 |
 Previous Article | Next Article 
The Journal of Neuroscience, July 15, 2002, 22(14):5889-5899
Ischemia Induces a Translocation of the Splicing Factor tra2- 1
and Changes Alternative Splicing Patterns in the Brain
Rosette
Daoud1,
Günter
Mies2,
Agata
Smialowska1,
Laszlo
Oláh1,
Konstantin-Alexander
Hossmann2, and
Stefan
Stamm1
1 Institute of Biochemistry, University of
Erlangen-Nurenberg, 91054 Erlangen, Germany, and
2 Max-Planck-Institute for Neurological Research,
50931 Köln, Germany
 |
ABSTRACT |
Alternative splice-site selection is regulated by the relative
concentration of individual members of the serine-arginine family of
proteins and heterogeneous nuclear ribonucleoproteins. Most of these
proteins accumulate predominantly in the nucleus, and a subset of them
shuttles continuously between nucleus and cytosol. We demonstrate that
in primary neuronal cultures, a rise in intracellular calcium
concentration induced by thapsigargin leads to a translocation of the
splicing regulatory protein tra2- 1 and a consequent change in
splice-site selection. To investigate this phenomenon under
physiological conditions, we used an ischemia model. Ischemia induced
in the brain causes a cytoplasmic accumulation and hyperphosphorylation
of tra2-1. In addition, several of the proteins binding to
tra2-1, such as src associated in mitosis 68 and
serine/arginine-rich proteins, accumulate in the cytosol. Concomitant
with this subcellular relocalization, we observed a change in
alternative splice-site usage of the ICH-1 gene. The increased usage of its alternative exons is in agreement with previous
studies demonstrating its repression by a high concentration of
proteins with serine/arginine-rich domains. Our findings suggest that a
change in the calcium concentration associated with ischemia is part of
a signaling event, which changes pre-mRNA splicing pathways by causing
relocalization of proteins that regulate splice-site selection.
Key words:
alternative pre-mRNA processing; SR proteins; ischemia; phosphorylation; calcium; stroke
| |
INTRODUCTION |
Advances in the human genome project
have shown that almost all human genes contain introns that are removed
during pre-mRNA processing. An estimated 47-60% of genes contain
exons that can be used alternatively (Lander et al., 2001 ; Modrek et
al., 2001). Alternative pre-mRNA processing plays a key role in
generating a vast proteome of 150,000-1,000,000 proteins from the
surprisingly low number of 30,000-40,000 genes (Lander et al., 2001;
Hodges et al., 2002). Alternative splicing pathways can be
regulated (e.g., during development) in response to cellular activity,
in response to stress, during programmed cell death, or as a result of
a pathological state (Daoud et al., 2000; Stoss et al., 2000; Akker et
al., 2001; Grabowski and Black, 2001; Soreq and Seidman, 2001).
Current models indicate that a fine-tuned balance of
cis-elements and trans-acting factors is
responsible for proper alternative splice-site selection (Grabowski,
1998; Elliot, 2000; Smith and Valcarcel, 2000). The major
cis-elements comprise 5' and 3' splice sites and auxiliary
sequence elements near them that act as enhancers or silencers. Those
auxiliary elements bind to two major groups of proteins, proteins with
serine-arginine-rich domains (SR proteins) (Fu, 1995; Manley and
Tacke, 1996; Graveley, 2000) and heterogeneous nuclear
ribonucleoproteins (hnRNPs) (Weighardt et al., 1996), which can change
the recognition of splice sites because both SR proteins and hnRNPs
bind to components of the spliceosome (Tian and Maniatis, 1993;
Hertel et al., 1997; Liu et al., 1998, 2000; Chew et al., 1999). As a
result, alternative exons can be regulated by modulation of the
concentration of SR proteins and hnRNPs (Cáceres et al., 1994;
Wang and Manley, 1995; Manley and Tacke, 1996) that have a
characteristic concentration in a given tissue (Kamma et al.,
1995; Hanamura et al., 1998).
Stroke is a leading cause of morbidity and mortality in industrialized
countries, imposing an enormous economic burden on the families of the
patients and the society overall (Taylor et al., 1996). The trigger of
stroke is a focal reduction of blood flow below the threshold required
to maintain oxidative respiration (Hossmann, 1994). However, in the
vicinity of this primary necrotic lesion, secondary disturbances evolve
and gradually expand and produce additional injury, the amount of which
may outweigh that of the primary impact (Heiss et al., 1994; Gyngell et
al., 1995). The reasons for this delayed ischemic injury are only
partly understood. Gene expression analysis suggests that >1000 genes
are either upregulated or downregulated by more than a factor of four,
and that many of these may be directly involved in the injury
propagation (Trendelenburg et al., 2000). This integrated pattern of
genomic dysregulation would also be complicated by mis-splicing or
alternative splicing; however, until now, this question has not been addressed.
We demonstrate that as a reaction to stroke, nuclear proteins
regulating pre-mRNA splicing change their subcellular distribution and
accumulate in the cytosol. Concomitantly, alternative splice-site selection of the ICH-1 gene is changed, suggesting that a
change in alternative splicing patterns contributes to the outcome of stroke.
| |
MATERIAL AND METHODS |
Primary neuron cultures. Cortex regions were
dissected from embryonic day 19 rats. The tissue was digested for 20 min with 500 µg of papain (Sigma, St. Louis, MO) in the presence of
10 mM glucose, 1 mg/ml bovine serum albumin, and
10 µg DNase in PBS. The cells were carefully dissociated with a
pipette, and the mixture was centrifuged at 1000 × g
for 5 min. The cells were resuspended in DMEM containing 15% fetal
calf serum and were plated onto
poly-DL-ornithine-precoated six well dishes
(Nunc, Naperville, IL). The density of plating was 1 × 106 cells/well. Approximately 1 hr after
plating, the medium was changed to a serum-free complete medium (Stamm
et al., 1993) and the cells were cultured at 37°C in a 10%
CO2 humidified atmosphere. After 1 week, cells
were subjected to treatment with thapsigargin (1 µM) (Sigma) for 1-24 hr.
Immunostaining. For immunohistochemistry, C57BL/6 mice were
subjected to transient focal cerebral ischemia for 1 hr and the animals
were immediately frozen in situ in liquid nitrogen at various recirculation times. Brains were then removed in a cold temperature cabinet at  20°C. Coronal cryostat sections were cut at
20 µm, placed on gelatinized slides, and stored at 20°C. Sections were fixed in 4% paraformaldehyde in PBS for 30 min and were washed three times in PBS. They were preincubated for 1 hr in 3% NGS with
0.5% Triton X-100 in PBS at room temperature and were then incubated
overnight at 4°C with the tra2-1 antiserum (1:500), anti-monoclonal antibody (mAb)104 (1:1) (American Type Culture Collection, Manassas, VA), anti-src associated in mitosis
(SAM)68 (Santa Cruz Biotechnology, Santa Cruz, CA) (1:50),
anti-rat SAM68-like molecule-2 (rSLM-2) (1:100) (Stoss et al.,
2001), and anti-cleaved caspase-3 (New England Biolabs, Beverly, MA) in
PBS containing 0.3% NGS and 0.5% Triton X-100. After three washes in
PBS, the sections were incubated with the secondary
Cy3-fluorochrome-conjugated goat anti-rabbit or IgG mouse antibody
(Jackson ImmunoResearch, West Grove, PA). For anti-mAb104, we used the
Cy3 anti-mouse IgM antibody at a dilution of 1:200 in PBS for 2 hr.
