 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 2002, 22(13):5291-5299
Abnormal Chemosensory Jump 6 Is a Positive Transcriptional
Regulator of the Cholinergic Gene Locus in Drosophila
Olfactory Neurons
Mi-Heon
Lee and
Paul M.
Salvaterra
Division of Neuroscience, Beckman Research Institute of the City of
Hope, Duarte, California 91010
 |
ABSTRACT |
Cholinergic neurons acquire their neurotransmitter phenotype, in
part, by expressing the cholinergic gene locus. Previous studies have
indicated that the 5' flanking DNA of the locus contains both positive
and negative regulatory elements important for expression in different
subsets of cholinergic neurons in Drosophila and other
animals. Approximately 300 bases of proximal 5' flanking DNA control
expression in Drosophila CNS neurons essential for viability, whereas more distal regulatory elements are important for
expression in PNS sensory neurons. In this study we identify the POU
domain transcription factor abnormal chemosensory jump 6 (Acj6)
as a necessary positive transcriptional regulator for cholinergic locus
expression in primary olfactory neurons. Choline acetyltransferase
enzyme activity, protein levels, mRNA, and a fluorescent cholinergic
reporter gene are all decreased in olfactory neurons of
acj6 mutants. Decreased cholinergic expression was observed in both adults and larvae. The presence of a specific Acj6
binding site has been identified in the cholinergic locus 5' flanking
DNA, suggesting that Acj6 may play a direct role in specifying the
cholinergic neurotransmitter phenotype of most olfactory neurons.
Transgenic expression of two different isoforms of Acj6 restricted to
olfactory neurons indicates that additional trans
factors may be required for cholinergic locus expression. Transgenic
expression in all cholinergic neurons, however, results in lethality
when a POU IV box element is absent but is essentially benign when
present, indicating the importance of this motif in specifying
different functional roles for Acj6.
Key words:
cholinergic locus; POU domain transcription factor; POU
IV box; Acj6; neurotransmitter phenotype; olfactory neurons
 |
INTRODUCTION |
Expression of particular
neurotransmitter phenotypes is a key component of neurons and an
important organizational principle of the nervous system necessary to
establish proper communication among cells in neural networks and
ensembles. Neurons using classical small molecule neurotransmitters
attain their phenotypes by regulating specific genes that catalyze the
unique biosynthesis of transmitter and unique uptake systems for
packaging neurotransmitter into synaptic vesicles or recovering
transmitter by plasma membrane uptake. Many specific
neurotransmitter-related genes are controlled by transcriptional
regulatory elements present in their 5' flanking DNA (Kitamoto et al.,
1992 , 1995 ; Kitamoto and Salvaterra, 1993 , 1995 ; Quinn et al., 1995 ;
Hahm et al., 1997 ; Benveniste and Taghert, 1999 ; Sacchetti et al.,
1999 ).
Acetylcholine is an important neurotransmitter in all animals, and
cholinergic neurons can be recognized by expression of the uniquely
organized cholinergic gene locus (Usdin et al., 1995 ). This complex
locus encodes two essential functions for cholinergic neurotransmission: choline acetyltransferase (ChAT) and the vesicular acetylcholine transporter (VAChT) (Alfonso et al., 1993 ; Erickson et
al., 1994 ; Kitamoto et al., 1998 ). Transgenic animals containing parts
of the cholinergic locus 5' flanking DNA fused to reporter genes show
subset specific expression patterns (Kitamoto et al., 1992 , 1995 ;
Kitamoto and Salvaterra, 1993 ; Yasuyama et al., 1995 ; Naciff et al.,
1999 ; Yasuyama and Salvaterra, 1999 ). In Drosophila, the
regulatory control also appears to be independent in some types of
cholinergic neurons such as peripheral sensory neurons (Kitamoto et
al., 1992 ; Kitamoto and Salvaterra, 1993 , 1995 ; Yasuyama et al., 1995 ).
These previous results imply that regulation of the cholinergic locus
is different in different types of cholinergic neurons and that
vertebrates and insects may share a common regulatory strategy
(Kitamoto et al., 1998 ). Few cis-regulatory elements and
associated trans factors, however, have been identified that would be candidates for differential regulation (Hahm et al., 1997 ;
Berse et al., 1999 ; De Gois et al., 2000 ). The Drosophila POU domain protein Nubbin (also known as Pdm1) is important for cholinergic locus expression in CNS neurons essential for survival (Kitamoto and Salvaterra, 1995 ), but cis and
trans factors important for other types of cholinergic
neurons, such as PNS sensory neurons, are unknown.
Drosophila offers a favorable genetic system to identify
transcriptional regulators for different types of cholinergic neurons. We have recently described a fluorescent cholinergic reporter system
that allows identification of cholinergic neurons in live animals
(Salvaterra and Kitamoto, 2001 ) which was used in this study. Here, we
show that expression of the cholinergic locus in olfactory neurons is
decreased in mutants of the abnormal chemosensory jump 6 (acj6, also known as IPOU) gene. Acj6 is a
class IV POU domain transcription factor homologous to members of the
vertebrate Brn3 family (Treacy et al., 1991 ) and is required for normal
olfactory physiology and behavior in both larval and adult
Drosophila (McKenna et al., 1989 ; Ayer et al., 1991 ; Ayer
and Carlson, 1992 ; Clyne et al., 1999a ; Certel et al., 2000 ). A
specific Acj6 binding motif has also been demonstrated in an
appropriate part of the cholinergic regulatory DNA. Our results lead us
to propose that Acj6 may be a direct transcriptional regulator of the
cholinergic locus in PNS olfactory sensory neurons and that abnormal
cholinergic synaptic transmission could explain many of the
acj6 mutant phenotypes.
 |
MATERIALS AND METHODS |
Fly culture and transgenic lines. Drosophila
melanogaster Canton S-5 (CS-5), the parental wild-type strain from
which acj6 mutants were derived (McKenna et al., 1989 ), were
reared at 18 or 25°C on cornmeal, sucrose, yeast media.
The olfactory neuron-specific P [Gal4] driver line GH86
(Heimbeck et al., 1999 ) and the UAS-Acj6 (1,3,4) and UAS-Acj6 (1,4) (Certel et al., 2000 ) responder lines were obtained from Dr. W. A. Johnson (University of Iowa). UAS-Acj6 (1,3,4) (chromosome II) and
UAS-Acj6 (1,4) (chromosome III) transgenic lines (Certel et al., 2000 )
were recombined with Cha-Gal4 lines (chromosome III or II)
by standard genetic crosses using second or third chromosome balancers,
CyO or TM3. The GH86 olfactory driver was
recombined with either UAS-Acj6 (1,3,4) or UAS-Acj6 (1,4) transgenic
lines, and male progeny were used for ChAT assay (see below).
A fluorescent cholinergic reporter line marking essentially all known
cholinergic neurons consisted of a 7.4 kb Cha-Gal4 driver line (19B) recombined with UAS-GFP (S65T) and has been described previously (Salvaterra and Kitamoto, 2001 ). The 19B driver (chromosome II) and another 7.4 kb Cha-Gal4 line (15A, chromosome III)
were used to drive expression of UAS transgenes. A new 1.2 kb
Cha-Gal4 line was constructed for this study by
PstI digestion of 1.2 Cha-pCaSpeR-AUG- -gal (Kitamoto et
al., 1995 ). The resulting digest was blunt-ended with T4 polymerase and
further digested with BamHI to remove the -gal sequence.
The vector was then ligated to a Gal4 fragment (5' blunt-ended by
Klenow digestion) obtained from pGaTB (Brand and Perrimon, 1993 ) by
SpeI/BamHI digestion. This construct was microinjected into embryos using standard methods (Rubin and Spradling, 1982 ). Transformant lines (1.2 kb Cha-GAL4) were recombined
with UAS-GFP lines (Bloomington Stock Center) and characterized for their fluorescence expression pattern using standard fluorescence microscopy (see below).
Mutant stocks. We obtained
acj61 and
acj66 from Drs. Peter J. Clyne and J. R. Carlson (Yale University). acj61
is a homozygous stock. acj66 males were
maintained with C(1)A,y/Y females.
lz3 males maintained with C(1)DX,y
f/Y females were obtained from the Bloomington Stock Center.
