 |
 Previous Article | Next Article 
The Journal of Neuroscience, June 1, 2002, 22(11):4499-4508
Altered Levels of Gq Activity Modulate Axonal Pathfinding in
Drosophila
Anuradha
Ratnaparkhi,
Santanu
Banerjee, and
Gaiti
Hasan
National Center for Biological Sciences, Tata Institute of
Fundamental Research, Bangalore 560065, India
 |
ABSTRACT |
A majority of neurons that form the ventral nerve cord send out
long axons that cross the midline through anterior or posterior commissures. A smaller fraction extend longitudinally and never cross
the midline. The decision to cross the midline is governed by a balance
of attractive and repulsive signals. We have explored the role of a
G-protein, G q, in altering this balance in
Drosophila. A splice variant of Gq,
dgq3, is expressed in early axonal
growth cones, which go to form the commissures in the
Drosophila embryonic CNS. Misexpression of a
gain-of-function transgene of dgq3
(AcGq3) leads to ectopic midline crossing. Analysis of
the AcGq3 phenotype in roundabout and
frazzled mutants shows that AcGq3 function is antagonistic to Robo signaling and requires Frazzled to promote ectopic
midline crossing. Our results show for the first time that a
heterotrimeric G-protein can affect the balance of attractive versus
repulsive cues in the growth cone and that it can function as a
component of signaling pathways that regulate axonal pathfinding.
Key words:
dgq; Robo; Frazzled; Netrins; G-protein; midline; axon guidance
| |
INTRODUCTION |
Axons use cues present at different
choice points in the cellular environment to reach their targets. These
cues are attractive and repulsive in nature and function at short range
by contact or through long range by diffusion (Tessier-Lavigne and
Goodman, 1996 ). The midline of the CNS in vertebrates and invertebrates functions as one such choice point for axons that need to project to
their targets on the opposite side in the CNS. Cells at the midline
provide cues that are both attractive and repulsive and thus enable
axons to make appropriate decisions at the midline. Attractive cues are
encoded by molecules called Netrins (Ishii et al., 1992; Kennedy et
al., 1994; Harris et al., 1996; Mitchell et al., 1996), whereas
repulsive cues are encoded by a class of molecules called Slit. These
cues and their receptors Frazzled/DCC and the Roundabout (Robo) family,
respectively, are also highly conserved (Chan et al., 1996; Keino-Masu
et al., 1996; Kolodziej et al., 1996; Kidd et al., 1998a; Rajagopalan
et al., 2000a,b; Simpson et al., 2000a,b). Studies in
Drosophila and vertebrates have shown that attraction and
repulsion are a consequence of the signaling pathways triggered by the
two receptors and are not intrinsic to the nature of the individual
ligands. (Bashaw and Goodman, 1999; Hong et al., 1999). Studies in
Drosophila have also shown that all cells in the nervous
system are competent to respond to attractive and repulsive cues,
thereby suggesting that the balance between attraction and repulsion
determines the final response of the growth cone (Bashaw and Goodman,
1999). This is achieved in part by regulating expression of individual receptors (Kidd et al., 1998a) and in part by modulating the activity of the signaling pathways (Menon and Zinn, 1998; Bonkowsky et al.,
1999; Sun et al., 2000; Bashaw et al., 2000). Thus, identifying the
signaling pathways and their regulation in response to various cues is
important in understanding how this balance is achieved and maintained.
In vitro studies in vertebrate systems have shown that
altering cyclic nucleotide levels and calcium in the growth cone can convert attraction into repulsion (Song et al., 1997; Hong et al.,
2000; Zheng, 2000), suggesting that G-protein-coupled signaling pathways are involved in this process. In this study we have examined the role of the heterotrimeric G-protein Gq in growth cone guidance in
Drosophila. The gene dgq encodes the subunit
of the Gq class of heterotrimeric G-proteins in Drosophila.
This family of G-proteins is known to activate the phosphoinositide
cascade within cells, which involves generation of inositol
1,4,5,trisphosphate (IP3) followed by release of
intracellular calcium through the IP3 receptor (Exton, 1994). In Drosophila, the role of this gene in
mediating phototransduction in the adult eye has been well established
(Lee et al., 1994; Scott et al., 1995). We find that a splice variant of the Gq gene (dgq3; Talluri et al., 1995; Alvarez et
al., 1996) is expressed in the embryonic CNS during development. In
this study we show for the first time that a dominant active form of dgq3 modulates repulsive signaling in the growth cone,
possibly in response to attractive cues. Our results suggest that Gq
signaling could function as a part of the regulatory network that
functions to tilt the balance from repulsion to attraction during
midline crossing of axons.
| |
MATERIALS AND METHODS |
cDNA isolation and sequencing. Embryonic
and appendage cDNA libraries were screened using a probe generated by a
PCR using degenerate primers on an appendage library (Wang et
al. 1999). The primer sequences were as follows: (1)
5'AC(T/C/A/G)TT(T/C)AT(T/C/A)AA(G/A)CA(A/G)ATG 3'; (2)
5'(A/G)AA(A/G)CA(A/G/T/C)TG(A/G/T)ATCCA(C/T)TT 3'.
They correspond to the conserved amino acid sequences "TFIKQM" and
"KWIQHCF" in the helical domain of Gq proteins. Standard PCR
conditions for degenerate primers were used (Hasan and Rosbash. 1992).
The PCR product was reamplified using an internal primer: 5'T(T/C)(A/G)TC(A/G)AA(A/T/C/G)GG(A/G)TA(T/C)TC3', which corresponds to
the conserved amino acid sequence "EYPFDL". A 400 bp product was
obtained using the internal primer. This was subcloned into the plasmid
pBluescript (Stratagene, La Jolla, CA) and sequenced. The sequenced
clone was then used to screen appendage and embryonic cDNA libraries.
cDNA clones obtained from the two libraries were sequenced manually
(Sanger et al., 1977).
RT-PCR analysis. Poly(A+) RNA
was isolated from various tissues following standard procedures
(Sambrook et al., 1989). Primers complementary to exon 9 and 10 (see
Fig. 1A) were used for RT-PCR analysis of
dgq3. Their sequences are as follows: PE-3 (exon 9):
5'AACTCGAGTACGATGGTCCTCAGCGAG 3' and PE-4 (exon 10): 5'
AAGGATCCTCCAAATCCAGTTTAGACC 3'. Reverse transcription and PCR (RT-PCR)
was according to published procedures (Sinha and Hasan, 1999).
In situ hybridization to whole mount embryos. In situ
hybridization to embryos was according to the procedure described by Tautz and Pfiefle (1989). A 210 bp dgq3-specific probe
was generated and labeled by PCR using primers to exons 11 and 14. Digoxygenin-dUTP from Boehringer Mannheim (Mannheim, Germany)
was included in the PCR mix.
Western blot analysis. Protein extracts from adult tissues
and 0-8, 8-16, and 16-24 hr embryos were made by homogenization in
polyacrylamide gel sample buffer at twice its normal concentration (Sambrook et al., 1989). The samples were run on a 10%
SDS-polyacrylamide gel and transferred to nitrocellulose membranes.
Detection of the protein blot was according to published procedures
(Edery et al., 1994) with minor modifications. Anti-Gq antiserum from Santa Cruz Biotechnology (Santa Cruz, CA) was used at a dilution of
1:1000.
Immunohistochemical methods. Immunohistochemical staining of
whole-mount embryos was according to published protocols (Gould et al.,
1990). Developmental stages were identified following the description
by Wieschaus and Nusslein-Volhard (1986). The anti-Gq antibody
used from Santa Cruz Biotechnology has been raised against the
C-terminal peptide (FAAVKDTILQLNLKEYNLV) of mammalian Gq. This
differs from the corresponding Drosophila Dgq3 sequence by a single residue (FAAVKDTILQSNLKEYNLV). For
immunohistochemistry the antibody was used at a dilution of 1:200.
