 |
Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2002, 22(14):5856-5864
Synaptic Calcium-Channel Function in Drosophila:
Analysis and Transformation Rescue of Temperature-Sensitive Paralytic
and Lethal Mutations of Cacophony
Fumiko
Kawasaki,
Stephen C.
Collins, and
Richard W.
Ordway
Department of Biology, The Pennsylvania State University,
University Park, Pennsylvania 16802
 |
ABSTRACT |
Voltage-gated calcium channels play a key role in chemical synaptic
transmission by providing the calcium trigger for regulated neurotransmitter release. Genes encoding the primary structural subunit, 1, as well as accessory subunits of presynaptic calcium channels have now been identified in a variety of organisms. The cacophony (cac) gene in Drosophila, also
known as nightblind A, encodes a voltage-gated
calcium-channel 1 subunit homologous to vertebrate 1 subunits
implicated in neurotransmitter release. A recent genetic screen in our
laboratory isolated cacTS2, a
conditional cac mutant exhibiting rapid paralysis at
elevated temperatures. This mutant has allowed synaptic
electrophysiology after acute perturbation of a specific
calcium-channel gene product, demonstrating that cac
encodes a primary calcium channel functioning in neurotransmitter
release. Here we report the molecular lesion in
cacTS2, a missense mutation within a
calcium-dependent regulatory domain of the 1 subunit, as well as
phenotypic rescue of temperature-sensitive and lethal
cac mutations by transgenic expression of a wild-type cac cDNA. Notably, rescue of rapid, calcium-triggered
neurotransmitter release was achieved by neural expression of a single
cDNA containing a subset of alternative exons and lacking any conserved
synaptic-protein interaction sequence. Possible implications of these
findings are discussed in the context of structure-function studies of synaptic calcium channels, as well as alternative splicing and mRNA
editing of the cac transcript.
Key words:
synapse; calcium channel; Drosophila; temperature-sensitive; alternative splicing; SYNPRINT
 |
INTRODUCTION |
Calcium channels implicated in
neurotransmitter release are composed of a primary structural subunit,
1, as well as , 2/ , and possibly subunits (for review,
see Catterall, 1998 ). The 1 subunit alone may form voltage-gated
calcium channels in heterologous expression systems; however,
coexpression of accessory subunits is thought to more closely reproduce
the function and regulation of endogenous channels (for review, see
Walker and De Waard, 1998 ; Ikeda and Dunlap, 1999 ). The 1 subunit
polypeptide is organized into four repeating domains, each including
six transmembrane segments (Fig.
1A). Vertebrate genes
encoding primary 1 subunits functioning in neurotransmitter release
include 1A (Cav2.1) and 1B
(Cav2.2), which encode P/Q- and N-type channels,
respectively. Both of these channel types have been localized to
presynaptic terminals (for review, see Stanley, 1997 ; Catterall, 1998 ),
and the pharmacology of these channels when expressed in heterologous systems is similar to that observed for neurotransmitter release.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
A missense mutation in
cacTS2. A, Presynaptic
voltage-gated calcium-channel 1 subunit topology.
Shading represents the plasma membrane. Roman
numerals refer to the four repeating domains, each including
six transmembrane segments (S1-S6). A charged S4 segment is thought to
serve as a voltage sensor. An intramembranous "P loop" between the
S5 and S6 segments of each repeat contributes to formation of the
channel pore. Both the N and C termini of the 1 subunit are
intracellular, and the four repeats are linked by three major
intracellular loops. Also represented are calcium-binding (EF
hand) and calmodulin-binding (IQ) domains within
the C-terminal cytoplasmic tail. B, The
cacTS2 mutation. Alignment of CAC with
related calcium-channel 1 subunit polypeptide sequences is shown.
Amino acid identities with CAC are shaded. Boxed
sequences correspond to the EF hand and a portion of the IVS6
transmembrane segment. The cacTS2
mutation, P1385S, maps to an invariant proline residue adjacent to the
EF hand. The aligned sequences correspond to CAC (U55776), rat brain
1A and 1B (M64373 and M92905, respectively), and
Caenorhabditis elegans UNC-2 (U25119).
|
|
Synaptic calcium channel diversity
The structural diversity of presynaptic calcium channels is
provided by different 1 subunit genes, as well as assembly of 1
with different combinations of accessory subunits. In contrast to the
closely related 1 subunit genes encoding vertebrate presynaptic calcium channels, cacophony (cac) appears to be
the only homologous gene in Drosophila (Smith et al., 1996 ;
Littleton and Ganetzky, 2000 ). Fly genes encoding L-type (Gielow et
al., 1995 ; Zheng et al., 1995 ; Ren et al., 1998 ) and T-type calcium
channels, as well as each of the known accessory subunits, have been
identified as well (Littleton and Ganetzky, 2000 ).
Another mechanism for generating presynaptic calcium-channel variants
involves alternative splicing of 1 subunit mRNAs. This process
acts on mammalian 1A and 1B transcripts to produce a variety of
mRNAs encoding different 1 subunit proteins (Lin et al., 1997 , 1999 ;
Bourinet et al., 1999 ; Hans et al., 1999 ; Krovetz et al., 2000 ; Pan and
Lipscombe, 2000 ). Similarly, alternative splicing of the cac
1 subunit mRNA contributes to calcium-channel diversity in
Drosophila (Smith et al., 1996 , 1998b ; Peixoto et al.,
1997 ). Several alternative exons have been described in cac, including two mutually exclusive exon pairs, IS4a/IS4b and I-IIa/I-IIb, as well as a 3, 6, or 9 bp insertion adding one to three amino acids to
the IVS3-IVS4 loop (Smith et al., 1996 ; results reported here).
The latter splicing site appears to be conserved in mammalian 1
subunit genes. At the equivalent position within the 1A and 1B
transcripts, inclusion of a 6 bp alternative exon adds two amino acids
to the IVS3-IVS4 loop and alters functional properties of the channels
(Lin et al., 1997 , 1999 ; Bourinet et al., 1999 ; Hans et al., 1999 ;
Krovetz et al., 2000 ). Additional mRNA splicing variants of
cac are reported in the present study.
Structural diversity of synaptic calcium channels may also be generated
through editing of 1 subunit mRNAs. A-to-I mRNA editing results in
conversion of adenosine residues to inosine, which may behave as
guanosine during translation (for review, see Reenan, 2001 ). Editing of
the cac transcript by this mechanism alters the
cac coding sequence at a number of positions (Smith et al., 1998a ; Palladino et al., 2000 ) (see Figure 3); however, the functional consequences of this editing remain to be determined. To date, editing
of calcium-channel transcripts has been described only in
Drosophila; however, editing of other mammalian ion-channel mRNAs and its functional consequences have been reported previously (Higuchi et al., 2000 ; Reenan, 2001 ).