Descriptions are found in Lindsley and Zimm (1992) and on line at
FlyBase (http://flybase.bio.indiana.edu). A
acj66/C(1)A/Y;7.4
Cha-Gal4 UAS-GFP stock was constructed from
acj66/Y;7.4 Cha-Gal4
UAS-GFP/+ males mated to C(1)A,y/Y;+/SM5,Cy
females. F1 fluorescent curly winged offspring were selected and mated to produce strongly fluorescent normal winged F2 flies used for the
stock. lz3/Y males were mated to
C(1)DX/Y;7.4 Cha-Gal4 UAS-GFP females. Strongly
fluorescent flies were selected from the F2 generation for the purpose
of mating in single pairs. A
lz3/C(1)DX,y f/Y;7.4
Cha-Gal4 UAS-GFP true breeding stock was selected from among
F3 offspring.
Microscopy. Larvae were washed out of their food with
a 15% sucrose solution and rinsed two times in PBS. Adult antennae or maxillary palps were dissected from male heads in PBS. Larvae or adult
appendages were fixed for 30 min in 3.7% formaldehyde in PBS and
mounted directly under a coverslip in a solution of 50% glycerol in
PBS, pH 7.4. Adult brains were first removed in cold PBS, fixed, and
mounted as above. Green fluorescent protein (GFP) fluorescence was
observed by either confocal or wide-field fluorescence microscopy.
Confocal microscopy used a Zeiss LSM 310. Excitation was at 488 nm
(argon laser) and emission at 515 nm. Z-sections were collected and
processed using Scion IMAGE (Scion, Frederick, MD) to construct
three-dimensional rotating projections or maximum intensity projections
through an extended depth of focus. Processing involved minor
corrections of brightness and contrast. Wide-field fluorescence
observations were made with an Olympus AX70 microscope using the U-MNB
filter cube (excitation 470-490 nm, emission 515 nm). Images (12 bit)
were collected with a Real14 CCD camera (Cambridge Research
Instruments, Cambridge, MA) and processed using Image Pro Plus (Media
Cybernetics, Silver Springs, MD) or Photoshop (Adobe, San Jose, CA).
Processing consisted of minimally correcting light levels, contrast,
and brightness, and digital merging.
ChAT enzyme assay. ChAT activity was assayed using a
standard method (Fonnum, 1975 ) as described previously (Kitamoto et
al., 1992 ). Adult flies were homogenized in 40 µl per fly of 50 mM Tris-HCl, 0.1 M NaCl,
0.5% Triton X-100, pH 7.5, on ice. The samples were frozen and thawed
once and centrifuged for 10 min at 4°C. The supernatant (20 µl) was
incubated with an equal volume of 14C-labeled acetyl-CoA enzyme
substrate at 37°C for 10 min.
Western blot. For Western blot analysis (Harlow and
Lane, 1988 ) of ChAT protein, 10 heads from males of appropriate
genotype were homogenized in SDS-dissociation buffer (50 mM Tris-HCl, pH 8.0, 0.1 M
NaCl, 5% SDS, 1 mM ethylenediamine tetraacetic
acid, 1% 2-mercaptoethanol). The supernatant was obtained after
centrifugation for 15 min at 12,000 rpm. One hundred micrograms of
total protein were electrophoresed on a 12% SDS-polyacrylamide gel and
transferred to a nitrocellulose membrane for antibody staining. The
nitrocellulose membrane was incubated with anti-Drosophila
anti-ChAT monoclonal antibody 4B1 (1:1000) (Yasuyama et al., 1995 ).
Antibody binding was detected with alkaline phosphatase-conjugated goat
anti-mouse IgG (Pierce; 1:5000), and color was developed using
bromochloroindolyl phosphate/nitroblue tetrazolium solution. Parallel
Coomassie blue-stained SDS-PAGE gels confirmed that similar amounts of
protein were analyzed for each genotype.
RT-PCR. ChAT-specific RNA was estimated using a quantitative
PCR procedure. One hundred antennae from either CS-5 or
acj66 males were dissected and homogenized
in 500 µl of RNAzol B for total RNA extraction (Tel-Test,
Friendswood, TX; RNAzol protocol). RT-PCR (Qiagen one-step
RT-PCR kit; Qiagen, Valencia, CA) contained 200 ng of total RNA, 1×
buffer (kit), including 10 mM dNTPs, and enzyme
along with 0.6 µM primers [ChAT: forward
5'-GACGATGAACGACGAGGATCGC-3' (1162-1182), reverse
5'-TGCGGACCCACATGCCACTCC-3' (1780-1800); -tubulin: forward
5'-GTCTCGCTGACCATGTCCGGG-3' (822-842), reverse 5'-GCCTCTCGGCGGGATGTCG-3' (1199-1217)] in a final volume of 25 µl. The PCR was performed in a Robocycler (Stratagene, La Jolla, CA)
at 50°C, 30 min for reverse transcription, 95°C, 15 min for initial
PCR activation step, followed by 94°C, 1 min, 60°C 1 min, 72°C 1 min, for 30 cycles. Amplified products were separated and analyzed by
agarose gel electrophoresis. RNase-free DNase (Promega, Madison, WI)
treatment was accomplished before RT-PCR reaction to avoid DNA contamination.
Gel mobility shift assay. We scanned the 5' flanking DNA of
the cholinergic locus known to be important for PNS expression [3.3 kb
minus 1.2 kb (Kitamoto et al., 1995 )] and identified seven sites
containing either an ATAATT or ATAAAT motif. These motifs are present
in either of the two proposed DNA binding sites for Brn-3:
ATAATTAAT or GCATAAATAA (Thompson et al., 1987 ;
Gerrero et al., 1993 ; Turner et al., 1994 ; Gruber et al., 1997 ). Brn3 is the vertebrate homolog of Acj6 (Gerrero et al., 1993 ; Xiang et al.,
1993 ). Potential Drosophila sites tested for Acj6 binding, in their proper flanking context, were as follows: (A)
485-5'-TTACAAATAATTTGAACTTCA-3', (B)
697-5'-ATAAGACATAATTGACAATGGA-3', (C)
1133-5'-TGCCATATAATTTGGCCCC-3', (D)
1818-5'-GACTTGAATAAATTAAAACTTT-3', (E)
1959-5'-GATCTTAACATAATTCTGTGG-3', (F)
2001-5'-CTTGATAAATTGCAGAAGTGCT-3', and (G)
2028-5'-AGTGATAAATGACAATGAAAT-3'. Numbers are
relative to the 3.3 kb Cha 5' flanking DNA (see Fig. 7 for
location of probe sequences). Complementary oligonucleotides (19-22
bases) were synthesized, end labeled with
[ -32P]ATP using T4 polynucleotide
kinase, and used as probes for gel electrophoretic mobility shift
assays (EMSA). The EMSA binding mixture (10 µl) contained 20 mM Tris, pH 8.0, 100 mM
KCl, 5 mM MgCl2, 2 mM EDTA, 100 µg/ml poly(dI-dC), 100 µg/ml
BSA, 10% glycerol, 1 mM DTT, ~90 pmol of
labeled DNA probe, and 50 ng of recombinant Acj6 protein composed of
the POU-specific and POU homeodomains (Gruber et al., 1997 ).
Recombinant Acj6 protein was obtained from Dr. Eric Turner (University
of California, San Diego). Binding was at room temperature for 10 min,
and mixtures were then electrophoresed through 4% nondenaturing
polyacrylamide gels at 4°C. Gels were dried and bands were detected
and quantified by Phosphorimager analysis (Molecular Dynamics/Amersham,
Piscataway, NJ). The optimal Brn-3.0 recognition element,
TGCATAATTAATTAC (Turner, 1996 ), was used as a positive control for Acj6 binding.
 |
RESULTS |
Reduction of cholinergic locus expression in acj6 mutants
ChAT enzyme activity was decreased in adult males containing
either of two different acj6 mutant alleles. The decrease in enzyme activity was greater in the acj66
null allele (~34%) than in the acj61
hypomorphic allele (~20%) as shown in Fig.
1. Western blots of protein extracts from
acj66 mutant or wild-type male fly heads,
stained with anti-ChAT antibody, indicate that the level of ChAT
protein is also decreased in acj66 mutants
as shown in Figure 2A.
