 |
Previous Article | Next Article 
The Journal of Neuroscience, July 1, 2002, 22(13):5536-5551
Atrial Natriuretic Peptide Type C Induces a Cell-Cycle Switch
from Proliferation to Differentiation in Brain-Derived Neurotrophic
Factor- or Nerve Growth Factor-Primed Olfactory Receptor
Neurons
P. Jeanette
Simpson1,
Ian
Miller1,
Cheil
Moon1,
Andrea L.
Hanlon1,
Daniel J.
Liebl3, and
Gabriele V.
Ronnett1, 2
Departments of 1 Neuroscience and
2 Neurology, The Johns Hopkins University School of
Medicine, Baltimore, Maryland 21205, and 3 Department of
Neurosurgery, The Miami Project to Cure Paralysis, University of Miami
School of Medicine, Miami, Florida 33136
 |
ABSTRACT |
With the discovery of postnatal stem cells within the brain, it has
become important to understand how extracellular factors might affect
the maturation of neuronal precursors in the postnatal brain.
Neurotrophic factors are known to play a role in neuronal development
but display pleiotrophic effects, in part because of their
physiological interactions with other factors. One factor positioned to
interact with neurotrophins in the brains of postnatal animals is
atrial C-type natriuretic peptide (CNP). In this study, we used
olfactory receptor neurons (ORNs) as a model, because their precursors
demonstrate the most robust and functional postnatal neurogenesis of
those systems thus far described. We examined the effects of
brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF)
and the interactions of these neurotrophins and CNP in postnatal
olfactory neuronal precursors. Results obtained using mice with
targeted deletion of the gene for BDNF indicated that BDNF is a
neuroproliferation-inducing and survival factor for ORN precursors.
These roles were confirmed in vitro using primary
cultures of ORNs. NGF was found to be a proliferation-inducing factor
but not a survival factor. The addition of CNP to either BDNF- or
NGF-treated neuronal precursors resulted in an inhibition of
proliferation and the promotion of maturation. These effects were
accompanied by changes in cell-cycle proteins that suggest possible
mechanisms for these effects. Thus, CNP may function in the postnatal
brain to regulate the exit from the cell cycle in neuronal precursor cells.
Key words:
olfactory receptor neurons; neurotrophins; neurogenesis; atrial natriuretic peptide type C; olfaction; cell cycle
 |
INTRODUCTION |
The discovery of stem cells in the
adult brain that can develop into mature neurons in vitro
suggests that postnatal neurogenesis could be used to repopulate
certain neuronal lineages (Shetty and Turner, 1998 , 1999 ). Many factors
have been implicated in neuronal precursor proliferation and
maturation, including neurotrophins, neuropeptides, and cytokines (Abe,
2000 ; Rosser et al., 2000 ). Although the proliferation of neuronal stem
cells can be induced in vitro by certain mitogens, the
factors that mediate differentiation remain unclear (Learish et al.,
2000 ; Miyazawa et al., 2000 ; Rosser et al., 2000 ). Identification of
factors that regulate the neuronal life cycle, specifically those that
modulate the maturation of neurons within the postnatal brain, is
critical to the application of stem cell therapy (Thomson et al., 1998 ;
Vogel, 1999 ; Edwards et al., 2000 ).
Atrial C-type natriuretic peptide (CNP) and its receptor, guanylyl
cyclase receptor type B (GC-B), are positioned to play a role in
prenatal and postnatal neurogenesis. CNP binds to GC-B to increase cGMP
production. CNP mRNA has been found in various regions in the postnatal
rat brain, notably in olfactory regions and in the hippocampus (Ryan
and Gundlach, 1998 ), and GC-B mRNA is detected in many brain regions,
including the limbic cortex, neocortex, olfactory bulb, hippocampus,
and amygdala (Herman et al., 1996 ). GC-B is found in the cerebral
cortex as early as embryonic day 16 (E16) (Brown and Zuo, 1995 ), a
stage during which cortical neurogenesis occurs (Bayer and Altman,
1995 ).
The roles of CNP and cGMP in the brain are unclear. Although CNP is
known for its role in fluid and electrolyte balance (Langub et al.,
1995 ), some work suggests a developmental role for this peptide in the
brain (Brown and Zuo, 1995 ). CNP as well as other atrial
natriuretic peptides antagonize mitogen-stimulated signaling pathways
and proliferation in fibroblasts and thymocytes (Vollmar et al., 1996 ;
Calderone et al., 1998 ; Chrisman and Garbers, 1999 ). CNP also inhibits
growth factor-dependent DNA synthesis in response to basic FGF,
epidermal growth factor (EGF), heparin-binding EGF-like growth
factor, and platelet-derived growth factor in smooth muscle cells, an effect that is mimicked by the application of 8-bromo-cGMP (Porter et al., 1992 ).
The peripheral olfactory system has long been recognized as a model of
postnatal neurogenesis, because it displays the most robust and
functional postnatal neurogenesis among neuronal populations that
maintain stem cells (Graziadei and Monti-Graziadei, 1978 , 1979 ). In
addition, neurogenesis is increased after lesioning of either the
olfactory bulb (termed bulbectomy) or the epithelium itself (Constanzo,
1984 ). The epithelium contains a mixed population of basal cells, basal
daughter cells, immature and mature olfactory receptor neurons (ORNs),
and sustentacular cells (Morrison and Costanzo, 1990a ,b ; Uraih and
Maronpot, 1990 ). Basal cells and their daughter cells generate the new
neurons that repopulate the olfactory epithelium (OE) throughout
life (Schultz, 1960 ; Graziadei and Monti-Graziadei, 1983 ; Morrison and
Moran, 1995 ; Calof et al., 1998 ; Huard et al., 1998 ). Here, we refer to
basal cells and their daughters as neuronal precursor cells.
Many factors involved in neurogenesis in the brain are also implicated
in prenatal and postnatal neurogenesis in the olfactory epithelium. CNP
is positioned to play a role in olfactory development, because GC-B
mRNA is abundant in the olfactory epithelium (Fulle et al., 1995 ). CNP
and GC-B are highly expressed in olfactory regions of the brain (Herman
et al., 1996 ; Ryan and Gundlach, 1998 ), suggesting a potential role for
CNP as a target-derived factor. In addition, BDNF, NGF, and their
receptors [tyrosine kinase (Trk) B, Trk A, and p75] are found
in the rodent olfactory epithelium in immature neurons and basal cells
(Roskams et al., 1996 ). Their expression is upregulated after
bulbectomy (Roskams et al., 1996 ; Buckland and Cunningham, 1998 ),
suggesting a potential role in postnatal ORN proliferation. Both
factors are able to stimulate c-fos when applied to ORNs in
culture (Roskams et al., 1996 ).
In this study, we have used the olfactory system as a model for
identifying factors that are involved in the switch from proliferation to maturation and in the survival of postnatal neuronal precursors. Mice with targeted deletion of the gene for BDNF were used to define
the role(s) of BDNF in olfactory neuroproliferation and survival.
Primary ORN cultures were used to confirm these results and to study
signaling mechanisms (Ronnett et al., 1991 ). The proliferation-inducing
role of NGF was also characterized. CNP and GC-B were localized in the
olfactory epithelium and bulb, and their ability to promote the
differentiation and survival of neurotrophin-treated ORNs was determined.
 |
MATERIALS AND METHODS |
Animals. All animal use procedures were in
strict accordance with institutional guidelines for the care and use of
laboratory animals at Johns Hopkins University. Transgenic C57BL/6 mice
heterozygous for BDNF deletions were obtained from the University of
Texas Southwestern Medical Center (Dallas, TX) (Liebl et al.,
1997 ). These mice were bred to obtain heterozygous BDNF +/ , wild-type (WT) +/+ breeding pairs. These breeding pairs were bred to produce BDNF
/ , +/+ pups. Mice were genotyped by PCR (94°C for 30 sec, 59°C
for 15 sec, and 72°C for 30 sec) using DNA obtained from tail
clippings. BDNF primer sequences are GGCGCCGAACCCTCATAGACAT, GACACTTTTGAGCACGTCATCGAAG, and CGCCTTCTTGACGAGTTCTTCTG.
Tissue preparation. BDNF / and WT pups destined for
immunohistochemistry were taken at postnatal day 0.5 (P0.5) and
decapitated. Incisions were made from the front of the cranium to the
base of the skull. The heads were then placed in either 4%
paraformaldehyde (PFA) in 0.1 M PBS, pH 7.4, or
Bouins' fixative overnight. For cryosectioning, tissues were then
washed three times in PBS for 1 hr each, cryoprotected by
incubating overnight with consecutive concentrations of sucrose (10 and
20%) in PBS, frozen in optimal cutting temperature compound,
and stored at 70°C until cryostat sectioning at 20°C. For
paraffin sections, tissue was washed as described above, dehydrated to
75% ethanol, and stored at 20°C until it was sent out for
commercial preparation of sections.
Primary culture of ORNs. Primary olfactory neurons were
prepared from neonatal rats as described previously (Ronnett et al., 1991 ) with few modifications. The tissue cultured was from 1- to
2-d-old WT rat pups. Cells were plated between 0.4 and 0.8 × 10 6
cells/cm2 in
MEM-D-Val (Invitrogen, Grand Island, NY)
supplemented with 15% dialyzed fetal bovine serum (dFBS) (Invitrogen)
without the addition of cytosine arabinoside or NGF. At 24 hr after
plating, medium was changed to 0.5% dFBS +/ treatments. BDNF was
used at a final concentration of 50 ng/ml, NGF at 25 ng/ml, and CNP at
50 nM prepared from a 10,000× stock diluted in
MEM-D-Val without supplements. The
mitogen-activated protein kinase (MAPK)/extracellular signal-regulated
kinase (ERK) kinase (MEK) inhibitor PD987059 was used at a final
concentration of 50 µM diluted from a 1000× stock solution prepared in DMSO. Cycloheximide (CHX) was used at a
final concentration of 15 µg/ml diluted from a 100× stock prepared
in water. Cells were harvested for immunochemistry as described below.
Immunohistochemistry. Paraffin sections were cleared of
paraffin by immersion in xylene and rehydrated through an ethanol series (100, 95 × 2, 70, 50% ethanol/water); cryosections were baked overnight at 37-42°C before processing for
immunohistochemistry. Immunohistochemistry was performed according to
the Vectastain Elite avidin-biotin complex (ABC) procedure (Vector
Laboratories, Burlingame, CA). Briefly, the sections were rinsed in
PBS, permeabilized in 0.1% PBS/Triton X-100 (PBST), blocked in
4% normal serum/1% BSA, and incubated with diluted antiserum at 4°C
overnight. The slides were rinsed in PBS and then incubated in
biotinylated secondary antibody for 30 min, followed by the ABC for 30 min. The peroxidase reaction was catalyzed using 3,3'-diaminobenzidine
tetrahydrochloride (DAB) and hydrogen peroxide as substrates.
Cryosections were rinsed in PBS and coverslipped in aqueous mounting
medium. Paraffin sections were dehydrated, cleared in xylene, and
coverslipped in Permount (Fisher Scientific, Fair Lawn, NJ).
Slides were viewed using a Zeiss (Thornwood, NY) Axiovert
microscope, and the images were captured digitally (Diagnostic
Instruments, Sterling Heights, MI).
Primary antibodies against the following antigens were diluted in PBS
as follows: neuron-specific tubulin (NST) (Babco, Richmond, CA),
1:1000; olfactory marker protein (OMP) (gift from Frank Margolis, University of Maryland School of Medicine, Baltimore, MD),
1:5000; and nestin (PharMingen, San Diego, CA), 1:500. Antibodies
against Ki67 (Immunotech, Marseilles, France) were diluted 1:50 in
high-salt 0.25% PBST. For staining of olfactory neuronal transcription
factor Olf-1 or O/E-1, GC-B, and CNP, a modified staining
protocol, as described by Suzuki et al. (2000) , was used to increase
accessibility of antigen to antibody. Antibodies to O/E-1 (gift from R. Reed, Johns Hopkins University School of Medicine, Baltimore,
MD), GC-B (a gift from K. Palczewski, University of Washington,
Seattle, WA), and CNP (Peninsula Laboratories, Belmont, CA) were
diluted 1:200, 1:500, and 1:7500, respectively, in 0.3% PBST. All of
these antibodies are available commercially or have been characterized previously for their specificity against their target antigens (Chinkers et al., 1989 ; Chinkers and Garbers, 1991 ).