Next, the sections were counterstained with 0.5 µg/ml
4',6-diamidino-2-phenylindole (DAPI; Sigma, Deisenhofen, Germany) in
PBS for 10 min or with 1:200 of the nuclear Nissl counterstain (Neuro
Trace Green Fluorescent Nissl Stain; Molecular Probes; Leiden, The
Netherlands), washed again three times with PBS, and coverslipped with
Gel-Mount (Biomeda Corporation, Frankfurt, Germany).
Immunofluorescence images were obtained using confocal laser
microscopy. The general overview of one section was obtained by
scanning the entire section with a CCD camera (Leica, Nussloch, Germany) and a scanner integrated to the microscope. The quantification of the tra2-positive cells was performed by Neurolucida (Leica).
Reverse transcription-PCR. Total RNA was extracted from the
striatal region of mice by the guanidinium thiocyanate method, as
described previously (Chomczynski and Sacchi, 1987). For reverse transcription (RT)-PCR, cDNA was made from 1 µg of total RNA using H -Moloney murine leukemia virus reverse
transcriptase (Invitrogen, San Diego, CA), 5 mM
random primers (Promega, Madison, WI), 0.1 mM
deoxyNTPs, 10 U of RNasin, and 10 mM
dithiothreitol. The reactions were performed using the following
primers: ICHrev, AATTCAAGGGACGGGTCATG; ICHfor, ATGCTAACTGTCCAAGTCTA.
The PCR conditions used were denaturation at 94°C for 2 min. Forty
cycles of denaturation (94°C for 30 sec), annealing (55°C for 30 sec), and elongation (72°C for 30 sec) were then performed.
The final elongation was performed at 72°C for 10 min. PCR products
were resolved on 2% agarose gels and were quantified with the enhanced
analysis system of Herolab (Wiesloch, Germany).
Experimental groups. Experimental procedures were conducted
with governmental approval according to the National Institutes of
Health guidelines for the care and use of laboratory animals. Adult
male C57BL/6 mice weighing 20-28 gm were subjected to transient focal
ischemia by middle cerebral artery (MCA) occlusion for 1 hr without
reperfusion or with recirculation for 3, 6, and 24 hr
(n = 3-4 animals per group).
Animal surgery. Animals were anesthetized with 1% halothane
(30% O2, remainder N2O).
Rectal temperature was maintained between 36.5 and 37.0°C using a
feedback-controlled heating system. During the experiments, cortical
blood flow was measured by laser Doppler flowmetry (LDF) using a 1 mm
fiberoptic probe (Perimed, Stockholm, Sweden) positioned on the intact
skull over the MCA territory to monitor LDF changes during ischemia and
after the onset of reperfusion. Focal cerebral ischemia was induced
using an intraluminal filament technique (Hata et al., 1998). Briefly,
a midline neck incision was made and the left common and external
carotid arteries were isolated and ligated. A microvascular clip
(FE691; Aesculap, Tuttlingen, Germany) was temporarily placed on the
internal carotid artery. An 8-0 nylon monofilament (Ethilon; Ethicon,
Norderstedt, Germany) coated with silicon resin (Xantopren; Bayer
Dental, Osaka, Japan) was introduced through a small incision into the
common carotid artery and was advanced 9 mm distal to the carotid
bifurcation for occlusion of the MCA. The size of the thread (150-200
µm) was matched to the body weight to ensure reproducible vascular occlusion (Hata et al., 1998). After 60 min, reperfusion was initiated by withdrawal of the thread. Twenty minutes later, anesthesia was
discontinued and animals were placed into their home cages. Experiments
were terminated under halothane anesthesia by in situ freezing of animals. Tissue was stored at 80°C until additional processing.
Regional measurement of ATP. Brains were removed in a cold
temperature cabinet (20°C) and cut into 20-µm-thick cryostat
sections. Coronal sections from the striatal level were mounted on
coverslips for ATP bioluminescent imaging and on gelatin-coated slides
for immunohistochemistry. For regional ATP measurement,
coverslip-mounted in situ frozen sections were freeze-dried
and coated with a layer of frozen reaction mix containing the enzymes,
coenzymes, and cofactors necessary for evoking ATP-specific
bioluminescence (Kogure and Alonso, 1978). The tissue/enzyme bilayer
was thawed, and light emission was recorded with a cooled CCD camera
(SensiCam) using the PC software SensiControl (PCO CCD Imaging,
Kelheim, Germany).
Western blot. Proteins for immunoblotting were
prepared from the striatal region of control and ischemic hemispheres
by homogenizing 0.25 gm of tissue in 1 ml of sample buffer (60 mM Tris/HCl, pH 6.8, 2% SDS, 0.1 M dithiothreitol). Boiling and centrifugation were then performed.
Protein (30 µg) was subjected to SDS-PAGE (12%), as described
previously (Laemmli, 1970), transferred onto ECL membranes (Amersham Biosciences, Arlington Heights, IL), incubated with rabbit tra2 antiserum (Daoud et al., 1999), diluted 1:2000 in 1× NET (150 mM NaCl,
5 mM EDTA, 50 mM Tris, pH 7.5, 0.05% Triton X-100, and 0.25%
gelatine)/2.5× gelatin, and detected with an anti-rabbit antiserum coupled to horseradish peroxidase (Amersham Biosciences) (1:3000).
| |
RESULTS |
Blocking the sarco-endoplasmatic reticulum
Ca2+-ATPases alters the subcellular localization of
the splicing regulatory protein tra2-1 in primary neurons
Previous studies have shown that an induction of the
mitogen-activated protein kinase kinase, 38 kDa (MKK-p38) pathway
causes a cytoplasmatic accumulation of the splicing regulatory proteins hnRNP A1 and splicing factor 2 (SF2)/alternative splicing factor (ASF) (van der Houven van Oordt et al., 2000). We previously
reported a change in splicing patterns after neuronal stimulation
(Daoud et al., 1999) and wanted to investigate whether the splicing
regulatory protein tra2-1 changes its intracellular localization
when intracellular calcium levels are elevated. An increase in
intracellular calcium was evoked in primary neuronal cultures by
blocking the sarco-endoplasmatic reticulum
Ca2+-ATPases with thapsigargin (Treiman et
al., 1998). As shown in Figure 1,
thapsigargin treatment causes a change in the subcellular localization
of endogenous tra2-1 after 1 hr in primary rat cortical cultures.