Because the same amount of total protein was added to each lane of the
gel as shown Figure 2B, a decrease in ChAT protein
production or an increase in its degradation could account for the
decreased enzyme activity.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 1.
ChAT activity is reduced in
acj61 and
acj66 mutant males. Ten adult male
flies (3-8 d old) of the indicated genotypes were homogenized, and the
supernatants were assayed for ChAT activity. We observed a 20%
decrease in acj61
(p < 0.0095) and a 34% decrease in
acj66 (p < 0.007) flies relative to wild type. Results are shown for three
independent experiments in which enzyme activity (±SEM) was determined
in triplicate.
|
|

View larger version (64K):
[in this window]
[in a new window]
|
Figure 2.
ChAT protein levels are reduced in
acj66 mutant males. Protein extracts
from adult males (3-8 d old) of the indicated genotypes were
electrophoresed on SDS-polyacrylamide gels. A, Proteins
were transferred to nitrocellulose, and ChAT protein was detected by
immunostaining with anti-Drosophila ChAT monoclonal
antibody 4B1. Only a single positive band was detected, and the
intensity was reduced ~66% for
acj66 relative to wild type.
B, A parallel gel stained with Coomassie blue shows that
equal amounts of protein were loaded on the gels for each
genotype.
|
|
Acj6 (Clyne et al., 1999a ; Certel et al., 2000 ) as well as ChAT and
VAChT (Kitamoto et al., 1995 ; Yasuyama et al., 1995 ; Yasuyama and
Salvaterra, 1999 ) are expressed in a partially overlapping and complex
set of both PNS and CNS neurons. Because olfactory organs such as the
antennae can easily be isolated form adult flies by simple dissection,
we initially examined the levels of ChAT mRNA in whole antennae using
quantitative RT-PCR. Antennae contain a mixture of primary olfactory
sensory neurons located on the third segment (Siddiqi, 1983 ) and
primary mechanosensory neurons located primarily on the second segment
(Eberl et al., 2000 ). Both populations of cells include cholinergic
neurons (Salvaterra and Kitamoto, 2001 ), but only the olfactory neurons
express Acj6 (Clyne et al., 1999a ; Certel et al., 2000 ). As shown in
Figure 3A, the ChAT mRNA
levels in antennae of male acj66 mutants
are reduced ~30% relative to wild type. In contrast, no significant
difference in -tubulin expression was observed between the genotypes
(Fig. 3B).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3.
ChAT mRNA levels are reduced in antennae from
acj66 mutant males. Total RNA was
extracted from dissected antennae of 5- to 10-d-old male flies. Samples
were analyzed for ChAT or -tubulin mRNA levels by ethidium bromide
staining after RT-PCR. A, The ChAT-specific band (693 bp) shows a dramatic reduction in samples from
acj66 males relative to wild type. The
-tubulin band (396 bp) was similar for either genotype.
B, Relative ChAT mRNA in CS-5 and
acj66 mutant antennae. The levels of
ChAT or -tubulin mRNA bands were quantified from ethidium
bromide-stained gels using Quantity One software (Bio-Rad, Hercules,
CA). The height of the bars represents
the mean mRNA values (±SEM) for three independent experiments. ChAT
mRNA was first normalized to the level of -tubulin mRNA. ChAT mRNA
values are significantly different for these two genotypes
(t test; p < 0.005).
|
|
Cholinergic reporter gene fluorescence is decreased in olfactory
neurons of acj6
We next examined cholinergic expression in acj6 mutants
using a cholinergic fluorescent reporter line (Salvaterra and Kitamoto, 2001 ). The reporter line was constructed by fusing the complete cholinergic locus regulatory DNA (~7.4 kb of 5' flanking sequence) to
the yeast transcriptional activator Gal4 (Kitamoto, 2001 ). When this
driver is recombined with UAS-GFP (S65T) responder line, all of the
known cholinergic neurons exhibit bright GFP fluorescence (Salvaterra
and Kitamoto, 2001 ). As shown in Figure
4A, robust cholinergic
reporter gene expression is easily observed in the primary olfactory
neurons localized to the third segment of adult male antennae as well
as the mechanosensory neurons of the second segment. In addition to the
antennae, adult Drosophila has a second olfactory organ, the
maxillary palps (Ayer and Carlson, 1992 ). Many olfactory neurons are
intensely fluorescent in maxillary palps dissected from wild-type flies
as shown in Figure 4E.

View larger version (72K):
[in this window]
[in a new window]
|
Figure 4.
Expression of a cholinergic neuron
reporter gene is decreased in primary olfactory neurons of antennae and
maxillary palps from acj66 mutant
males. Antennae or maxillary palps were dissected from the heads of
three different adult male flies containing a fluorescent cholinergic
reporter gene system and imaged using confocal microscopy. Stacks of Z
sections were collected, and two-dimensional (2D) projections were
constructed to provide an extended depth of focus. A,
Numerous primary olfactory neurons are visible in the third antennal
segment (III) of wild-type flies containing a 7.4 kb Cha-Gal4/UAS-GFP reporter system marking all
cholinergic neurons. Chordotonal mechanosensory neurons are also
intensely fluorescent in the second antennal segment
(II). B, Most of the primary
olfactory neuron fluorescence is lost from the third segment in
antennae from acj66 mutant males
containing the 7.4 kb Cha-Gal4/UAS-GFP reporter. The
second segment fluorescence appears normal. C, Nearly
all fluorescence is absent from the third segment of antennae from
lz3 mutants, and the segment is
smaller than that of acj66 or
wild-type flies. The second segment fluorescence appears normal.
D, Nearly all third segment fluorescence is lost in
wild-type flies containing a 1.2 kb Cha-Gal4/UAS-GFP
fluorescent reporter system. The second segment fluorescence appears
relatively normal. E, Most primary olfactory neurons in
maxillary palps from wild-type flies containing a 7.4 kb
Cha-Gal4/UAS-GFP reporter system are fluorescent. We
count 97 ± 1 (SEM; n = 5) cholinergic
fluorescent neurons. F, The number and intensity of
cholinergic fluorescent olfactory neurons are reduced in maxillary
palps from acj66 mutant males.
G, The number and intensity of cholinergic fluorescent
olfactory neurons are reduced in maxillary palps from
lz3 mutant males. H,
Nearly all cholinergic fluorescence is absent from maxillary palps from
wild-type flies containing the 1.2 kb Cha-Gal4/UAS-GFP
reporter system. All antennae are viewed from the dorsal surface
with distal to the left and medial up.
Scale bar, 50 µm.
|
|
When the complete 7.4 kb Cha-Gal4 reporter line is
recombined with the acj66 null mutation,
GFP expression in the third antennal segment (Fig. 4B) and maxillary palps (Fig. 4F)
is reduced dramatically. There was a consistently greater reduction in
fluorescence of antennal neurons compared with maxillary palp neurons,
suggesting that different regulatory machinery for cholinergic
expression may exist in these two olfactory sensory organs.
Interestingly, the second antennal segment mechanosensory chordotonal
neurons, associated with Johnston's organ, show normal fluorescence in
acj66 mutants (Fig. 4B).
Expression of the cholinergic locus in the neurons of the second
antennal segment thus does not depend on acj6.
We also genetically recombined the 7.4 kb Cha-Gal4
cholinergic reporter line with a strong lozenge mutant
allele lz3. The lz gene encodes
a Zn finger transcription factor important for the development of eyes
(Daga et al., 1996 ; Flores et al., 1998 , 2000 ) and olfactory organs
(Riesgo-Escovar et al., 1997a ,b ). In
lz3 mutants, the basiconic sensilla, one
of the three different types of olfactory sensilla, are missing from
the third antennal segment and the maxillary palps (Lienhard and
Stocker, 1991 ; Ray and Rodrigues, 1995 ) because these structures,
including their associated neurons, fail to develop. Cholinergic
fluorescence in antennae from lz3 mutant
males (Fig. 4C) shows an even greater loss of fluorescence than that seen in acj66 mutants. Maxillary
palp fluorescence is also significantly reduced in
lz3 mutants (Fig. 4G). The
antennae and maxillary palps from lz3
mutants are smaller than wild type, and the decrease in cholinergic fluorescence can be explained by the complete loss of basiconic sensilla, including their associated cholinergic neurons (Lienhard and
Stocker, 1991 ; Ray and Rodrigues, 1995 ).