Cell counts on immunostained tissue were performed on serial sections
from various regions throughout the sinus cavity. For O/E-1 cell
counting (and all cell counting analyses), all immunopositive cells
present in an entire coronal section were counted to avoid any bias in
results that might be generated by counting only certain regions of the
olfactory epithelium. Sections from null mice and their WT littermates
were matched for both size and depth within the olfactory region.
Staining and cell counting were performed on 6-10 sections per animal,
using two to three animals per genotype. Values are reported as either
the total mean ± SEM of each genotype or the mean ± SEM per
40× field of each genotype. Statistical significance was analyzed by
Student's t test using the Instat2 statistical
analysis program (GraphPad Software Inc., San Diego, CA).
Immunocytochemistry. Cells from primary ORN culture were
harvested at various times after treatment with neurotrophic factors and CNP. For harvesting, they were rinsed briefly with PBS, air-dried for 15-20 min, and fixed with Fixdenate (Roche Molecular
Biochemicals, Indianapolis, IN) for 30 min at room temperature.
After fixation, samples were washed with PBS and stored at 20°C
until use. For immunostaining, cells were washed in PBS, blocked in 4%
normal serum/3% BSA/PBS for 1 hr, and exposed to diluted 1° antibody at appropriate concentrations ( -NST, 1:1000; -OMP, 1:7500;
-Ki67, 1:500) in block solution overnight at 4°C. Cells were
washed the following day with PBS, treated with 1%
H2O2/PBS for 20 min,
blocked with 0.5% BSA/PBS for 20 min, and incubated with biotinylated 2° antibody for 1 hr at room temperature. Slides then went through a
second blocking step followed by incubation with ABC for 90 min at room
temperature. Detection was accomplished using a 3-amino, 9-ethyl-carbazole (AEC) peroxidase chromagen kit (Biomeda,
Foster City, CA).
For cell counts of primary cultured ORNs, three rows of five 40×
fields spaced evenly over the area of the slide were counted for each
well of treatment. Values are reported as the mean ± SEM per 40×
field per treatment. In some cases data have been normalized to WT
values to allow comparison of multiple experiments that differed
slightly in starting cell density. Cells counts were performed on two
wells per treatment from triplicate experiments. Statistical
significance was determined by ANOVA of all treatments followed when
applicable by Student's t test comparisons of individual treatments using the Instat2 statistical analysis program.
3'-terminal deoxynucleotidyl transferase-mediated biotinylated
UTP nick end labeling and NST/3'-terminal deoxynucleotidyl transferase-mediated biotinylated UTP nick end double labeling. Paraffin sections were cleared of paraffin by immersion in xylene and
rehydrated through an ethanol series (100, 95 × 2, 70, 50% ethanol/water); cryosections were baked overnight at 37-42°C before processing for terminal deoxynucleotidyl transferase (TdT)-mediated biotinylated UTP nick end labeling (TUNEL). Sections were then incubated in 0.1 M Tris-HCl, pH 8.0, for 10 min,
followed by proteinase K treatment (5 µg/ml)/0.1
M Tris, 0.5 M EDTA, pH 8.0, for 15 min at room temperature. Sections were then washed four times
for 3-5 min in Tris-HCl, pH 8.0, and positive control sections were treated with10 U/ml RNase-free DNase RQ1 dissolved in 30 mM Tris-HCl, pH 7.2, 140 mM
Na cacodylate, 4 mM MgCl2,
and 0.1 mM DTT. All sections were then washed and
treated with 1% H2O2/MeOH
for 5 min at room temperature. Sections were then washed in Tris-HCl, pH 7.2, and preincubated in TdT buffer (30 mM
Tris-HCl, pH 7.2, 140 mM Na cacodylate, and 1 mM CoCl2) for 10 min at
room temperature. Labeling was performed by the addition of TdT enzyme
(200-250 U/ml; Sigma, St. Louis, MO) and biotin-16-dUTP (1:100 1 mM stock) to TdT buffer and incubation of
sections in this solution for 3 hr at 37°C. A negative control
section was included by incubation in TdT buffer containing the
biotin-16-dUTP label but no enzyme. After labeling, sections were
washed in Tris-HCl, pH 7.2, and then blocked in 2% BSA/PBS for 30 min
at room temperature. Detection of biotin-16-dUTP labeling was performed
by incubating sections in Vectastain Elite avidin-biotin reagents for
1 hr at room temperature. After washing,
NiCl2-enhanced DAB was used for chromagen development.
For NST/TUNEL double labeling of primary culture slides, NST staining
through the addition of the primary anti-NST antibody was followed as
described above. The following day a modified immunocytochemistry
protocol was followed, which included treatment of the cells with 3%
H2O2/PBS for 5 min after
the initial wash step and elimination of the second block step before
exposure to the ABC. NST staining was visualized using AEC chromagen
(Vector Laboratories). After NST labeling, the cells were washed in
DEPC H2O, pretreated with TdT buffer, and labeled
with biotin-16-dUTP as described above, except that labeling was
performed for only 1 hr at 37°C. After labeling, cells were washed
twice with 2× SSC and once with PBS and then blocked with 3% normal
horse serum (NHS) for 30 min at room temperature. Detection of
biotin-16-dUTP labeling was accomplished by incubating sections in
Vectastain Elite ABC reagents for 1 hr at room temperature, followed by
washing and chromagen development in an
NiCl2-enhanced DAB solution. Cell counts and
statistics were performed as described above; however, results are
reported as the percentage of NST-positive cells that are also
TUNEL-positive per 40× field.
Bromodeoxyuridine labeling of embryonic tissue and
bromodeoxyuridine/NST double labeling. Bromodeoxyuridine
(BrdU) for injection into E17 pregnant mice was prepared by dissolving
4 mg of BrdU (Roche Molecular Biochemicals, Indianapolis, IN) in 1 ml
of PBS at 37°C for 15 min. The entire solution was then sterile
filtered and injected intraperitoneally into the pregnant female. At 24 hr after injection, embryonic pups were harvested as described above
for neonates, fixed in 4% PFA, and prepared for cryosectioning.
After baking cryosections overnight at 37-42°C, BrdU-labeled
cells were detected as follows. Sections were washed in PBS and treated
with 3% H2O2/10% MeOH/PBS
for 30 min at room temperature. This was followed by washing and
treatment with pepsin (0.2 mg/ml) in 0.01N HCl/PBS for 20 min at room
temperature. DNA was then denatured in a 2N HCl bath for 45 min at room
temperature followed by neutralization of the acid in 0.1 M
sodium borate, pH 8.5, for 10 min at room temperature.
After subsequent washing, tissue was blocked in blocking solution (100 µl of NHS from Vectastain Elite kit/3.3 ml of PBS) for 30 min at room
temperature and then incubated in mouse anti-BrdU (Roche Molecular
Biochemicals) 1:50/blocking solution overnight at 4°C. The following
day slides were warmed at room temperature for 45 min, washed in PBS,
and treated with biotinylated anti-mouse (100 µl/5 ml PBS)
for 1 hr at room temperature. Sections were then incubated in
Vectastain Elite ABC reagents for 1 hr at room temperature, followed by
washing and chromagen development in an
NiCl2-enhanced DAB solution. Cell counts were
performed as described previously.
For BrdU/NST double labeling of primary cell cultures, BrdU reagent
(Roche BrdU labeling kit; Roche Molecular Biochemicals) was diluted
1:1000 in culture medium and added to cells with appropriate treatments
for various lengths of time. Cells were then harvested in Fixdenate as
described above. Next, cells were washed in PBS and incubated with
mouse anti-BrdU (Becton Dickinson, San Jose, CA) diluted 1:100/0.1%
BSA/PBS for 30 min at 37°C. This was followed by washing in PBS and
incubation with anti-mouse Ig (Fab fragment)-alkaline phosphatase (Roche Molecular Biochemicals) for 30 min at
37°C. Visualization was performed with nitroblue
tetrazolium/X-phosphate in detection buffer (100 mM
Tris-HCl, 100 mM NaCl, and 50 mM
MgCl2, pH 9.5) for 20 min at room temperature in
the dark. After BrdU detection, NST immunostaining was performed as
described previously for TUNEL/NST double labeling. Cell counts and
statistics were performed as described above; however, results are
reported as the percentage of NST-positive cells that are also
BrdU-positive per 40× field.
cGMP determinations. cGMP radioimmunoassays were performed
as described previously (Ronnett et al., 1993 ; Jaworsky et al., 1995 )
with modifications. Incubations were quenched with 6% (w/v) TCA. The
quenched samples were collected on ice and spun for 5 min in a
microfuge at 4°C. The supernatant was collected and ether extracted
four times with anhydrous ether to remove TCA. cGMP was assayed with
the Amersham Biosciences (Arlington Heights, IL)
125I-labeled cGMP assay system and
acetylation method. Values were normalized to the level of cGMP at zero
time, just before treatment with CNP.
Western blot analysis. Total homogenates of primary cultures
of rat ORNs were solubilized in boiling sample buffer (100 mM Tris-HCl, 2% SDS, and 10%
-mercaptoethanol and 20% glycerol, pH 6.8) and subjected to
SDS-PAGE on a 4-15% gel (Laemmli, 1970 ). For blotting,
polyvinylidene difluoride membrane (BA-S 83; 0.2 mm) was saturated with
transfer buffer containing 25 mM Tris-HCl, pH
8.3, 192 mM glycine, and 20% methyl alcohol. The
separated proteins were transferred onto the membrane at 140 mA for 90 min. After neutralization in Tris-buffered saline, pH 7.4, plus 0.1% Tween 20 (TBST), the membrane was blocked for 2 hr in 1%
nonfat dry milk in PBS at 20°C. The blocked membrane was washed twice in PBS, incubated in primary antibody, and diluted in 3% protease-free BSA-TBST overnight at 4°C. The membrane was washed three times in
0.5% nonfat dry milk TBST and was then incubated with secondary antibody (HRP-conjugated antibody diluted in 3% nonfat dry milk-TBST for 1 hr at 20°C). The membrane was washed twice in 0.5% nonfat dry
milk-TBST and rinsed twice in 0.2% Tween-TBST. The membrane was
incubated in chemiluminescence substrate for 5 min at 20°C and
exposed to film. Anti-phospho-ERK1/2 and anti-ERK1/2 were purchased from New England Biolabs (Beverly, MA), and
anti-proliferating cell nuclear antigen (PCNA) was purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phospho-ERK and
anti-ERK antibodies were used at a dilution of 1:1000. Anti-PCNA was
used at a dilution of 1:500.
 |
RESULTS |
BDNF regulates the proliferation and survival of olfactory receptor
neuronal precursors in vivo
Identification of factors that mediate the switch from
proliferation to differentiation required that we first characterize candidate factors that regulate proliferation. The localization of BDNF
and Trk B to basal cells and immature neurons in the olfactory epithelium suggests that BDNF might influence olfactory neurogenesis (Roskams et al., 1996 ; Buckland and Cunningham, 1999 ). To investigate this, mice with targeted deletion of the gene for BDNF were studied (Liebl et al., 1997 ). Immunohistochemistry of developmental markers expressed in ORNs was performed on cryosections of olfactory epithelium from BDNF null mice and WT littermates.