Anti- gal monoclonal supernatant, monoclonal antibody (mAb)
40-1a (Developmental Studies Hybridoma Bank, University of Iowa, Iowa
City, IA) and mAb 1D4 (anti-Fasciclin II; courtesy C. Goodman
laboratory, University of California, Berkeley, CA) were used at a
dilution of 1:25 each. Anti-Robo (courtesy C. Goodman) and
anti-Connectin antiserum (courtesy of Rob White, Department of Anatomy,
University of Cambridge, Cambridge, UK) were used at a dilution of
1:10. Vectastain A+B kit (Vector Laboratories, Burlingame, CA) was used
for nonfluorescent immunohistochemical visualizations. The stained
embryos were filleted and mounted in 90% glycerol.
Fluoro-isothiocyanate (FITC) and rhodamine or Alexa Red-conjugated
secondary antibodies (Jackson ImmunoResearch, West Grove, PA; Molecular
Probes, Eugene, OR) were used at a dilution of 1:200. Specimens stained
with fluorescent secondaries were mounted in 70% glycerol containing 1 mg/ml of p-phenylenediamine (Sigma, St. Louis, MO) to
prevent quenching.
Confocal imaging. Confocal images of antibody staining done
with fluorescent secondaries were viewed on Bio-Rad (Poole, UK) MRC
1024. For double-labeled images, data from the two channels (605 DF32
for rhodamine and Alexa Red and 522 DF32 for FITC) were superimposed
using Metamorph software version 4.0. Confocal sections of 2 µM thickness were obtained, and composite
images were created by merging relevant numbers of sections. Confocal
sections of 0.3 µM thickness were obtained for
the images shown in Figure 2, E and F.
Site-directed mutagenesis and germline transformation. The
Q203L mutation requiring an A T change was introduced in the
dgq3 cDNA by site-directed mutagenesis using the
Quik-change kit by Stratagene. The primer used to introduce the
mutation was 5'CGGTGGTCTGCGATCCG 3'. The mutant cDNA was
sequenced fully to ensure that no other mutations had been incorporated
into the modified sequence. Both mutant and wild-type cDNAs were
independently subcloned into the transformation vector pUAST (Brand and
Perrimon, 1993) to obtain germline transformants. Two independent
transformant lines for each construct were obtained. These are
UAS-Gq3FF17-2 on chromosome 3, UAS-Gq3MM17-2 on chromosome 2, UAS-AcGq3F58a on chromosome 1, and
UAS-AcGq3F58c on chromosome 2. Equivalent
phenotypes were observed with both sets of transformant lines.
Flystocks. All stocks were grown at 25°C. The following
GAL4 stocks were used: C155-GAL4 (Lin and
Goodman, 1994),
ftzng-GAL4 and
eveng-GAL4 (courtesy of Jim Jaynes,
Thomas Jefferson University, Philadelphia, PA) (Baines et al., 1999).
The ApC-taugal stock was obtained from the laboratory of
Dr. John Thomas (Salk Institute, San Diego, CA) (Lundgren et al.,
1995), whereas the Ap-GAL4 stock was obtained from the
Drosophila stock center (Bloomington, IN). UAS-roboY-F (Bashaw et al., 2000) was obtained from C. Goodman's laboratory. The Df(2R)vg-C stock, which carries
the deficiency for dgq, was obtained from the
Drosophila stock center and placed against a
CyoActgal balancer to identify homozygous deficiency embryos. For expression of AcGq3, males of the genotype
UAS-AcGq3/FM7-GFP were crossed to homozygous females of one
of the following genotypes: (1) C155-GAL4, (2)
C155-GAL4; +; Ap-taugal, (3) +; +;
ftzng-GAL4, UAS-taugal, or (4)
UAS-taugal;eveng-GAL4. To study
the behavior of Apterous neurons, an Apterous-GAL4/CyoWggal;
Apterous-taugal strain was generated and subsequently crossed
to UAS-AcGq3F58c/CyoActgal.
To examine the genetic interactions between AcGq3 and
robo1 and frazzled
mutants, the following strains were generated:
C155-GAL4;fra4/CyoActgal;+/+.,
UAS-AcGq3/FM7ftzgal;fra3/CyoActgal;+/+.,
and
UAS-AcGq3/FM7ftzgal;robo1/CyoActgal.
Homozygous and heterozygous mutant embryos were distinguished based on
the presence or absence of marked balancers in each case. For studying
the interaction between roboY-F and AcGq3,
UAS-AcGq3F58c/Cyo-GFP, UAS-roboY-F
strain was generated and crossed to C155-GAL4 females.
Expression of AcGq3 was confirmed by immunohistochemical staining with
anti-Gq antibody. With both C155-GAL4 and
ftzng-GAL4 drivers, the pattern of
Gq expression observed is different from the wild-type pattern.
| |
RESULTS |
Identification and expression of dgq3 in
Drosophila embryos
cDNA clones corresponding to the dgq gene were isolated
in library screens using a fragment from the eye-specific splice
variant dgq1 (Lee et al., 1990). We screened libraries
derived from either embryo or appendage RNAs and analyzed
dgq-positive cDNA clones by restriction digests and PCR. The
three classes of cDNA clones obtained are shown in Figure
1A. Of these, one class
corresponds, in the region of the open-reading frame, to the previously
identified splice variant transcript of the dgq gene, called
dgq3, known to be expressed in several adult tissues
(Talluri et al., 1995; Alvarez et al., 1996). This class was isolated
repeatedly from the embryo cDNA library, as judged by extensive PCR
analysis. Specifically, primers to exons 4 and 9, 6 and 9, 6 and 11, and 11 and 14 (Fig. 1A), amplified the expected
fragments of 673, 321, 445, 210 bp. No amplification was observed using
primers to exons 6 and 12 and exons 12 and 13, indicating that none of the embryonic cDNAs belong to the next class of cDNA isolated from the
appendage library (dgq4) (Fig.
1A). Because this was the first characterization of a
dgq transcript in Drosophila embryos, we
performed RT-PCRs using dgq3-specific primers from exons
11 and 14 (Fig. 1A). As shown in Figure
1B, dgq3-specific transcripts are
present in poly(A+) RNA extracted from
heads, appendages, male and female bodies, and embryos. These results
were corroborated by a Northern blot analysis using the unique 3'
region of dgq3 as a probe (data not shown). A third class
of cDNA clones was found only in the appendage library and appeared
identical to the adult visual Gq splice form (dgq1)
(Fig. 1A), as determined by the presence of dgq1-specific exon 7 (by PCR), and exons 10 and 13 (by
sequencing) (Fig. 1A). We have not analyzed this cDNA
any further.
View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
A, Structure of the
dgq gene and its splice variants dgq3
and dgq4. All known exons are numbered
and shown as boxes in the row marked
dgq. The hatched exons indicate regions
unique to dgq3 and dgq4 splice
variants. In the row marked dgq3, the
stippled exons indicate regions that are not found in
the dgq3 cDNAs identified by us. The open
box for exon 12 indicates a dgq4-specific
exon. The arrows on dgq3 indicate
positions of the primers used for RT-PCR analysis shown below. The
asterisk marks the C-terminal region recognized by the
Gq3 antiserum. Arrowheads on dgq4
indicate primer positions used to differentiate it from
dgq3. B, Expression of
dgq3 mRNA by RT-PCR. A
dgq3-specific band of 210 bp is seen in
poly(A+) RNA extracted from adult male and female
bodies, heads, and appendages, as well as embryos. Lanes
marked as ( ) were loaded with PCR reactions from minus reverse
transcriptase control tubes. The control lane contains a PCR-amplified
product from the dgq3 cDNA clone. The quality and
quantity of poly(A+) RNA isolated from each tissue
was estimated by an RT-PCR done with primers specific to the
rp49 gene. The rp49 control plasmid is a
genomic clone, leading to small difference in its size from the RT-PCR
product. C, Expression of Dgq3 protein. A Western
blot of protein lysates made from staged embryos and adult heads was
stained with antiserum to Gq. A 39 kDa band corresponding to the size
of Dgq3 can be seen in all the lanes.
|
|
Next we ascertained the presence of the Dgq3 protein in
Drosophila embryos by Western blot analysis of embryo
extracts (Fig. 1C). The antiserum used recognizes the
C-terminal end of the mammalian Gq protein. In Drosophila Gq
this C-terminal sequence is conserved only in the Dgq3 form (Fig.