After 6 hr, tra2-1 immunoreactivity can no longer be detected in the
majority of nuclei (Fig. 1, 6 hr), whereas application of the solvent
(DMSO) had no effect. In thapsigargin-treated cells, it could clearly
be seen that tra2-1 immunoreactivity was detectable in the neurites.
Similar results were obtained when SR proteins were detected with the
pan-anti-SR antibody mAb104 (data not shown). Previous work
demonstrated that activation of MKK-p38 can cause a relocalization of
splicing factors. However, we were not able to detect phosphorylation
of MKK-p38, which would be indicative for the activation of the MKK-p38
kinase pathway (data not shown).
View larger version (93K):
[in this window]
[in a new window]
|
Figure 1.
Intracellular localization of tra2-1 in primary
neuronal cultures after treatment with thapsigargin. Primary cortical
neurons were subjected to treatment with thapsigargin. The
intracellular localization of tra2-1 was determined by
immunocytochemistry. The control (con) shows cells that
were treated with DMSO only for 3 hr. Other time points looked similar.
Left column, tra2-1 is detected with a tra2-1
antiserum. Middle column, DAPI staining of the same
field. Right column, Overlay of the tra2-1 and DAPI
staining. The numbers on the left
indicate the time of thapsigargin treatment.
|
|
We conclude that a change in the intracellular
Ca2+ concentration, evoked by
thapsigargin, causes an accumulation of tra2-1 and SR proteins in
the cytosol of primary neurons.
Thapsigargin treatment changes the alternative splicing patterns of
ICH-1 in primary neuronal cultures
Next, we tested whether the thapsigargin-induced relocation of
splicing factors changes alternative splicing patterns. Cells were
treated with thapsigargin for 1-24 hr, and the splicing patterns of
the endogenous ICH-1 gene were determined. As shown in
Figure 2, we observed an approximately
fourfold increase in the ICH-1S form. These data indicate that a
change in intracellular calcium evoked by thapsigargin can affect
pre-mRNA processing pathways.
View larger version (35K):
[in this window]
[in a new window]
|
Figure 2.
Thapsigargin treatment changes alternative
splicing patterns. Primary cortical neurons were subjected to treatment
with thapsigargin, and the splicing pattern of the endogenous
ICH-1S gene was determined. C, Control
receiving DMSO for 3 hr. D, Control receiving DMSO for
24 hr. Thapsigargin treatment times are indicated at the
bottom of each panel. A
representative agarose gel of the RT-PCR products is on the
left. The drawing to the right shows
schematically the primer localization and the structure of the PCR
products. The statistical evaluation of independent experiments is
shown the the bottom panel. Error bars indicate the SD
from at least four different experiments. Arrows
indicate the location of the primers used for PCR.
|
|
The number of tra2-1-positive nuclei decrease in an
ischemic focus
Calcium release from intracellular stores is the major cause for
calcium-related neuronal injury during cerebral ischemia (Paschen et
al., 1996; Grondahl et al., 1998). We therefore asked whether a
translocation of splicing factors is also observed under such
pathological conditions and applied an established ischemia paradigm
(Hara et al., 1996; Hata et al., 1998). In this model, mice were
subjected to 60 min of suture occlusion of the MCA and then
recirculation for 0, 3, 6, and 24 hr. The immediate pathophysiological response of this treatment was a focal depletion of ATP that defines the ischemic focus. To localize the ischemic focus, tissue sections were analyzed with ATP-specific bioluminescence (Kogure and Alonso, 1978). As expected, ATP was depleted in the striatum at the end of 1 hr
of MCA occlusion, but recirculation resulted in the return of ATP 3 hr
after ischemia. After 24 hr of recirculation, a focus of secondary ATP
depletion developed in the center of the MCA territory (Fig.
3A). We analyzed the
expression of a critical splicing regulatory protein, human
tra2-1 (Beil et al., 1997), after the ischemic insult.
Immunohistochemistry with an antiserum specific for tra2- revealed
an altered staining pattern in the ischemic focus after 6 and 24 hr of
recirculation. In particular, we noticed a decrease in the number
of tra2-1-positive nuclei (Fig. 3B; see Fig. 5 for larger
magnification). The presence and integrity of the nuclei were confirmed
by DAPI (Fig. 3C) and Nissl (see Fig. 5E)
staining that also allowed us to quantify the tra2--positive nuclei.
We determined the fraction of nuclei that were positive for tra2-1
by comparing tra2-1 immunoreactivity with the nuclear DAPI staining,
both in the ischemic side and in the contralateral control side (Fig.
3D). As expected, only ~70% of the cells in the brain
expressed tra2-1, which is in agreement with our previous findings
(Daoud et al., 1999). After 1 hr of transient ischemia, this fraction
dropped to 50 and 40% after 6 and 24 hr of recirculation, respectively. In contrast, no change in the amount of
tra2-1-positive nuclei was observed in the unaffected contralateral
side and in cortical regions distant to the territory supported by the
MCA. In contrast, the ischemic focus was not visible when the sections were stained for rSLM-2 (Stoss et al., 2001) (data not shown) (see Fig.
6C).
View larger version (88K):
[in this window]
[in a new window]
|
Figure 3.
tra2-1 immunoreactivity in an ischemic focus.
Coronal mouse brain sections after 1 hr of transient focal cerebral
ischemia and reperfusion are shown. The columns
correspond to 0, 3, 6, and 24 hr after recirculation. A,
Determination of the regional ATP content in tissue sections. A
luciferase assay was used. Dark areas indicate normal
ATP levels. ATP was depleted after 1 hr of ischemia (0 hr of
recirculation), returned to normal levels at the time of recirculation
until 6 hr after ischemia, and developed secondary energy failure that
was clearly visible at 24 hr after ischemia (asterisk).
B, tra2-1 expression was determined in parallel
sections by immunohistochemistry. Changes in the caudate-putamen were
already detected at 6 hr and were clearly evident 24 hr after ischemia.
The area showing relocalization of tra2-1 is marked by a
dotted line for the 24 hr time point. Cells from this
area are enlarged in Figure 5. C, DAPI staining of a
parallel section shows the integrity of the nuclei. D,
Quantification of tra2-1-positive cells in the ischemic focus
(blue) and in the unaffected cortex regions
(red). con, Area of contralateral side
corresponding to the ischemic focus; IF, area of
ischemic focus; con, cortical region of the
contralateral side; IS, cortical region on the ischemic
side.
|
|
We conclude that after transient focal cerebral ischemia, the number of
tra2-1-positive nuclei decreases in the cells located in the
ischemic focus.
Ischemia causes hyperphosphorylation of tra2-1 and a change in
its subcellular distribution
Similar to other SR proteins, tra2-1 exists in different
phosphorylated forms that can be distinguished by PAGE. We investigated whether ischemia alters the phosphorylation pattern (Daoud et al.,
1999). Using the ATP depletion as a marker for the ischemic focus, we
isolated tissue from the ischemic focus and the contralateral control
side from adjacent sections and analyzed protein extracts by Western
blot using an antiserum against tra2-1. As demonstrated previously,
the antiserum detects two forms, a slow-migrating hyperphosphorylated
form and a fast-migrating hypophosphorylated form (Daoud et al., 1999).