To evaluate the consequences of the absence of BDNF on the ORN
population, immunohistochemistry was preformed using stage-specific markers. Neuronal daughter cells (still capable of proliferation) and
postproliferative immature ORNs are located basally in the epithelium
and express NST; as ORNs mature, NST expression decreases (Lee and
Pixley, 1994 ; Roskams et al., 1998 ). WT mice displayed NST-positive
cells distributed at a level beginning slightly above the basal lamina
and extending several cell layers apically (Fig. 1A). NST
immunoreactivity was reduced in BDNF null mice, especially in the upper
layers of the epithelium (Fig. 1B). Mature ORNs are located more apically and express OMP, a cytoplasmic protein found in
mature ORNs (Margolis, 1985 ). WT mice display a normal distribution of
OMP-expressing cells in the upper one-half of the epithelium (Fig.
1C). Despite the reduction in NST immunoreactivity in BDNF null mice, OMP-positive ORNs were still found in BDNF null mice, although they appeared to be reduced in number and their morphology was
abnormal (Fig. 1D). This elongated morphology may be
the result of decreased packing of neurons, as we have seen this in
other genotypes that have reduced numbers of ORNs in the olfactory
epithelium (Hansel et al., 2001b ). Decreased packing of neurons may
also be responsible for the increased thickness of the OE in BDNF null animals. Collectively, these observations indicate that BDNF null mice
possess fewer immature olfactory neurons, but that ORNs can still
mature to express OMP in the absence of BDNF. These results suggested
that BDNF may influence olfactory neurogenesis or the survival of ORN
precursors.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 1.
BDNF knock-out mice have a reduced number
of ORNs. Cryostat sections of olfactory epithelium were immunostained
with anti-NST antibody in WT (A) and BDNF
knock-out (B) P0.5 mice. Scale bar, 50 µm.
Sections were immunostained with anti-OMP antibody in P0.5 WT
(C) and BDNF knock-out (D)
mice. Sections were immunostained with anti-O/E-1
(OE-1) antibody in WT and BDNF knock-out P0.5 mice, and the
results were quantified by cell counting (E).
Because of the large number of positive cells per section, cell counts
are reported as those present in linear regions per 40× field. NST is
a cytoskeletal marker for immature and maturing neurons, OMP is a
cytoplasmic marker for more mature neurons, and O/E-1 is a nuclear
marker for all cells of a neuronal lineage. Staining was performed on
6-10 sections per mouse, two to four mice per genotype. Statistics
were calculated by Student's t test using the Instat2
statistics program; ***p < 0.0001.
|
|
O/E-1, a transcription factor expressed in cells of the olfactory
neuronal lineage (Wang and Reed, 1993 ), was used to quantify the number
of ORNs and their precursors (Fig. 1E). Sections from WT and BDNF null mice used for this analysis were matched for both size
and depth within the nasal cavity. As reported previously, O/E-1
immunoreactivity was observed throughout the neuronal layers of the
epithelium in WT mice (Hansel et al., 2001b ). BDNF null mice displayed
a consistent decrease in the number of O/E-1-positive cells (Fig.
1E) (p < 0.0001). These data
suggest that BDNF deficiency results in a decrease in the number of
ORNs in the epithelium. This decrease in O/E-1-positive cells in BDNF
null mice could represent decreased proliferation, increased apoptosis,
a combination of these processes, or an effect on O/E-1 expression.
Fragmentation of nuclear DNA is a marker of apoptosis in many cell
types (Holcomb et al., 1995 ). To determine whether the reduction in
ORNs in the BDNF null mice is attributable to apoptosis, we performed
TUNEL on sections of olfactory epithelium from WT and BDNF null mice.
BDNF null mice showed a significant increase in the number of
TUNEL-positive cells within the olfactory epithelium (Fig.
2A)
(p < 0.0001). To determine whether this
increase in cell death occurred at any specific stage in development,
the numbers of TUNEL-positive cells at specific levels within the olfactory epithelium were calculated as a percentage of the total number of TUNEL-positive cells. This permits correlation between apoptosis (TUNEL positivity) and developmental stage, as defined by
outward migration of neurons from the basal to the outer layer as they
mature (Mackay-Sim and Chuah, 2000 ). For this analysis, the epithelium
was divided into three regions, the lower (basal) third of the
epithelium containing precursors and immature neurons, a middle third
containing a mixture immature and mature neurons, and an apical or
upper third containing mature neurons (Fig. 2B). There was a significant increase in the percentage of apoptotic cells
(percentage of total TUNEL-positive cells) within the lower (basal)
region in BDNF null mice when compared with WT mice (Fig. 2C) (p < 0.0001). When normalized
for differences in the total number of apoptotic cells per genotype,
this difference represents a threefold increase in apoptosis in BDNF
null mice specifically within the basal one-third of the epithelium. No
other region of the olfactory epithelium showed a significant
difference in the percentage of TUNEL-positive cells between the two
genotypes. If all percentages are normalized for differences in the
total number of apoptotic cells per genotype (165% in BDNF null mice vs 100% in WT mice), there is very good agreement with data obtained from counting total apoptotic cells in null and WT animals directly (144% in BDNF null mice vs 100% in WT mice). This suggests that BDNF
specifically affects the survival of ORN precursors and not the
survival of mature neurons.

View larger version (89K):
[in this window]
[in a new window]
|
Figure 2.
BDNF knock-out (KO) mice
demonstrate increased apoptosis and decreased proliferation within the
basal cell region of the olfactory epithelium. A, TUNEL
staining was performed on the olfactory epithelium from WT and BDNF
knock-out animals and quantified across the entire epithelium.
***p < 0.0001 (direct cell counts: WT, 148 ± 9; BDNF null, 220 ± 15 TUNEL-positive cells/section).
B, To evaluate the number of cells undergoing apoptosis
at different times in the ORN life cycle, the epithelium was divided
into thirds, representing the basal third containing neuronal
precursors and some immature neurons, the middle third containing
immature and mature neurons, and the apical or upper third containing
mature neurons and sustentacular cell bodies. This schematic of the
olfactory epithelium shows regional definitions that were used for
TUNEL cell counting. C, The number of TUNEL-positive
cells per region within the olfactory epithelium as defined in
B is presented as a percentage of the total number per
section. Direct cell counts (WT, 7.3 ± 1.1; BDNF null, 22.6 ± 2.2 TUNEL-positive cells within the lower one-third of the OE per
section) demonstrate that BDNF null animals show a threefold increase
in the number apoptotic cells found in the basal region over WT
animals. Statistics were calculated by ANOVA followed by Student's
t tests. n = 10-15 sections
per mouse, three mice per genotype. ***p < 0.0001. Nestin
and Ki67 immunostaining were performed on the olfactory epithelium from
P0.5 WT (D, F) and BDNF knock-out (E,
G) mice to confirm the results of TUNEL that suggested a
decrease in the population of neuronal precursors and immature neurons
in BDNF knock-out animals. Scale bar, 50 mm. Nestin- and Ki67-positive
cells are indicated by asterisks. Nestin is a marker for
neuroepithelial stem cells. Ki67 is a marker for non-Go cells. Both
nestin and Ki67 staining were reduced in BDNF knock-out mice. Nestin
and Ki67 staining were performed on 6-10 sections per mouse, three to
four mice per genotype. H, The total number of
H3-phosphohistone-stained cells per section in P0.5 WT and BDNF
knock-out mice was quantified. H3-phosphohistone is a marker for cells
undergoing mitosis, and was reduced in BDNF knock-out mice.
I, Timed-pregnant mice received BrdU at E17, and embryos
were harvested at E18 to examine the number of cells that incorporated
BrdU in the olfactory epithelium. BrdU incorporation is a marker of DNA
synthesis. The number of BrdU-positive cells per 40× field in 24 hr
labeled E18 WT and BDNF knock-out mice was quantified. Cell counts were
performed on 6-10 sections per mouse, two to three mice per genotype.
Statistics were calculated by ANOVA followed by Student's
t tests; *p < 0.05;
**p < 0.001.
|
|
Other developmentally expressed markers were used to confirm these
findings. Nestin is a marker for neuroepithelial stem cells (Zimmerman
et al., 1994 ); however, others have suggested that it identifies
different classes of cells (Tohyama et al., 1992 ; Zimmerman et al.,
1994 ; Osada et al., 1995 ). In the olfactory epithelium, nestin appeared
to identify neuronal precursor cells, in addition to basal cells,
within the lower region of the epithelium. Immunohistochemistry using
anti-nestin antibodies consistently identified fewer cells within the
olfactory epithelium of the BDNF null mice compared with littermate WT
controls (Fig. 2D,E). Interestingly, nestin
antibodies identified several layers of basally positioned cells and
small clusters of apically extending cells in the WT epithelium,
whereas the few nestin-positive cells that remained in the
BDNF null mice were found as single cells distributed at all layers of
the epithelium (Fig. 2D,E, asterisks). These results confirm the decrease in neuronal precursor numbers that
would be expected based on results of TUNEL analysis showing increased
apoptosis in the basal region in BDNF null mice.
The increased apoptosis of ORN precursors seen in the BDNF null
phenotype suggests two possible effects on proliferation. One would be
a decrease in proliferation, based on a decrease in the number
precursor cells available to proliferate. In many cases, however, a
compensatory upregulation of olfactory neurogenesis is observed as a
result of injury to the olfactory epithelium or olfactory bulb. In
these cases, increases in ORN death lead to an upregulation of neuronal
precursor proliferation (Kastner et al., 2000 ). In our case, it is
possible to imagine that although the number of olfactory neuronal
precursors present in BDNF null animals is reduced, those precursors
still present may compensate for this reduction by undergoing
additional rounds of cell division.
To evaluate the neuronal precursor population and proliferation in BDNF
null mice, we performed immunohistochemistry on the olfactory
epithelium from WT and null mice using antibodies to Ki67, a marker for
nonquiescent cells (Fig. 2F,G) (Mahadevan et al.,
1991 ; Ajiro et al., 1996 ). These results showed no compensatory increase in proliferation within the olfactory epithelium, but rather a
decrease in the number of proliferating cells. Ki67 antibodies identified fewer cells within the olfactory epithelium of BDNF null
mice compared with WT littermates. Within the epithelium of WT mice,
immunostaining with antibodies to Ki67 appeared to be primarily
localized to groups of cells within proliferative clusters, located
slightly above the basal cell layer (Fig. 2F). No
obvious changes were seen in the actual basal cell layer itself. In
BDNF null mice, only single cells were visualized, again distributed throughout the epithelium (Fig. 2G). This lack of
proliferative clusters suggests that individual surviving neuronal
precursors are not induced to undergo increased proliferation. Based on
the localization of this staining, these data also suggest that BDNF is
required for the rapid proliferation of daughter cells after their
migration from the basal cell layer (Mackay-Sim and Kittel, 1991 ),
rather than for the first round of division within the basal cell layer.
Antibodies to phosphohistone H3, a marker for mitosis (M phase)
(Rijzewijk et al., 1989 ), revealed that the differences in proliferation between WT and BDNF null mice were statistically significant (Fig. 2H) (p < 0.05). These results were confirmed by analysis of BrdU labeling in WT
and BDNF null mice. Timed-pregnant female mice received BrdU at E18,
and embryos were harvested 24 hr later (Fig. 2I). A
significant reduction in the number of BrdU-labeled cells
in the null animals was observed compared with WT animals (p < 0.001), confirming the observations
obtained using the H3 mitosis marker. These findings demonstrate that
BDNF influences the proliferation of neuronal precursors and suggest
that it may be involved in supporting the survival of immature neurons
within the olfactory epithelium in vivo.
BDNF induces neuronal precursor proliferation
in vitro
To confirm these results and to investigate the interactions of
BDNF with factors that might influence neuronal differentiation, we
used primary cultures of olfactory epithelium enriched for olfactory
neuronal precursors (Ronnett et al., 1991 ). These cultures have been
used to study the roles of a number of factors that regulate olfactory
neurogenesis (Hansel et al., 2001a b ). ORNs in these cultures express
stage-specific markers and respond to odorants (Cunningham et al.,
1999 ; Barber et al., 2000 ).