1A, asterisk) (see Materials and Methods). The
results obtained indicate that a 39 kDa band, corresponding to the
predicted size of the Dgq3 protein, is present in embryos throughout
development from as early as 0-8 hr.
dgq3 RNA and protein are expressed predominantly in axonal
tracts of the embryonic CNS
Presence of dgq3 RNA and protein in embryos suggests
an involvement of the dgq gene in Drosophila
development. We therefore studied the expression pattern of
dgq3 during embryonic development by in situ
hybridization with a dgq3 splice variant-specific probe.
Although dgq3 RNA is present in earlier stages,
tissue-specific expression of dgq3 is first seen in the
brain and ventral nerve cord at stage 13 (Fig.
2A). This expression
persists till late in development, where in addition, strong expression
is seen in an anterior sense organ (Fig. 2B). This
organ corresponds in position to the Bolwig's organ or the larval eye
(Schmucker et al., 1992). In similar experiments with a
dgq4-specific probe, no hybridization was observed to any
region of the developing embryo (data not shown).
View larger version (126K):
[in this window]
[in a new window]
|
Figure 2.
In situ localization of
dgq3 RNA and protein in Drosophila
embryos. A, B, In situ hybridization of a
dgq3-specific probe showing RNA expression at late
stage 13 (A) and stage 16 (B). The arrows indicate
localization of dgq3 RNA in the ventral nerve cord
(A) and the Bolwig's organ
(B). C, D, Dgq3 expression in
the embryonic CNS observed by immunofluorescent staining using anti-Gq
antibodies at stage 12 (C, arrows) and stage 17 (D). E, F, Confocal
images of the developing CNS in an early stage 12 embryo after
double-staining with anti-Gq (E) and the axonal
marker mAb BP102 (F). G,
H, Confocal images of the CNS from stage 15 embryos
stained with Anti-Gq. Embryos were either heterozygous
(G) or homozygous
(H) for the Df(2R)vg-C.
I, J, Embryos shown in G
and H were double-stained with mAb BP102. Heterozygous
and homozygous deficiency embryos were distinguished by the presence of
actin-lacZ on the balancer chromosome, which shows up as green
spots (I, arrow). The commissures are poorly
formed and appear thin in J. Anti-Gq was visualized
using rhodamine-labeled secondary antibodies, whereas an FITC-linked
secondary was used for BP102. Magnification: A-D,
200×; E-J, 600×. A-C are lateral
views with dorsal side up. D-J are ventral views. In
all cases anterior is to the left.
|
|
Expression of Dgq3 during development of the embryonic nervous
system was further confirmed by immunohistochemical staining of
wild-type embryos with the Gq antiserum. The CNS in
Drosophila embryos develops from a delaminated set of
neuroblasts that derive from the ventral neuroepithelium after
gastrulation (Goodman and Doe, 1993). These neuroblasts undergo a
series of highly stereotyped cell divisions during embryonic stages
8-11, which lead to a well defined spatial pattern (Goodman and Doe,
1993). The expression of Dgq3 at these and earlier stages appeared
diffuse and non-neuronal (data not shown). The first indication of
Dgq3 expression in the CNS is at early stage 12 (Fig.
2C). This is also the stage at which the pioneer neurons
begin formation of axon pathways that give rise to the typical
ladder-like appearance of the embryonic CNS, consisting of longitudinal
tracts and anterior and posterior commissures that can be visualized
with the axonal marker mAb BP102 (Fig. 2I). A similar
pattern of expression of anti-Gq and the axonal marker mAb BP102 at
early stage 12 suggests that Dgq3 is expressed in the pioneer growth
cones that give rise to the commissures (Fig.
2E,F) (Klambt et al., 1991). At later stages of development Dgq3 protein expression increases in the axonal tracts of the CNS (Fig. 2D,G). In addition, Dgq3
expression was visible in the midgut epithelium at stages 12 (Fig.
2C) and 13 (data not shown). Specificity of the anti-Gq
antibody was determined by immunohistochemical staining of embryos that
were either deficient for dgq in one copy (Fig.
2G,I) or both copies (Fig.
2H,J). The likely presence of the Dgq3
protein in growth cones of early commissural axons lead us to examine
the role for this gene in axonal growth and guidance.
Neuronal expression of the activated form of Dgq3 causes
abnormal midline crossing
Axonal guidance in the Drosophila CNS requires the
interpretation of both attractive and repulsive cues, generated by
cells that lie in the midline (Harris et al., 1996; Kolodziej et al., 1996; Mitchell et al., 1996; Culotti and Merz, 1998; Kidd et
al., 1999). The expression pattern of Dgq3 protein suggested that it
might be required in early growth cones for the interpretation of these
cues. To address this possibility, it was essential to alter Gq
signaling in a tissue and cell-specific manner. We therefore created
transgenic strains with a dominant active form of Dgq3, in which a
glutamine residue at position 203 was mutated to a leucine. The
mutation was made based on previous studies on dominant active forms of
Gq from mammalian cells and Drosophila (DeVivo et al.,
1992; Lee et al., 1994). As controls we also generated transgenic lines
carrying the wild-type form of Dgq3. Both activated dgq3 (UAS-AcGq3) and dgq3
(UAS-Gq3) cDNAs were placed under the control of the
GAL4-inducible UAS promoter that would allow tissue and cell-specific expression. To study the effect of
UAS-AcGq3 expression on axonal development, we
used the C155-GAL4 line initially, which expresses in all
postmitotic neurons (Lin and Goodman, 1994). When stained with mAb
BP102, the CNS of C155-GAL4; UAS-Gq3 embryos looked normal
(Fig. 3A). In embryos
expressing AcGq3, the pattern of the CNS appeared mildly deranged in
that the commissures were thicker, and the neuropil region was broader
than usual (Fig. 3B). More significant differences between
the two genotypes were obvious when a monoclonal antibody against
Fasciclin II (mAb 1D4) was used (Fig. 3C-H). At
stage 13, anti-Fasciclin II (anti-Fas II) marks the pioneer axons that
go to form the first longitudinal axon pathway (Fig. 3C),
which by stage 16, defasciculates to form three distinct fascicles
(Fig. 3G). These axons project ipsilaterally and do not
cross the midline. In embryos of the genotype C155-GAL4; UAS-Gq3 this projection pattern was identical to wild-type
embryos, indicating that overexpression of Dgq3 has no effect on Fas
II-expressing axons (Fig. 3C,E,G). However, in embryos
expressing AcGq3, Fas II-positive axons appeared abnormal in all the
embryos examined (Fig. 3D,F,H) with variations in the
extent of abnormality. One obvious phenotype observed was that of
"stalling" of Fas II-positive axons, which could be seen clearly at
late stage 13 (Fig. 3D, arrowheads). At this stage, minute
outgrowths from the cell bodies and axonal tracts were also visible
(Fig. 3F, arrowheads). Stage 15 onward, Fasciclin
II-expressing axons could be seen crossing the midline (Fig. 3H,
arrow). Occasionally a whirling phenotype similar to that observed
in robo mutant alleles was seen (Fig. 3H,
asterisk) (Kidd et al., 1998a). A quantification of these phenotypes is given in Table 1.
View larger version (63K):
[in this window]
[in a new window]
|
Figure 3.