The ischemic insult leads to an increase in the hyperphosphorylated
form after 6 and 24 hr (Fig. 4). In addition, no change in the total tra2-1 level was observed when the
tra2-1 signal was compared with actin and histone signals (data not
shown).
View larger version (22K):
[in this window]
[in a new window]
|
Figure 4.
tra2-1 is hyperphosphorylated after ischemia.
Western blot analysis of tissue derived from the ischemic focus
(I) and from the unaffected contralateral
side that serves as a control (C) is shown. The
reoxygenation time is indicated at the top. The
open arrow indicates the hyperphosphorylated form, and
the closed arrow points to the hypophosphorylated form.
Molecular mass is indicated on the left.
|
|
We then stained the tissues with an antiserum against tra2-1 and
inspected the cells of the ischemic focus under higher magnification. Similar to the situation with primary neuronal culture, we found that
with the ischemic focus, tra2-1 immunoreactivity decreased in the
cell nuclei, whereas immunoreactivity became detectable in the
cytoplasma and the neurites of cells (Fig.
5). These changes could be observed in
both the periphery and the center of the focus. As expected, in
ischemic animals without recirculation (Fig. 5, 0 hr), tra2-1 could
be detected only in nuclei, where it was localized in a speckled
pattern. In contrast, after 6 hr of recirculation, tra2-1
immunoreactivity could be detected in the cytoplasma surrounding the
nucleus (Fig. 5, 6 hr) and the residual nuclear staining became more
diffuse. Finally, 24 after MCA occlusion, most tra2-1
immunoreactivity disappeared from the nucleus and was located in the
surrounding cytosol (Fig. 5, 24 hr). At that time, tra2-1 could be
detected even in neurites emerging from the neurons. Staining with
Neuro Trace Nissl confirmed the integrity of the nuclei in cells
showing a cytosolic accumulation of tra2-1 (Fig. 5E).
View larger version (45K):
[in this window]
[in a new window]
|
Figure 5.
tra2-1 protein changes its
intracellular localization after ischemia. The ischemic focus after 0, 3, 6, and 24 hr of recirculation after the occlusion, stained with the
tra2-1 antiserum (A-D), is shown. The cells
were taken from the periphery of the ischemic focus. The left
column shows an overview of the affected area at lower
magnification. On the right, representative cell nuclei
are enlarged to show the subcellular tra2-1 distribution. At the end
of the 1 hr ischemic interval (0 hr of recirculation), the speckled
pattern of tra2-1 is clearly visible. Twenty-four hours after
ischemia, the protein is removed from the nucleus.
Arrowheads in D indicate protein that is
present in neurites of cells. E, Cells of the ischemic
focus are counterstained with Nissl stain (center) to
demonstrate the cytoplasmatic localization or tra2-1 (overlay of
Nissl and tra2-1 stain, right). Nissl stain binds to
RNA present in the nucleus.
|
|
We conclude that transient ischemia induces a hyperphosphorylation of
tra2-1. This phosphorylation occurs several hours after the ischemic
insult and is accompanied by a translocation of tra2-1 from the
nucleus to the cytosol.
After ischemia, proteins interacting with tra2-1 translocate
from the nucleus
Previous work shows that pre-mRNA processing occurs in a large
macromolecular complex in vivo (Corden and Patturajan, 1997; McCracken et al., 1997), which has been named "transcriptosomal complex" or "RNA factory." Several studies have shown previously that tra2-1 interacts with components of this complex, among them
the SR proteins SRp75, SRp55, SRp40, SF2/ASF, and splicing component 35 kDa (SC35) (Nayler et al., 1998a), the hnRNP-like protein
scaffold attachment factor B (Nayler et al., 1998b), the SR
protein kinases clk1-clk4 (Nayler et al., 1997), the signal transduction and activation of RNA (STAR) protein
SLM-2/tra2-STAR (Venables et al., 1999), and hnRNP G-related
protein (Venables et al., 2000). Several SR proteins shuttle
continuously between the nucleoplasma and the cytosol, which is
suggestive of cytosolic modification of the proteins as well as
additional roles of these proteins in nuclear export of mature mRNA and
in translation (Cáceres et al., 1998). In addition, SAM68 was
shown to leave the nucleus after viral infections (McBride et al.,
1996). We therefore determined whether tra2- interacting proteins
change their subcellular localization after ischemia as well.
First, we used the mAb104 antibody that recognizes a phosphoepitope
present in all members of the SR protein family (Neugebauer et al.,
1995). As shown in Figure
6A, mAb104
immunoreactivity translocates from the nucleus to the cytosol similarly
to tra2-1. However, this change in subcellular localization occurs
earlier than the one observed with tra2-1, because a significant
number of cells showed mAb104 immunoreactivity in cytosol and neurites as early as 3 hr after reoxygenation.
View larger version (101K):
[in this window]
[in a new window]
|
Figure 6.
Intracellular localization of tra2-1
interacting proteins after ischemia. The left column
shows an overview of the affected area at lower magnification. The area
analyzed is from the periphery of the ischemic focus. On the
right, representative cell nuclei are enlarged to show
the subcellular distribution. A, Detection of SR
proteins with mAb104 in the ischemic focus. The
arrowheads in A (3h) show the staining in
neurites. B, Detection of SAM68 with anti-SAM68
antiserum in the ischemic focus. C, Detection of
rSLM-2 in the ischemic focus.
|
|
We subsequently tested the ubiquitously expressed STAR protein family
member SAM68 (Taylor et al., 1995; Vernet and Artzt, 1997) and found
that it also translocated from the nucleus to the cytosol (Fig.
6B). Finally, we tested the related STAR protein family member rSLM-2 (Di Fruscio et al., 1999; Stoss et al., 2001). rSLM-2 regulates splice-site selection by binding to purine-rich enhancers and was postulated to be a link between signal-transduction pathways and pre-mRNA processing (Stoss et al., 2001). We found that
this protein remains in the nucleus of cells in the ischemic focus,
even 24 hr after reoxygenation (Fig. 6C). Furthermore, we
could neither detect any DNA condensation in DAPI staining, nor did we
observe any abnormal Nissl staining (Fig. 5E). Together, these data indicated that ischemia causes a translocation of some factors regulating pre-mRNA splicing but does not affect the nuclear integrity.
We then asked whether the changes we observed were caused by cell death
and tested the expression of cleaved caspase-3, a marker for apoptosis.