Our previous characterization of the cholinergic locus
regulatory DNA indicated that 1.2 kb of 5' flanking sequence was
not sufficient to drive reporter gene expression in PNS
olfactory neurons (Kitamoto et al., 1995 ). We confirmed this by
constructing 1.2 kb Cha-Gal4 driver lines and observing
fluorescence in antennae and maxillary palps when recombined with a
UAS-GFP responder line. Nearly all fluorescence is lost from the third
antennal segment (Fig. 4D) or maxillary palps (Fig.
4H) in a wild-type genetic background. The
cholinergic locus 5' flanking DNA thus contains an important positive
regulatory element(s) required for expression in olfactory neurons that
are upstream of the proximal 1.2 kb of 5' flanking DNA.
Insect antennal lobes are the primary olfactory association
centers in the CNS and can be subdivided into structural units termed
glomeruli (Homberg et al., 1989 ; Boeckh and Tolbert, 1993 ). Glomeruli
are neuropile regions made up of axon projections of olfactory neurons
originating in the third antennal segment and maxillary palps along
with antennal lobe interneuron projections (Stocker et al., 1983 ; Gao
et al., 2000 ). Drosophila antennal lobe neuropile, primary
olfactory neurons, and antennal lobe interneurons are all enriched in
cholinergic elements (Yasuyama et al., 1995 ; Salvaterra and Kitamoto,
2001 ). We examined the cholinergic fluorescence in antennal lobes of
acj66 and lz3
mutants and compared the patterns with wild type as shown in Figure
5. As expected, we saw a dramatic
reduction of cholinergic fluorescence in subsets of glomeruli in the
antennal lobes of both mutants. The decreased cholinergic fluorescence
in acj66 mutant antennal lobes is likely
to result entirely from the decreased fluorescence in primary olfactory
cholinergic neurons because the fluorescent population of cholinergic
antennal lobe interneurons appears similar to that of wild type (Fig.
5A,B). In contrast, the decrease in
lz3 antennal lobe cholinergic fluorescence
is a result of both a loss of olfactory neurons and a decrease in
fluorescent antennal lobe interneurons (Fig. 5C). We do not
know whether the normal population of cholinergic antennal lobe
interneurons is missing in lz3 mutants or
whether the neurons are present but fail to express the reporter
gene.

View larger version (133K):
[in this window]
[in a new window]
|
Figure 5.
Cholinergic neuropile fluorescence is decreased in
antennal lobes of acj66 mutant males.
Brains were dissected from the heads of adult male flies containing the
7.4 kb Cha-Gal4/UAS-GFP fluorescent cholinergic reporter
gene system and imaged using confocal microscopy. Stacks of Z sections
were collected, and 2D projections were constructed to provide an
extended depth of focus. A, The pattern of cholinergic
fluorescence in wild-type flies. Several antennal lobe glomeruli show
high levels of cholinergic fluorescence made up of a combination of
elements projecting from the primary olfactory neurons of the third
antennal segments and maxillary palps as well as the projections of
fluorescent cholinergic antennal lobe interneurons (*). The
arrowheads indicate the roots of the antennal nerves.
B, Fluorescence of antennal lobe glomerular structures
in acj66 mutant males is less
distinct, probably caused by the reduction or absence of cholinergic
fluorescence in primary olfactory neurons, because the fluorescence of
the antennal lobe cholinergic interneurons appears relatively normal.
Note the absence of fluorescence in the antennal nerve root.
C, The antennal lobe fluorescence pattern is absent or
very indistinct in lz3 mutant brain.
Glomerular organization of fluorescence is not visible, and the number
of fluorescent antennal lobe interneurons is dramatically reduced. All
antennal lobes are viewed from the anterior with dorsal
up. Scale bar, 50 µm.
|
|
Acj6 is expressed during all developmental stages of
Drosophila (embryo, larval, pupal, and adult) (Treacy et
al., 1991 ; Turner 1996 ), and larvae exhibit defective olfactory
behavior (Ayer et al., 1991 ). We evaluated the pattern of cholinergic
fluorescent reporter gene expression in the larval
olfactory organ, the antennomaxillary complex (AMC) (Park et al.,
1997 ). As shown in Fig. 6, the strong cholinergic GFP expression in wild-type AMC neurons is significantly reduced in acj66 mutants. Acj6 function is
thus also necessary for larval olfactory expression of the cholinergic
locus.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 6.
Cholinergic neuron fluorescence is decreased in
larval primary olfactory neurons from
acj66 mutants. Whole intact male third
instar larvae containing the 7.4 kb Cha-Gal4/UAS-GFP
fluorescent cholinergic reporter gene system were imaged using
wide-field fluorescence microscopy. Stacks of Z sections were
collected, and 2D projections were constructed to provide an extended
depth of focus. A, Cholinergic fluorescence is observed
in neurons of the antennomaxillary complex of wild-type larvae
(arrowhead) as well as neurons associated with external
sensory organs. Individual neurons are obscured by the intensity of
fluorescence in the antennomaxillary complex. Note that the dendrites
extending into the dorsal organ (*) are visible, as well as the
antennal nerve (arrow). B, The
cholinergic fluorescence is decreased significantly in antennomaxillary
complex neurons of acj66 larvae
(arrowhead). Other fluorescent cholinergic neurons
(associated with external sensory organs) appear relatively normal.
Larvae are viewed from the dorsal surface with anterior at the
bottom. Scale bar, 40 µm.
|
|
Acj6 binds to a specific motif present in the cholinergic
regulatory DNA
Acj6 function is necessary for the normal expression of the
cholinergic locus and may act either directly, as a transcriptional regulator of the locus, or indirectly, through regulation of other intermediate genes. We next studied the interaction of Acj6 protein with putative binding sites in the cholinergic locus 5' flanking DNA.
No direct DNA binding motifs in regulatory elements are known for
Drosophila Acj6 protein. Acj6, however, is a homolog of the vertebrate class IV POU proteins of the Brn3 family and contains a POU
specific domain and a POU homeodomain with extensive
homology to Brn3a, b, and c (Gerrero et al., 1993 ; Xiang et al., 1993 ). Because Brn3 DNA binding motifs have been studied extensively (Turner
et al., 1994 ), we scanned the cholinergic locus 5' flanking DNA for
similar motifs. Initially we concentrated on a region of the
cholinergic locus 5' flanking DNA known to be important for expression
in peripheral sensory olfactory neurons (Kitamoto et al., 1995 ). This
region is in the distal part of a 3.3 kb DNA fragment because deletion
of the 5' flanking DNA to 1.2 kb eliminates reporter gene expression in
olfactory neurons (Kitamoto et al., 1995 ) (Fig.
4D,H). It is likely,
therefore that any direct interaction of Acj6 protein with cholinergic
regulatory DNA important for olfactory neuron expression will be
localized upstream of the 1.2 kb 5' flanking DNA. We identified seven
candidate binding motifs (designated A-G) (Fig.
7A) on the basis of the fact
that they contained either of two core elements (ATAATT or ATAAAT) identified in the two known Brn3 binding motifs, ATAATTAAT
(Gruber et al., 1997 ) and GCATAAATAAT (Thompson et al.,
1987 ; Gerrero et al., 1993 ; Turner et al., 1994 ). Nineteen to
twenty-two base oligonucleotides, representing these core sequences
along with their flanking bases, were synthesized and tested for their
ability to bind recombinant Acj6 protein. Only motif D showed strong
specific binding with Acj6 recombinant protein as shown in Figure
7B(a). Figure 7 also shows the absence of Acj6 binding to
motif B, which is representative of the six negative sites tested.
Specificity of Acj6 binding to motif D was established by competitive
inhibition using unlabeled oligonucleotide [Fig. 7B(b)]
and tested further by constructing clustered point mutations in the
target oligonucleotide D [Fig. 7B(c)]. As expected,
binding was abolished when the core sequence was mutated [Fig.