Mechanisms of calcium-channel regulation
The gating of presynaptic calcium channels is regulated by several
mechanisms, including direct 1 subunit interactions with G-proteins,
calcium/calmodulin, and components of the neurotransmitter release
apparatus. Inhibition of neurotransmitter release by G-protein-linked receptor agonists occurs through direct interactions between the calcium-channel 1 subunit and  subunits of heterotrimeric
G-proteins (De Waard et al., 1997 ; Dunlap, 1997 ; Zamponi et al.,
1997 ; Mirotznik et al., 2000 ; Colecraft et al., 2001 ). Regulation by
G-proteins is antagonized by protein kinase C-mediated phosphorylation
of the 1 subunit (Zamponi et al., 1997 ; Herlitze et al., 2001 ), which has also been reported to increase basal calcium current (Yang
and Tsien, 1993 ). Another regulatory mechanism involves direct binding
of calcium/calmodulin to the IQ motif within the C-terminal
cytoplasmic domain of the 1 subunit and is thought to mediate
calcium-dependent channel gating, including facilitation and
inactivation (Lee et al., 1999 ; DeMaria et al., 2001 ; Erickson et al.,
2001 ). An EF hand calcium-binding motif within the same C-terminal region of the 1 subunit may also contribute to
calcium-dependent inactivation (Peterson et al., 2000 ). Finally,
interaction of presynaptic calcium-channel 1 subunits with syntaxin,
a core protein of the neurotransmitter release apparatus, has been
shown to regulate channel gating (Bezprozvanny et al., 1995 , 2000 ;
Degtiar et al., 2000 ) and also to promote regulation by G-proteins
(Stanley, 1997 ; Jarvis and Zamponi, 2001 ; Lü et al., 2001 ).
Binding of syntaxin and several other synaptic proteins to calcium
channels led to identification of a synaptic-protein interaction
(SYNPRINT) domain within the intracellular loop linking domains II and
III of 1A (P/Q-type) and 1B (N-type) subunits (for review, see
Sheng et al., 1998 ). This domain is proposed to mediate fast coupling of calcium influx to synaptic vesicle fusion by tethering calcium channels and the release apparatus and by participating in
calcium-channel regulation (Mochida et al., 1996 ; Sheng et al., 1998 ;
Wu et al., 1999 ; Zhong et al., 1999 ). Although our previous work has
shown that cac-encoded calcium channels function in fast,
calcium-triggered neurotransmitter release (Kawasaki et al., 2000 ), no
sequence homologous to known calcium-channel synaptic-protein
interaction domains is present in cac or elsewhere in the
fly genome (Kawasaki et al., 2000 ; Littleton and Ganetzky, 2000 ). These
findings suggest either a novel synaptic-protein interaction domain or
an alternative mechanism for the fast coupling of calcium influx to
synaptic vesicle fusion.
The central importance of presynaptic calcium channels has motivated
genetic analysis to investigate the in vivo functions of
specific calcium-channel proteins at native synapses (Schafer and
Kenyon, 1995 ; Dove et al., 1998 ; Lorenzon et al., 1998 ; Jun et al.,
1999 ; Saegusa et al., 2000 ; Ino et al., 2001 ). This presents several
challenges, including the long-term compensatory changes that may occur
in null or hypomorphic mutant animals (Jun et al., 1999 ; Saegusa et
al., 2000 ; Ino et al., 2001 ). Thus, temperature-sensitive (TS)
paralytic mutants of Drosophila provide an important and complementary tool allowing acute perturbation of specific gene products for analysis of the molecular mechanisms underlying
physiological processes. Our previous genetic (Dellinger et al., 2000 )
and electrophysiological (Kawasaki et al., 2000 ) studies of the TS
paralytic mutant cacTS2 demonstrated that
cac encodes a primary calcium-channel 1 subunit functioning in neurotransmitter release. Here we report
characterization of the molecular lesion underlying the TS paralytic
and synaptic phenotypes of cacTS2, as well
as rescue of cac mutants by transgenic expression of a
specific cac-encoded 1 subunit. These studies further
characterize a TS paralytic calcium-channel mutant and further define
the molecular determinants governing in vivo function of
presynaptic calcium channels.
 |
MATERIALS AND METHODS |
Fly stocks
cacTS2 was from our laboratory
stock collection. The cac lethal mutants
l(1)L1320-3 and
l(1)L13HC129 were generously provided by
Jeffrey C. Hall (Brandeis University, Waltham, MA). These were
established in the following balanced lines:
l(1)L1320-3/In(1)FM7i,
y93j sc8
w1 oc1
ptg1 B1
P{w+mC =
ActGFP}JMR3 and
l(1)L13HC129/In(1)FM7i,
y93j sc8
w1 oc1
ptg1 B1
P{w+mC =
ActGFP}JMR3. The X-linked elav-GAL4 enhancer trap
line, P(w+)
elavC155, was obtained from the Bloomington
Stock Center (Indiana University, Bloomington, IN). This driver
will be referred to as elav-GAL4. elav-GAL4
cacTS2, elav-GAL4
l(1)L1320-3, and elav-GAL4
l(1)L13HC129 recombinant chromosomes were
generated in our laboratory. Wild-type (WT) flies were Canton
S.
Molecular analysis
Preparation of head RNA. Fifty flies were placed in a
microcentrifuge tube, frozen in liquid nitrogen, and vortexed to remove the heads, which were collected and homogenized in 3 M LiCl and 6 M urea for
total RNA preparation by conventional methods.
Reverse transcriptase PCR. Total RNA from 50 heads
was used for first-strand cDNA synthesis by conventional methods using Moloney murine leukemia virus reverse transcriptase (RT)
(Invitrogen, Carlsbad, CA) and random oligonucleotide primers
(Invitrogen). A previously reported cac sequence (Smith et
al., 1996 ) was used to design primers for RT-PCR using the head cDNA
preparations as a template. The entire cac open reading
frame (ORF) was amplified in three segments using six primers. Two
different primer sets were used to generate slightly different PCR
fragments for sequencing (primer set 1) and cloning (primer set 2).
Primer set 1 included the following primer pairs (forward and reverse
primers in a pair are separated by a slash):
cac11-catcaacaggactccttagg/cac21-caccaccctgagatatgatg; cac12-cccgatagcactgttgactg/cac22-gaattttccaccgtacctag;
and
cac13-ggcacttccctatgtctgtt/cac23-cctgatgctatacccagatc. Primer set 2 included the following:
cac11-catcaacaggactccttagg/cac22B-cggtgaatcccatgttaatg; cac12-cccgatagcactgttgactg/cac22-gaattttccaccgtacctag;
and
cac12A-ccaaccaatcccatacgacg/cac23-cctgatgctatacccagatc. For direct sequencing of PCR products, PCRs were performed with Taq polymerase (PGC Scientific, Gaithersburg, MD), whereas
Pfu polymerase (Stratagene, La Jolla, CA) was used in reactions for cloning.
Sequencing. Direct sequencing of PCR products and sequencing
of cac clones was performed at the Penn State Nucleic Acids
Facility. Sequencing primers for each of the three cac ORF
fragments were designed on the basis of a previously reported
cac sequence (Smith et al., 1996 ). Because
cacTS2 was isolated as an extragenic
enhancer of comatoseST53 (Dellinger et
al., 2000 ), the cacTS2 mutation was
identified by comparing the cac ORF sequence from cacTS2 and the
comatoseST53 parent chromosome. Any
apparent sequence differences were re-examined in independent RNA
preparations. With respect to the published cac coding
sequence (U55776), three silent polymorphisms were detected in
cac ORF sequences; these were present in both
cacTS2 and the parent
comatoseST53 line. Sequence alignments
were performed by the Clustal method, using the Megalign feature of the
Lasergene Software Package (DNAStar, Madison, WI).