As shown in Figure 7, in the entire
ischemic focus, only a few cells could be detected expressing this
marker, which is in agreement with the data obtained in cell culture. In contrast, tra2-1 and SR protein localization is strongly affected in this area, because approximately one-half the nuclei are depleted from tra2-1 (Fig. 3D). Furthermore, we did not
observe any abnormal Nissl staining (Fig. 5E). Our results
indicate that the observed change in subcellular localization is not
caused by cell death and the subsequent necrosis of the tissue. Similar
results were seen at all other time points and with terminal
deoxynucleotidyl transferase-mediated biotinylated UTP nick end
labeling (TUNEL) staining (data not shown).
View larger version (115K):
[in this window]
[in a new window]
|
Figure 7.
The apoptotic marker cleaved caspase-3
is present in only a few cells in the ischemic focus. A,
DAPI staining of a coronal section, including the ischemic focus (i.e.,
the left caudate putamen). The section shown is from an animal
subjected to 1 hr of focal cerebral ischemia and then 6 hr of
recirculation. B, Immunostaining of a parallel section
with an antiserum recognizing the cleaved caspase-3 product. The
box shows the area that is enlarged in C.
C, Enlargement of the area marked in B.
Cells expressing cleaved caspase-3 are indicated with
arrowheads.
|
|
We conclude that some but not all proteins interacting with
tra2-1 change their subcellular localization after transient ischemia.
The alternative splicing pattern of ICH-1 changes
after ischemia
SR proteins can change splice-site selection in a
concentration-dependent manner (Manley and Tacke, 1996). We
investigated whether the change in nuclear SR protein concentration is
concomitant with a change in splice-site
selection. We isolated tissue from the ischemic area and from the
contralateral control side and performed RT-PCR. The ischemic focus was
identified by the lack of ATP in adjacent sections (Fig. 3). We tested
the ICH-1 gene that can generate two isoforms, ICH-1L, which
promotes apoptosis, and ICH-1S, which prevents apoptosis (Wang et al.,
1994), which is observed as a late effect of ischemia (Dirnagl et al.,
1999). Again in agreement with the situation in culture, the ischemic episode stimulates inclusion of the alternative exon, which promotes the formation of the ICH-1S form (Fig.
8).
View larger version (42K):
[in this window]
[in a new window]
|
Figure 8.
Change of alternative splicing pattern of the
ICH-1 gene after ischemia. RT-PCR analysis of the
ICH-1 (Wang et al., 1994) gene. The tissue from the
ischemic focus (I) was localized with
tra2-1 immunocytochemistry and ATP content in parallel sections. It
was then separated from unaffected tissue, and its RNA was subjected to
RT-PCR. As a control (C), the contralateral side
was used. Tissue probes were sampled from an animal subjected to 1 hr
of ischemia and then 0, 3, 6, and 24 hr of recirculation. A
representative agarose gel of the RT-PCR products is on the
left. The drawing on the
left shows schematically the primer localization and the
structure of the PCR products. The time points of recirculation are
indicated at the top. The statistical evaluation of
independent experiments is shown in the bottom panel.
Error bars indicate the SD from at least four different
experiments.
|
|
We conclude that concomitant with a decrease in nuclear concentration
of splicing factors, alternative splice-site selection is changed in an
ischemic focus.
| |
DISCUSSION |
Proteins regulating pre-mRNA processing change their subcellular
localization after ischemia
We demonstrated that splicing regulatory proteins changes their
intracellular localization in the brain after this tissue has been
subjected to ischemia. These findings are physiologically relevant,
because we relied on the analysis of endogenous proteins in cells of
intact tissue. Our results are in agreement with previous studies that
used overexpressed proteins in transformed cells that were subjected to
osmotic shock (van der Houven van Oordt et al., 2000). We observed
relocalization of tra2-1, SR proteins, and SAM68 to the cytoplasma.
Based on the morphology, the cells where the translocation occurred
were most likely neurons. Several lines of evidence indicated that this
relocalization was an active process and not the result of a
nonspecific breakdown of the nuclear envelope. First, some factors,
such as rSLM-2, were not relocating to the cytosol; second, ribosomal
RNA complexes present in the nucleus did not change their localization;
and third, no evidence of apoptosis, either by cleaved caspase-3 or by
TUNEL staining, was observed. The most likely explanation of our
findings is that after ischemia, either the nuclear import pathways
were blocked or the nuclear export was increased. The change in
subcellular localization of tra2-1 was concomitant with
hyperphosphorylation. It remains to be established whether this change
in phosphorylation was the cause or the consequence of a change in
subcellular localization. Similar results were observed when the
influence of cellular stress, evoked by osmotic shock, was studied on
hnRNP A1 (van der Houven van Oordt et al., 2000). Both tra2-1 and
hnRNP A1 accumulate in the cytosol after being hyperphosphorylated.
Because both proteins bind to transportin SR and transportin (Kataoka
et al., 1999) (our unpublished data), a modulation of these systems by
phosphorylation after ischemia is an interesting hypothesis that
remains to be tested.
The signal-transduction pathways leading to a change in splicing factor
phosphorylation are not clear. In contrast to cellular events after
osmotic shock (Kataoka et al., 1999; van der Houven van Oordt et al.,
2000), ischemia does not activate the MKK-p38 pathway in the brain.
Blockage of the calcium reuptake into the endoplasmatic reticulum of
primary neuronal cultures has effects similar to those of ischemia. It
is well established that the cytoplasmatic calcium concentration
increases after an ischemic insult, and in the culture system, we found
relocalization of tra2-1 to the cytosol. It is therefore likely that
several independent pathways exist that ultimately converge on the
kinases that phosphorylate hnRNP A1 and tra2-1.
Splice-site selection is changed after ischemia
The current model of alternative splice-site selection assumes
that SR proteins and hnRNPs form a network across the pre-mRNA that
identifies exons (Wu and Maniatis, 1993; Manley and Tacke, 1996; Hertel
and Maniatis, 1998; Stoss et al., 2000; Hastings and Krainer,
2001), which is reflected by their ability to regulate splice-site usage in a concentration-dependent manner (Cáceres et
al., 1994; Wang and Manley, 1995). The effect of SR protein kinases on
splice-site selection has been attributed to a recruitment of SR
proteins from their nuclear storage sites, the speckles, and a
subsequent increase in nuclear SR protein concentration (Stojdl and
Bell, 1999; Misteli, 2000). Because the relocation of tra2-1 and SR
proteins to the cytosol will decrease its concentration relative to
other factors regulating splice-site selection, we tested the ICH-1
pre-mRNAs that undergo alternative splicing in the brain.
We observed an increase in inclusion of the 61 bp alternative exon of
ICH-1. An increase in the SR protein SC35 and SF2/ASF concentration was
shown to promote skipping of the 61 bp alternative exon of ICH-1 (Jiang
et al., 1998). Therefore, the increase in usage of this exon after
ischemia could be explained by the relocation of SR proteins from the
nucleus to the cytosol. The effects on RNA splicing seem to be
specific, because the splicing patterns of several mRNAs were not
changed. For example, alternative splicing patterns of Bax,
Bcl, and SERCA2 genes were not affected.