Expression of activated Dgq3 (AcGq3) in the CNS
leads to defects in axonal growth and guidance. Embryos of the genotype
C155-GAL4; UAS-Gq3/+ or
C155-GAL4/UAS-AcGq3 were stained with mAb BP102
(A, B, stage 15) or mAb 1D4, which is specific for Fas
II (C-H). C-F, Late stage 13. Fas II-expressing axons are abnormal in embryos expressing AcGq3
(D, F) as compared with the control embryos in
C and E. The arrowheads in
D indicate stalled axons, and the
arrowheads in F point toward minute
outgrowths from neuronal cell bodies and axonal tracts.
E and F are enlarged images from
C and D, respectively. At stage 15, Fas
II-positive axons appear normal in G, whereas in
H they are seen crossing the midline
(arrow) through the posterior commissure and recrossing
through the anterior commissure (*). I, Anti-gal
staining of a stage 16 embryo of the genotype C155-GAL4/+;
UAS-Gq3/Ap-taugal. Normal ipsilateral projection of
Apterous-expressing axons is observed (arrow); vc, ventral cell;
dc, dorsal cell. J, Stage 16. Embryo of
the genotype C155-GAL4/UAS-AcGq3; Ap- taugal/+. Axons
derived from apterous-expressing lateral cell (lc) and
dorsal cell (dc) cross the midline and stall
(arrows). T2, Second thoracic segment;
T3, third thoracic segment; A1, first
abdominal segment. All photographs were taken at a magnification
of 200×.
|
|
From these experiments the fate of the axons that cross the midline was
unclear. For this purpose we generated a strain with the Apterous
tau-galactosidase (Ap-taugal) construct in
which single axons could be observed.
Ap-taugal marks specific Apterous-expressing neurons in
each hemisegment of the embryo. Normally these axons project anteriorly
on the ipsilateral side to form a distinct Apterous
fascicle (Fig. 3I, arrow) (Lundgren et al.
1995). In embryos of the genotype C155; UAS-AcGq3, axons
from Apterous-expressing neurons no longer remain on the ipsilateral
side but are now able to cross the midline (Fig. 3J,
arrows). However, unlike axons that crossover in robo
mutant embryos (Wolf and Chiba, 2000), these appear to stall after
reaching and crossing the midline.
Expression of AcGq3 in specific neurons leads to aberrant
midline crossing
The phenotypes observed in embryos expressing AcGq3 suggest that
Gq signaling can drive formation of the commissures and longitudinal tracts. This idea is supported by the phenotype observed in embryos homozygous for Df(2R)vg-C (which uncovers dgq)
(Fig. 2J). In these embryos the commissures appear
thinner, and there are extensive breaks in the longitudinal tracts.
These phenotypes are considerably stronger than those observed for
frazzled mutants, which is also uncovered by the same
deficiency, indicating that the effect of removing both Dgq
and Frazzled is additive. However, these defects could be
either caused by erroneous signaling within neurons so that they
misinterpret existing cues, or by a non-autonomous mechanism that
affects midline guidance cues. The latter would result in misplaced
neurons or glia or neurons with changed identity. In Df(2R)
vg-C embryos, the pattern of neurons expressing the Even-skipped (Eve) protein appear normal (data not shown), indicating that the
defects seen occur after neuronal patterning is complete.
To confirm that the phenotype seen by expression of AcGq3 in the CNS is
caused by altered signaling within neurons expressing AcGq3, we used
more restrictive GAL4 drivers to express UAS-AcGq3 in
specific subsets of neurons of the embryonic CNS.
ftzng-GAL4 expresses in a small
subset of neurons that include mostly motor neurons and some
interneurons like vMP2, pCC, dMP2, and MP1 (Doe et al., 1988; Landgraf
et al., 1999). These interneurons pioneer the longitudinal axon tracts,
which stain positive for Fasciclin II. In addition, these axons never
cross the midline. On expressing UAS-AcGq3 with
ftzng-GAL4, midline crossing by
Fasciclin II-positive axons could be observed. At stage 13, the pCC
axon which, normally projects anteriorly on the ipsilateral side, could
be seen turning toward the midline (Fig.
4B). At stage 16, aberrant midline crossing by the medial fascicle could be observed
(data not shown). The number of midline crossovers at this stage is
less as compared with C155-GAL4, presumably because of the
restricted and comparatively weak expression of the
ftzng-GAL4 line (Table 1). Similar
results were obtained with
eveng-GAL4, which expresses in aCC,
pCC, and RP2 neurons (Fig. 4C,D) (Baines et al., 1999;
Featherstone et al., 2000). The pCC axon can be seen crossing the
midline, whereas the aCC and RP2 projections look normal on expression
of AcGq3 (Fig. 4D). Axons from Apterous-expressing
dorsal cells (dc) can also change their trajectory on expression of
AcGq3 (Fig. 4E,F). Instead of projecting
toward the anterior and in an ipsilateral direction as is normal (Fig.
4E,F, asterisks), a fraction of the axons can be seen
drifting across the midline (Fig. 4F, arrowhead). The
autonomy of AcGq3 function is further supported by the observation that
neurons and glia are patterned normally in
C155-GAL4/UAS-AcGq3 embryos, as judged by staining with
anti-Eve and anti-Repo antibodies (data not shown). Taken together
these data demonstrate that specific activation of Dgq3 in
ipsilaterally projecting neurons causes changes in their axonal
trajectories so that they are now able to project across the
midline.
View larger version (95K):
[in this window]
[in a new window]
|
Figure 4.
Midline crossing by ectopic expression of AcGq3
appears cell autonomous. A, B, Embryos stained with
anti-fasciclin II. C-F, Embryos stained with
anti-gal antibody. A,
ftzng-GAL4/+ control embryo.
B, Embryo of the genotype UAS-AcGq3/+;
ftzng-GAL4/+. A,
Late stage 13 embryo shows ipsilateral projection of the pCC axon
(arrow). B, Early stage 13 embryo.
Arrow indicates projection of the pCC axon toward the
midline. C, UAS-taugal;eve-GAL4 embryo at stage 16 embryo. The pCC axon is not visible in this photomicrograph because it
runs at a different focal plane from the cell bodies. D,
UAS-AcGq3; UAS-taugal;eve-GAL4 embryo at stage 16. The pCC axon is
seen projecting across the midline (arrowheads). Because
eve-GAL4 expression was not consistent in each segment,
quantification of this phenotype (Table 1) was done on the basis of
UAS-taugal expression. E, F, Abdominal
segments of stage 15 embryos of the genotype
Ap-GAL4/AcGq3F58c;apC-taugal/+.
Normal longitudinal fascicles, projecting from the dorsal cell
(dc), are marked with an asterisk,
whereas the arrowhead in F shows an axon
crossing the midline.
|
|
Midline crossing by ectopic expression of AcGq3 is
independent of Robo downregulation
To understand how Dgq3 acts to change axonal paths, we looked
for possible interactions with genes known to affect midline guidance.
Axons that cross the midline and project along the contralateral longitudinal tract normally need to downregulate expression of Robo,
which acts as a receptor for the midline repellant Slit (Kidd et al.,
1999). It is known that Robo downregulation requires Commissureless,
but the precise mechanism is not understood (Tear et al., 1996; Kidd et
al., 1998b). A possible mechanism by which AcGq3 could promote midline
crossing was by downregulating Robo. To test this hypothesis we looked
at Robo expression in
ftzng-GAL4;UAS-AcGq3 embryos.
Interestingly, we find that Robo is not downregulated visibly in axons
that ectopically cross the midline under the influence of AcGq3 (Fig.
5B). The extent of Robo
staining seen on these axons that aberrantly cross the midline is
comparable with that seen on the longitudinal tracts. Thus,
constitutive activation of Dgq3 results in aberrant midline crossing
of axons by a mechanism that is independent of Robo downregulation.