7B(c), cm]. Mutations introduced into the 5' or
3' flanking bases of motif D have little or no effect on Acj6 binding
[Fig. 7B(c)]. These results show that Acj6 protein can
interact directly with a specific site in the cholinergic locus
regulatory DNA and suggest that Acj6 may function as a direct transcriptional regulator of the cholinergic locus in peripheral sensory olfactory neurons.

View larger version (61K):
[in this window]
[in a new window]
|
Figure 7.
Acj6 protein binds to a motif in the 5' flanking
DNA of the cholinergic locus. Shown is a schematic drawing of the
~3.3 kb of 5' flanking DNA upstream of the Drosophila
cholinergic locus. Regulatory elements necessary for CNS specific
expression are located in the proximal 1.2 kb of 5' flanking DNA
(black), whereas those necessary for expression in PNS
olfactory neurons are thought to be located in the distal part
(3.3-1.2 kb; gray). The relative positions of the seven
different motifs tested for their ability to bind recombinant Acj6
protein are indicated as small boxes along the
line. Motifs that did not bind Acj6 protein are shown in
gray, and positive motif D is indicated in
black. The arrow indicates the
transcription start site for the locus. B,
Electrophoretic gel mobility shift assay. Synthetic oligonucleotides
complementary to seven different 19-22 base sequences were end labeled
with 32P and tested for binding to recombinant Acj6 protein
containing the POU homeodomain and POU specific domain responsible for
DNA recognition. Only motif D (GACTTGAATAAATTAAAACTTT) showed a shifted
band indicated by the arrowhead [(a),
lane 2]. Motif B (ATAAGACATAATTGACAATGGA) is included
on the same gel as an example of the six negative motifs tested
(lane 1). A consensus Brn3.0 motif (TGCATAATTAATTAC) was
also tested as a positive control. The shifted band is weaker than that
seen for motif D and appears to run slightly faster (lane
3). No bands were shifted when Acj6 protein was eliminated from
the reaction (lanes 4, 5, and
6). In (b),
32P-labeled motif D binding to Acj6 can be competitively
inhibited by addition of increasing amounts of unlabeled
oligonucleotide (0×, 0.4×, 4×, or 40× fold concentration). Panel
(c) shows that clustered point mutations introduced into
the core residues of motif D (cm,
GACTTGAACGGGCCAAAACTTT, underlined base
changes) lose their ability to compete with 32P-labeled
motif D. In contrast, changes in the 5' flanking bases
(5m, TGACCTAATAAATTAAAACTTT or the 3'
flanking bases (3m, GACTTGAATAAATTAAGGACCC)
retain the ability to compete with 32P-labeled motif D. Mutant oligonucleotides were tested at 12× and 350× molar
excess.
|
|
Transgenic expression of Acj6
We have used the Gal4 expression system (Brand and Perrimon, 1993 )
to investigate whether transgenic overexpression of Acj6 in wild-type
flies is sufficient to increase expression of the cholinergic locus.
Transgenic lines carrying a UAS responder gene coding for either of two
different Acj6 isoforms were tested (Certel et al., 2000 ). The isoforms
differ primarily by the absence [UAS-acj6 (1,4)] or
presence [acj6 (1,3,4)] of an exon 3 coding for POU IV box
characteristic of this class of POU domain genes (Herr and Cleary,
1995 ; Latchman, 1999 ; Certel et al., 2000 ). Expression either was
driven in all of the cholinergic neurons by recombination with the 7.4 kb Cha-Gal4 driver or was restricted to olfactory neurons by
recombination with the GH86-Gal4 driver (Heimbeck et al., 1999 ). ChAT
activity was measured in recombinants, and the results are presented in
Table 1. Gal4 driver-dependent expression of UAS-Acj6 isoforms was confirmed by RT-PCR analysis (data not shown).
Expression of the Acj6 (1,3,4) isoform in all types of cholinergic
neurons resulted in a small but statistically significant increase in
ChAT activity (~10%). Surprisingly, expression of the Acj6 (1,4)
isoform with the same cholinergic driver resulted in third instar
larval or late pupal lethality. The reason for lethality is unknown but
may be related to misregulation of the cholinergic locus (or other
genes) in cholinergic neurons. The same Acj6 (1,4) isoform has been
shown to inhibit terminal branching and synapse formation when
ectopically expressed in motor neurons (Certel et al., 2000 ). When
expression of either Acj6 isoform is restricted to antennal and
maxillary palp olfactory neurons using the GH86-Gal4 driver, we
observed no significant changes in ChAT activity (Table 1). These
results suggest that overexpression of these two Acj6 isoforms in
cholinergic olfactory neurons is not sufficient to alter expression of
the cholinergic locus in olfactory neurons but may be able to alter
expression in a population of unidentified cholinergic neurons. In
addition, there is a clear difference in the function of Acj6 isoforms
when they are over or misexpressed in all cholinergic neurons.
 |
DISCUSSION |
Acj6 function is necessary for proper expression of the cholinergic
locus in primary olfactory neurons
The principal conclusion of this study is that the
Drosophila class IV POU domain transcription factor Acj6 is
required for normal expression of the cholinergic gene locus in primary
olfactory neurons. Evidence supporting this conclusion comes primarily
from genetic experiments demonstrating a reduction in cholinergic locus expression in animals carrying mutations in the acj6 gene.
We have documented a decrease in ChAT enzyme activity and protein, a
substantial decrease in antennal ChAT-specific mRNA, and a loss of
fluorescent cholinergic reporter gene expression in olfactory neurons
of antennae and maxillary palps of acj6 mutants. The
decrease in cholinergic locus expression is proportional to the level
of Acj6 function because ChAT activity is decreased more in an
acj66 null genetic background than in an
acj61 hypomorphic background (Clyne et
al., 1999a ) (Fig. 1). The reduction of ChAT mRNA in antennae from
acj66 mutants (Fig. 2) is consistent with
a decrease in transcription. The decrease in locus expression is not
complete because some residual fluorescence is observed in antennal,
maxillary palp neurons as well as in larval and embryonic (data not
shown) olfactory neurons. Perhaps there are redundant transcriptional
regulators expressed in some types of olfactory neurons, or
alternatively, some types of cholinergic neurons may be only partly
dependent on Acj6 for locus expression.
Acj6 does not regulate the cholinergic locus in all types of
cholinergic neurons. There are at least three classes of cholinergic neurons that can be distinguished relative to Acj6 function. First are
those that are dependent on Acj6, such as most primary olfactory neurons. Eighty-four of the 120 total maxillary palp olfactory neurons
express Acj6 (Clyne et al., 1999a ), whereas we estimate ~97 are
cholinergic (data not shown) and show reduced or absent expression in
acj66 mutants. Second are neurons that are
independent of Acj6, such as the second antennal segment mechanosensory
neurons, which do not express Acj6 and show no change in cholinergic
fluorescence in acj66 mutants. Third are
neurons that express Acj6 but maintain cholinergic expression even in
acj66 mutants, such as the larval SP
interneurons (Certel et al., 2000 ). There is also likely to be some
overlap in the cholinergic central complex, antennal lobe, and optic
lobe interneurons, because all of these regions have numerous
Acj6-positive (Certel et al., 2000 ) and cholinergic neurons (Yasuyama
and Salvaterra, 1999 ). In addition, acj66
null mutants are viable (Clyne et al., 1999a ), whereas loss-of-function mutations in either product of the cholinergic locus (the
Cha or Vacht genes) are late embryo or early
larval lethal (Greenspan, 1980 ; Kitamoto et al., 2000 ). Thus the
reduction in ChAT enzyme activity, protein, mRNA, and fluorescent
cholinergic reporter expression seen in acj6 mutants is
likely attributed to the dependence of cholinergic locus expression on
Acj6 function only in nonessential cholinergic neurons, such as the
primary olfactory neurons.
Two major possibilities could account for the reduction in cholinergic
fluorescence in olfactory neurons from
acj66 mutants. One is a loss of olfactory
cholinergic neurons themselves and the other is a loss of cholinergic
reporter gene expression. Olfactory sensilla house olfactory neurons as
well as associated support cells (Stocker, 1994 ; Riesgo-Escovar et al.,
1997a ,b ; Clyne et al., 1999b ; Vosshall et al., 1999 ). Mutant
acj66 males show no significant sensillar
phenotype and appear to contain a normal number of primary olfactory
neurons (Ayer et al., 1991 ; Clyne et al., 1999a ), making the latter
possibility most likely. In addition, lz3
mutants fail to develop neurons of basiconic sensilla, have a reduced
number of trichoid sensilla (Stocker and Gendre, 1988 ; Stocker et al.,
1993 ; Riesgo-Escovar et al., 1997a ,b ), and show a nearly complete
absence of cholinergic fluorescence in their smaller olfactory organs
(Fig. 4C,G). Our results indicate that cholinergic neurons are associated with these two major types of sensilla.
