 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2002, 22(15):6309-6314
BRIEF COMMUNICATION
Cortical Excitatory Neurons and Glia, But Not GABAergic Neurons,
Are Produced in the Emx1-Expressing Lineage
Jessica A.
Gorski1,
Tiffany
Talley1,
Mengsheng
Qiu3,
Luis
Puelles4,
John L. R.
Rubenstein2, and
Kevin R.
Jones1
1 Department of Molecular, Cellular, and Developmental
Biology, University of Colorado, Boulder, Colorado 80309, 2 Department of Psychiatry, University of California at San
Francisco, San Francisco, California 94143-0984, 3 Department of Anatomical Sciences and Neurobiology,
University of Louisville, Louisville, Kentucky 40241, and
4 Department of Morphological Sciences, Medical School,
University of Murcia, E30100 Murcia, Spain
 |
ABSTRACT |
By homologous recombination of an internal ribosome entry site and
Cre recombinase coding region into the 3'-untranslated region of the
mouse Emx1 gene, we have generated a strain of mice, Emx1IREScre, that
expresses the Cre recombinase in a spatial and temporal pattern like
that observed for Emx1. When mated to reporter strains, these mice are
a sensitive means to fate-map the Emx1-expressing cells of the
developing forebrain. Our results demonstrate that radial glia,
Cajal-Retzius cells, glutamatergic neurons, astrocytes, and
oligodendrocytes of most pallial structures originate from an
Emx1-expressing lineage. On the other hand, most of the pallial GABAergic neurons arise outside the Emx1-expressing lineage. Structures that are located near the basal ganglia (e.g., the amygdala and endopiriform nuclei) are not uniformly derived from Emx1-expressing cells.
Key words:
Emx1; cell fate; cortex; hippocampus; Cre; GABAergic
interneuron; glia
 |
INTRODUCTION |
Recent studies suggest that the
vertebrate cerebral cortex primordium (pallium) is subdivided into at
least four primary progenitor zones, medial, dorsal, lateral, and
ventral, giving rise to the hippocampus, neocortex, piriform cortex,
and parts of the endopiriform nucleus and amygdala, respectively
(Puelles et al., 2000 ). Furthermore, there is now evidence that these
regions integrate glutamatergic projection neurons and astroglia
produced by radial glial cells present in pallial progenitor zones and
GABAergic local circuit neurons produced in subpallial progenitor zones
(for review, see Marin and Rubenstein, 2001 ). Some cortical
oligodendrocytes also appear to be produced in the cortex, although
others may be derived from a subcortical source (Spassky et al., 1998 ).
Additional fate mapping and lineage analysis will be useful in testing
these ideas.
Site-specific DNA recombinases are a useful tool for lineage analysis
(Yamauchi et al., 1999 ; Chai et al., 2000 ). In this strategy, a
transgenic mouse strain expressing a site-specific DNA recombinase
(e.g., Cre) in a subset of cells is bred with a transgenic
"reporter" strain in which the reporter gene is only expressed
after deletion of DNA sequences by the recombinase. Thus, offspring
having both the recombinase and reporter transgenes express the
reporter in cells whose ancestors expressed the recombinase at a
previous developmental stage, even if recombinase expression was transient.
To study lineage relationships in the cerebral cortex of mice, we used
the Emx1 gene to drive expression of the Cre recombinase. Emx1 encodes
a homeodomain protein whose expression is restricted primarily to
cortical subdivisions of the telencephalon (Simeone et al., 1992a ,b ;
Briata et al., 1996 ; Gulisano et al., 1996 ; Puelles et al., 2000 ). Emx1
is expressed in both progenitor cells and postmitotic neurons of the
medial, dorsal, and lateral pallia; expression is not detectable in the
ventral pallium during early stages of development. Neuronal expression
in the cortex is restricted to projection neurons (Chan et al., 2001 ).
Mating this
Emx1IREScre
strain to Cre-dependent reporter strains defines lineage relationships between cortical neurons and glia and sheds light on the origins of the
cellular constituents of several major telencephalic structures.
 |
MATERIALS AND METHODS |
Generation of targeting construct. An Emx1 cDNA
fragment (Qiu et al., 1996 ) was used to isolate a genomic clone
containing the last Emx1 exon. An improved internal ribosomal entry
site IREScre gene (Gorski and Jones, 1999 ) followed by an
FRT site-flanked PGKneo selectable marker was inserted into an
XhoI site located 120 bp 3' of the Emx1 stop codon. The
FRT-PGKneo-FRT cassette was generated by annealing oligonucleotides
containing FRT sites (FRTNEO linker:
5'-CTAGAATTCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGG- AACTTC-3'
and 5'-AATTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGA ACTTCGAATT-3'; FRTNEOB linker:
5'-AGCTCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAG- TATAGGAACTTCAAGCTTGGCCGCGGAGCTCGGGCC-3'
and
5'- CGAGCTCCGCGGCCAAGCTTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCG-3') followed by ligation to the EcoRI-HindIII PGKneo
fragment from pGEM7(KJ1) (Rudnicki et al., 1992 ).
Isolation of mouse strain and genetics. All animal
procedures were conducted in accord with U.S. Public Health
Service guidelines and with the approval of the University of
Colorado Institutional Animal Care and Use Committee. Targeted
embryonic stem cell clones were identified and injected into
blastocysts, and mice carrying the mutation were derived using standard
methods. Four strains were isolated from independent stem cell clones;
all displayed indistinguishable patterns of recombination when mated to
reporter strains. One of the four strains was mated to the FLP-4917 Flp recombinase-expressing transgenic strain (Dymecki, 1996 ) to eliminate the PGKneo selectable marker. The resulting
Emx1IREScre
mice were backcrossed four to eight generations to C57BL/6J and bred to
the reporter strains, and offspring were genotyped using PCR.