View larger version (116K):
[in this window]
[in a new window]
|
Figure 5.
AcGq3 inhibits repulsive signaling by Robo through
a mechanism independent of Robo downregulation. A-D are
confocal images of stage 16 embryos stained with antibodies against
Robo (A, B) and Fasciclin II (C, D).
E and F are immunohistochemical and
fluorescent images, respectively, of stage 16 embryos stained with
antibodies against Fasciclin II. A, In a control embryo
of the genotype ftzng-GAL4/+, Robo
expression is confined to axons in the longitudinal tracts.
B, An embryo of the genotype
UAS-AcGq3/+;ftzng-GAL4/+. Robo
expression is observed in ectopic commissural axons
(arrowhead). C, An embryo of the genotype
UAS-AcGq3/+;ftzng-GAL4/+. Arrowhead
points to a single midline crossover. D,
UAS-AcGq3/+;robo1/+;ftzngGAL4/+
embryo with enhanced midline crossovers (arrowheads).
E, A stage 16 embryo of the genotype
C155-GAL4/+; UAS-roboY-F. F, A stage
16 embryo of the genotype C155-GAL4/+, AcGq3/+;
UAS-roboY-F/+.
|
|
Reducing robo function enhances midline
crossing by AcGq3
Another mechanism by which AcGq3 could induce midline crossing is
through inhibition of the repulsive signal mediated by Robo. If this
were so, then reducing levels of Robo by genetic means should enhance
the phenotype of AcGq3. To test this, AcGq3 was expressed using
ftzng-GAL4 in embryos carrying a
single copy of the robo1 mutant allele.
robo1 is a recessive mutation. However,
embryos with one copy of this mutation show midline crossing at a
frequency of ~10% (Fritz and VanBerkum, 2000) (Fig. 5C,
Table 1). When
UAS-AcGq3;robo1/+;ftzng-GAL4
embryos were stained with mAb 1D4, a significant increase in the number
of midline crossovers was observed as compared with embryos of
the genotype
UAS-AcGq3;+/+;ftzng-GAL4 (Fig.
5D, Table 1) This suggests that activation of Dgq3
antagonizes the repulsive output through Robo resulting in excessive
midline crossing. The antagonism could be mediated either through
phosphorylation of Robo or signaling components that function
downstream and/or in parallel with Robo.
Phosphorylation of a single tyrosine residue on Robo by Abelson (Abl)
tyrosine kinase inhibits Robo repulsive signaling and is needed for
normal midline crossing to take place. Expression of a mutant form of
Robo in which this tyrosine residue (Y1040) has been replaced with a
phenylalanine (in a transgenic strain referred to as
UAS-roboY-F), lead to constitutive Robo signaling such that no axons cross the midline, resulting in a complete absence
of commissure formation (Bashaw et al., 2000). If AcGq3 acts upstream
of Robo, we predicted that ectopic midline-crossovers, induced by
expression of AcGq3, would be reduced in presence of Robo Y-F. In fact,
in embryos expressing both AcGq3 and Robo Y-F, no ectopic crossovers
are seen (Fig. 5F, Table 1), indicating that AcGq3 could
inhibit Robo signaling by promoting Robo phosphorylation. This finding
is also supportive of the fact that AcGq3 exerts its effect independent
of Commissureless-mediated Robo downregulation. It is possible however,
that AcGq3 acts through a parallel pathway that is no longer effective
in the presence of Robo Y-F (see Discussion).
Ectopic midline crossing requires Frazzled function
Both the spatiotemporal pattern of expression and functional
analysis of dgq indicate that Gq activation in
vivo promotes midline crossing. Axons that cross the midline need
to turn down their repulsive signaling pathway(s) as well as respond
positively to attractive cues. We therefore looked to see if changes in
the levels of "attractive" signaling such as the Netrin-Frazzled
pathway affect the phenotype of AcGq3. Interestingly, AcGq3 phenotype shows a dosage-dependent interaction with Fra. Removal of a
single copy of the Fra gene led to a threefold reduction in
the number of midline crossovers induced by AcGq3 (Table 1). A further
reduction was observed on removal of both copies of the Fra
gene as seen in embryos of the genotype
C155-GAL4/UAS-AcGq3;fra3/fra4
(Table 1, Fig. 6C). Signaling
through AcGq3 is thus sensitive to levels of Frazzled in the CNS.
View larger version (154K):
[in this window]
[in a new window]
|
Figure 6.
Frazzled function is essential for ectopic midline
crossing induced by UAS-AcGq3. A-C,
Stage 16 embryos stained with mAb 1D4. D-F, Stage 14 embryos stained with antibodies against Connectin. A, In
wild-type embryos, three distinct fascicles can be observed on either
side of the midline. B, An embryo of the genotype
C155-GAL4/+;
fra3/fra4.
C, An embryo of the genotype
C155-GAL4/UAS-AcGq3;fra3/fra4;+/+.
Aberrant midline crossing by ipsilateral axons is absent.
D, C155-GAL4/+;fra/CyoActgal embryo at
stage 14 showing the wild-type staining pattern of anti-Connectin
antibody (Meadows et al., 1994). A Connectin-positive axon is seen
projecting through the posterior commissure (arrowhead).
E, Embryo of the genotype
C155-GAL4/+;fra3/fra4;
F,
C155-GAL4/UAS-AcGq3;fra3/fra4;+/+
embryo, show breaks in connectin positive commissural axon
(arrowheads).
|
|
To examine the effect, if any, of AcGq3 on the frazzled
mutant phenotype, embryos of the genotype
C155-GAL4/UAS-AcGq3;fra3/fra4
were examined with anti-connectin antibody (Fig. 6) and BP102 (data not
shown). Anti-connectin labels a distinct axon fascicle in the
longitudinal connectives, axon projections of SP1 and RP1 neurons that
project through the anterior commissure, and a subset of axons
that project through the posterior commissure to their contralateral
targets (Fig. 6D, arrowhead) (Meadows et al., 1994). In embryos of the genotype C155-GAL4/+;
fra3/fra4,
breaks were observed in connectin-positive commissural axons and
longitudinal tracts (Fig. 6E, arrowhead). Embryos of
the genotype C155-GAL4/UAS-AcGq3;fra3/fra4
also show similar breaks (Fig. 6F, arrowhead),
indicating that AcGq3 does not have an effect on the
frazzled mutant phenotype. Similar results were obtained by
staining with BP102.
| |
DISCUSSION |
Embryonic expression of Dgq3
Dgq was originally identified from a head cDNA library
as a homolog of mammalian Gq (Strathmann and Simon, 1990). Initial functional characterization suggested that it was a visual-specific G-protein essential for Drosophila visual transduction (Lee
et al., 1990, 1994; Scott et al., 1995). However, from subsequent studies it was apparent that splice variants of dgq existed
in other adult tissues (Talluri et al., 1995; Alvarez et al., 1996). In
this study we have analyzed dgq expression and function
during development of the Drosophila embryonic CNS. From
analysis of dgq transcripts and protein we have shown that
the dgq3 splice variant is the primary embryonic form,
suggesting multifunctional roles for this protein. Considering the
broad expression pattern of dgq, a traditional mutagenesis
approach might be unable to address late developmental phenotypes
caused by dgq3 loss-of-function. The UAS-GAL4
system offered an alternate strategy that allowed us to dissect
dgq3 function during axon guidance. UAS-AcGq3
essentially functions as a dominant gain-of-function allele in a
tissue- and cell-specific manner.