Furthermore, we did not observe an increase in RNA degradation (data
not shown). The twofold to threefold changes in exon usage were
comparable with the effects seen in other systems that have
investigated endogenous mRNAs (Kaufer et al., 1998; Daoud et al., 1999;
Xie and Black, 2001). Changes of this magnitude are physiologically relevant; for example, a 1.8-fold increase in prothrombin pre-mRNA can
cause human disease (Gehring et al., 2001). In several systems studied
(e.g., drug-induced increase in neuronal activity and stress evoked by
forced swimming) (Kaufer et al., 1998; Daoud et al., 1999), a change in
alternative splice-site selection was found as a molecular mechanism to
memorize an external stimulus. Because tra2-1 acts on several
pre-mRNAs containing purine-rich enhancers (P. Stoilov, R. Daoud, O. Nayler, and S. Stamm, unpublished observations), it is likely
that the translocation of tra2-1 in cells affected by ischemia will
orchestrate a coordinate change in alternative splice-site selection of
several genes that will add to the long-term effect observed after ischemia.
We conclude that cells are able to increase the concentration of
splicing regulatory proteins by recruiting them from nuclear storage
sites and are able to decrease their concentration in the nucleus by
transporting them to the cytosol. Because splice-site selection is
dependent on the relative concentration of splicing regulatory
proteins, pre-mRNA splicing patterns of some genes are changed as a result.
Regulation of splice-site selection by subcellular localization of
regulatory proteins
To our knowledge, this is the first report demonstrating a change
in subcellular localization of endogenous proteins regulating splice-site selection in intact tissue. To determine possible molecular
mechanisms, we investigated whether a change in the intracellular
calcium concentration had an effect that is comparable with ischemia.
We blocked intracellular calcium reuptake and observed a change in the
subcellular distribution of regulatory proteins in cultured cortical
neurons. Interestingly, alternative splicing patterns of the
ICH-1 gene parallel the situation in the ischemic brain.
This suggests that the calcium concentration could be part of the
cascade connecting ischemia to changes in pre-mRNA splicing.
There is now increasing evidence that external stimuli can regulate
pre-mRNA processing. Some of these stimuli are within the physiological
range. For example, stress induced by forced swimming in mice increases
the intercellular calcium concentrations and changes the alternative
splicing patterns of the acetylcholine esterase gene (Kaufer et al.,
1998; Grisaru et al., 1999). Other nonphysiological stimuli (e.g.,
neuronal activity in models of epilepsy) (Vezzani et al., 1995; Daoud
et al., 1999), potassium stimulation of cultured cells (Xie and Black,
2001), and osmotic (van der Houven van Oordt et al., 2000) and
temperature shock (Takechi et al., 1994; Bournay et al., 1996; Ars et
al., 2000) can also result in a change in alternative splicing
pathways. However, the signal-transduction pathways that mediate these
changes are just beginning to emerge. The effects of potassium
stimulation are mediated by calcium/calmodulin-dependent protein kinase
IV (Xie and Black, 2001), which also suggests a role of intracellular calcium in splice-site regulation.
Phosphorylation was shown to release splicing factors from their
internuclear storage sites, the speckles (Misteli, 2000), but under
these experimental conditions, no accumulation of splicing factors in
the cytosol was observed. We suggest that accumulation of splicing
factors in the cytosol is a second mechanism to regulate the
internuclear concentration of those proteins, which in turn can affect
splice-site selection. It is likely that in most physiological stimulations, the change in subcellular localization will not be as
dramatic as in ischemia, where nuclei are depleted from some splicing
factors. Furthermore, it is possible that these proteins fulfill roles
in the cytosol that need to be determined. Because 47-60% of all
human genes are alternatively spliced (Lander et al., 2001; Modrek et
al., 2001), regulation of splice-site selection is emerging as
an important mechanism to regulate gene expression. In the future, DNA
chip analysis will show what subset of exons is regulated by the
decrease in nuclear tra2-1 concentration and the identification of
splicing-related signal-transduction pathways will offer the
opportunity for drug design in ischemia.
| |
FOOTNOTES |
Received Nov. 2, 2001; revised March 7, 2002; accepted April 19, 2002.
This work was supported by the European Union (Bio4-98-0259) and the
Deutsche Forschungsgemeinschaft (Sta399/2-1 and 3/1 and SFB473/C8).We thank Gregor Eichele, Annette Gärtner, and Peter Stoilov for discussions, J. Chalcroft for artwork, and Manuela Olbrich for technical assistance.
Correspondence should be addressed to Stefan Stamm at the above
address. E-mail: stefan{at}stamms-lab.net.
| |
REFERENCES |
-
Akker SA,
Smith PJ,
Chew SL
(2001)
Nuclear post-transcriptional control of gene expression.
J Mol Endocrinol
27:123-131[Abstract].
-
Ars E,
Serra E,
de la Luna S,
Estivill X,
Lazaro C
(2000)
Cold shock induces the insertion of a cryptic exon in the neurofibromatosis type 1 (NF1) mRNA.
Nucleic Acids Res
28:1307-1312[Abstract/Free Full Text].
-
Beil B,
Screaton G,
Stamm S
(1997)
Molecular cloning of htra2-beta-1 and htra2-beta-2, two human homologues of tra-2 generated by alternative splicing.
DNA Cell Biol
16:679-690[ISI][Medline].
-
Bournay A-S,
Hedley PE,
Maddison A,
Waugh R,
Machray GC
(1996)
Exon skipping induced by cold stress in a potato invertase gene transcript.
Nucleic Acids Res
24:2347-2351[Abstract/Free Full Text].
-
Cáceres J,
Stamm S,
Helfman DM,
Krainer AR
(1994)
Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors.
Science
265:1706-1709[Abstract/Free Full Text].
-
Cáceres JF,
Screaton GR,
Krainer AR
(1998)
A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm.
Genes Dev
12:55-66[Abstract/Free Full Text].
-
Chew SL,
Lui H-X,
Mayeda A,
Krainer AR
(1999)
Evidence for the function of an exonic splicing enhancer after the first catalytic step of pre-mRNA splicing.
Proc Natl Acad Sci USA
96:10655-10660[Abstract/Free Full Text].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate/phenol/chloroform extraction.
Anal Biochem
162:156-159[ISI][Medline].
-
Corden JL, Patturajan M (1997) A CTD function linking
transcription to splicing. Trends Biochem Sci 413-419.
-
Daoud R,
Berzaghi M,
Siedler F,
Hübener M,
Stamm S
(1999)
Activity dependent regulation of alternative splicing patterns in the rat brain.
Eur J Neurosci
11:788-802[ISI][Medline].
-
Daoud R,
Stoilov P,
Stoss O,
Hübener M,
Berzaghi DP,
Hartmann AM,
Olbrich M,
Stamm S
(2000)
Control of pre-mRNA processing by extracellular signals: from molecular mechanisms to clinical applications.
Gene Ther Mol Biol
5:141-150.