When added to cell cultures containing ORN precursors, BDNF caused a
dose-dependent increase in the number of NST-positive neurons within 24 hr after application (Fig. 3A)
(p = 0.02), confirming that BDNF influenced
precursor proliferation and/or survival of immature neurons. This
effect was dose-dependent up to a dose of 50 ng/ml (data not shown). In
addition, BDNF also caused a significant increase in the number of
Ki67-positive cells in culture within this same time period (Fig.
3B) (p = 0.0026), suggesting that at
least part of the increase in ORNs seen in BDNF-treated cultures was
caused by increased proliferation. Thus, BDNF influences olfactory
neuronal precursor proliferation in vivo and in
vitro. We therefore used BDNF as a treatment to identify factors
that could specifically affect the maturation of proliferating ORN precursors.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3.
BDNF increases the number of NST- and
Ki67-positive cells in primary cultures of olfactory epithelium
in vitro. Primary cultures were prepared from P1 rat
pups as described in Materials and Methods and incubated for various
times in medium with or without 50 ng/ml BDNF. A, The
number of NST-positive cells per 40× field in ORN culture at 24 and 48 hr after addition of BDNF was determined. B, The number
of Ki67-positive cells per 40× field in ORN culture from P1 rat pups
with or without 50 mg/ml BDNF at the 24 hr time point was determined.
The data were normalized to WT. Statistics were calculated by ANOVA
followed by Student's t tests; *p < 0.05; **p < 0.001. n = 15 counts per well, two wells per treatment, from triplicate
experiments.
|
|
GC-B and CNP are expressed within the olfactory system
Immunohistochemistry was performed to localize GC-B and CNP in the
olfactory epithelium, (Fig. 4). GC-B was
localized to ORNs in the upper one-half of the epithelium of the adult
rat, where immature and maturing neurons reside (Fig.
4A). GC-B was also expressed in stretches of cells
located near the basal lamina, at the interface of the olfactory
epithelium and the lamina propria, and in cells just above this
interface (Fig. 4C). Staining in both distribution patterns
was found within the same regions throughout the OE. This pattern was
present in P1 neonatal mouse and rat pups, although the staining was
lighter and more diffuse (data not shown). GC-B was not detected in the
olfactory bulb (Fig. 4F).

View larger version (58K):
[in this window]
[in a new window]
|
Figure 4.
GC-B and CNP are positioned to play a role in ORN
development and regeneration. Cryosections of adult olfactory
epithelium and bulb were immunostained for GC-B or CNP. A,
C, Staining of adult rat olfactory epithelium with anti-GC-B
antibody indicated that GC-B was expressed in more mature cells found
in the upper layer of the epithelium (A) and
within cells of and migrating out of the basal cell layer
(C). This pattern was also seen in P1 mouse pups,
although the staining was lighter and more diffuse (data not shown).
F, Immunostaining of the adult rat olfactory bulb with
anti-GC-B antibody demonstrated that GC-B does not appear to be present
in the bulb. B, Immunostaining of the adult rat
olfactory epithelium with anti-CNP antibody showed that CNP was
expressed in sustentacular cell processes and foot pads. Intense
staining is also seen within axon bundles within the lamina propria
(E) and leading into the olfactory bulb
(D). Within the epithelium of P1 rat pups, CNP
was present within scattered cells, both mature and immature,
throughout the epithelium (data not shown). G,
Immunostaining of the adult bulb with anti-CNP antibody demonstrated
expression of CNP in periglomerular cells surrounding the glomeruli.
Within the adult olfactory bulb, cells of the mitral cell layer were
also densely stained (data not shown). Within P1 rat pups, staining is
also seen within the forming glomeruli and within the mitral cell layer
(data not shown). Staining was performed on 5-10 sections from each of
two to three rats from both P1 pups and adult animals.
H, cGMP production in response to CNP added to primary
cultures of P1 rat ORNs. n = 2 values per dose from
triplicate experiments.
|
|
CNP was expressed in both the olfactory epithelium and the olfactory
bulb (Fig. 4B,D,E,G). Within the olfactory epithelium of adult rats, CNP was associated with sustentacular cells, and expression was most prominent in sustentacular cell foot processes (Fig. 4B). CNP was also associated with ORN axon
bundles in the lamina propria leading into the bulb (Fig.
4D,E). In contrast to GC-B, CNP was expressed in the
olfactory bulb in periglomerular cells that surround the glomeruli
(Fig. 4G), and, in some cases, within the mitral cells
deeper within the bulb (data not shown). The localization of CNP in the
bulb confirmed a previous study (Herman et al., 1996 ). The expression
of GC-B in ORNs located in different layers of the epithelium, and of
CNP in sustentacular cells and in cells surrounding glomeruli, position
CNP to act as a paracrine factor that could regulate neuronal
differentiation or survival.
To demonstrate that GC-B is present and functional (capable of being
activated by CNP) in our primary culture system, we measured cGMP
production in response to a 5 min CNP treatment (Fig.
4H). CNP caused a dose-dependent increase in cGMP
with a Km = 31.4 nM. The localization of GC-B and CNP in the
olfactory epithelium suggested that CNP might affect growth
factor-induced proliferation in ORN development, as it does in
non-neuronal cells.
CNP blocks BDNF-induced proliferation in ORNs
in vitro
To determine whether CNP was capable of blocking BDNF-induced
proliferation, these factors were added to primary cultures individually and in combination. Extensive time courses using BrdU/NST
double labeling were performed to permit analysis of the role of CNP on
BDNF-induced neuronal proliferation (Fig.
5). This double labeling indicates the
number of neuronal precursors that are proliferating during BrdU
incorporation and are, or subsequently become, NST-positive. This group
of cells is referred to as neuronal precursors. BDNF caused a
significant increase in the number of BrdU-positive neurons within 30 min of application (Fig. 5A) (p < 0.001). The number of proliferating cells remained high for 4 hr but
began to decrease between 4 and 6 hr. The rapid increase seen in
proliferation in response to BDNF suggests that BDNF has a direct
effect on proliferation itself, and that the decrease in BrdU labeling
seen in vivo was not attributable entirely to increased cell
death.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5.
CNP antagonizes BDNF-induced proliferation and
promotes the formation, survival, and process outgrowth of more mature
neurons. Primary cultures were prepared and incubated in control medium
or in medium containing BDNF alone, CNP alone, or a combination of the
two as indicated. A, The effect of BDNF and CNP
both together and separately on BrdU incorporation in NST-positive
neurons over a 6 hr time course. B, The effect of BDNF
and CNP on the number of NST-positive cells in culture over a 72 hr
time course; data have been normalized to 3 hr control values.
C, The effect of BDNF and CNP on the number of
OMP-positive cells in culture over a 72 hr time course; data were
normalized to 8 hr control values. In all cases, the concentration of
BDNF was 50 ng/ml and the concentration of CNP was 50 nM.
Statistics were calculated by ANOVA followed by Student's
t tests; * p < 0.05;
**p < 0.001. n = 8 counts from
each of two wells per treatment from triplicate experiments.
D, Photographs of ORNs in primary culture immunostained
with anti-NST in the presence of either BDNF alone or BDNF and CNP,
demonstrating the differences seen in process outgrowth between the two
treatments. E, Graph showing the number of cells
displaying processes versus non-process-bearing cells in cultures
treated with BDNF, CNP, or BDNF and CNP combined. n
represents 15 counts per well from two wells per treatment from
triplicate experiments; *p < 0.05.
|
|
We subsequently wanted to determine whether CNP might inhibit
proliferation and induce maturation (Fig. 5A). BDNF
treatment caused a twofold increase in the number of BrdU/NST-positive
cells by 30 min (p < 0.001), whereas CNP alone
had little effect (p = 0.03). In contrast, CNP,
added at the same time with BDNF, completely abolished BDNF-induced
proliferation by 2 hr (p < 0.001). The fact
that CNP was not able to inhibit BDNF within 30 min suggests that the
mechanism used by CNP to cause this inhibition requires a kinetically
longer signal transduction pathway, or perhaps even an alteration in
gene expression.
The number of NST-positive cells was also analyzed to determine the
fate of cells undergoing proliferation (Fig. 5B). BDNF increased the number of NST-positive cells in culture over an 8-24 hr
time course, with a maximum effect at 8 hr. CNP alone had no effect on
the number of NST-positive cells at any point in the time course.
However, the addition of CNP with BDNF completely abolished the
BDNF-induced increase at both the 8 and 24 hr time points. By 48 hr,
BDNF-treated cultures no longer showed an increased number of
NST-positive cells over control values. CNP applied in the presence of
BDNF, however, was still able to cause an additional and significant
reduction in NST-positive cells compared with controls. These data
suggest that the increase in NST-positive neurons in response to BDNF
is attributable, at least in part, to rapid induction of proliferation.
The decrease in NST-positive cells seen in the presence of BDNF and CNP
(48 hr) suggests that under these conditions proliferating neuronal
precursors either do not survive or mature and lose NST immunoreactivity.
CNP promotes differentiation and survival of ORNs treated
with BDNF
To investigate further the fate of proliferating NST-positive
cells, OMP immunocytochemistry was performed (Fig. 5C). The time course for formation of OMP-positive cells in culture is slightly
later than that for cells expressing NST, reaching a maximum between 24 and 48 hr, a time period during which BDNF loses its effectiveness in
increasing the number of NST-positive cells. Treatment with either BDNF
or CNP alone during this period had no effect on the number of cells
expressing OMP. However, when cultures were treated with BDNF and CNP
together, the number of OMP-positive neurons increased significantly by
48 hr. These data suggest that CNP not only interrupts BDNF-induced
proliferation but also promotes the formation and/or survival of more
mature neurons.
The above data suggest that in the presence of CNP, BDNF "primed"
cells switch from a program of proliferation to differentiation. However, these results do not discriminate between increased
differentiation and increased survival of older neurons. To address
this question, we examined the morphology of NST-positive cells treated
with BDNF and CNP either together or separately (Fig. 5D).
Two distinct NST-positive cell populations were visualized: one
population consisting of densely stained round cells that displayed no
process outgrowth, and another consisting of cells possessing densely stained processes of various lengths and lighter stained cell bodies
(Fig. 5D). By 24 hr, cells treated with both BDNF and CNP showed a significant increase in the ratio of process-bearing versus
non-process-bearing NST-positive cells (Fig. 5E)
(p = 0.004), although as indicated above, the
total number of NST-positive cells was not increased above control
values (Fig. 5E). CNP alone had no effect. After 48 hr, this
value remained significantly higher than controls, whereas cultures
treated with BDNF alone showed a significant decrease in the ratio of
process-bearing to non-process-bearing NST-positive cells
(p = 0.016). These changes in morphology were
clearly visible within the cultures by 48 hr (Fig. 5D).
These data indicate that CNP induces differentiation in BDNF-treated
cultures, as monitored by process extension and OMP expression. These
data also suggest that in the absence of additional factors, cells that
have been induced by BDNF to proliferate fail to undergo further
differentiation and become quiescent.
Based on our in vivo data, BDNF may not only act
as a proliferation-inducing factor but may also aid in the survival of
proliferating immature neurons. To investigate this possibility, we
examined the effects of these factors on apoptosis using TUNEL/NST
double labeling. BDNF treatment caused a significant reduction in the number of NST-positive apoptotic cells (Fig.
6) (p = 0.0027)
within 3 hr, confirming our in vivo TUNEL data. In contrast
to its effect on BDNF-induced proliferation, CNP did not affect
BDNF-induced survival at this time point. This suggests that separate
signal transduction pathways are involved in the survival and
proliferation-inducing effects of BDNF, and confirms that BDNF has an
effect on proliferation that is not attributable to increased survival
of proliferating cells.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6.