Function of Dgq3 in the embryonic CNS
The induction of ectopic midline crossing by AcGq3 suggests that
Dgq3 function might be required during commissural growth. What
activates Dgq3 in vivo? In Drosophila, the
only pathway so far known to mediate attraction toward the midline, is
the Netrin-Frazzled signaling pathway. However, null mutants for
netrins and frazzled continue to show formation
of commissures, albeit thin and poorly organized. The failure to show a
complete absence of commissures suggests that an alternate signaling
pathway or pathways exists at the midline that promotes commissural
growth. The presence of a second attractive signaling pathway operating at the midline has also been suggested based on analysis of mutants involved in formation of commissures (Hummel et al., 1999a,b). Dgq3
might act as a component of this alternate pathway to promote commissural growth.
Signaling mechanisms involved in DCC/Frazzled-mediated attraction are
poorly understood in vertebrates as well as invertebrates. In
vitro studies using pharmacology in vertebrate systems have shown
that guidance mediated by Netrin-1 is dependent on cAMP levels in the
growth cone. Increase in cAMP levels results in attraction, whereas low
levels of the cyclic nucleotide causes repulsion (Song et al., 1997).
In Xenopus cultured neurons, Netrin-1-induced turning
response has also been shown to depend on
Ca2+ influx through the plasma membrane
and Ca2+-induced
Ca2+ release through intracellular stores
(Hong et al., 2000). The involvement of second messengers such as
Ca2+ and cAMP suggests that
G-protein-coupled signaling pathways might be involved. Heterotrimeric
G-proteins are also thought to play a role in neuronal migration
(Horgan et al., 1994) and growth cone collapse (Nakayama et al., 1999).
A study implicating the Adenosine A2b receptor in Netrin-1 signaling
supports this idea (Corset et al., 2000). More recently however, it has
been shown that DCC can bind Netrin-1 and signal attraction independent
of the Adenosine A2b receptor (Stein et al., 2001). This study shows that DCC undergoes a ligand-dependent dimerization essential for its
signaling that remains unaffected even in the presence of antagonists
to adenosine receptors, thus providing evidence that DCC alone is
central to Netrin-1 signaling. As compared with vertebrates, the
mechanism of Netrin signaling in Drosophila is still
obscure. Recent studies involving this signaling pathway have, however, suggested that a second receptor for Netrins could exist in the nervous
system (Gong et al., 1999; Hiramoto et al., 2000). Given the
evolutionarily conserved nature of both, the ligand and the receptor,
similar downstream signaling elements are very likely involved in
mediating attraction. It is possible that a seven transmembrane domain
receptor activates Dgq3 signaling in response to novel attractive
cues or Netrins leading to increase in
Ca2+ levels and thus promoting attraction.
Our results from the genetic analysis of AcGq3 and
frazzled suggest that Frazzled function is essential for
AcGq3-mediated ectopic midline crossing. In addition, they also
indicate that Dgq3 does not function downstream of
frazzled signaling. A simple explanation for these
observations could be that activity of Dgq3 and Frazzled are both
essential to promote midline crossing. The effects of the two signaling
pathways are additive; activation of Frazzled and Dgq3 are both
necessary to elicit attraction. Removal of one or both copies of
frazzled in the presence of AcGq3 simply reduces the sum
total of attraction sensed by the growth cone, thus inhibiting aberrant
midline crossing of ipsilateral axons.
Interaction of AcGq3 with robo
The antagonism between AcGq3 and Robo suggests that AcGq3 operates
by modulating repulsion from the midline during commissural growth. It
has been demonstrated that Robo signaling is negatively modulated by
tyrosine phosphorylation by Abelson kinase (Bashaw et al., 2000). Our
results in Figure 5 suggest that AcGq3 could inhibit Robo signaling by
a similar mechanism of phosphorylating Robo. It could perhaps do this
by activating a kinase cascade involving a nonreceptor tyrosine kinase
such as Bruton's tyrosine kinase (BTK or Tec kinase) which, in
mammalian cells, has been shown to be a direct effector of Gq signaling
(Bence et al., 1997; Ma and Huang, 1998). Our results are equally
consistent with the possibility that AcGq3 and Robo act through
parallel pathways, such that AcGq3 induced midline crossing requires
downregulation of Robo signaling.
Based on the results obtained from genetic analysis of AcGq3
with frazzled and robo, the following models can
be proposed to explain the function of Dgq3. In the first, Dgq3
can be thought of as being a component of the attractive signaling
pathway alone. Expression of the activated form of the protein
functions to override the repulsive cues at the midline and promote
ectopic midline crossing. In such a scenario, one would argue that the
synergism observed between AcGq3 and
robo1 is a consequence of the combined
effect of reduced Robo signaling and excess attractive signaling
induced by AcGq3 leading to an increase in the number of midline
crossovers. In the presence of UAS-RoboY-F, repulsive
signaling increases to a level that cannot be overriden by
AcGq3-attractive signaling. A second possibility is that Dgq3 is a
component of an attractive signaling pathway, which functions to
potentiate Frazzled signaling by negatively modulating the repulsion
mediated by Robo signaling. This could be through phosphorylation of
Robo. A recent study using spinal axons from stage 22 Xenopus embryos has shown that the repulsive ligand Slit can
"silence" the Netrin-mediated attraction through a direct physical
interaction between the cytoplasmic domains of Robo and Frazzled (Stein
and Tessier-Lavigne, 2001). This ligand-dependent silencing effect
serves to promote repulsion of growth cones from the midline during the
development of commissures. Dgq3 might function conversely at the
level of downstream effector molecules to inhibit repulsion in response
to attractive cues to promote midline crossing.
In summary, our results predict the involvement of a Gq-mediated
signaling pathway in regulating midline crossing in
Drosophila. In addition, they also support the notion that
balance between attraction and repulsion is a crucial factor that
determines the final response of a growth cone to different cues.
Inhibition of dgq function specifically in the growth cones
should prove useful in dissecting out other components of this pathway
that regulates midline crossing.
| |
FOOTNOTES |
Received Nov. 8, 2001; revised Feb. 4, 2002; accepted Feb. 20, 2002.
This work was supported by a grant from the Department of
Biotechnology, Government of India, and core funding from National Center for Biological Sciences. We thank Mattias Landgraf for useful
discussions and Veronica Rodrigues, Satyajit Mayor, and K. VijayRaghavan for critical comments on this manuscript.
Correspondence should be addressed to Gaiti Hasan, National Center for
Biological Sciences, Tata Institute of Fundamental Research, Gandhi
Krishi Vigyan Kendra Campus, Bellary Road, Bangalore 560065. E-mail:
gaiti{at}ncbs.res.in.
| |
REFERENCES |
-
Alvarez CE,
Robison K,
Gilbert W
(1996)
Novel Gq alpha isoform is a candidate transducer of rhodopsin signaling in a Drosophila testes-autonomous pacemaker.
Proc Natl Acad Sci USA
93:12278-12282[Abstract/Free Full Text].
-
Baines RA,
Robinson SG,
Fujioka M,
Jaynes JB,
Bate M
(1999)
Postsynaptic expression of tetanus toxin light chain blocks synaptogenesis in Drosophila.
Curr Biol
9:1267-1270[Web of Science][Medline].
-
Bashaw GJ,
Goodman CS
(1999)
Chimeric axon guidance receptors: the cytoplasmic domains of slit and netrin receptors specify attraction versus repulsion.
Cell
97:917-926[Web of Science][Medline].
-
Bashaw GJ,
Kidd T,
Murray D,
Pawson T,
Goodman CS
(2000)
Repulsive axon guidance: Abelson and Enabled play opposing roles downstream of the roundabout receptor.
Cell
101:703-715[Web of Science][Medline].
-
Bence K,
Ma W,
Kozasa T,
Huang XY
(1997)
Direct stimulation of Bruton's tyrosine kinase by G(q)-protein alpha-subunit.
Nature
389:296-299[Medline].
-
Bonkowsky JL,
Yoshikawa S,
O'Keefe DD,
Scully AL,
Thomas JB
(1999)
Axon routing across the midline controlled by the Drosophila Derailed receptor.
Nature
402:540-544[Medline].
