N, Nabekura J (2002) Diversity of neuron-specific K⁺-Cl cotransporter expression and inhibitory postsynaptic potential depression in rat motoneurons. J Biol Chem 277:4945-4950[Abstract/Free Full Text].
• van den Pol AN, Obrietan K, Chen G (1996) Excitatory actions of GABA after neuronal trauma. J Neurosci 16:4283-4292[Abstract/Free Full Text].
• Waxman SG, Kocsis JD, Black JA (1994) Type III sodium channel mRNA is expressed in embryonic but not adult spinal sensory neurons, and is reexpressed following axotomy. J Neurophysiol 72:466-470[Abstract/Free Full Text].

---

Copyright © 2002 Society for Neuroscience  0270-6474/02/22114412-06$05.00/0

This article has been cited by other articles:

				A. Shulga, J. Thomas-Crusells, T. Sigl, A. Blaesse, P. Mestres, M. Meyer, Q. Yan, K. Kaila, M. Saarma, C. Rivera, et al. Posttraumatic GABAA-Mediated [Ca2+]i Increase Is Essential for the Induction of Brain-Derived Neurotrophic Factor-Dependent Survival of Mature Central Neurons J. Neurosci., July 2, 2008; 28(27): 6996 - 7005. [Abstract] [Full Text] [PDF]

				A. S. Galanopoulou Dissociated Gender-Specific Effects of Recurrent Seizures on GABA Signaling in CA1 Pyramidal Neurons: Role of GABAA Receptors J. Neurosci., February 13, 2008; 28(7): 1557 - 1567. [Abstract] [Full Text] [PDF]

				H. R. Pathak, F. Weissinger, M. Terunuma, G. C. Carlson, F.-C. Hsu, S. J. Moss, and D. A. Coulter Disrupted Dentate Granule Cell Chloride Regulation Enhances Synaptic Excitability during Development of Temporal Lobe Epilepsy J. Neurosci., December 19, 2007; 27(51): 14012 - 14022. [Abstract] [Full Text] [PDF]

				G. Huberfeld, L. Wittner, S. Clemenceau, M. Baulac, K. Kaila, R. Miles, and C. Rivera Perturbed Chloride Homeostasis and GABAergic Signaling in Human Temporal Lobe Epilepsy J. Neurosci., September 12, 2007; 27(37): 9866 - 9873. [Abstract] [Full Text] [PDF]

				C. Jean-Xavier, G. Z. Mentis, M. J. O'Donovan, D. Cattaert, and L. Vinay Dual personality of GABA/glycine-mediated depolarizations in immature spinal cord PNAS, July 3, 2007; 104(27): 11477 - 11482. [Abstract] [Full Text] [PDF]

				S. Pieraut, V. Laurent-Matha, C. Sar, T. Hubert, I. Mechaly, C. Hilaire, M. Mersel, E. Delpire, J. Valmier, and F. Scamps NKCC1 Phosphorylation Stimulates Neurite Growth of Injured Adult Sensory Neurons J. Neurosci., June 20, 2007; 27(25): 6751 - 6759. [Abstract] [Full Text] [PDF]

				M. Schumacher, R. Guennoun, A. Ghoumari, C. Massaad, F. Robert, M. El-Etr, Y. Akwa, K. Rajkowski, and E.-E. Baulieu Novel Perspectives for Progesterone in Hormone Replacement Therapy, with Special Reference to the Nervous System Endocr. Rev., June 1, 2007; 28(4): 387 - 439. [Abstract] [Full Text] [PDF]

				C. Xiao, C. Zhou, K. Li, and J.-H. Ye Presynaptic GABAA receptors facilitate GABAergic transmission to dopaminergic neurons in the ventral tegmental area of young rats J. Physiol., May 1, 2007; 580(3): 731 - 743. [Abstract] [Full Text] [PDF]

				H. Wake, M. Watanabe, A. J. Moorhouse, T. Kanematsu, S. Horibe, N. Matsukawa, K. Asai, K. Ojika, M. Hirata, and J. Nabekura Early Changes in KCC2 Phosphorylation in Response to Neuronal Stress Result in Functional Downregulation J. Neurosci., February 14, 2007; 27(7): 1642 - 1650. [Abstract] [Full Text] [PDF]

				A. Mizokami, T. Kanematsu, H. Ishibashi, T. Yamaguchi, I. Tanida, K. Takenaka, K. I. Nakayama, K. Fukami, T. Takenawa, E. Kominami, et al. Phosholipase C-Related Inactive Protein Is Involved in Trafficking of {gamma}2 Subunit-Containing GABAA Receptors to the Cell Surface J. Neurosci., February 14, 2007; 27(7): 1692 - 1701. [Abstract] [Full Text] [PDF]

				Y. Lu, J. A. Harris, and E. W. Rubel Development of Spontaneous Miniature EPSCs in Mouse AVCN Neurons During a Critical Period of Afferent-Dependent Neuron Survival J Neurophysiol, January 1, 2007; 97(1): 635 - 646. [Abstract] [Full Text] [PDF]

				P. Uvarov, A. Ludwig, M. Markkanen, C. Rivera, and M. S. Airaksinen Upregulation of the Neuron-Specific K+/Cl- Cotransporter Expression by Transcription Factor Early Growth Response 4 J. Neurosci., December 27, 2006; 26(52): 13463 - 13473. [Abstract] [Full Text] [PDF]