The effect of BDNF and CNP on apoptosis of
NST-positive neurons. Primary cultures received BDNF and CNP alone or
in combination over a 48 hr time course. In all cases, the
concentration of BDNF was 50 ng/ml and the concentration of CNP was 50 nM. Statistics were calculated by ANOVA followed by
Student's t tests; *p < 0.05;
**p < 0.001; ***p < 0.0001. n = 15 counts from each of two wells per treatment
from triplicate experiments.
|
|
By 24 hr in culture, BDNF no longer had an effect on survival. This
result confirmed our in vivo data that suggested that BDNF
affected ORN precursors early in their life cycle (Fig. 6). When CNP
was added along with BDNF, however, the number of apoptotic neurons was
significantly reduced by 24 hr (p = 0.039),
supporting a role for CNP in the survival of older neurons. By 48 hr,
both BDNF- and CNP/BDNF-treated cultures showed a significant increase in the numbers of apoptotic NST-positive neurons
(p < 0.0001, BDNF; p = 0.0006, CNP/BDNF). It is at this stage in culture that CNP/BDNF-treated
cultures showed a significant increase in the number of OMP-positive
cells (Fig. 5C); it may be that NST-positive neurons that
fail to undergo further maturation at this point undergo apoptosis.
NGF induces ORN precursor proliferation followed by
increased apoptosis
We wanted to determine whether CNP could also affect ORN precursor
proliferation induced by other factors. Although NGF is primarily
associated with differentiation, process outgrowth, and survival
responses in neurons and PC12 cells, it has been shown to stimulate
proliferation in some neuronal populations (Geffen and Goldstein, 1996 ;
Anastasiadis et al., 1997 ; Goldstein et al., 1997 ; Jiang et al., 1997 ;
Calza et al., 1998 ; Sieber-Blum, 1998 ). In the olfactory system, NGF is
positioned to be involved in neurogenesis after bulbectomy. NGF
expression is seen in ORNs in the upper one-half of the epithelium,
where it appears to be associated with cells destined to die (Roskams
et al., 1996 ). Within 3 d after bulbectomy, Trk A expression
appears within basally located cells in the olfactory epithelium and
remains high for up to 2 weeks (Roskams et al., 1996 ). These results
suggest that the NGF may be released from older cells that are dying
within the olfactory epithelium in response to bulbectomy as a signal for basal cells to begin proliferation.
To examine this potential role for NGF in olfactory neurogenesis, we
determined the effect of NGF and CNP on neurogenesis in
vitro. As with BDNF, NGF was found to induce neuronal
proliferation (Fig. 7A),
although over a longer time course than BDNF. No significant increase
in proliferation was seen until 4 hr (p = 0.03)
after the addition of NGF, and proliferation remained significantly increased for at least 24 hr (p = 0.0001). To
determine the fate of these proliferating precursors, NST
immunostaining was performed (Fig. 7B). In contrast to
results obtained with BDNF, NGF did not increase the number of
NST-positive cells at any time over a 24-96 hr time course. These data
indicated that NGF induced neuronal proliferation but did not lead to
an increase in the number of NST-positive cells, and suggested that
cells treated with NGF must have a different fate than those treated
with BDNF. Several possible fates exist for these cells: quiescence in
an immature state before NST expression, cell death after
proliferation, or rapid maturation and a switch to OMP expression. To
examine these possibilities, we performed TUNEL/NST double labeling on NGF-treated cells (Fig. 7C). Within 24 hr after treatment
with NGF, at a time when cells were undergoing NGF-induced
proliferation, apoptosis was increased significantly above control
values (Fig. 7C) (p = 0.002).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 7.
CNP antagonizes NGF-induced proliferation and
promotes neuronal maturation and survival. Primary cultures were
prepared and treated with control medium or medium containing NGF or
CNP alone or in combination as specified. A, The effect
of NGF and CNP both together and separately on BrdU incorporation in
NST-positive neurons was determined over a 24 hr time course.
B, The effect of NGF and CNP on the number of
NST-positive cells in culture was measured over a 72 hr time course.
C, The effect of NGF and CNP on apoptosis of
NST-positive neurons in culture was determined after 24 hr of
treatment. D, The effect of NGF and CNP on the number of
OMP-positive cells in culture was determined after 72 hr of treatment;
data were normalized to control values. E, The effects
of NGF and CNP alone or in combination on process outgrowth were
determined. In all cases, the concentration of NGF was 25 ng/ml and the
concentration of CNP was 50 nM. Statistics were calculated
by ANOVA followed by Student's t tests;
*p < 0.05; **p < 0.001;
***p < 0.0001. n = 15 counts
per well for two wells per treatment from triplicate experiments.
|
|
CNP inhibits NGF-induced neuronal proliferation in
vitro and rescues cells from apoptosis
When CNP was added to NGF-treated cells, CNP was able
to completely abolish the NGF-induced increase in proliferation (Fig. 7A). CNP also completely inhibited the increase in apoptosis
of NST-positive cells in response to NGF (Fig. 7C). This
suggests that in the absence of additional factors, many of the cells
induced by NGF to proliferate undergo apoptosis, and that CNP is able to both inhibit this proliferation and save NGF-treated cells from
subsequent apoptosis.
Interestingly, when the effect of CNP on the total number of
NST-positive cells in NGF-treated cultures was examined, a significant decrease in the number of NST-positive cells was evident within 48 hr
(Fig. 7B) (p = 0.0031). This time
point corresponds to the time point at which CNP showed the maximal
ability to induce differentiation of BDNF-treated neuronal precursors
and suggested that in the absence of their death, these cells continue
to the next level of ORN maturity.
CNP also promotes the differentiation of NGF-treated cells
To confirm that CNP also induced differentiation/maturation of
NGF-treated neurons, we examined the effects of CNP and NGF on OMP
staining in culture after 72 hr of treatment (Fig. 7D). Addition of CNP to NGF-treated cultures resulted in a significant increase in the number of OMP-positive neurons at this time (Fig. 7D) (p = 0.015).
Analysis of the ratio of process/non-process-bearing
NST-positive cells (Fig. 7E) showed that NGF, like BDNF,
caused a substantial decrease in the number of process-bearing cells
within 48 hr after treatment. However, unlike cells treated with
BDNF/CNP, NGF/CNP-treated cells did not show a significant increase in
process outgrowth but did return to control values, as would be
expected if CNP acts on the maturation of ORN precursors saved from
cell death. These results confirm that CNP can act on cells pretreated
with at least two different growth factors to influence maturation. It
also suggests that, based on differing time courses of action, fates of
treated cells, and localization of receptors, NGF and BDNF may act on
cells at two different developmental stages, both of which are
sensitive to CNP.
The effects of CNP are mediated by cGMP
We investigated the specificity of the effect of CNP on
BDNF-treated cells by using atrial A-type and B-type natriuretic
peptides (ANPs and BNPs, respectively), as well the full-length CNP
peptide (C53), because a shorter peptide is generally used for most
experiments (C22) (Sudoh et al., 1990 ). As with C22, C53 alone had no
effect on ORN precursors, but C53 reproduced the effect of C22 in
inhibiting BDNF-induced proliferation (Fig.
8A). Neither ANP nor
BNP was able to mimic the effect of C22 and C53 (data not shown). To
confirm that the effect was caused by an increase in cGMP, we also
analyzed the effect of 8-bromo-cGMP on BDNF-induced
proliferation. As with CNP, 8-bromo-cGMP had little effect alone. At
a concentration of 1 nM, 8-bromo-cGMP completely
inhibited BDNF-induced proliferation (Fig. 8B).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 8.
The effect of CNP on BDNF-primed cultures is
specific and is mimicked by 8-bromo-cGMP. Primary cultures were
prepared and treated with control medium or medium containing BDNF,
CNP, C22, or C53 alone or in combination as indicated.
A, Comparison of the effect of the truncated C22 peptide
with full-length CNP (C53), both alone and in the presence of BDNF, on
BrdU incorporation into NST-positive neurons. As can be seen, the
effects of the two peptides alone and with BDNF are almost identical at
both the 30 min and 2 hr time points. Neither ANP nor BNP mimicked
these effects (data not shown). BDNF statistical significance applies
to control, BDNF/C22, and BDNF/C53 results at both time points;
***p < 0.0001. B, The effect of
8-bromo-cGMP (8-Br-cGMP) on BrdU incorporation into
NST-positive neurons with and without BDNF. 8-bromo-cGMP was used at a
concentration of 1 nM. For each graph, n
represents 15 counts per well, two wells per treatment from triplicate
experiments. Statistics were calculated by ANOVA followed by Student's
t tests; **p < 0.001.
|
|
CNP requires protein synthesis to inhibit
BDNF-induced proliferation
CNP may exert its effect by several mechanisms. It may directly
interfere with the BDNF-induced signal transduction pathway, or it may
inhibit proliferation through an independent pathway to alter gene
expression. To address whether or not CNP requires gene expression to
block BDNF-induced proliferation, we examined the effects of CHX on
this process (Fig. 9). Based on the time course of action of BDNF and CNP, we hypothesized that BDNF-induced proliferation would not be inhibited by CHX, whereas the ability of CNP
to block BDNF action would be inhibited. BDNF-induced proliferation was
entirely unaffected by CHX, whereas the ability of CNP to inhibit this
proliferation was completely blocked (Fig. 9A). CHX blocked
the effect of CNP when BDNF/CNP and CHX were added at the same time
(Fig. 9A-C) or when additions were staggered by 30 min
(Fig. 9A-C) (BDNF was followed by CHX 30 min later, and CNP
was added 30 min after that). CHX did not affect proliferation in
control cultures.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 9.
The effect of CNP on BDNF-induced BrdU
incorporation is blocked by inhibition of protein synthesis with CHX or
by the inhibition of MEK. Primary cultures were prepared and treated
with control medium or medium containing BDNF or CNP alone or in
combination, and with or without CHX or PD98059 as indicated. BrdU
incorporation and immunostaining for NST were then performed on fixed
slides. A, The effect of 10 mg/ml CHX on the ability of
CNP to inhibit BDNF-induced BrdU incorporation in NST-positive neurons.
B, The effects of BDNF and CNP either alone or together
on BrdU incorporation in NST-positive neurons in the presence (+) or
absence of the MEK inhibitor PD98059. PD98059 inhibited BDNF-induced
BrdU incorporation by 43% at the 30 min time point, and this level of
inhibition remained constant for the remainder of the time course.
PD98059 also inhibited the ability of CNP to block BDNF-induced BrdU
incorporation, although over a longer time course; at 30 min the MEK
inhibitor had no effect on CNP/BDNF, but by 2 hr it had completely
inhibited the ability of CNP to block the effects of BDNF. Statistics
were calculated by ANOVA followed by Student's t tests;
**p < 0.001; ***p < 0.0001. n = 15 counts per well, two wells per
treatment from triplicate experiments. C, Western blot
analysis of MAPK phosphorylation (pERK1/2) in response to CNP and BDNF
alone or together (C, no treatment; B,
BDNF; N, CNP; B/N, BDNF and CNP).
Nonphosphorylated MAPK (ERK1/2) serves as a loading control.
D, Schematic of signal transduction events that could
explain the above findings: BDNF activates the MAPK signal transduction
pathway through binding to Trk B leading directly to stimulation of
BrdU incorporation or proliferation. PD98059 blocks this response by
43%. cGMP also stimulates MAPK signaling through an as yet unknown
mechanism, albeit to a lesser extent than BDNF. Stimulation of this
pathway by cGMP leads to an alteration in gene expression within 2 hr
after its application. It is alteration of this gene product by cGMP
that ultimately interferes with the ability of BDNF to increase
neuronal BrdU incorporation. The inclusion of either PD98059, which
blocks cGMP-stimulated MAPK pathway activity, or CHX, which blocks
protein synthesis, inhibits the effects of CNP on BDNF.
|
|
CNP inhibits BDNF-induced activation of MAPK
BDNF is known to stimulate the Ras-MAPK pathway (Nakamura et al.,
1996 ; You et al., 2000 ), which has been confirmed in our ORN cultures.