-
Di Fruscio M,
Chen T,
Richard S
(1999)
Characterization of Sam68-like mammalian proteins SLM-1 and SLM-2: SLM-1 is a Src substrate during mitosis.
Proc Natl Acad Sci USA
96:2710-2715[Abstract/Free Full Text].
-
Dirnagl U,
Iadecola C,
Moskowitz MA
(1999)
Pathobiology of ischaemic stroke: an integrated view.
Trends Neurosci
22:391-397[ISI][Medline].
-
Elliot DJ
(2000)
Splicing and the single cell.
Histol Histopathol
15:239-249[Medline].
-
Fu X-D
(1995)
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[ISI][Medline].
-
Gehring NH,
Frede U,
Neu-Yilik G,
Hundsdörfer P,
Vetter B,
Hentze MW,
Kulozik AE
(2001)
Increased efficiency of mRNA 3' end formation: a new genetic mechanism contributing to hereditary thrombophilia.
Nat Genet
28:389-392[ISI][Medline].
-
Grabowski P
(1998)
Splicing regulation in neurons: tinkering with cell-specific control.
Cell
92:709-712[ISI][Medline].
-
Grabowski PL,
Black DL
(2001)
Alternative RNA splicing in the nervous system.
Prog Neurobiol
65:289-308[ISI][Medline].
-
Graveley BR
(2000)
Sorting out the complexity of SR protein function.
RNA
6:1197-1211[ISI][Medline].
-
Grisaru D,
Sternfeld M,
Eldor A,
Glick D,
Soreq H
(1999)
Structural roles of acetylcholineesterase variants in biology and pathology.
Eur J Biochem
264:672-686[ISI][Medline].
-
Grondahl TO,
Hablitz JJ,
Langmoen IA
(1998)
Depletion of intracellular Ca2+ stores or lowering extracellular calcium alters intracellular Ca2+ changes during cerebral energy deprivation.
Brain Res
796:125-132[ISI][Medline].
-
Gyngell ML,
Busch E,
Schmitz B,
Kohno K,
Back T,
Hoehnberlage M,
Hossmann K-A
(1995)
Evolution of acute focal cerebral ischaemia in rats observed by localized H-1 MRS, diffusion-weighted MRI, and electrophysiological monitoring.
NMR Biomed
8:206-214[ISI][Medline].
-
Hanamura A,
Cáceres JF,
Mayeda A,
Franza BR,
Krainer AR
(1998)
Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors.
RNA
4:430-444[Abstract].
-
Hara H,
Huang PL,
Panahian N,
Fishman MC
(1996)
Reduced brain edema and infarction volume in mice lacking the neuronal isoform of nitric oxide synthase after transient MCA occlusion.
J Cereb Blood Flow Metab
16:605-611[ISI][Medline].
-
Hastings ML,
Krainer AR
(2001)
Pre-mRNA splicing in the new millennium.
Curr Opin Cell Biol
13:302-309[ISI][Medline].
-
Hata R,
Mies G,
Wiessner C,
Fritze K,
Hesselbarth D,
Brinker G,
Hossmann K-A
(1998)
A reproducible model of middle cerebral artery occlusion in mice: hemodynamic, biochemical and magnetic resonance imaging.
J Cereb Blood Flow Metab
18:367-375[ISI][Medline].
-
Heiss W-D,
Graf R,
Wienhard K,
Lottgen J,
Saito R,
Fujita T,
Rosner G,
Wagner R
(1994)
Dynamic penumbra demonstrated by sequential multitracer PET after middle cerebral artery occlusion in cats.
J Cereb Blood Flow Metab
14:892-902[ISI][Medline].
-
Hertel KJ,
Maniatis T
(1998)
The function of multisite splicing enhancers.
Mol Cell
1:449-455[ISI][Medline].
-
Hertel KJ,
Lynch KW,
Maniatis T
(1997)
Common themes in the function of transcription and splicing enhancers.
Curr Opin Cell Biol
9:350-357[ISI][Medline].
-
Hodges PE,
Carrico PM,
Hogan JD,
O'Neill KE,
Owen JJ,
Mangan M,
Davis BP,
Brooks JE,
Garrels JI
(2002)
Annotating the human proteome: the Human Proteome Survey Database (HumanPSD) and an in-depth target database for G protein-coupled receptors (GPCR-PD) from Incyte Genomics.
Nucleic Acids Res
30:137-141[Abstract/Free Full Text].
-
Hossmann K-A
(1994)
Viability thresholds and the penumbra of focal ischemia.
Ann Neurol
36:557-565[ISI][Medline].
-
Jiang H-H,
Zhang W-J,
Rao Y,
Wu JY
(1998)
Regulation of Ich-1 pre-mRNA alternative splicing and apoptosis by mammalian splicing factors.
Proc Natl Acad Sci USA
95:9155-9160[Abstract/Free Full Text].
-
Kamma H,
Portman DS,
Dreyfuss G
(1995)
Cell type-specific expression of hnRNP proteins.
Exp Cell Res
221:187-196[ISI][Medline].
-
Kataoka N,
Bachorik JL,
Dreyfuss G
(1999)
Transportin-SR, a nuclear import receptor for SR proteins.
J Cell Biol
145:1145-1152[Abstract/Free Full Text].
-
Kaufer D,
Friedman A,
Seidman S,
Soreq H
(1998)
Acute stress facilitates long-lasting changes in cholinergic gene expression.
Nature
393:373-377[Medline].
-
Kogure K,
Alonso OF
(1978)
A pictorial representation of endogenous brain ATP by a bioluminescent method.
Brain Res
154:273-284[ISI][Medline].
-
Laemmli UK
(1970)
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
-
Lander ES,
Linton LM,
Birren B,
Nusbaum C,
Zody MC,
Baldwin J,
Devon K,
Dewar K,
Doyle M,
FitzHugh W,
Funke R,
Gage D,
Harris K,
Heaford A,
Howland J,
Kann L,
Lehoczky J,
LeVine R,
McEwan P,
McKernan K
(2001)
Initial sequencing and analysis of the human genome.
Nature
409:860-921[Medline].
-
Liu HX,
Zhang M,
Krainer AR
(1998)
Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins.
Genes Dev
12:1998-2012[Abstract/Free Full Text].
-
Liu HX,
Chew SL,
Cartegni L,
Zhang MQ,
Krainer AR
(2000)
Exonic splicing enhancer motif recognized by human SC35 under splicing conditions.
Mol Cell Biol
20:1063-1071[Abstract/Free Full Text].
-
Manley JL,
Tacke R
(1996)
SR proteins and splicing control.
Genes Dev
10:1569-1579[Free Full Text].
-
McBride AE,
Schlegel A,
Kirkegaard K
(1996)
Human protein Sam68 relocalization and interaction with poliovirus RNA polymerase in infected cells.
Proc Natl Acad Sci USA
93:2296-2301[Abstract/Free Full Text].