Cloning. Each of the three cac ORF fragments
generated with primer set 2 was cut at unique restriction sites and
cloned separately into the pBluescript
SK vector. These overlapping segments
(Fig. 2) were then assembled into a
single clone containing a complete ORF, which was subsequently shuttled into the KpnI and NotI sites of the
transformation vector, pUAST (Brand and Perrimon, 1993 ). Clones of ORF
segments B and C (Fig. 2) were toxic to several different strains of
bacteria. These could be propagated successfully in JM109 cells
(Promega, Madison, WI); however, only small colonies were obtained, and liquid cultures grew poorly. The presence of specific splice variants among the population of clones for each segment was determined by
sequencing and restriction mapping. As described in Results, two novel
alternative exons of 12 and 60 bp were found in the region
of the transcript encoding the C-terminal cytoplasmic tail of the 1
subunit. These were identified as contiguous exons in the
cac gene and have the following nucleotide sequences (60 bp, CGGAAGAAGCTGGAGCACGATGATGAGCATAAATATAGCCCAACGGCAGTCGAGGAGCCG; 12 bp, AACTGGAAGGAG).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 2.
Three overlapping cDNA clones assembled into a
clone containing the entire cac ORF. Details regarding
the generation and cloning of these segments are provided in Materials
and Methods. Nucleotide positions (in base pairs) correspond to those
of the cac cDNA sequence (U55776). The ORF is
represented as a gray bar.
|
|
Transgenic lines were generated essentially as described previously
(Karess and Rubin, 1984 ). Briefly, the transformation construct
UAS-cac1 in pUAST was prepared for injection by column purification (Plasmid Maxi Kit; Qiagen, Valencia, CA). DNA (0.8 µg/µl) was injected into the posterior pole of
w1118 embryos before cellularization.
Coinjection of the p 25.7wc plasmid (0.2 µg/µl) provided
transient expression of the P element transposase. The
w+ marker carried by pUAST was
used to select transformed progeny.
Transformation rescue
Rescue data were obtained using the third chromosome insertion
line UAS-cac1 256B. For rescue of both TS and lethal
cac phenotypes, eight independent UAS-cac1
insertion lines were tested; seven produced results similar to those of
UAS-cac1 256B. The remaining line was somewhat less
effective, producing rescue of cacTS2
paralysis but not full rescue of cac lethal mutants to adult viability.
Rescue of temperature-sensitive paralysis. All flies used
for behavioral tests were raised and maintained at room temperature (22-25°C). Paralysis at a given temperature was monitored as
described previously (Dellinger et al., 2000 ). Briefly, groups of six
flies were introduced into preheated vials and the time at which 50% of the flies were no longer standing was recorded (50% paralysis). For
tests exceeding 5 min in duration, the vials were humidified at 5 min
by adding water to the cotton plug sealing the vial.
Rescue of cac lethal phenotypes. Three different crosses
were performed to determine the adult viability of each cac
lethal mutant and each rescued cac lethal mutant
relative to that of males carrying a WT X chromosome. In rescue
crosses, elav-GAL4 l(1)L1320-3/FM7i and elav-GAL4
l(1)L13HC129/FM7i females were mated
to lines homozygous for a UAS-cac1 insertion. The extent of
rescue to WT viability was measured by determining the percentage of
total adult progeny represented by non-FM7i males (carrying
the lethal mutation but rescued by transgene expression) relative to
the percentage obtained from similar control crosses using
+/FM7i females. These data were expressed as percentage viability values, which were calculated as follows: (% non-FM7i male progeny from the rescue cross/%
non-FM7i male progeny from the control cross) × 100. Finally, viability of cac lethals in the absence
of UAS-cac1 was determined similarly in crosses of elav-GAL4 l(1)L1320-3/FM7i and
elav-GAL4 l(1)L13HC129/FM7i
females to WT (Canton S) males. All crosses were transferred frequently to prevent crowding of the vials.
Electrophysiology
Recordings of EPSCs from dorsal longitudinal muscle (DLM)
neuromuscular synapses of the adult were obtained and analyzed as described previously (Kawasaki et al., 1998 , 2000 ; Kawasaki and Ordway,
2000 ). Recordings were performed on 2- to 4-d-old flies raised at room
temperature (22-25°C).
Data analysis
Graphing and analysis of numerical data were performed in
Microsoft Excel (Microsoft, Seattle, WA). All data values throughout the text and bar graphs are given as means ± SEM.
Statistical analysis was performed using the two-tailed Student's
t test; significance was assigned to comparisons for which
p 0.05.
 |
RESULTS |
A missense mutation in cacTS2
To examine whether the cacTS2
mutation resides within coding sequence, the ORF of
cac was amplified by RT-PCR and sequenced. To distinguish
the induced mutation from any background polymorphisms present in the
cacTS2 strain, sequence from
cacTS2 was compared directly with the
cac ORF sequence from the parent chromosome on which the
cacTS2 mutation was generated (Dellinger
et al., 2000 ) (see Materials and Methods). Putative sequence
differences between cacTS2 and the parent
line were re-examined using independent RNA preparations. The only
nucleotide difference observed in cacTS2
(c4714t) creates a proline-to-serine missense mutation at amino acid
1385. Thus, the cacTS2 mutation maps to
the second proline of a highly conserved proline pair located adjacent
to the EF hand domain within the C-terminal cytoplasmic tail of the
1 subunit (Fig. 1B). This region of the channel is known to participate in calcium-dependent inactivation, raising the possibility that cacTS2
disrupts channel function by altering this regulatory process. By
arrangement, the laboratory of Dr. Jeffrey C. Hall sequenced cacTS2 independently and identified the
same missense mutation (B. Chan and J. C. Hall, Brandeis
University, personal communication).
Generation of a cac transgene: head cDNAs reflect
diversity of cac transcripts
As described in the introductory remarks, the cac gene
is known to express diverse transcripts that differ with respect to mRNA splicing and editing, and possibly in their temporal and/or spatial expression patterns (Smith et al., 1996 , 1998a ,b ; Peixoto et
al., 1997 ). In light of this complexity, the in vivo
expression of specific cac-encoded protein variants will be
an important tool in examining the structural determinants of
calcium-channel function. Thus, molecular constructs were generated to
allow in vivo expression of a specific cac cDNA.
Transgenic expression studies required generation of cac
cDNA clones containing a complete ORF, which have not been reported previously. Thus, RT-PCR was performed to generate cac cDNAs
for this purpose. On the basis of previous sequence analysis (Smith et
al., 1996 ), PCR primers were designed for RT-PCR amplification of
cac from head RNA (see Materials and Methods). The resulting PCR products were used to generate three overlapping clones spanning the entire cac ORF (Fig. 2, clones A-C). As discussed in
Materials and Methods, clones B and C were difficult to propagate in
several bacterial strains. Multiple clones were generated and
characterized for each ORF segment, revealing numerous cDNA variants
that differed with respect to mRNA splicing and editing (Fig.
3). Although previously published studies
of cac mRNA processing were performed on whole-body mRNA
(Smith et al., 1996 , 1998a ; Peixoto et al., 1997 ), most of the head
cDNA variants observed in the present study have been reported
previously. Several exceptions are described in Figure 3 (and see
Discussion). Notably, a novel site of alternative splicing was
identified in the region encoding the C-terminal cytoplasmic tail, and
is referred to here as the "C-terminal variable" region (Fig.
3A,B). In addition to clones corresponding to previously reported cac cDNAs covering this region, variants containing
insertions of 12 and 60 bp were observed as well. Both of these
nucleotide sequences were identified as single cac exons in
the Drosophila genome sequence (see Materials and Methods)
and were associated with canonical splice donor and acceptor sequences
at the intron-exon boundaries (Mount et al., 1992 ). Inclusion of
the 12 or 60 bp alternative exon results in the addition of 4 or 20 aa
adjacent to the IQ binding domain for calmodulin (Fig. 3A).