Although NGF is also known to stimulate this pathway, we have chosen to
confine our examination of signal transduction to BDNF-stimulated
pathways because of the more concise time course of BDNF action, and
because BDNF produces a more robust proliferative response. To
determine whether this pathway mediated BDNF-induced proliferation, we
included the MEK inhibitor, PD98059 (Alessi et al., 1995 ; Dudley et
al., 1995 ), in our cultures 30 min before treatment with BDNF and CNP
alone or in combination (Fig. 9B). PD98059 caused a 43%
inhibition in BDNF-induced BrdU labeling of neurons
(p < 0.001). Thus, BDNF acts, at least in part,
through the MAPK pathway to mediate its proliferation-inducing effect. Surprisingly, PD98059 also blocked the ability of CNP to inhibit the
BDNF response. This suggests that CNP also uses the MAPK pathway to
exert its effects.
Because the results obtained using the MEK inhibitor suggested that
BDNF might act through stimulation of the MAPK pathway to induce
proliferation, we examined the effects of BDNF and CNP on various
components of the MAPK signal transduction pathway using Western blots
(Fig. 9C). After 30 min, BDNF treatment increased MAPK
(ERK1/2) phosphorylation. Treatment of cultures with CNP and BDNF
together partially inhibited BDNF-stimulated MAPK phosphorylation by 30 min of treatment; after 2 hr, this combination treatment completely
abolished the effect of BDNF alone. Thus, CNP may act through two
mechanisms to inhibit BDNF-induced precursor proliferation: CNP
interferes with MAPK signaling early, within 30 min, perhaps by
competition for MAPK signaling components and also affects protein
synthesis. A mechanism that explains these results is presented in
Figure 9D.
BDNF and CNP alter the expression of
cell-cycle-associated proteins
If BDNF and CNP regulate proliferation and differentiation in
ORNs, they should also alter the activation and/or expression of
cell-cycle-associated proteins. To examine this, we determined the
effects of BDNF and CNP on several cell-cycle-associated proteins, including PCNA, Cdk2, and p21 (Fig.
10). PCNA is a DNA sliding-clamp protein that acts as a DNA polymerase processivity factor and is also
required for DNA synthesis during the S phase of the cell cycle
(Tsurimoto, 1999 ). PCNA also interacts with several cell-cycle regulatory proteins such as the cyclin D1/Cdk complex and both p53 and
p21, which inhibit DNA replication (Tsurimoto, 1999 ). Based on BrdU
labeling results presented previously, we predicted that PCNA levels
would be increased with exposure of ORNs to BDNF, and that this
increase would be inhibited by simultaneous exposure to
CNP. This was examined by two methods, Western blot analysis and PCNA/NST immunocytochemical double labeling followed by
cell counting. Both of these results confirmed our hypothesis (Fig. 10A,B). Exposure of ORNs to BDNF resulted in a
dramatic increase in PCNA levels within 30 min, and this increase was
completely inhibited 2 hr after the addition of CNP. These results were
confirmed by cell-counting experiments at the 2 hr time point, which
revealed the same pattern of effect. Quantification of these results
also demonstrated that differences seen in PCNA levels in response to
different treatments were statistically significant (BDNF vs controls,
p < 0.01; BDNF vs BDNF/CNP, p < 0.001). In contrast to PCNA, Cdk2 showed no change in expression levels
when detected by either Western blot or Cdk2/NST immunocytochemistry
(data not shown). This is perhaps not surprising, because Cdk2 is
regulated by phosphorylation as well as by its level of expression.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 10.
BDNF and CNP alter levels of PCNA expression.
A, Western blot analysis of PCNA levels in response to
CNP and BDNF alone or together over a 6 hr time course. Note that the
reduction in control levels at the 2 hr time course is probably caused
by reduced proliferation after transfer to 0.5% FBS feeding media.
B, The effect of BDNF and CNP either alone or together
on PCNA/NST double-labeled neurons 2 hr after application.
p values are shown on the graph. Statistics were
performed as described above. n represents 15 counts per
well, two wells per treatment from triplicate experiments.
|
|
 |
DISCUSSION |
In this study, we sought to identify factors that mediate the
switch from proliferation to differentiation during postnatal neurogenesis using the olfactory system as a model. We provide evidence
that BDNF and NGF are neuroproliferation-inducing factors whose
unopposed actions result in the quiescence and apoptosis of daughter
olfactory neurons and basal cells, respectively. CNP is identified as a
factor that can act on these neuronal precursors when primed by BDNF or
NGF, and mediates their differentiation and survival (Fig.
11). CNP appears to act through at
least two signaling mechanisms. CNP alters neurotrophin-induced MAPK
signaling and requires protein synthesis to execute these switches in
cell cycle and cell phenotype.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 11.
Model of BDNF, NGF, and CNP actions in the
olfactory system. 1, NGF is released from apoptotic
cells within the regenerating olfactory epithelium and acts on basal
cells to promote their division to form basal daughter cells that then
migrate to a region slightly above the basal layer
(2). 3, In the absence of other
factors, these cells then undergo apoptosis. 4, BDNF is
released from cells within the basal layer and acts on basal daughter
cells to allow them to undergo further rapid proliferation
(5). 6, In the absence of other
factors, these cells become quiescent. 7, CNP can act at
either the level of the basal cells or their daughter cells to inhibit
growth factor-induced proliferation and promote cell differentiation to
the next stage of maturation. CNP by itself has no effect. CNP appears
to be released from mature cells within the olfactory epithelium at P1,
and later by sustentacular cells in the adult animal. 8,
CNP also promotes the survival of more mature, OMP-positive neurons
within the olfactory epithelium, perhaps through its presence in the
olfactory bulb. Within less mature animals (P1), CNP appears
within the forming glomeruli and mitral cell layer, whereas in the
adult it appears in the periglomerular cells surrounding each glomeruli
and also in the mitral cell region.
|
|
We have shown that BDNF induces the proliferation and survival of
neuronal precursor cells/immature neurons in the olfactory system
in vivo and in vitro using BDNF null mice and an
olfactory epithelium culture system, respectively. Within the
olfactory epithelium, the proliferation of neuronal cells involves the
proliferation of basal cells to produce daughter cells and the
subsequent migration of these daughter cells out of the basal layer,
followed by their rapid proliferation to produce immature neurons
(Mackay-Sim and Kittel, 1991 ). BDNF appears to act on daughter cells
rather than on basal cells themselves, based on its rapid temporal
effect on proliferation (within 30 min of treatment) and on alterations in nestin and Ki67 staining in the olfactory epithelium of BDNF null
mice. This hypothesis is supported by localization studies showing that
BDNF is found in basal cells (Buckland and Cunningham, 1999 ), whereas
its receptor is localized to the region above the basal layer, where
basal daughter cells are found (Roskams et al., 1996 ). Thus, we propose
that BDNF is released by basal cells to trigger the proliferation of
daughter cells that then become quiescent until they receive additional
instruction from another factor that signals maturation (Fig. 11).
NGF induces proliferation of olfactory neuronal precursors in cell
culture, but with a different time course, suggesting that NGF may act
on a different target. NGF is not detected in the normal olfactory
epithelium but is upregulated after lesioning of the olfactory bulb,
which causes massive olfactory neuronal apoptosis and a compensatory
increase in olfactory neurogenesis (Roskams et al., 1996 ). In the
postbulbectomy olfactory epithelium, NGF is associated with more mature
cells within the olfactory epithelium, whereas its receptor is found on
basally positioned cells (Roskams et al., 1996 ; Miwa et al., 1998 ).
This suggests that NGF acts directly on basal cells as a signal for
proliferation to induce repopulation of the olfactory epithelium after
injury (Fig. 11). Thus, NGF may act as a neuroproliferation-inducing
signal during regeneration, when it appears to be released from dying neurons during the wave of target-deprived ORN apoptosis (Roskams et
al., 1996 ).
After NGF-induced proliferation, at least a subset of NGF-treated cells
undergoes apoptosis. Our hypothesis that BDNF acts later in the ORN
life cycle than NGF suggests that subsequent exposure to BDNF might
rescue these cells and allow their continued proliferation/survival.
Sequential dependence on neurotrophins has been shown to occur in many
systems, including sensory and sympathetic neurons (Davies, 1994 ).
Previous work by others (Nef et al., 2001 ) has suggested that BDNF and
NT-3 are not necessary for normal embryonic development of the
olfactory epithelium, as measured by the ability of the epithelium to
form and the presence of ORN axons in the olfactory bulb. Our work,
however, suggests that BDNF, as well as NGF, plays a role in
maintaining a homeostatic neuronal population in the olfactory
epithelium postnatally.
CNP was able to inhibit both BDNF- and NGF-induced proliferation of
NST-positive neurons. The fact that CNP acts on both BDNF- and
NGF-treated cells suggests that it may act on at least two developmentally distinct populations, basal cells and their
proliferating daughter cells. Furthermore, CNP promotes the
differentiation of BDNF-treated neurons, based on process outgrowth
analysis and its ability to increase the number of OMP-labeled mature
neurons in culture. CNP also appears to promote survival of these cells and is able to save NGF-treated cells from subsequent apoptosis. In the
case of NGF-treated cells, we also suspect that CNP induces differentiation to the next natural check point in maturation, the
formation of daughter neurons. In the absence of specific markers for
this stage, however, we cannot definitively demonstrate this activity.
This role is supported by process outgrowth data, which show that
treatment with CNP and NGF increases process outgrowth only to control
values and not above, suggesting that additional maturation occurs normally.
We suggest that NGF, BDNF, and CNP may act in a sequential or
combinatorial pattern to promote the maturation of ORNs within the
olfactory epithelium. Specifically, NGF acts to promote basal cell
proliferation to form daughter cells, BDNF acts to promote rapid
proliferation of daughter cells, and CNP acts on either cell type to
promote differentiation to the next maturational checkpoint. Previous
work has shown that checkpoints exist subsequent to both basal and
daughter cell proliferation within the olfactory epithelium (Calof et
al., 1998 ). It also has been shown that the presence of a large number
of differentiated neurons in culture with ORN basal cells inhibits
their proliferation (Calof et al., 1998 ). It may be that this
inhibitory factor is CNP. That CNP would act only on cells previously
induced to proliferate by exposure to growth factors seems logical, in
that unregulated proliferation of these cells would be detrimental for
maintenance of a homeostatic population of ORNs within the olfactory
epithelium. Thus, the effect of CNP may be viewed as a form of
autoregulation that takes place within the olfactory epithelium to
maintain a homeostatic population.
The effect of CNP on BDNF- or NGF-treated cells appears to be specific
for CNP and is not mimicked by either ANP or BNP (data not shown). It
is, however, mimicked by 8-bromo-cGMP. Previous work has suggested that
cGMP has both mitogenic and anti-mitogenic effects. Transient increases
in cGMP are seen after reinitiation of growth in quiescent fibroblasts
(Rudland et al., 1974 ). Alternatively, nitric oxide (NO)
donors, acting through stimulation of soluble guanylyl cyclase and the
subsequent production of cGMP, have anti-mitogenic effects and
potentiate the development of catecholaminergic traits in cultures of
chick sympathetic neurons (Zurn, 1991 ). cGMP-stimulated PKG and PKA
activities have been shown to both stimulate and inhibit MAPK pathway
activity (Browning et al., 2000 ; Gudi et al., 2000 ; Schwarz et al.,
2000 ). PKG has been implicated as both a mitogenic and anti-mitogenic
mediator (Hindley et al., 1997 ; Firestein and Bredt, 1998 ), whereas PKA
has been suggested to play an anti-mitotic role (Cornwell et al.,
1994 ). cGMP analogues have also been shown to prevent spinal cord motor
neuron apoptosis during the period of programmed cell death (Weill and
Greene, 1984 ). Our data support all of these roles for cGMP, suggest
that they may even occur in the same cell type, depending on cellular
environment, and provide a context for the pleiotrophic effects seen in
response to many factors. In the absence of BDNF, CNP either has no
effect or occasionally shows a modest proliferative effect on ORNs in culture; however, in the presence of either BDNF or NGF, CNP displays strong anti-mitogenic effects.