The AMC houses the embryonic and larval olfactory neurons (Stocker,
1994 ), and we see a dramatic reduction in cholinergic fluorescence in
acj66 mutants (Fig. 6). Interestingly, AMC
neurons are among the first to show a cholinergic fluorescence (data
not shown) and are the first neurons in which Acj6 expression is
detected (Certel et al., 2000 ). The expression of Acj6 and ChAT
activity also parallels each other during embryonic development
(Carbini et al., 1990 ; Certel et al., 2000 ).
A reduction in cholinergic locus expression could account for
acj66
A decrease in expression of the cholinergic locus is likely to
modify synaptic neurotransmission between the primary olfactory cholinergic neurons and the antennal lobes in the brain. This could
easily explain the failure of acj66 mutant
adults and larvae to behaviorally respond to many types of odors (Ayer
et al., 1991 ; Certel et al., 2000 ). Most, but not all, odors result in
abnormal behavioral responses in acj66
mutants (Clyne et al., 1999a ). Perhaps the loss of cholinergic locus
expression is not complete in all affected neurons, or alternatively, there could be small populations of cholinergic or noncholinergic neurons not affected by the acj66
mutation, because we see a small amount of residual cholinergic fluorescence in olfactory organs.
It is harder to explain the defective cellular physiology observed in
primary olfactory neurons of acj66 mutants
(Clyne et al., 1997 ; Clyne et al., 1999a ), because reduced cholinergic
expression may not be expected to affect the intrinsic membrane
responsive properties of these neurons. Expression of a few types of
olfactory receptor genes are lost in acj66
mutants (Clyne et al., 1999b ). It is not known, however, whether the
loss of receptor expression is a direct or indirect consequence of
mutant Acj6 function. Acj6 could play a direct role by binding to
regulatory sequences of particular olfactory receptor genes, but such a
possibility has not been demonstrated. As an alternative explanation,
disruption of synaptic transmission between cholinergic olfactory
sensory neurons and the CNS could result in indirect changes in
olfactory receptor gene expression through a feedback mechanism
dependent on normal synaptic transmission. Such an activity-dependent positive feedback mechanism has been proposed to account for the loss
of cholinergic expression in Drosophila
temperature-sensitive mutants (Tajima and Salvaterra, 1992 ) and has
been well documented in stress-related effects on catecholaminergic
gene expression (for review, see Sabban and Kvetnansky, 2001 ). This
type of feedback mechanism could perhaps better account for the rather
extensive changes in olfactory physiology in
acj66 mutants because most of the neurons
are cholinergic, but individual neurons express only one or a few
different olfactory receptor genes (Clyne et al., 1999a ; Vosshall et
al., 1999 ; Vosshall, 2000 ).
In addition to olfactory defects, acj6 mutants also show
reduced locomotor activity (Certel et al., 2000 ). This phenotype is
thought to result from defective neurons in the central complex, a
region of the CNS believed to regulate locomotor function. Reduced locomotor activity is also a phenotype of Cha mutants
(Greenspan, 1980 ), and transgenic animals expressing low levels of
choline acetyltransferase activity show reduced locomotion (Kitamoto
and Salvaterra, 1995 ; Yasuyama et al., 1995 ). Perhaps Acj6 is also involved in regulating cholinergic locus expression in an unidentified subset of CNS cholinergic neurons.
Acj6 binds to a specific motif in the cholinergic locus 5'
regulatory DNA
We have identified a particular motif that binds recombinant Acj6
protein and thus propose that it is a direct transcriptional regulator
of the cholinergic locus. This is the first reported binding motif for
Acj6 present in a DNA regulatory element and confirms that it is
closely related to the known binding motifs of Brn3 (Gerrero et al.,
1993 ; Xiang et al., 1993 ; Turner, 1996 ; Gruber et al., 1997 ). The Acj6
binding motif is present in a position consistent with its proposed
importance in regulating the locus in olfactory neurons. Cholinergic
reporter gene constructs are only expressed in olfactory neurons when
they contain upstream DNA sequences of 1.2 kb of 5' flanking DNA
(Kitamoto et al., 1992 ).
The vertebrate (Brn3 family) and nematode (UNC-86) proteins, most
homologous to Acj6, are important for specifying many types of
differentiated neurons and have been studied most extensively in
sensory neurons (Finney et al., 1988 ; Gerrero et al., 1993 ; Xiang et
al., 1993 , 1997 ; Latchman, 1999 ). Although regulation of cholinergic
locus expression has not been investigated directly in Brn3
or Unc-86 mutants, at least one form of Brn3 regulates expression of a particular type of nicotinic cholinergic receptor (Milton et al., 1996 ). Thus there may be some evolutionarily conserved aspects of cholinergic gene regulation.
Class IV POU domain transcriptional regulators have been studied
extensively in vertebrates, and their versatility makes them ideally
suited to regulate diverse cellular phenotypes (for review, see
Schonemann et al., 1998 ; Latchman, 1999 ; Phillips and Luisi, 2000 ).
They interact with specific but divergent DNA sequences, can activate
or inhibit target genes, and can form hetero- or homomultimers.
Additional versatility comes from alternatively spliced isoforms. When
we express the Acj6 (1,4) isoform in all cholinergic neurons, the
result is lethality. In contrast, expression of Acj6 (1,3,4) results in
a modest increase in ChAT activity. The difference between these
isoforms is the presence of exon 3 in the latter, which contributes to
the structure of the characteristic POUIV box (Certel et al., 2000 ).
This result emphasizes the differential functional activity provided by
the POU IV box (Morris et al., 1994 ; Turner t al., 1994 ; Certel et al.,
2000 ). It is also likely that the increase in ChAT activity seen with
the Acj6 (1,3,4) isoform is not restricted to olfactory cholinergic
neurons because the olfactory neuron-specific GH86-Gal4 expression did
not increase cholinergic locus expression. Other unknown regulatory
factors may thus be necessary to positively regulate cholinergic locus expression in olfactory neurons. Perhaps these are non-DNA binding coregulators such as those known to help establish their specificity and transcriptional readout of vertebrate POU domain proteins (Latchman, 1999 ). Interestingly, besides Acj6, two other
Drosophila POU transcriptional regulators have been
implicated in neurotransmitter phenotype specification (Johnson et al.,
1989 ; Johnson and Hirsh, 1990 ; Kitamoto and Salvaterra, 1995 ). Future
studies in Drosophila and other species will be required to
identify other neurotransmitter-related genes regulated by POU domain
transcription factors and particular transcriptional coregulators
necessary for their specificity.
 |
FOOTNOTES |
Received Jan. 16, 2002; revised April 4, 2002; accepted April 10, 2002.
This work was supported by grants from National Institutes of
Health-National Institute of Neurological Disorders and Stroke and the
John Douglas French Foundation for Alzheimer's Research. We thank Dr.
E. Turner for providing recombinant Acj6 protein, Drs. P. Clyne and
J. R. Carlson for acj6 mutants, and Dr. Wayne Johnson for the UAS-acj6 and GH86-Gal4 lines. We also
thank R. Williamson for generously providing expert genetic advice,
Drs. T. Kitamoto, S. Song, and N. Bournias-Vardiabasis for helpful discussions, and Elvia Guiterrez for excellent technical assistance.
Correspondence should be addressed to Paul M. Salvaterra, Division of
Neuroscience, Beckman Research Institute of the City of Hope, 1450 East
Duarte Road, Duarte, CA 91010. E-mail: psalv{at}coh.org.
 |
REFERENCES |
-
Alfonso A,
Grundahl K,
Duerr JS,
Han HP,
Rand JB
(1993)
The Caenorhabditis elegans unc-17 gene: a putative vesicular acetylcholine transporter.
Science
261(5121):617-619[Abstract/Free Full Text].