The protein sequences encoded by these exons are NWKE and
RKKLEHDDEHKYSPTAVEEP, respectively. The latter amino acid sequence
was used as a query in Basic Local Alignment Search Tool (BLAST)
searches of nonredundant protein and translated databases
(http://www.ncbi.nlm.nih.gov/BLAST); however, no clear matches outside
of the Drosophila cac gene were found.

View larger version (59K):
[in this window]
[in a new window]
|
Figure 3.
Diversity of cac head mRNA
transcripts. Nucleotide and amino acid positions correspond to those of
the cac cDNA sequence (U55776). Most variants were
identified previously in the analysis of whole-body mRNA, with the
following exceptions: *1, The variant lacking both I-IIa
and I-IIb. *2, The C-terminal variable alternative
exons. *3, Editing of nucleotide 936; however, this has
been documented by others in recent analysis of whole body mRNA (see
Discussion).
|
|
Clones for each of the three ORF segments were chosen to be assembled
into a clone spanning the entire cac ORF. The specific clone
selected for each segment represented the editing or splicing variant
most abundant in the cDNA population and/or the most conserved with
respect to vertebrate presynaptic calcium channels (Fig. 4A). For example,
alternative exon I-IIb was included in the transgene construct because
it was more abundant than I-IIa among head cDNAs and includes protein
binding motifs strongly conserved with those of mammalian presynaptic
calcium channels (Smith et al., 1996 ) (see Discussion). In addition,
previous work suggests that exon I-IIa may be eye-specific (Smith et
al., 1998b ).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4.
Neural expression of a specific WT
cac-encoded 1 subunit rescues TS paralysis of
cacTS2. A, Alternative
exons and edited sequences included in the UAS-cac1
transgene. B, Rescue of
cacTS2 paralytic behavior. Time for
50% paralysis was measured in WT,
cacTS2, and elav-GAL4
cacTS2;;UAS-cac1/+
(cacTS2 Rescue) at 38°C. Data and n
values are provided in Results. Behavioral tests in WT animals
were truncated after 50 min. The time for 50% paralysis values
obtained in
cacTS2Rescue
experiments was significantly different from that obtained for
cacTS2 alone
(p 0.05).
|
|
Transformation rescue of temperature-sensitive behavioral and
synaptic phenotypes in cacTS2
The clone including the entire cac ORF was shuttled
into the pUAST transformation vector to produce the transgene referred to as UAS-cac1. The pUAST vector contains multiple binding
sites for the yeast transcription factor GAL4; thus, controlled
expression can be achieved using available drivers expressing GAL4 in
different temporal and spatial expression patterns (Brand and Perrimon, 1993 ). Transgenic flies were generated to examine whether expression of
the UAS-cac1 transgene could rescue the
cacTS2 paralytic phenotype. In light of
previous work in embryos indicating that cac is expressed in
the nervous system (Smith et al., 1996 ), as well as our recent studies
showing a presynaptic role for cac at adult neuromuscular
synapses (Kawasaki et al., 2000 ), we chose to drive expression
specifically in the nervous system. A GAL4 enhancer trap
element in the pan-neurally expressed elav gene (Robinow and
White, 1988 ; Lin and Goodman, 1994 ) was combined with a
UAS-cac1 transgene in a cacTS2
mutant background. Neural expression of UAS-cac1 produced
striking rescue of cacTS2 paralysis at
38°C (Fig. 4B), increasing the time for paralysis from 0.27 ± 0.01 min (n = 5) in
cacTS2 alone to 39.19 ± 2.16 min
(n = 6) in the presence of the transgene. Neither the
elav-GAL4 driver nor the UAS-cac1 transgene alone produced rescue, as expected from the requirement for both elements to
drive expression.
To examine rescue of cacTS2 in more
detail, voltage-clamp analysis of synaptic currents at DLM
neuromuscular synapses was performed to determine whether the synaptic
phenotype of cacTS2 was also rescued. As
described previously (Kawasaki et al., 2000 ), cacTS2 exhibited a WT synaptic current at
20°C and a marked reduction in synaptic current amplitude with
respect to WT at 36°C (Fig. 5A). In contrast,
cacTS2Rescue flies carrying the
elav-GAL4 driver and UAS-cac1 transgene exhibited marked rescue of this synaptic phenotype (Figs.
5A,B). With respect to WT, synaptic current amplitudes in
cacTS2 and
cacTS2Rescue flies were
38.1 ± 2.6% (n = 4) and 80.2 ± 5.6%
(n = 4), respectively. The above results confirm the
presynaptic nature of the cacTS2 phenotype
(Kawasaki et al., 2000 ) and show that the specific 1 subunit variant
expressed from the UAS-cac1 transgene can support fast,
calcium-triggered neurotransmitter release (see Discussion).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 5.
Rescue of the TS synaptic phenotype in
cacTS2. A,
Representative synaptic current recordings from DLM neuromuscular
synapses of WT, cacTS2, and
elav-GAL4
cacTS2;;UAS-cac1/+
(cacTS2 Rescue). Arrows indicate
stimulation of the cut motor axon. Stimulation artifacts were removed
for clarity. B, Mean EPSC amplitudes relative to WT at
36°C. Data and n values are provided in
Resutls. The synaptic current in
cacTS2Rescue
experiments was significantly different from
cacTS2 alone
(p 0.05). Comparison of the synaptic
current amplitudes in
cacTS2Rescue with those
of WT resulted in a p value of 0.073.
|
|
Transformation rescue of cac lethal alleles
In addition to cacTS2 and other
viable cac mutations, lethal alleles of cac have
also been described. The lethal phase has been determined for several
cac lethal mutants, which exhibit lethality during late
embryogenesis just before hatching (Perrimon et al., 1989 ; Smith et
al., 1998b ; our unpublished observations). This late embryonic lethal
stage is consistent with analysis of cac expression during
development, which increases dramatically during late embryogenesis
(Smith et al., 1996 ); the similar lethal phenotypes of several mutants
suggest that late embryonic lethality may reflect a complete loss of
zygotic cac function. To further explore the molecular
determinants of calcium-channel function, as well as the importance of
calcium-channel diversity resulting from mRNA processing, we
subsequently examined whether the specific 1 subunit expressed from
the UAS-cac1 transgene could rescue cac lethal mutants.
Rescue of two different cac lethals,
l(1)L1320-3 and
l(1)L13HC129, was attempted by driving
neural expression of UAS-cac1 using the elav-GAL4
driver. This resulted in striking rescue of the embryonic lethal
phenotype in both mutants, producing viability similar to that of WT
controls (Fig. 6). Routine observation of
these rescued adults suggested that their motor behavior and activity were similar to WT, with the exception of wing function (see
Discussion), and that they were fertile. These results indicate that
neural expression of cac is sufficient to fulfill the
essential functions of this gene. Furthermore, the specific 1
subunit expressed from UAS-cac1 appears to provide
sufficient cac-encoded calcium-channel activity to support
robust neural function. The strong rescue of cac lethal
mutants is surprising given that the transgene was not expressed under
the control of the native cac promoter and that only a
single variant of many possible cac-encoded 1 subunits was expressed.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 6.
Rescue of cac lethal mutants. Three
different crosses were performed to determine the adult viability of
each cac lethal mutant and rescued cac
lethal mutant relative to males carrying a WT X chromosome
(percentage viability; see Materials and Methods).