We have examined the mechanisms that mediate the actions of these
factors in ORN precursors. Addition of the MEK inhibitor PD987059
inhibits the ability of BDNF to induce proliferation by ~50%.
Western blot analysis also reveals that CNP blocks BDNF-induced MAPK
phosphorylation within 30 min. However, CNP requires at least 1-2 hr
to inhibit BDNF-induced proliferation, suggesting that additional steps
are involved. CNP also requires protein synthesis to exert its affects
on BDNF- and NGF-induced proliferation. CHX blocks the ability of CNP
to inhibit neurotrophin-induced proliferation 2 hr after addition. The
mechanism that leads to this alteration of protein expression has not
been completely explored; however, the time course of MEK inhibitor
action suggests that activation of the MAPK pathway precedes this step.
Previous work in this laboratory has shown that cGMP analogues are able
to promote cAMP response element-binding protein (CREB) phosphorylation
through their subsequent elevation of cAMP levels and activation of PKA (Moon et al., 1999 ), and others have suggested that both
cGMP-stimulated activation of adenylyl cyclase and PKG may lead to CREB
phosphorylation and alteration of gene expression (Moon et al., 1999 ;
Gudi et al., 2000 ). Some candidate products for CNP-induced gene
expression are cell-cycle regulatory proteins.
Our findings demonstrate a role for BDNF, NGF, and CNP in regulating
neurogenesis in the olfactory epithelium. These results should be
especially relevant to stem cell research in the hippocampus, where
both factors are present, and application of BDNF leads to only partial
process outgrowth from stem cells (Shetty and Turner, 1999 ). In
addition, NO donors that cause the production of cGMP through
stimulation of soluble guanylyl have already been shown to promote
increased neurite outgrowth in hippocampal cell lines (Hindley et al.,
1997 ). Although in this case no additional growth factor was added,
these cells were cocultured with astrocytes, a potential source of
unidentified trophic factors. It may be that CNP is the endogenous
source of cGMP production in these neurons. The existence of high
levels of CNP and GC-B throughout the brain suggests developmental
roles for this peptide and its receptor in a variety of neuronal cell types.
 |
FOOTNOTES |
Received Jan. 30, 2002; revised April 12, 2002; accepted April 19, 2002.
This work was supported by National Institute on Deafness and Other
Communication Disorders Grant DC-2979 and National Institute of
Neurological Disorders and Stroke Grant NS-39657 to G.V.R. and by
National Institutes of Health National Research Service Award F32 DC
00406 to P.J.S. We thank Luis Parada (University of Texas at
Southwestern, Dallas, TX), Valéry Matarazzo, Debby R. Cohen, and David Ginty for helpful discussions and reading of this
manuscript, Kris Palczewski (University of Washington, Seattle,
WA) for anti-GC-B antibodies, and Lana Kramer for manuscript preparation.
Correspondence should be addressed to Dr. Gabriele V. Ronnett,
Department of Neuroscience, 1006B Preclinical Teaching Building, Johns
Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205. E-mail: gronnett{at}jhmi.edu.
 |
REFERENCES |
-
Abe K
(2000)
Therapeutic potential of neurotrophic factors and neural stem cells against ischemic brain injury.
J Cereb Blood Flow Metab
20:1393-1408[Medline].
-
Ajiro K,
Yoda K,
Utsumi K,
Nishikawa Y
(1996)
Alteration of cell cycle-dependent histone phosphorylations by okadaic acid. Induction of mitosis-specific H3 phosphorylation and chromatin condensation in mammalian interphase cells.
J Biol Chem
271:13197-13201[Abstract/Free Full Text].
-
Alessi DR,
Cuenda A,
Cohen P,
Dudley DT,
Saltiel AR
(1995)
PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo.
J Biol Chem
270:27489-27494[Abstract/Free Full Text].
-
Anastasiadis PZ,
Bezin L,
Imerman BA,
Kuhn DM,
Louie MC,
Levine RA
(1997)
Tetrahydrobiopterin as a mediator of PC12 cell proliferation induced by EGF and NGF.
Eur J Neurosci
9:1831-1837[Web of Science][Medline].
-
Barber RD,
Jaworsky DE,
Yau K-W,
Ronnett GV
(2000)
Isolation and in vitro differentiation of conditionally immortalized murine olfactory receptor neurons.
J Neurosci
20:3695-3704[Abstract/Free Full Text].
-
Bayer S,
Altman J
(1995)
Neurogenesis and neuronal migration.
In: The rat nervous system (Paxinos G,
ed), pp 1041-1078. London: Academic.
-
Brown J,
Zuo Z
(1995)
Natriuretic peptide receptors in the fetal rat.
Am J Physiol
269:E253-E268[Abstract/Free Full Text].
-
Browning DD,
McShane MP,
Marty C,
Ye RD
(2000)
Nitric oxide activation of p38 mitogen-activated protein kinase in 293T fibroblasts requires cGMP-dependent protein kinase.
J Biol Chem
275:2811-2816[Abstract/Free Full Text].
-
Buckland M,
Cunningham AM
(1998)
Alterations in the neurotrophic factors BDNF, GDNF, and CNTF in the regenerating olfactory system.
Ann NY Acad Sci
855:260-265[Web of Science][Medline].
-
Buckland M,
Cunningham AM
(1999)
Alterations in expression of the neurotrophic factors glial cell line-derived neurotrophic factor, ciliary neurotrophic factor, and brain-derived neurotrophic factor, in the target deprived olfactory neuroepithelium.
Neuroscience
90:333-347[Web of Science][Medline].
-
Calderone A,
Thaik CM,
Takahashi N,
Chang DL,
Colucci WS
(1998)
Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts.
J Clin Invest
101:812-818[Web of Science][Medline].
-
Calof AL,
Rim PC,
Askins KJ,
Mumm JS,
Gordon MK,
Iannuzzelli P,
Shou J
(1998)
Factors regulating neurogenesis and programmed cell death in mouse olfactory epithelium.
Ann NY Acad Sci
855:226-229[Medline].
-
Calza L,
Giardino L,
Pozza M,
Bettelli C,
Micera A,
Aloe L
(1998)
Proliferation and phenotype regulation in the subventricular zone during experimental allergic encephalomyelitis: in vivo evidence of a role for nerve growth factor.
Proc Natl Acad Sci USA
95:3209-3214[Abstract/Free Full Text].
-
Chinkers M,
Garbers DL
(1991)
Signal transduction by guanylyl cyclases.
Annu Rev Biochem
60:553-575[Web of Science][Medline].
-
Chinkers M,
Chang DL,
Lowe M-S,
Chin H,
Goeddel DV,
Schulz S
(1989)
A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor.
Nature
338:78-83[Medline].
-
Chrisman TD,
Garbers DL
(1999)
Reciprocal antagonism coordinates C-type natriuretic peptide and mitogen-signaling pathways in fibroblasts.
J Biol Chem
274:4293-4299[Abstract/Free Full Text].
-
Constanzo RM
(1984)
Comparison of neurogenesis and cell replacement in the hamster olfactory system with and without a target (olfactory bulb).
Brain Res
307:295-301[Web of Science][Medline].
-
Cornwell TL,
Arnold E,
Boerth NJ,
Lincoln TM
(1994)
Inhibition of smooth muscle cell growth by nitric oxide and activation of cAMP-dependent protein kinase by cGMP.
Am J Physiol
267:C1405-C1413[Abstract/Free Full Text].
-
Cunningham AM,
Manis PB,
Reed RR,
Ronnett GV
(1999)
Olfactory receptor neurons exist as distinct subclasses of immature and mature cells in primary culture.
Neuroscience
93:1301-1312[Web of Science][Medline].
-
Davies AM
(1994)
The role of neurotrophins during successive stages of sensory neuron development.
Prog Growth Factor Res
5:263-289[Medline].
-
Dudley DT,
Pang L,
Decker SJ,
Bridges AJ,
Saltiel AR
(1995)
A synthetic inhibitor of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci USA
92:7686-7689[Abstract/Free Full Text].
-
Edwards BE,
Gearhart JD,
Wallach EE
(2000)
The human pluripotent stem cell: impact on medicine and society.
Fertil Steril
74:1-7[Web of Science][Medline].
-
Firestein BL,
Bredt DS
(1998)
Regulation of sensory neuron precursor proliferation by cyclic GMP-dependent protein kinase.
J Neurochem
71:1846-1853[Medline].
-
Fulle H-J,
Vassar R,
Foster DC,
Yang R-B,
Axel R,
Garbers DL
(1995)
A receptor guanylyl cyclase expressed specifically in olfactory sensory neurons.
Proc Natl Acad Sci USA
92:3571-3575[Abstract/Free Full Text].
-
Geffen R,
Goldstein RS
(1996)
Rescue of sensory ganglia that are programmed to degenerate in normal development: evidence that NGF modulates proliferation of DRG cells in vivo.
Dev Biol
178:51-62[Medline].
-
Goldstein RS,
Avivi C,
Geffen R
(1997)
In vivo NGF treatment increases proliferation in the primary sympathetic ganglia of chick embryos.
Dev Biol
181:116-120[Medline].
-
Graziadei PPC,
Monti-Graziadei M
(1978)
The olfactory system: a model for the study of neurogenesis and axon regeneration in mammals.
In: Neuronal plasticity (Cotman CW,
ed), pp 131-153. New York: Raven.
-
Graziadei PPC,
Monti-Graziadei GA
(1979)
Neurogenesis and neuron regeneration in the olfactory system of mammals.
J Neurocytol
8:1-18[Medline].
-
Graziadei PPC,
Monti-Graziadei GA
(1983)
Regeneration in the olfactory system of vertebrates.
Am J Otolaryngol
4:228-233[Web of Science][Medline].
-
Gudi T,
Casteel DE,
Vinson C,
Boss GR,
Pilz RB
(2000)
NO activation of fos promoter elements requires nuclear translocation of G-kinase I and CREB phosphorylation but is independent of MAP kinase activation.
Oncogene
19:6324-6333[Medline].
-
Hansel DE,
Eipper BA,
Ronnett GV
(2001a)
Neuropeptide Y functions as a neuroproliferative factor.
Nature
410:940-944[Medline].
-
Hansel DE,
May V,
Eipper BA,
Ronnett GV
(2001b)
PACAP peptides and
-amidation in olfactory neurogenesis and neuronal survival in vitro.
J Neurosci
21:4625-4636[Abstract/Free Full Text]. -
Herman JP,
Dolgas CM,
Rucker D,
Langub MC
(1996)
Localization of natriuretic peptide-activated guanylate cyclase mRNAs in the rat brain.
J Comp Neurol
369:165-187[Web of Science][Medline].
-
Hindley S,
Juurlink BH,
Gysbers JW,
Middlemiss PJ,
Herman MA,
Rathbone MP
(1997)
Nitric oxide donors enhance neurotrophin-induced neurite outgrowth through a cGMP-dependent mechanism.
J Neurosci Res
47:427-439[Web of Science][Medline].
-
Holcomb JD,
Mumm JS,
Calof AL
(1995)
Apoptosis in the neuronal lineage of the mouse olfactory epithelium: regulation in vivo and in vitro.
Dev Biol
172:307-323[Web of Science][Medline].
-
Huard JM,
Youngentob SL,
Goldstein BJ,
Luskin MB,
Schwob JE
(1998)
Adult olfactory epithelium contains multipotent progenitors that give rise to neurons and non-neural cells.
J Comp Neurol
400:469-486[Web of Science][Medline].
-
Jaworsky DE,
Matsuzaki O,
Borisy FF,
Ronnett GV
(1995)
Calcium modulates the rapid kinetics of the odorant-induced cyclic AMP signal in rat olfactory cilia.
J Neurosci
15:310-318[Abstract].