-
Brand AH,
Perrimon N
(1993)
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
-
Chan SS,
Zheng H,
Su MW,
Wilk R,
Killeen MT,
Hedgecock EM,
Culotti JG
(1996)
UNC-40, a C. elegans homolog of DCC (Deleted in Colorectal Cancer), is required in motile cells responding to UNC-6 netrin cues.
Cell
87:187-195[Web of Science][Medline].
-
Corset V,
Nguyen-Ba-Charvet KT,
Forcet C,
Moyse E,
Chedotal A,
Mehlen P
(2000)
Netrin-1-mediated axon outgrowth and cAMP production requires interaction with adenosine A2b receptor.
Nature
407:747-750[Medline].
-
Culotti JG,
Merz DC
(1998)
DCC and Netrins.
Curr Opin Cell Biol
10:609-613[Web of Science][Medline].
-
DeVivo M,
Chen J,
Codina J,
Iyengar R
(1992)
Enhanced phospholipase C stimulation and transformation in NIH-3T3 cells expressing Q209L Gq subunits.
J Biol Chem
267:18263-18266[Abstract/Free Full Text].
-
Doe CQ,
Hiromi Y,
Gehring WJ,
Goodman CS
(1988)
Expression and function of the segmentation gene fushi tarazu during Drosophila neurogenesis.
Science
239:170-175[Abstract/Free Full Text].
-
Edery I,
Zwiebel LJ,
Dembinska ME,
Rosbash M
(1994)
Temporal phosphorylation of the Drosophila period protein.
Proc Natl Acad Sci USA
91:2260-2264[Abstract/Free Full Text].
-
Exton JH
(1994)
Phosphoinositide phospholipases and G proteins in hormone action.
Annu Rev Physiol
56:349-369[Web of Science][Medline].
-
Featherstone DE,
Rushton EM,
Hilderbrand-Chae M,
Phillips AM,
Jackson FR,
Broadie K
(2000)
Presynaptic glutamic acid decarboxylase is required for induction of the postsynaptic receptor field at a glutamatergic synapse.
Neuron
27:71-84[Web of Science][Medline].
-
Fritz JL,
VanBerkum MF
(2000)
Calmodulin and son of sevenless dependent signaling pathways regulate midline crossing of axons in the.
Drosophila CNS Development
127:1991-2000.
-
Gong Q,
Rangarajan R,
Seeger M,
Gaul U
(1999)
The netrin receptor frazzled is required in the target for establishment of retinal projections in the Drosophila visual system.
Development
126:1451-1456[Abstract].
-
Goodman CS,
Doe CQ
(1993)
Embryonic development of the Drosophila CNS.
In: The development of Drosophila melanogaster (Bate M,
Martinez-Arias A,
eds), pp 1131-1206. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Gould AP,
Lai RYK,
Green MJ,
White RAH
(1990)
Blocking cell division does not remove the requirement for polycomb function in Drosophila embryogenesis.
Development
110:1319-1325[Abstract/Free Full Text].
-
Harris R,
Sabatelli LM,
Seeger MA
(1996)
Guidance cues at the Drosophila CNS midline: identification and characterization of two Drosophila Netrin/UNC-6 homologs.
Neuron
17:217-228[Web of Science][Medline].
-
Hasan G,
Rosbash M
(1992)
Drosophila homologs of two mammalian intracellular Ca(2+)-release channels: identification and expression patterns of the inositol 1,4,5-triphosphate and the ryanodine receptor genes.
Development
116:967-975[Abstract].
-
Hiramoto M,
Hiromi Y,
Giniger E,
Hotta Y
(2000)
The Drosophila Netrin receptor Frazzled guides axons by controlling Netrin distribution.
Nature
406:886-889[Medline].
-
Hong K,
Hinck L,
Nishiyama M,
Poo MM,
Tessier-Lavigne M,
Stein E
(1999)
A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion.
Cell
97:927-941[Web of Science][Medline].
-
Hong K,
Nishiyama M,
Henley J,
Tessier-Lavigne M,
Poo M
(2000)
Calcium signalling in the guidance of nerve growth by netrin-1.
Nature
403:93-98[Medline].
-
Horgan AM,
Lagrange MT,
Copenhaver PF
(1994)
Developmental expression of G proteins in a migratory population of embryonic neurons.
Development
120:729-742[Abstract].
-
Hummel T,
Schimmelpfeng K,
Klambt C
(1999a)
Commissure formation in the embryonic CNS of Drosophila.
Dev Biol
209:381-398[Web of Science][Medline].
-
Hummel T,
Schimmelpfeng K,
Klambt C
(1999b)
Commissure formation in the embryonic CNS of Drosophila.
Development
126:771-779[Abstract].
-
Ishii N,
Wadsworth WG,
Stern BD,
Culotti JG,
Hedgecock EM
(1992)
UNC-6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans.
Neuron
9:873-881[Web of Science][Medline].
-
Keino-Masu K,
Masu M,
Hinck L,
Leonardo ED,
Chan SS,
Culotti JG,
Tessier-Lavigne M
(1996)
Deleted in Colorectal Cancer (DCC) encodes a netrin receptor.
Cell
87:175-185[Web of Science][Medline].
-
Kennedy TE,
Serafini T,
De La Torre JR,
Tessier-Lavigne M
(1994)
Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord.
Cell
78:425-435[Web of Science][Medline].
-
Kidd T,
Brose K,
Mitchell KJ,
Fetter RD,
Tessier-Lavigne M,
Goodman CS,
Tear G
(1998a)
Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of evolutionarily conserved guidance receptors.
Cell
92:205-215[Web of Science][Medline].
-
Kidd T,
Russell C,
Goodman CS,
Tear G
(1998b)
Dosage-sensitive and complementary functions of roundabout and commissureless control axon crossing of the CNS midline.
Neuron
20:25-33[Web of Science][Medline].
-
Kidd T,
Bland KS,
Goodman CS
(1999)
Slit is the midline repellent for the robo receptor in.
Drosophila Cell
96:785-794[Web of Science][Medline].
-
Klambt C,
Roger Jacobs J,
Goodman CS
(1991)
The midline of the Drosophila central nervous system: a model for the genetic analysis of cell fate, cell migration, and growth cone guidance.
Cell
84:801-815.
-
Kolodziej PA,
Timpe LC,
Mitchell KJ,
Fried SR,
Goodman CS,
Jan LY,
Jan YN
(1996)
Frazzled encodes a Drosophila member of the DCC immunoglobulin subfamily and is required for CNS and motor axon guidance.
Cell
87:197-204[Web of Science][Medline].
-
Landgraf M,
Roy S,
Prokop A,
VijayRaghavan K,
Bate M
(1999)
even-skipped determines the dorsal growth of motor axons in Drosophila.
Neuron
22:43-52[Medline].
-
Lee YJ,
Dobbs MB,
Verardi ML,
Hyde DR
(1990)
dgq: a Drosophila gene encoding a visual system-specific G alpha molecule.
Neuron
5:889-898[Web of Science][Medline].
-
Lee YJ,
Shah S,
Suzuki E,
Zars T,
O'Day PM,
Hyde DR
(1994)
The Drosophila dgq gene encodes a G alpha protein that mediates phototransduction.
Neuron
13:1143-1157[Web of Science][Medline].
-
Lin DM,
Goodman CS
(1994)
Ectopic and increased expression of Fasciclin II alters motoneuron growth cone guidance.
Neuron
13:1055-1069[Web of Science][Medline].
-
Lundgren SE,
Callahan CA,
Thor S,
Thomas JB
(1995)
Control of neuronal pathway selection by the Drosophila LIM homeodomain gene apterous.
Development
121:1769-1773[Abstract].
-
Ma YC,
Huang XY
(1998)
Identification of the binding site for Gqalpha on its effector Bruton's tyrosine kinase.
Proc Natl Acad Sci USA
95:12197-12201[Abstract/Free Full Text].