-
Ayer Jr RK,
Carlson J
(1991)
acj6: a gene affecting olfactory physiology and behavior in Drosophila.
Proc Natl Acad Sci USA
88:5467-5471[Abstract/Free Full Text].
-
Ayer Jr RK,
Carlson J
(1992)
Olfactory physiology in the Drosophila antenna and maxillary palp: acj6 distinguishes two classes of odorant pathways.
J Neurobiol
23:965-982[Web of Science][Medline].
-
Benveniste RJ,
Taghert PH
(1999)
Cell type-specific regulatory sequences control expression of the Drosophila FMRF-NH2 neuropeptide gene.
J Neurobiol
38:507-520[Web of Science][Medline].
-
Berse B, I.,
Lopez-Coviella I,
Blusztajn JK
(1999)
Activation of TrkA by nerve growth factor upregulates expression of the cholinergic gene locus but attenuates the response to ciliary neurotrophic growth factor.
Biochem J
342:301-308.
-
Boeckh J,
Tolbert LP
(1993)
Synaptic organization and development of the antennal lobe in insects.
Microsc Res Tech
24:260-280[Web of Science][Medline].
-
Brand AH,
Perrimon N
(1993)
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
-
Carbini LA,
Muno Zmaines VJ,
Salvaterra PM
(1990)
Developmental expression of choline acetyltransferase mRNA in Drosophila.
Neurochem Res
15:1089-1096[Web of Science][Medline].
-
Certel SJ,
Clyne PJ,
Carlson JR,
Johnson WA
(2000)
Regulation of central neuron synaptic targeting by the Drosophila POU protein, Acj6.
Development
127:2395-2405[Abstract].
-
Clyne P,
Grant A,
O'Connell R,
Carlson JR
(1997)
Odorant response of individual sensilla on the Drosophila antenna.
Invert Neurosci
3:127-135[Medline].
-
Clyne PJ,
Certel SJ,
de Bruyne M,
Zaslavsky L,
Johnson WA,
Carlson JR
(1999a)
The odor specificities of a subset of olfactory receptor neurons are governed by Acj6, a POU-domain transcription factor.
Neuron
22:339-347[Web of Science][Medline].
-
Clyne PJ,
Warr CG,
Freeman MR,
Lessing D,
Kim J,
Carlson JR
(1999b)
A novel family of divergent seven-transmembrane proteins: candidate odorant receptors in Drosophila.
Neuron
22:327-338[Web of Science][Medline].
-
Daga A,
Karlovich CA,
Dumstrei K,
Banerjee U
(1996)
Patterning of cells in the Drosophila eye by Lozenge, which shares homologous domains with AML1.
Genes Dev
10:1194-1205[Abstract/Free Full Text].
-
De Gois S,
Houhou L,
Oda Y,
Corbex M,
Pajak F,
Thevenot E,
Vodjdani G,
Mallet J,
Berrard S
(2000)
Is RE1/NRSE a common cis-regulatory sequence for ChAT and VAChT genes?
J Biol Chem
275:36683-36690[Abstract/Free Full Text].
-
Eberl DF,
Hardy RW,
Kernan MJ
(2000)
Genetically similar transduction mechanisms for touch and hearing in Drosophila.
J Neurosci
20:5981-5988[Abstract/Free Full Text].
-
Erickson JD,
Varoqui H,
Schafer MK,
Modi W,
Diebler MF,
Weihe E,
Rand J,
Eiden LE,
Bonner TI,
Usdin TB
(1994)
Functional identification of a vesicular acetylcholine transporter and its expression from a cholinergic gene locus.
J Biol Chem
269:21929-21932[Abstract/Free Full Text].
-
Finney M,
Ruvkun G,
Horvitz HR
(1988)
The C. elegans cell lineage and differentiation gene unc-86 encodes a protein with a homeodomain and extended similarity to transcription factors.
Cell
55:757-769[Web of Science][Medline].
-
Flores GV,
Daga A,
Kalhor HR,
Banerjee U
(1998)
Lozenge is expressed in pluripotent precursor cells and patterns multiple cell types in the Drosophila eye through the control of cell-specific transcription factors.
Development
125:3681-3687[Abstract].
-
Flores GV,
Duan H,
Yan H,
Nagaraj R,
Fu W,
Zou Y,
Noll M,
Banerjee U
(2000)
Combinatorial signaling in the specification of unique cell fates.
Cell
103:75-85[Web of Science][Medline].
-
Fonnum F
(1975)
A rapid radiochemical method for the determination of choline acetyltransferase.
J Neurochem
24:407-409[Web of Science][Medline].
-
Gao Q,
Yuan B,
Chess A
(2000)
Convergent projections of Drosophila olfactory neurons to specific glomeruli in the antennal lobe.
Nat Neurosci
3:780-785[Web of Science][Medline].
-
Gerrero MR,
McEvilly RJ,
Turner E,
Lin CR,
O'Connell S,
Jenne KJ,
Hobbs MV,
Rosenfeld MG
(1993)
Brn-3.0: a POU-domain protein expressed in the sensory, immune, and endocrine systems that functions on elements distinct from known octamer motifs.
Proc Natl Acad Sci USA
90:10841-10845[Abstract/Free Full Text].
-
Greenspan RJ
(1980)
Mutations of choline acetyltransferase and associated neural defects in Drosophila melanogaster.
J Comp Physiol
137:83-92.
-
Gruber CA,
Rhee JM,
Gleiberman A,
Turner EE
(1997)
POU domain factors of the Brn-3 class recognize functional DNA elements which are distinctive, symmetrical, and highly conserved in evolution.
Mol Cell Biol
17:2391-2400[Abstract].
-
Hahm SH,
Chen L,
Patel C,
Erickson J,
Bonner TI,
Weihe E,
Schafer MK,
Eiden LE
(1997)
Upstream sequencing and functional characterization of the human cholinergic gene locus.
J Mol Neurosci
9:223-236[Web of Science][Medline].
-
Harlow E,
Lane D
(1988)
In: Antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Heimbeck G,
Bugnon V,
Gendre N,
Haberlin C,
Stocker RF
(1999)
Smell and taste perception in Drosophila melanogaster larva: toxin expression studies in chemosensory neurons.
J Neurosci
19:6599-6609[Abstract/Free Full Text].
-
Herr W,
Cleary MA
(1995)
The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain.
Genes Dev
9:1679-1693[Free Full Text].
-
Homberg U,
Christensen TA,
Hildebrand JG
(1989)
Structure and function of the deutocerebrum in insects.
Annu Rev Entomol
34:477-501[Web of Science][Medline].
-
Johnson WA,
Hirsh J
(1990)
Binding of a Drosophila POU-domain protein to a sequence element regulating gene expression in specific dopaminergic neurons.
Nature
343:467-470[Medline].
-
Johnson WA,
McCormick CA,
Bray SJ,
Hirsh J
(1989)
A neuron-specific enhancer of the Drosophila dopa decarboxylase gene.
Genes Dev
3:676-686[Abstract/Free Full Text].
-
Kitamoto T
(2001)
Conditional modification of behavior in Drosophila by targeted expression of a temperature-sensitive shibire allele in defined neurons.
J Neurobiol
47:81-92[Web of Science][Medline].
-
Kitamoto T,
Salvaterra PM
(1993)
Developmental regulatory elements in the 5' flanking DNA of the Drosophila choline acetyltransferase gene.
Roux's Arch Dev Biol
202:159-169.
-
Kitamoto T,
Salvaterra PM
(1995)
A POU homeodomain protein related to dPOU-19/pdm-1 binds to the regulatory DNA necessary for vital expression of the Drosophila choline acetyltransferase gene.
J Neurosci
15:3509-3518[Abstract].
-
Kitamoto T,
Ikeda K,
Salvaterra PM
(1992)
Analysis of cis-regulatory elements in the 5' flanking region of the Drosophila melanogaster choline acetyltransferase gene.
J Neurosci
12:1628-1639[Abstract].
-
Kitamoto T,
Ikeda K,
Salvaterra PM
(1995)
Regulation of choline acetyltransferase/lacZ fusion gene expression in putative cholinergic neurons of Drosophila melanogaster.
J Neurobiol
28:70-81[Web of Science][Medline].