-
McCracken S,
Fong N,
Yankulov K,
Ballantyne S,
Pan G,
Greenblatt J,
Patterson SD,
Wickens M,
Bentley DL
(1997)
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[Medline].
-
Misteli T
(2000)
Cell biology of transcription and pre-mRNA splicing: nuclear architecture meets nuclear function.
J Cell Sci
113:1841-1849[Abstract].
-
Modrek B,
Resch A,
Grasso C,
Lee C
(2001)
Genome-wide detection of alternative splicing in expressed sequences of human genes.
Nucleic Acids Res
29:2850-2859[Abstract/Free Full Text].
-
Nayler O,
Stamm S,
Ullrich A
(1997)
Characterization and comparison of four serine- and arginine-rich (SR) protein kinases.
Biochem J
326:693-700.
-
Nayler O,
Cap C,
Stamm S
(1998a)
Human transformer-2-beta gene (SFRS10): complete nucleotide sequence, chromosomal localization, and generation of a tissue-specific isoform.
Genomics
53:191-202[ISI][Medline].
-
Nayler O,
Strätling W,
Bourquin J-P,
Stagljar I,
Lindemann L,
Jasper H,
Hartmann AM,
Fackelmayer FO,
Ullrich A,
Stamm S
(1998b)
SAF-B couples transcription and pre-mRNA splicing to SAR/MAR elements.
Nucleic Acids Res
26:3542-3549[Abstract/Free Full Text].
-
Neugebauer KM,
Stolk JA,
Roth MB
(1995)
A conserved epitope on a subset of SR proteins defines a larger family of pre-mRNA splicing factors.
J Cell Biol
129:899-908[Abstract/Free Full Text].
-
Paschen W,
Doutheil J,
Gissel C,
Treiman M
(1996)
Depletion of neuronal endoplasmic reticulum calcium stores by thapsigargin: effect on protein synthesis.
J Neurochem
67:1735-1743[ISI][Medline].
-
Smith CW,
Valcarcel J
(2000)
Alternative pre-mRNA splicing: the logic of combinatorial control.
Trends Biochem Sci
25:381-388[ISI][Medline].
-
Soreq H,
Seidman S
(2001)
Acetylcholinesterase
 new roles for an old actor.
Nat Rev Neurosci
2:294-302[ISI][Medline]. -
Stamm S,
Casper D,
Lees-Miller JP,
Helfman DM
(1993)
Brain-specific tropomyosins TMBr-1 and TMBr-3 have distinct patterns of expression during development and in adult brain.
Proc Natl Acad Sci USA
90:9857-9861[Abstract/Free Full Text].
-
Stojdl DF,
Bell JC
(1999)
SR protein kinases: the splice of life.
Biochem Cell Biol
77:293-298[ISI][Medline].
-
Stoss O,
Stoilov P,
Daoud R,
Hartmann AM,
Olbrich M,
Stamm S
(2000)
Misregulation of pre-mRNA splicing that causes human diseases.
Gene Ther Mol Biol
5:9-28.
-
Stoss O,
Olbrich M,
Hartmann AM,
König H,
Memmott J,
Andreadis A,
Stamm S
(2001)
The STAR/GSG family protein rSLM-2 regulates the selection of alternative splice sites.
J Biol Chem
276:8665-8673[Abstract/Free Full Text].
-
Takechi H,
Hosokawa N,
Hirayoshi K,
Nagata K
(1994)
Alternative 5' splice site selection induced by heat shock.
Mol Cell Biol
14:567-575[Abstract/Free Full Text].
-
Taylor SJ,
Anafi M,
Pawson T,
Shalloway D
(1995)
Functional interaction between c-src and its mitotic target, Sam68.
J Biol Chem
270:10120-10124[Abstract/Free Full Text].
-
Taylor TN,
Davis PH,
Torner JC,
Holmes J,
Meyer JW,
Jacobson MF
(1996)
Lifetime cost of stroke in the United States.
Stroke
27:1459-1466[Abstract/Free Full Text].
-
Tian M,
Maniatis T
(1993)
A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA.
Cell
74:105-114[ISI][Medline].
-
Treiman M,
Casperson C,
Christensen S
(1998)
A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmatic reticulum Ca++-ATPases.
Trends Pharmacol Sci
19:131-135[Medline].
-
Trendelenburg G,
Muselmann C,
Prass K,
Ruscher K,
Polley A,
Wiegand F,
Meisel A,
Rosenthal A,
Dirnagl U
(2000)
Reproducibility of serial analysis of gene expression (SAGE) and comprehensive transcript profiling in focal cerebral ischemia in the mouse.
Eur J Neurosci
12 [Suppl 11]:307.
-
van der Houven van Oordt W,
Diaz-Meco MT,
Lozano J,
Krainer AR,
Moscat J,
Cáceres JF
(2000)
The MKK 3/6-p38-signaling cascade alters the subcellular distribution of hnRNPA1 and modulates alternative splicing regulation.
J Cell Biol
149:307-316[Abstract/Free Full Text].
-
Venables JP,
Vernet C,
Chew SL,
Elliott DJ,
Cowmaedow RB,
Wu J,
Cooke HJ,
Artzt K,
Eperon IC
(1999)
T-STAR/ETOILE: a novel relative of SAM68 that interacts with an RNA-binding protein implicated in spermatogenesis.
Hum Mol Genet
8:959-969[Abstract/Free Full Text].
-
Venables JP,
Elliott DJ,
Makarova OV,
Makarova EM,
Cooke HJ,
Eperon IC
(2000)
RBMY, a probable human spermatogenesis factor, and other hnRNP G proteins interact with Tra2beta and affect splicing.
Hum Mol Genet
9:685-694[Abstract/Free Full Text].
-
Vernet C,
Artzt K
(1997)
STAR, a gene family involved in signal transduction and activation of RNA.
Trends Genet
13:479-484[ISI][Medline].
-
Vezzani A,
Speciale C,
Vedova FD,
Tamburin M,
Benatti L
(1995)
Alternative splicing at the C-terminal but not the N-terminal domain of the NMDA receptor NR1 is altered in the kindled hippocampus.
Eur J Neurosci
7:2513-2517[ISI][Medline].
-
Wang J,
Manley JL
(1995)
Overexpression of the SR proteins ASF/SF2 and SC35 influences alternative splicing in vivo in diverse ways.
RNA
1:335-346[Abstract].
-
Wang L,
Miura M,
Bergeron L,
Zhu H,
Yuan J
(1994)
Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death.
Cell
78:739-750[ISI][Medline].
-
Weighardt F,
Biamonti G,
Riva S
(1996)
The role of heterogeneous nuclear ribonucleoproteins (hnRNP) in RNA metabolism.
BioEssays
18:747-756[ISI][Medline].
-
Wu JY,
Maniatis T
(1993)
Specific interactions between proteins implicated in splice site selection and regulated alternative splicing.
Cell
75:1061-1070[ISI][Medline].
-
|
TOP
ABSTRACT
INTRODUCTION