-
Meadows LA,
Gell D,
Broadie K,
Gould AP,
White RA
(1994)
The cell adhesion molecule, connectin, and the development of the Drosophila neuromuscular system.
J Cell Sci
107:321-328[Abstract].
-
Menon KP,
Zinn K
(1998)
Tyrosine kinase inhibition produces specific alterations in axon guidance in the grasshopper embryo.
Development
125:4121-4131[Abstract].
-
Mitchell KJ,
Doyle JL,
Serafini T,
Kennedy TE,
Tessier-Lavigne M,
Goodman CS,
Dickson BJ
(1996)
Genetic analysis of Netrin genes in Drosophila: netrins guide CNS commissural axons and peripheral motor axons.
Neuron
17:203-215[Web of Science][Medline].
-
Nakayama T,
Goshima Y,
Misu Y,
Kato T
(1999)
Role of cdk5 and tau phosphorylation in heterotrimeric G protein-mediated retinal growth cone collapse.
J Neurobiol
41:326-339[Medline].
-
Rajagopalan S,
Vivancos V,
Nicolas E,
Dickson BJ
(2000a)
Selecting a longitudinal pathway. Robo receptors specify the lateral position of axons in the Drosophila CNS.
Cell
103:1033-1045[Web of Science][Medline].
-
Rajagopalan S,
Nicolas E,
Vivancos V,
Berger J,
Dickson BJ
(2000b)
Crossing the midline: roles and regulation of Robo receptors.
Neuron
28:767-777[Web of Science][Medline].
-
Sambrook J,
Fritsch EF,
Maniatis T
(1989)
In: Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Sanger F,
Nicklen S,
Coulson AR
(1977)
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:5463-5467[Abstract/Free Full Text].
-
Schmucker D,
Taubert H,
Jackle H
(1992)
Formation of the Drosophila larval photoreceptor organ and its neuronal differentiation require continuous Kruppel gene activity.
Neuron
6:1025-1039.
-
Scott K,
Becker A,
Sun Y,
Hardy R,
Zuker CS
(1995)
Gq alpha protein function in vivo: genetic dissection of its role in photoreceptor cell physiology.
Neuron
15:919-927[Web of Science][Medline].
-
Simpson JH,
Kidd T,
Bland KS,
Goodman CS
(2000a)
Short-range and long-range guidance by slit and its Robo receptors. Robo and Robo2 play distinct roles in midline guidance.
Neuron
28:753-766[Web of Science][Medline].
-
Simpson JH,
Bland KS,
Fetter RD,
Goodman CS
(2000b)
Short- range and long-range guidance by Slit and its Robo receptors. A combinatorial code of Robo receptors controls lateral position.
Cell
103:1019-1032[Web of Science][Medline].
-
Sinha M,
Hasan G
(1999)
Sequencing and exon mapping of the inositol 1,4,5-trisphosphate receptor cDNA from Drosophila embryos suggests the presence of differentially regulated forms of RNA and protein.
Gene
233:271-276[Web of Science][Medline].
-
Song HJ,
Ming GL,
Poo MM
(1997)
cAMP-induced switching in turning direction of nerve growth cones.
Nature
388:275-279[Medline].
-
Stein E,
Tessier-Lavigne M
(2001)
Hierarchical organization of guidance receptors: silencing of netrin attraction by slit through a Robo/DCC receptor complex.
Science
291:1928-1938[Abstract/Free Full Text].
-
Stein E,
Zou Y,
Poo M,
Tessier-Lavigne M
(2001)
Binding of DCC by netrin-1 to mediate axon guidance independent of adenosine A2B receptor activation.
Science
291:1976-1982[Abstract/Free Full Text].
-
Strathmann M,
Simon MI
(1990)
G protein diversity: a distinct class of alpha subunits is present in vertebrates and invertebrates.
Proc Natl Acad Sci USA
87:9113-9117[Abstract/Free Full Text].
-
Sun Q,
Bahri S,
Schmid A,
Chia W,
Zinn K
(2000)
Receptor tyrosine phosphatases regulate axon guidance across the midline of the Drosophila embryo.
Development
127:801-812[Abstract].
-
Talluri S,
Bhatt A,
Smith DP
(1995)
Identification of a Drosophila G protein alpha subunit (dGq alpha-3) expressed in chemosensory cells and central neurons.
Proc Natl Acad Sci USA
92:11475-11479[Abstract/Free Full Text].
-
Tautz D,
Pfiefle C
(1989)
A non radioactive in situ hybridization method for localisation of RNAs in Drosophila embryos reveals translation control of the segmentation gene hunchback.
Chromosoma
98:81-85[Web of Science][Medline].
-
Tear G,
Harris R,
Sutaria S,
Kilomanski K,
Goodman CS,
Seeger MA
(1996)
Commissureless controls growth cone guidance across the CNS midline in Drosophila and encodes a novel membrane protein.
Neuron
16:501-514[Web of Science][Medline].
-
Tessier-Lavigne M,
Goodman CS
(1996)
The molecular biology of axon guidance.
Science
274:1123-1133[Abstract/Free Full Text].
-
Wang Q,
Hasan G,
Pikielny CW
(1999)
Preferential expression of biotransformation enzymes in the olfactory organs of Drosophila melanogaster, the antennae.
J Biol Chem
274:10309-10315[Abstract/Free Full Text].
-
Wieschaus F,
Nusslein-Volhard C
(1986)
Looking at embryos.
In: Drosophila: a practical approach (Roberts DB,
ed), pp 199-227. Oxford: IRL.
-
Wolf BD,
Chiba A
(2000)
Axon pathfinding proceeds normally despite disrupted growth cone decisions at CNS midline.
Development
127:2001-2009[Abstract].
-
Zheng JQ
(2000)
Turning of nerve growth cones induced by localized increases in intracellular calcium ions.
Nature
403:89-93[Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22114499-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
A. Nurnberg, A. U. Brauer, N. Wettschureck, and S. Offermanns
Antagonistic Regulation of Neurite Morphology through Gq/G11 and G12/G13
J. Biol. Chem.,
December 19, 2008;
283(51):
35526 - 35531.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. Kain, T. S. Chakraborty, S. Sundaram, O. Siddiqi, V. Rodrigues, and G. Hasan
Reduced Odor Responses from Antennal Neurons of Gq{alpha}, Phospholipase C{beta}, and rdgA Mutants in Drosophila Support a Role for a Phospholipid Intermediate in Insect Olfactory Transduction
J. Neurosci.,
April 30, 2008;
28(18):
4745 - 4755.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. H. Cho, M. Lepine, W. Andrews, J. Parnavelas, and J.-F. Cloutier
Requirement for Slit-1 and Robo-2 in Zonal Segregation of Olfactory Sensory Neuron Axons in the Main Olfactory Bulb
J. Neurosci.,
August 22, 2007;
27(34):
9094 - 9104.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Banerjee, R. Joshi, G. Venkiteswaran, N. Agrawal, S. Srikanth, F. Alam, and G. Hasan
Compensation of inositol 1,4,5-trisphosphate receptor function by altering sarco-endoplasmic reticulum calcium ATPase activity in the Drosophila flight circuit.
J. Neurosci.,
August 9, 2006;
26(32):
8278 - 8288.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. J. Forsthoefel, E. C. Liebl, P. A. Kolodziej, and M. A. Seeger
The Abelson tyrosine kinase, the Trio GEF and Enabled interact with the Netrin receptor Frazzled in Drosophila
Development,
April 15, 2005;
132(8):
1983 - 1994.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Grillet, V. Dubreuil, H. D. Dufour, and J.-F. Brunet
Dynamic Expression of RGS4 in the Developing Nervous System and Regulation by the Neural Type-Specific Transcription Factor Phox2b
J. Neurosci.,
November 19, 2003;
23(33):
10613 - 10621.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