-
Kitamoto T,
Wang W,
Salvaterra PM
(1998)
Structure and organization of the Drosophila cholinergic locus.
J Biol Chem
273:2706-2713[Abstract/Free Full Text].
-
Kitamoto T,
Xie X,
Wu CF,
Salvaterra PM
(2000)
Isolation and characterization of mutants for the vesicular acetylcholine transporter gene in Drosophila melanogaster.
J Neurobiol
42:161-171[Web of Science][Medline].
-
Latchman DS
(1999)
POU family transcription factors in the nervous system.
J Cell Physiol
179:126-133[Web of Science][Medline].
-
Lienhard MC,
Stocker RF
(1991)
The development of the sensory neuron pattern in the antennal disc of wild-type and mutant (lz3, ssa) Drosophila melanogaster.
Development
112:1063-1075[Abstract].
-
Lindsley DL,
Zimm GG
(1992)
In: The genome of Drosophila melanogaster. San Diego: Academic.
-
McKenna M,
Monte P,
Helfand SL,
Woodard C,
Carlson J
(1989)
A simple chemosensory response in Drosophila and the isolation of acj mutants in which it is affected.
Proc Natl Acad Sci USA
86:8118-8122[Abstract/Free Full Text].
-
Milton NG,
Bessis A,
Changeux JP,
Latchman DS
(1996)
Differential regulation of neuronal nicotinic acetylcholine receptor subunit gene promoters by Brn-3 POU family transcription factors.
Biochem J
317:419-423.
-
Morris PJ,
Theil T,
Ring CJ,
Lillycrop KA,
Moroy T,
Latchman DS
(1994)
The opposite and antagonistic effects of the closely related POU family transcription factors Brn-3a and Brn-3b on the activity of a target promoter are dependent on differences in the POU domain.
Mol Cell Biol
14:6907-6914[Abstract/Free Full Text].
-
Naciff JM,
Behbehani MM,
Misawa H,
Dedman JR
(1999)
Identification and transgenic analysis of a murine promoter that targets cholinergic neuron expression.
J Neurochem
72:17-28[Web of Science][Medline].
-
Park Y,
Caldwell MC,
Datta S
(1997)
Mutation of the central nervous system neuroblast proliferation repressor ana leads to defects in larval olfactory behavior.
J Neurobiol
33:199-211[Web of Science][Medline].
-
Phillips K,
Luisi B
(2000)
The virtuoso of versatility: POU proteins that flex to fit.
J Mol Biol
302:1023-1039[Web of Science][Medline].
-
Quinn JP,
Mendelson SC
(1995)
Transcriptional control of neuropeptide gene expression in sensory neurons, using the preprotachykinin-A gene as a model.
Can J Physiol Pharmacol
73:957-962[Web of Science][Medline].
-
Ray K,
Rodrigues V
(1995)
Cellular events during development of the olfactory sense organs in Drosophila melanogaster.
Dev Biol
167:426-438[Web of Science][Medline].
-
Riesgo-Escovar JR,
Piekos WB,
Carlson JR
(1997a)
The maxillary palp of Drosophila: ultrastructure and physiology depends on the lozenge gene.
J Comp Physiol [A]
180:143-150[Medline].
-
Riesgo-Escovar JR,
Piekos WB,
Carlson JR
(1997b)
The Drosophila antenna: ultrastructural and physiological studies in wild-type and lozenge mutants.
J Comp Physiol [A]
180:151-160[Medline].
-
Rubin GM,
Spradling AC
(1982)
Genetic transformation of Drosophila with transposable element vectors.
Science
218:348-353[Abstract/Free Full Text].
-
Sabban EL,
Kvetnansky R
(2001)
Stress-triggered activation of gene expression in catecholaminergic systems: dynamics of transcriptional events.
Trends Neurosci
24:91-98[Web of Science][Medline].
-
Sacchetti P,
Brownschidle LA,
Granneman JG,
Bannon MJ
(1999)
Characterization of the 5'-flanking region of the human dopamine transporter gene.
Brain Res Mol Brain Res
74:167-174[Medline].
-
Salvaterra PM,
Kitamoto T
(2001)
Drosophila cholinergic neurons and processes visualized with Gal4/UAS-GFP.
Gene Exp Patterns
1:73-82.
-
Schonemann MD,
Ryan AK,
Erkman L,
McEvilly RJ,
Bermingham J,
Rosenfeld MG
(1998)
POU domain factors in neural development.
Adv Exp Med Biol
449:39-53[Web of Science][Medline].
-
Siddiqi O
(1983)
In: Olfactory neurogenetics of Drosophila. New Delhi: Oxford and IBH.
-
Stocker RF
(1994)
The organization of the chemosensory system in Drosophila melanogaster: a review.
Cell Tissue Res
275:3-26[Web of Science][Medline].
-
Stocker RF,
Gendre N
(1988)
Peripheral and central nervous effects of lozenge3: a Drosophila mutant lacking basiconic antennal sensilla.
Dev Biol
127:12-24[Web of Science][Medline].
-
Stocker RF,
Singh RN,
Schorderet M,
Siddiqi O
(1983)
Projection patterns of different types of antennal sensilla in the antennal glomeruli of Drosophila melanogaster.
Cell Tissue Res
232:237-248[Web of Science][Medline].
-
Stocker RF,
Gendre N,
Batterham P
(1993)
Analysis of the antennal phenotype in the Drosophila mutant lozenge.
J Neurogenet
9:29-53[Web of Science][Medline].
-
Tajima Y,
Salvaterra PM
(1992)
Positive and negative feedback regulation of choline acetyltransferase mRNA levels in Drosophila: a study using temperature-sensitive mutants and embryo cell cultures.
Mol Brain Res
13:213-221[Medline].
-
Thompson RC,
Seasholtz AF,
Herbert E
(1987)
Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression.
Mol Endocrinol
1:363-370[Abstract/Free Full Text].
-
Treacy MN,
He X,
Rosenfeld MG
(1991)
I-POU: a POU-domain protein that inhibits neuron-specific gene activation.
Nature
350:577-584[Medline].
-
Turner EE
(1996)
Similar DNA recognition properties of alternatively spliced Drosophila POU factors.
Proc Natl Acad Sci USA
93:15097-15101[Abstract/Free Full Text].
-
Turner EE,
Jenne KJ,
Rosenfeld MG
(1994)
Brn-3.2: a Brn-3-related transcription factor with distinctive central nervous system expression and regulation by retinoic acid.
Neuron
12:205-218[Web of Science][Medline].
-
Usdin TB,
Eiden LE,
Bonner TI,
Erickson JD
(1995)
Molecular biology of the vesicular ACh transporter.
Trends Neurosci
18:218-224[Web of Science][Medline].
-
Vosshall LB
(2000)
Olfaction in Drosophila.
Curr Opin Neurobiol
10:498-503[Web of Science][Medline].
-
Vosshall LB,
Amrein H,
Morozov PS,
Rzhetsky A,
Axel R
(1999)
A spatial map of olfactory receptor expression in the Drosophila antenna.
Cell
96:725-736[Web of Science][Medline].
-
Xiang M,
Zhou L,
Peng YW,
Eddy RL,
Shows TB,
Nathans J
(1993)
Brn-3b: a POU domain gene expressed in a subset of retinal ganglion cells.
Neuron
11:689-701[Web of Science][Medline].
-
Xiang M,
Gan L,
Li D,
Zhou L,
Chen ZY,
Wagner D,
O'Malley Jr BW,
Klein W,
Nathans J
(1997)
Role of the Brn-3 family of POU-domain genes in the development of the auditory/vestibular, somatosensory, and visual systems.
Cold Spring Harb Symp Quant Biol
62:325-336[Abstract/Free Full Text].
-
Yasuyama K,
Salvaterra PM
(1999)
Localization of choline acetyltransferase-expressing neurons in Drosophila nervous system.
Microsc Res Tech
45:65-79[Web of Science][Medline].
-
Yasuyama K,
Kitamoto T,
Salvaterra PM
(1995)
Immunocytochemical study of choline acetyltransferase in Drosophila melanogaster: an analysis of cis-regulatory regions controlling expression in the brain of cDNA-transformed flies.
J Comp Neurol
361:25-37[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22135291-09$05.00/0
|