+;;UAS-cac1/+ males (Control)
served as a reference for WT viability. In the absence of a
UAS-cac1 transgene, elav-GAL4
l(1)L1320-3 (L13 20-3) and
elav-GAL4 l(1)L13HC129 (L13
HC129) males were never observed, indicating uniform lethality.
In contrast, males of the genotypes elav-GAL4
l(1)L1320-3;;UAS-cac1/+
(L13 20-3 Rescue) and elav-GAL4
l(1)L13HC129;;UAS-cac1/+
(L13 HC129 Rescue) were clearly rescued and exhibited
viability similar to that of WT controls. The mean percentage viability
value obtained from five independent rescue experiments for each
genotype (n = 5) is indicated. Viability of
L13 20-3 Rescue and L13 HC129 Rescue males was
not significantly different from that of control males
(p > 0.05).
|
|
 |
DISCUSSION |
The present study takes further advantage of the
Drosophila genetic model system to investigate the molecular
determinants of synaptic function. The findings reported here identify
a missense mutation producing the TS paralytic and synaptic phenotypes
in cacTS2, and show that cac
lethal and TS mutants can be rescued by neural expression of a specific
cac cDNA. Together, these results further define the
structural basis of presynaptic calcium-channel function in
vivo.
The molecular lesion in cacTS2
A calcium-dependent regulatory domain within the C-terminal
cytoplasmic tail of the 1 subunit includes a conserved calmodulin binding site (Fig. 1A, IQ) and a conserved
EF hand calcium-binding domain. Together, the IQ and EF hand motifs are
thought to mediate a form of channel inactivation that is dependent on
calcium influx through the open channel (Peterson et al., 2000 ; DeMaria
et al., 2001 ). The cacTS2 mutation
(P1385S) substitutes serine for the second proline of a highly
conserved proline pair adjacent to the EF hand (Fig. 1B). Proline pairs are generally excluded from
classical secondary structures, such as helices and strands,
and instead are found in flexible loop and hinge regions (MacArthur and
Thornton, 1991 ; Branden and Tooze, 1999 ). In light of recent models of
calcium-dependent channel inactivation involving structural
rearrangements of this regulatory domain (DeMaria et al., 2001 ;
Erickson et al., 2001 ), it is possible that proline 1385 participates
in folding transitions associated with calcium-dependent inactivation.
In cacTS2, enhanced steady-state channel
inactivation at elevated temperatures might account for reduced
neurotransmitter release. Additional investigation of this issue will
await direct analysis of WT and cacTS2
channel behavior at permissive and restrictive temperatures.
Alternative splicing of cac head mRNA
The present study does not include a systematic analysis of
alternative splicing; however, our survey of cac transcripts
in head mRNA led to a few notable observations. One was the appearance of a novel site of alternative splicing producing variation within the
C-terminal cytoplasmic tail of the 1 subunit (Fig. 3B).
cDNA variants including either a 12 or 60 bp alternative exon at this position, as well as those lacking either exon, were observed. The
close proximity of this C-terminal variable region to the IQ binding
domain for calmodulin raises the possibility that the resulting channel
variants may differ in their regulation by calmodulin. Given that the
UAS-cac1 transgene did not include either the 12 or 60 bp
exon, these sequences are not essential for rapid neurotransmitter release.
Another novel splice variant lacked both the I-IIa and I-IIb exons.
Alternative exon I-IIb includes binding motifs for calcium-channel subunits and heterotrimeric G-protein subunits that are highly conserved with respect to vertebrate presynaptic calcium-channel 1
subunits (Smith et al., 1998b ). In contrast, exon I-IIa is less
conserved and lacks a primary G-protein binding motif, QQxxRxLxGY. Thus, variation in these exons, including their absence in certain 1
subunit variants, creates the potential for differential regulation of
distinct 1 subunits (Smith et al., 1998b ). The conserved I-IIb alternative exon is present in the UAS-cac1 transgene.
A final consideration is the role of alternative exons that produce
variation within the IVS3-IVS4 extracellular loop. In mammalian
synaptic calcium-channel 1 subunits, inclusion of NP ( 1A)
or ET ( 1B) sequences within this loop has been reported to alter
channel activation, inactivation, and pharmacology (Lin et al., 1997 ,
1999 ; Bourinet et al., 1999 ; Hans et al., 1999 ; Krovetz et al., 2000 ).
Similar variation is generated by alternative splicing of the
cac transcript, producing a one to three amino acid
insertion at the same position. Interestingly, most cac mRNA variants in Drosophila heads lack any alternative exon in
the sequence encoding the IVS3-IVS4 loop, perhaps consistent with work
indicating that the analogous alternative exons in mouse 1A and
1B are enriched in the peripheral nervous system (Lin et al., 1999 ).
It remains an open question whether variation in the IVS3-IVS4 loop of
the cac-encoded 1 subunit serves a conserved functional
role. However, the UAS-cac1 transgene lacks alternative exons at this site, suggesting that 1 subunit sequences encoded by
these exons are not critical for calcium-channel function in neurotransmitter release.
A-to-I mRNA editing
As in the case of alternative splicing, previous studies of
cac mRNA editing have been performed using whole-fly RNA
preparations. In the present study, only a qualitative survey of
editing in head RNA was conducted; however, all of the reported sites
were observed. In addition, sequence data were consistent with a novel editing event at nucleotide 936 (Fig. 3). On the basis of genomic and
whole-fly cDNA sequence comparisons performed by others, position 936 has been confirmed as an mRNA editing site (Chan and Hall, personal
communication). A subset of edited sites was present in the
UAS-cac1 transgene. Although it is possible that the mRNA produced by this transgene is edited, we consider this unlikely because
editing of mRNAs, including cac, may require intronic sequences (Smith et al., 1998a ). Thus, edited sequences absent from the
transgene are probably not required for fast, calcium-triggered neurotransmitter release. With respect to the general role of editing
in Drosophila, recent studies of a mutant thought to lack A-to-I mRNA editing of all transcripts revealed a moderate phenotype (Palladino et al., 2000 ). Although this mutant exhibited behavioral phenotypes and progressive deterioration of the adult nervous system,
A-to-I mRNA editing in general does not appear to be essential for
basic neural development or function.
Rescue of cac mutants by neural expression of the
UAS-cac1 transgene
As discussed above, neural expression of the UAS-cac1
transgene produced striking rescue of both TS paralytic and embryonic lethal cac mutants. Synaptic current recordings demonstrate
that the specific 1 subunit variant encoded by the transgene can
support fast neurotransmitter release at neuromuscular synapses and
confirm previous findings demonstrating a presynaptic role for the
cac gene product (Kawasaki et al., 2000 ). Because
cac encodes the only Drosophila homolog of
vertebrate presynaptic calcium-channel 1 subunits and is expressed
broadly in the embryonic CNS (Smith et al., 1996 ), it is likely
that the same UAS-cac1 transgene product can support robust
synaptic transmission in the CNS as well.