-
Jiang H,
Movsesyan V,
Fink Jr DW,
Fasler M,
Whalin M,
Katagiri Y,
Monshipouri M,
Dickens G,
Lelkes PI,
Guroff G,
Lazarovici P
(1997)
Expression of human p140trk receptors in p140trk-deficient, PC12/endothelial cells results in nerve growth factor-induced signal transduction and DNA synthesis.
J Cell Biochem
66:229-244[Medline].
-
Kastner A,
Moyse E,
Bauer S,
Jourdan F,
Brun G
(2000)
Unusual regulation of cyclin D1 and cyclin-dependent kinases cdk2 and cdk4 during in vivo mitotic stimulation of olfactory neuron progenitors in adult mouse.
J Neurochem
74:2343-2349[Web of Science][Medline].
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
-
Langub MC,
Dolgas CM,
Watson RE,
Herman JP
(1995)
The C-type natriuretic peptide receptor is the predominant natriuretic peptide receptor mRNA expressed in rat hypothalamus.
J Neuroendocrinol
7:305-309[Medline].
-
Learish RD,
Bruss MD,
Haak-Frendscho M
(2000)
Inhibition of mitogen-activated protein kinase kinase blocks proliferation of neural progenitor cells.
Brain Res Dev Brain Res
122:97-109[Medline].
-
Lee VM,
Pixley SK
(1994)
Age and differentiation-related differences in neuron-specific tubulin immunostaining of olfactory sensory neurons.
Brain Res Dev Brain Res
83:209-215[Medline].
-
Liebl DJ,
Tessarollo L,
Palko ME,
Parada LF
(1997)
Absence of sensory neurons before target innervation in brain-derived neurotrophic factor-, neurotrophin 3-, and TrkC-deficient embryonic mice.
J Neurosci
17:9113-9121[Abstract/Free Full Text].
-
Mackay-Sim A,
Kittel PW
(1991)
Cell dynamics in the adult mouse olfactory epithelium: a quantitative autoradiographic study.
J Neurosci
11:979-984[Abstract].
-
Mackay-Sim A,
Chuah MI
(2000)
Neurotrophic factors in the primary olfactory pathway.
Prog Neurobiol
62:527-559[Web of Science][Medline].
-
Mahadevan LC,
Willis AC,
Barratt MJ
(1991)
Rapid histone H3 phosphorylation in response to growth factors, phorbol esters, okadaic acid, and protein synthesis inhibitors.
Cell
65:775-783[Web of Science][Medline].
-
Margolis FL
(1985)
Olfactory marker protein: from PAGE band to cDNA clone.
Trends Neurosci
8:542-546.
-
Miwa T,
Horikawa I,
Uramoto N,
Ishimaru T,
Yamamoto K,
Furukawa M,
Kato T,
Moriizumi T
(1998)
TrkA expression in mouse olfactory tract following axotomy of olfactory nerves.
Acta Otolaryngol Suppl
539:79-82[Medline].
-
Miyazawa K,
Himi T,
Garcia V,
Yamagishi H,
Sato S,
Ishizaki Y
(2000)
A role for p27/Kip1 in the control of cerebellar granule cell precursor proliferation.
J Neurosci
20:5756-5763[Abstract/Free Full Text].
-
Moon C,
Sung YK,
Reddy R,
Ronnett GV
(1999)
Odorants induce the phosphorylation of the cAMP response element binding protein in olfactory receptor neurons.
Proc Natl Acad Sci USA
96:14605-14610[Abstract/Free Full Text].
-
Morrison EE,
Costanzo RM
(1990a)
Morphology of the human olfactory epithelium.
J Comp Neurol
297:1-13[Web of Science][Medline].
-
Morrison EE,
Costanzo RM
(1990b)
Morphology of olfactory epithelium in humans and other vertebrates.
Microscopy Res Tech
23:49-61.
-
Morrison EE,
Moran DT
(1995)
Anatomy and ultrastructure of the human olfactory neuroepithelium.
In: Handbook of olfaction and gustation (Doty RL,
ed), pp 75-101. New York: Marcel Dekker.
-
Nakamura T,
Sanokawa R,
Sasaki Y,
Ayusawa D,
Oishi M,
Mori N
(1996)
N-Shc: a neural-specific adapter molecule that mediates signaling from neurotrophin/Trk to Ras/MAPK pathway.
Oncogene
13:1111-1121[Web of Science][Medline].
-
Nef S,
Lush ME,
Shipman TE,
Parada LF
(2001)
Neurotrophins are not required for normal embryonic development of olfactory neurons.
Dev Biol
234:80-92[Web of Science][Medline].
-
Osada T,
Ichikawa M,
Costanzo RM
(1995)
In nestin a marker for chemosensory precursor cells?
Brain Res
683:254-257[Web of Science][Medline].
-
Porter JG,
Catalano R,
McEnroe G,
Lewicki JA,
Protter AA
(1992)
C-type natriuretic peptide inhibits growth factor-dependent DNA synthesis in smooth muscle cells.
Am J Physiol
263:C1001-C1006[Abstract/Free Full Text].
-
Rijzewijk JJ,
Erp PEV,
Bauer FW
(1989)
Two binding sites for Ki67 related to quiescent and cycling cells in human epidermis.
Acta Derm Venereol
69:512-515[Medline].
-
Ronnett GV,
Hester LD,
Snyder SH
(1991)
Primary culture of neonatal rat olfactory neurons.
J Neurosci
11:1243-1255[Abstract].
-
Ronnett GV,
Cho H,
Hester LD,
Wood SF,
Snyder SH
(1993)
Odorants differentially enhance phosphoinositide turnover and adenylyl cyclase in olfactory receptor neuronal cultures.
J Neurosci
13:1751-1758[Abstract].
-
Roskams AJ,
Bethel MA,
Hurt KJ,
Ronnett GV
(1996)
Sequential expression of Trks A, B, and C in the regenerating olfactory neuroepithelium.
J Neurosci
16:1294-1307[Abstract/Free Full Text].
-
Roskams AJI,
Cai X,
Ronnett GV
(1998)
Expression of neuron-specific
-III tubulin during olfactory neurogenesis in the embryonic and adult rat.
Neuroscience
83:191-200[Web of Science][Medline]. -
Rosser AE,
Tyers P,
Dunnett SB
(2000)
The morphological development of neurons derived from EGF- and FGF-2-driven human CNS precursors depends on their site of integration in the neonatal rat brain.
Eur J Neurosci
12:2405-2413[Medline].
-
Rudland PS,
Seeley M,
Seifert W
(1974)
Cyclic GMP and cyclic AMP levels in normal and transformed fibroblasts.
Nature
251:417-419[Medline].
-
Ryan MC,
Gundlach AL
(1998)
Ontogenic expression of natriuretic peptide mRNAs in postnatal rat brain: implications for development?
Brain Res Dev Brain Res
105:251-268[Medline].
-
Schultz E
(1960)
Repair of olfactory mucosa, with special reference to regeneration of olfactory cells (sensory neurones).
Am J Pathol
37:1-19[Medline].
-
Schwarz UR,
Kobsar AL,
Koksch M,
Walter U,
Eigenthaler M
(2000)
Inhibition of agonist-induced p42 and p38 mitogen-activated protein kinase phosphorylation and CD40 ligand/P-selectin expression by cyclic nucleotide-regulated pathways in human platelets.
Biochem Pharmacol
60:1399-1407[Medline].
-
Shetty AK,
Turner DA
(1998)
In vitro survival and differentiation of neurons derived from epidermal growth factor-responsive postnatal hippocampal stem cells: inducing effects of brain-derived neurotrophic factor.
J Neurobiol
35:395-425[Web of Science][Medline].
-
Shetty AK,
Turner DA
(1999)
Neurite outgrowth from progeny of epidermal growth factor-responsive hippocampal stem cells is significantly less robust than from fetal hippocampal cells following grafting onto organotypic hippocampal slice cultures: effect of brain-derived neurotrophic factor.
J Neurobiol
38:391-413[Medline].
-
Sieber-Blum M
(1998)
Growth factor synergism and antagonism in early neural crest development.
Biochem Cell Biol
76:1039-1050[Web of Science][Medline].
-
Sudoh T,
Minamino N,
Kangawa K,
Matsuo H
(1990)
C-type natriuretic peptide (CNP): a new member of natriuretic peptide family identified in porcine brain.
Biochem Biophys Res Commun
168:863-870[Web of Science][Medline].
-
Suzuki M,
Kitanishi T,
Kitano H,
Yazawa Y,
Kitajima K,
Takeda T,
Tokunaga Y,
Maeda T,
Kimura H,
Tooyama I
(2000)
C-type natriuretic peptide-like immunoreactivity in the rat inner ear.
Hear Res
139:51-58[Medline].
-
Thomson JA,
Itskovitz-Eldor J,
Shapiro SS,
Waknitz MA,
Swiergeil JJ,
Marshall VS,
Jones JM
(1998)
Embryonic stem cell lines derived from human blastocytes.
Science
282:1145-1147[Abstract/Free Full Text].
-
Tohyama T,
Lee VMY,
Rorke LB,
Marvin M,
McKay RDG,
Trojanowski JQ
(1992)
Nestin expression in embryonic human neuroepithelium and in human neuroepithelial tumor cells.
Lab Invest
66:303-313[Web of Science][Medline].
-
Tsurimoto T
(1999)
PCNA binding proteins.
Front Biosci
4:D849-D858[Medline].
-
Uraih LC,
Maronpot RR
(1990)
Normal histology of the nasal cavity and application of special techniques.
Environ Health Perspect
85:187-208[Web of Science][Medline].
-
Vogel G
(1999)
Harnessing the power of stem cells.
Science
283:1432-1434[Free Full Text].
-
Vollmar AM,
Schmidt KN,
Schulz R
(1996)
Natriuretic peptide receptors on rat thymocytes: inhibition of proliferation by atrial natriuretic peptide.
Endocrinology
137:1706-1713[Abstract].
-
Wang MM,
Reed RR
(1993)
Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast.
Nature
364:121-126[Medline].
-
Weill CL,
Greene DP
(1984)
Prevention of natural motoneurone cell death by dibutyryl cyclic GMP.
Nature
308:452-454[Medline].
-
You L,
Kruse FE,
Volcker HE
(2000)
Neurotrophic factors in the human cornea.
Invest Ophthalmol Vis Sci
41:692-702[Abstract/Free Full Text].
-
Zimmerman L,
Parr B,
Lendahl U,
Cunningham M,
McKay R,
Gavin B,
Mann J,
Vassileva G,
McMahon A
(1994)
Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors.
Neuron
12:11-24[Web of Science][Medline].
-
Zurn AD
(1991)
Catecholaminergic traits of chick sympathetic neurons may be differentially regulated by a cGMP-dependent pathway.
Brain Res Dev Brain Res
58:105-110[Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22135536-16$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Clerico, F. A. Recchia, C. Passino, and M. Emdin
Cardiac endocrine function is an essential component of the homeostatic regulation network: physiological and clinical implications
Am J Physiol Heart Circ Physiol,
January 1, 2006;
290(1):
H17 - H29.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Moriya-Ito, T. Osada, Y. Ishimatsu, K. Muramoto, T. Kobayashi, and M. Ichikawa
Maturation of Vomeronasal Receptor Neurons In Vitro by Coculture with Accessory Olfactory Bulb Neurons
Chem Senses,
February 1, 2005;
30(2):
111 - 119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tamura, L. K. Doolittle, R. E. Hammer, J. M. Shelton, J. A. Richardson, and D. L. Garbers
Critical roles of the guanylyl cyclase B receptor in endochondral ossification and development of female reproductive organs
PNAS,
December 7, 2004;
101(49):
17300 - 17305.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tamura and D. L. Garbers
Regulation of the Guanylyl Cyclase-B Receptor by Alternative Splicing
J. Biol. Chem.,
December 5, 2003;
278(49):
48880 - 48889.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|