One surprising finding related to rescue of cac lethals was
an apparent defect in the wing function of rescued adult flies. No
formal behavioral analysis was performed; however, it was clear from
routine observation that rescued flies were flightless and did not beat
their wings under usual flight conditions. No gross morphological
abnormalities were apparent in dissected preparations of cac
lethal mutants rescued to the adult stage; however, DLM neuromuscular
synapses in these preparations produced only small synaptic currents
ranging from 0 to 40% of WT amplitude (our unpublished results). The
reason for the observed defect in wing function remains unclear. Rescue
of the cacTS2 synaptic phenotype confirms
that the pan-neural elav-GAL4 driver induces expression in
the motor neurons innervating the DLMs. However, proper development of
these connections may require precise temporal and spatial control of
cac expression, or perhaps a specific cac-encoded
1 subunit variant, that is not reproduced by expression of the
UAS-cac1 transgene under the control of
elav-GAL4. Perhaps coincidentally, cac mutants
were first identified in a phenotypic screen for alterations in the
precise wing-beat patterns comprising the male courtship song (von
Schilcher, 1976 , 1977 ; Smith et al., 1998b ). In combination with viable
cac mutants exhibiting song phenotypes, the availability of
cac transgenes that may be driven in different temporal and
spatial expression patterns may provide new insights into the cellular
and molecular basis of the courtship song.
Absence of a conserved SYNPRINT domain within the calcium-channel
1 subunit does not prevent rapid coupling of calcium influx to
neurotransmitter release
Previous work on the Drosophila cac gene
indicated that the Drosophila genome contains no sequences
related to characterized calcium-channel synaptic protein binding
domains (Kawasaki et al., 2000 ; Littleton and Ganetzky, 2000 ). The
present study extends this observation by demonstrating directly that a
specific calcium-channel 1 subunit lacking these sequences functions
in fast, calcium-triggered neurotransmitter release. These findings
indicate either that the cac-encoded 1 subunit contains
an analogous but distinct synaptic protein binding domain or that such
domains do not play a critical role in synaptic transmission. Recent
work in another system has shown that syntaxin-mediated enhancement of
slow calcium-channel inactivation does not require the SYNPRINT domain,
although this regulation was more effective on SYNPRINT-containing
channels (Bezprozvanny et al., 2000 ). Together, these results suggest
that multiple biochemical and functional interactions between
calcium-channel 1 subunits and synaptic proteins may contribute to
regulation of neurotransmitter release.
The present study further defines the determinants of synaptic
calcium-channel function in Drosophila through molecular
analysis of cacTS2, as well as rescue of
cac mutants by neural expression of a specific cac-encoded 1 subunit. These findings also serve as the
basis for additional analysis in this model system, including direct studies of TS calcium-channel function produced by the
cacTS2 mutation, analysis of second-site
cac mutations that either enhance or suppress the
cacTS2 phenotype (Brooks et al., 2002 ),
and a variety of investigations that require controlled expression of
specific cac-encoded 1 subunits in vivo.
 |
FOOTNOTES |
Received Jan. 2, 2002; revised April 18, 2002; accepted April 30, 2002.
This work was supported by grants from the National Institutes of
Health and the National Science Foundation and by The Pennsylvania State University President's Fund for Undergraduate Research. We thank
Jeffrey C. Hall for helpful discussions and for sharing unpublished observations.
Correspondence should be addressed to Richard W. Ordway, Department of
Biology, 208 Mueller Laboratory, Pennsylvania State University,
University Park, PA 16802. E-mail: rwo4{at}psu.edu.
 |
REFERENCES |
-
Bezprozvanny I,
Scheller RH,
Tsien RW
(1995)
Functional impact of syntaxin on gating of N-type and Q-type calcium channels.
Nature
378:623-626[Medline].
-
Bezprozvanny I,
Zhong P,
Scheller RH,
Tsien RW
(2000)
Molecular determinants of the functional interaction between syntaxin and N-type Ca2+ channel gating.
Proc Natl Acad Sci USA
97:13943-13948[Abstract/Free Full Text].
-
Bourinet E,
Soong TW,
Sutton K,
Slaymaker S,
Mathews E,
Monteil A,
Zamponi GW,
Nargeot J,
Snutch TP
(1999)
Splicing of
1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.
Nat Neurosci
2:407-415[Web of Science][Medline]. -
Brand AH,
Perrimon N
(1993)
Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:401-415[Abstract].
-
Branden C,
Tooze J
(1999)
In: Introduction to protein structure, Ed 2. New York: Garland.
-
Brooks IM, Felling R, Godeny MD, Ordway RW (2002) Genetic
modifiers of a temperature-sensitive paralytic calcium channel mutant
of Drosophila: genetic, molecular and phenotypic
characterization. Paper presented at the 43rd Annual
Drosophila Research Conference, San Diego.
-
Catterall WA
(1998)
Structure and function of neuronal Ca2+ channels and their role in neurotransmitter release.
Cell Calcium
24:307-323[Web of Science][Medline].
-
Colecraft HM,
Brody DL,
Yue DT
(2001)
G-protein inhibition of N- and P/Q-type calcium channels: distinctive elementary mechanisms and their functional impact.
J Neurosci
21:1137-1147[Abstract/Free Full Text].
-
Degtiar VE,
Scheller RH,
Tsien RW
(2000)
Syntaxin modulation of slow inactivation of N-type calcium channels.
J Neurosci
20:4355-4367[Abstract/Free Full Text].
-
Dellinger BB,
Felling R,
Ordway RW
(2000)
Genetic modifiers of the Drosophila NSF mutant, comatose, include a temperature-sensitive paralytic allele of the calcium channel
1 subunit gene, cacophony.
Genetics
155:203-211[Abstract/Free Full Text]. -
DeMaria CD,
Soong TW,
Alseikhan BA,
Alvania RS,
Yue DT
(2001)
Calmodulin bifurcates the local Ca2+ signal that modulates P/Q-type Ca2+ channels.
Nature
411:484-489[Medline].
-
De Waard M,
Liu H,
Walker D,
Scott VES,
Gurnett AA,
Campbell KP
(1997)
Direct binding of G-protein
 complex to voltage-dependent calcium channels.
Nature
385:446-450[Medline]. -
Dove LS,
Abbott LC,
Griffith WH
(1998)
Whole-cell and single-channel analysis of P-type calcium currents in cerebellar Purkinje cells of leaner mutant mice.
J Neurosci
18:7687-7699[Abstract/Free Full Text].
-
Dunlap K
(1997)
Integration hot-spot gets hotter.
Nature
385:394-397[Medline].
-
Erickson MG,
Alseikhan BA,
Peterson BZ,
Yue DT
(2001)
Preassociation of calmodulin with voltage-gated Ca2+ channels revealed by FRET in single living cells.
Neuron
31:973-985[Web of Science][Medline].
-
Gielow ML,
Gu G-G,
Singh S
(1995)
Resolution and pharmacological analysis of the voltage-dependent calcium channels of Drosophila larval muscles.
J Neurosci
15:6085-6093[Abstract].
-
Hans M,
Urrutia A,
Deal C,
Brust PF,
Stauderman K,
Ellis SB,
Harpold MM,
Johnson EC,
Williams ME
(1999)
Structural elements in domain IV that influence biophysical and pharmacological properties of human
1A-containing high-voltage-activated calcium channels.
Biophys J
76:1384-1400[Web of Science][Medline]. -
Herlitze S,
Zhong H,
Scheuer T,
Catterall WA
(2001)
Allosteric modulation of Ca2+ channels by G proteins, voltage-dependent facilitation, protein kinase C, and Cav
subunits.
Proc Natl Acad Sci USA
98:4699-4704[Abstract/Free Full Text]. -
Higuchi M,
Maas S,
Single FN,
Hartner J,
Rozov A,
Burnashev N,
Feldmeyer D,
Sprengel R,
Seeburg PH
(2000)
Point mutation in an AMPA receptor gene rescues lethality in mice deficient in the RNA-editing enzyme ADAR2.
Nature
406:78-81[Medline].
-
Ikeda SR,
Dunlap K
(1999)
Voltage-dependent modulation of N-type calcium channels: role of G protein subunits.
Adv Second Messenger Phosphoprotein Res
33:131-151[Web of Science][Medline].
-
Ino M,
Yoshinaga T,
Wakamori M,
Miyamoto N,
Takahashi E,
Sonoda J,
Kagaya T,
Oki T,
Nagasu T,
Nishizawa Y,
Tanaka I,
Imoto K,
Aizawa S,
Koch S,
Schwartz A,
Niidome T,
Sawada K,
Mori Y
(2001)
Functional disorders of the sympathetic nervous system in mice lacking the
1B subunit (Cav 2.2) of N-type calcium channels.
Proc Natl Acad Sci USA
98:5323-5328[Abstract/Free Full Text]. -
Jarvis SE,
Zamponi GW
(2001)
Distinct molecular determinants govern syntaxin 1A-mediated inactivation and G-protein inhibition of N-type calcium channels.
J Neurosci
21:2939-2948[Abstract/Free Full Text].
-
Jun K,
Piedras-Renteria ES,
Smith SM,
Wheeler DB,
Lee SB,
Lee TG,
Chin H,
Adams ME,
Scheller RH,
Tsien RW,
Shin H-S
(1999)
Ablation of P/Q-type Ca2+ channel currents, altered synaptic transmission, and progressive ataxia in mice lacking the
1A-subunit.
Proc Natl Acad Sci USA
96:15245-15250[Abstract/Free Full Text]. -
Karess RE,
Rubin GM
(1984)
Analysis of P transposable element functions in Drosophila.
Cell
38:135-146[Web of Science][Medline].
-
Kawasaki F,
Ordway RW
(2000)
Fast synaptic fatigue in shibire mutants reveals a rapid requirement for dynamin in synaptic vesicle membrane trafficking.
Nat Neurosci
3:859-860[Web of Science][Medline].
-
Kawasaki F,
Mattiuz AM,
Ordway RW
(1998)
Synaptic physiology and ultrastructure in comatose mutants define an in vivo role for NSF in neurotransmitter release.
J Neurosci
18:10241-10249[Abstract/Free Full Text].
-
Kawasaki F,
Felling R,
Ordway RW
(2000)
A temperature-sensitive paralytic mutant defines a primary synaptic calcium channel in Drosophila.
J Neurosci
20:4885-4889[Abstract/Free Full Text].
-
Krovetz HS,
Helton TD,
Crews AL,
Horne WA
(2000)
C-terminal alternative splicing changes the gating properties of a human spinal cord calcium channel
1A subunit.
J Neurosci
20:7564-7570[Abstract/Free Full Text]. -
Lee A,
Wong ST,
Gallagher D,
Li B,
Storm DR,
Scheuer T,
Catterall WA
(1999)
Ca2+/calmodulin binds to and modulates P/Q-type calcium channels.
Nature
399:155-159[Medline].
-
Lin DM,
Goodman CS
(1994)
Ectopic and increased expression of Fasciclin II alters motoneuron growth cone guidance.
Neuron
13:507-523[Web of Science][Medline].
-
Lin Z,
Haus S,
Edgerton J,
Lipscombe D
(1997)
Identification of functionally distinct isoforms of the N-type Ca2+ channel in rat sympathetic ganglia and brain.
Neuron
18:153-166[Web of Science][Medline].
-
Lin Z,
Lin Y,
Schorge S,
Qian Pan J,
Beierlein M,
Lipscombe D
(1999)
Alternative splicing of a short cassette exon in
1B generates functionally distinct N-type calcium channels in central and peripheral neurons.
J Neurosci
19:5322-5331[Abstract/Free Full Text]. -
Littleton TJ,
Ganetzky B
(2000)
Ion channels and synaptic organization: analysis of the Drosophila genome.
Neuron
26:36-43.
-
Lorenzon NM,
Lutz CM,
Frankel WN,
Beam KG
(1998)
Altered calcium channel currents in Purkinje cells of the neurological mutant mouse leaner.
J Neurosci
18:4482-4489[Abstract/Free Full Text].
-
Lü Q,
AtKisson MS,
Jarvis SE,
Feng ZP,
Zamponi GW,
Dunlap K
(2001)
Syntaxin 1A supports voltage-dependent inhibition of
1B Ca2+ channels by G in chick sensory neurons.
J Neurosci
21:2949-2957[Abstract/Free Full Text]. -
MacArthur MW,
Thornton JM
(1991)
Influence of proline residues on protein conformation.
J Mol Biol
218:397-412[Web of Science][Medline].
-
Mirotznik RR,
Zheng X,
Stanley EF
(2000)
G-protein types involved in calcium channel inhibition at a presynaptic nerve terminal.
J Neurosci
20:7614-7621[Abstract/Free Full Text].
-
Mochida S,
Sheng Z-H,
Carl B,
Kobayashi H,
Catterall WA
(1996)
Inhibition of neurotransmission by peptides containing the synaptic protein interaction site of N-type Ca2+ channels.
Neuron
17:781-788[Web of Science][Medline].
-
Mount SM,
Burks C,
Hertz G,
Stormo GD,
White O,
Fields C
(1992)
Splicing signals in Drosophila: intron size, information content, and consensus sequences.
Nucleic Acids Res
20:4255-4262[Abstract/Free Full Text].
-
Palladino MJ,
Keegan LP,
O'Connell MA,
Reenan RA
(2000)
A-to-I pre-mRNA editing in Drosophila is primarily involved in adult nervous system function and integrity.
Cell
102:437-449[Web of Science][Medline].
-
Pan JQ,
Lipscombe D
(2000)
Alternative splicing in the cytoplasmic II-III loop of the N-type Ca channel
1B subunit: functional differences are subunit-specific.
J Neurosci
20:4769-4775[Abstract/Free Full Text]. -
Peixoto AA,
Smith LA,
Hall JC
(1997)
Genomic organization and evolution of alternative exons in a Drosophila calcium channel gene.
Genetics
145:1003-1013[Abstract].
-
Perrimon N,
Engstrom L,
Mahowald AP
(1989)
Zygotic lethals with specific maternal effect phenotypes in Drosophila melanogaster. I. Loci on the X chromosome.
Genetics
121:333-352[Abstract/Free Full Text].
-
Peterson BZ,
Lee JS,
Mulle JG,
Wang Y,
de Leon M,
Yue DT
(2000)
Critical determinants of Ca2+-dependent inactivation within an EF-hand motif of L-type Ca2+ channels.
Biophys J
78:1906-1920[Web of Science][Medline].
-
Reenan RA
(2001)
The RNA world meets behavior: A to I pre-mRNA editing in animals.
Trends Genet
17:53-56[Web of Science][Medline].
-
Ren D,
Xu H,
Eberl DF,
Chopra M,
Hall LM
(1998)
A mutation affecting dihydropyridine-sensitive current levels and activation kinetics in Drosophila muscle and mammalian heart calcium channels.
J Neurosci
18:2335-2341[Abstract/Free Full Text].
-
Robinow S,
White K
(1988)
The locus elav of Drosophila melanogaster is expressed in neurons at all developmental stages.
Dev Biol
126:294-303[Web of Science][Medline].
-
Saegusa H,
Kurihara T,
Zong S,
Minowa O,
Kazuno A,
Han W,
Matsuda Y,
Yamanaka H,
Osanai M,
Noda T,
Tanabe T
(2000)
Altered pain responses in mice lacking
1E subunit of the voltage-dependent Ca2+ channel.
Proc Natl Acad Sci USA
97:6132-6137[Abstract/Free Full Text]. -
Schafer WR,
Kenyon CJ
(1995)
A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans.
Nature
375:73-78[Medline].
-
Sheng Z-H,
Westenbroek RE,
Catterall WA
(1998)
Physical link and functional coupling of presynaptic calcium channels and the synaptic vesicle docking/fusion machinery.
J Bioenerg Biomembr
30:335-345[Web of Science][Medline].
-
Smith LA,
Wang X,
Peixoto AA,
Neumann EK,
Hall LM,
Hall JC
(1996)
A Drosophila calcium channel
1 subunit gene maps to a genetic locus associated with behavioral and visual defects.
J Neurosci
16:7868-7879[Abstract/Free Full Text]. -
Smith LA,
Peixoto AA,
Hall JC
(1998a)
RNA editing in the Drosophila Dmca1A calcium-channel
1 subunit transcript.
J Neurogenet
12:227-240[Medline]. -
Smith LA,
Peixoto AA,
Kramer EM,
Villella A,
Hall JC
(1998b)
Courtship and visual defects of cacophony mutants reveal functional complexity of a calcium-channel
1 subunit in Drosophila.
Genetics
149:1407-1426[Abstract/Free Full Text]. -
Stanley EF
(1997)
The calcium channel and the organization of the presynaptic transmitter release face.
Trends Neurosci
20:404-409[Web of Science][Medline].
-
von Schilcher F
(1976)
The behavior of cacophony, a courtship song mutant in Drosophila melanogaster.
Behav Biol
17:187-196[Web of Science][Medline].
-
von Schilcher F
(1977)
A mutation which changes courtship song in Drosophila melanogaster.
Behav Genet
7:251-259[Web of Science][Medline].
-
Walker D,
De Waard M
(1998)
Subunit interaction sites in voltage-dependent Ca2+ channels: role in channel function.
Trends Neurosci
21:148-154[Web of Science][Medline].
-
Wu MN,
Fergestad T,
Lloyd TE,
He Y,
Broadie K,
Bellen HJ
(1999)
Syntaxin 1A interacts with multiple exocytic proteins to regulate neurotransmitter release in vivo.
Neuron
23:593-605[Web of Science][Medline].
-
Yang J,
Tsien RW
(1993)
Enhancement of N- and L-type calcium channel currents by protein kinase C in frog sympathetic neurons.
Neuron
10:127-136[Web of Science][Medline].
-
Zamponi GW,
Bourinet E,
Nelson D,
Nargeot J,
Snutch TP
(1997)
Crosstalk between G proteins and protein kinase C mediated by the calcium channel
1 subunit.
Nature
385:442-446[Medline]. -
Zheng W,
Feng G,
Ren D,
Eberl DF,
Hannan F,
Dubald M,
Hall LM
(1995)
Cloning and characterization of a calcium channel
1 subunit from Drosophila melanogaster with similarity to the rat brain type D isoform.
J Neurosci
15:1132-1143[Abstract]. -
Zhong H,
Yokoyama CT,
Scheuer T,
Catterall WA
(1999)
Reciprocal regulation of P/Q-type Ca2+ channels by SNAP-25, syntaxin and synaptotagmin.
Nat Neurosci
2:939-941[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22145856-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. S. Dason, J. Romero-Pozuelo, L. Marin, B. G. Iyengar, M. K. Klose, A. Ferrus, and H. L. Atwood
Frequenin/NCS-1 and the Ca2+-channel {alpha}1-subunit co-regulate synaptic transmission and nerve-terminal growth
J. Cell Sci.,
November 15, 2009;
122(22):
4109 - 4121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Kawasaki and R. W. Ordway
Molecular mechanisms determining conserved properties of short-term synaptic depression revealed in NSF and SNAP-25 conditional mutants
PNAS,
August 25, 2009;
106(34):
14658 - 14663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Fouquet, D. Owald, C. Wichmann, S. Mertel, H. Depner, M. Dyba, S. Hallermann, R. J. Kittel, S. Eimer, and S. J. Sigrist
Maturation of active zone assembly by Drosophila Bruchpilot
J. Cell Biol.,
July 13, 2009;
186(1):
129 - 145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Gu, S. A. Jiang, J. M. Campusano, J. Iniguez, H. Su, A. A. Hoang, M. Lavian, X. Sun, and D. K. O'Dowd
Cav2-Type Calcium Channels Encoded by cac Regulate AP-Independent Neurotransmitter Release at Cholinergic Synapses in Adult Drosophila Brain
J Neurophysiol,
January 1, 2009;
101(1):
42 - 53.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Worrell and R. B. Levine
Characterization of Voltage-Dependent Ca2+ Currents in Identified Drosophila Motoneurons In Situ
J Neurophysiol,
August 1, 2008;
100(2):
868 - 878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Long, E. Kim, H.-T. Leung, E. Woodruff III, L. An, R. W. Doerge, W. L. Pak, and K. Broadie
Presynaptic Calcium Channel Localization and Calcium-Dependent Synaptic Vesicle Exocytosis Regulated by the Fuseless Protein
J. Neurosci.,
April 2, 2008;
28(14):
3668 - 3682.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. K. Dickman, P. T. Kurshan, and T. L. Schwarz
Mutations in a Drosophila {alpha}2{delta} Voltage-Gated Calcium Channel Subunit Reveal a Crucial Synaptic Function
J. Neurosci.,
January 2, 2008;
28(1):
31 - 38.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I-F. Peng and C.-F. Wu
Drosophila cacophony Channels: A Major Mediator of Neuronal Ca2+ Currents and a Trigger for K+ Channel Homeostatic Regulation
J. Neurosci.,
January 31, 2007;
27(5):
1072 - 1081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Spafford, T. Dunn, A. B. Smit, N. I. Syed, and G. W. Zamponi
In Vitro Characterization of L-Type Calcium Channels and Their Contribution to Firing Behavior in Invertebrate Respiratory Neurons
J Neurophysiol,
January 1, 2006;
95(1):
42 - 52.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, F. Kawasaki, and R. W. Ordway
Properties of Short-Term Synaptic Depression at Larval Neuromuscular Synapses in Wild-Type and Temperature-Sensitive Paralytic Mutants of Drosophila
J Neurophysiol,
May 1, 2005;
93(5):
2396 - 2405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. W. Tedford, N. Gilles, A. Menez, C. J. Doering, G. W. Zamponi, and G. F. King
Scanning Mutagenesis of {omega}-Atracotoxin-Hv1a Reveals a Spatially Restricted Epitope That Confers Selective Activity against Insect Calcium Channels
J. Biol. Chem.,
October 15, 2004;
279(42):
44133 - 44140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Kawasaki, B. Zou, X. Xu, and R. W. Ordway
Active Zone Localization of Presynaptic Calcium Channels Encoded by the cacophony Locus of Drosophila
J. Neurosci.,
January 7, 2004;
24(1):
282 - 285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Rieckhof, M. Yoshihara, Z. Guan, and J. T. Littleton
Presynaptic N-type Calcium Channels Regulate Synaptic Growth
J. Biol. Chem.,
October 17, 2003;
278(42):
41099 - 41108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. M. Brooks, R. Felling, F. Kawasaki, and R. W. Ordway
Genetic Analysis of a Synaptic Calcium Channel in Drosophila: Intragenic Modifiers of a Temperature-Sensitive Paralytic Mutant of cacophony
Genetics,
May 1, 2003;
164(1):
163 - 171.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|