Western blotting. Emx1 protein was quantified from the
neocortex of perinatal (P0) wild-type (n = 4) and
Emx1IREScre
homozygous (n = 3) pups. Protein (15 µg) was
transferred and incubated with an anti-Emx1 antibody and normalized to
anti-NeuN (Molecular Probes, Eugene, OR) using the Odyssey detection
reagents and software (Li-Cor Biosciences, Lincoln, NE).
Histochemistry and immunohistochemistry. Procedures for
5-bromo-4-chloro-3-indoyl- -D-galactopyranoside
(X-gal) staining and immunocytochemistry were as described
previously (Vigers et al., 2000 ). Primary antibody sources were as
follows: anti- -Gal (a gift from C. Yee and T. Finger, University of
Colorado Health Sciences Center), anti- -Gal (ICN
Pharmaceuticals, Auroria, OH), anti-calretinin, anti-calbindin, and
anti-ChAT (Chemicon, Temecula, CA), anti-GABA, anti-neurofilament, and
anti-parvalbumin (Sigma, St Louis, MO), anti-NeuN (Molecular Probes),
anti-Rip and anti-RC2 (Developmental Studies Hybridoma Bank),
and anti-S100 (Dako, Glostrup, Denmark). Alexa 488 goat anti-mouse IgG
antibody and Alexa 546 goat anti-rabbit IgG antibody (Molecular Probes)
were used for detection. Sections were coverslipped with Fluoromount
(Fisher Scientific, Pittsburgh, PA), and images were captured using an Axioplan deconvolution microscope (Zeiss, Germany) with an attached Hamamatsu C4742-95 digital camera (Hamamatsu, Bridgewater, NJ) running
Openlab software (Improvision, Coventry, UK).
 |
RESULTS |
Insertion of an IREScre into the Emx1 3'-UTR
Homologous recombination was used to insert an IREScre
gene into the exon encoding the 3' untranslated region of the mouse Emx1 gene, thereby generating bicistronic messenger RNAs encoding both
the Emx1 and Cre proteins (Fig.
1A,B).
Homozygous
Emx1IREScre
mice and transheterozygous
Emx1IREScre/Emx1null
mice did not exhibit any of the abnormal phenotypes reported for
Emx1null/Emx1null
mice (Qiu et al., 1996 ; Yoshida et al., 1997 ) (n = 3;
data not shown). There was no apparent reduction of Emx1 protein in the neocortex of
Emx1IREScre/Emx1IREScre
neonates compared with wild type (Fig. 1C). Thus, by both
genetic and biochemical criteria, insertion of IREScre did
not interfere with the function of the Emx1 gene.

View larger version (78K):
[in this window]
[in a new window]
|
Figure 1.
Tissue-specific lox recombination driven by
Emx1IREScre.
A, Schematic of the
Emx1IREScre
targeting construct. SA, Splice acceptor;
UGA, stop codon; pA, polyadenylation
signal; black triangles, FRT sites; small
arrow, PGK promoter. B, Schematic of Emx1 exon
3. Hatched box, Coding region; open box,
3'-untranslated. C, Western blots of cortical
protein from wild-type mice (lanes 1,
2) and
Emx1IREScre/Emx1IREScre
mice (lanes 3, 4), probed with
anti-Emx1 or anti-NeuN. D, An X-galstained E10.5
Emx1IREScre;R26R
embryo. E, An E10.5
Emx1IREScre;R26R
embryo X-gal stained and processed for neurofilament
immunohistochemistry. Cranial ganglia are numbered.
F-I, Sections (10 µm) of X-gal-stained
E12.5
Emx1IREScre;R26R
embryos. AEP, Anterior entopeduncular area;
amyg, amygdala; ch, choroid plexus
primordium; DP, dorsal pallium; EMT,
eminentia thalami; hem, cortical hem;
MGE, medial ganglionic eminence; MP,
medial pallium; LGE, lateral ganglionic eminence;
LP, lateral pallium; POA, preoptic area;
OT, olfactory tuberculum; pspb,
pallial-subpallial boundary; Sp, pallial septum;
Ssp, subpallial septum; VP, ventral
pallium. Also see supplemental material at
http://www.jneurosci.org.
|
|
Emx1IREScre-mediated
recombination in specific telencephalic domains
To characterize Cre recombinase expression, we mated
Emx1IREScre
mice to the R26R strain (Soriano, 1999 ). In the R26R strain,
Cre-mediated recombination enables expression of
lacZ-encoded -Gal. X-gal staining of embryonic day (E)
10.5 Emx1IREScre;R26R
embryos revealed recombination in the dorsal telencephalon, maxillary
branch of the first branchial arch, cranial ganglia VII/VIII and IX/X,
and limb ectoderm (Fig. 1D,E).
These results are consistent with reported sites of Emx1 expression
(Simeone et al., 1992a ,b ).
At E12.5 nearly every cell of the proliferative and postmitotic zones
in the medial, dorsal, and lateral pallia had undergone recombination
(Fig. 1F). Dorsomedially, recombination included the
fimbria (cortical hem) and part of the choroid plexus (Fig. 1G). In the ventral pallium, scattered periventricular cells
expressed -Gal along with cells that extended radially into the
mantle and seemed to accumulate subpially (Fig.
1H,I). In the subpallium, scattered groups of radially oriented recombined cells were apparent in
the lateral and medial ganglionic eminences (LGEs, MGEs), with variable
numbers in different embryos analyzed (data not shown). Extensive
recombination was found in a layer of subpial cells in the mantle of
the LGE and MGE. Thus, recombination in E12.5 Emx1IREScre;R26R
embryos was detected not only in all areas of the forebrain reported
previously to express Emx1 mRNA, but also in the ventral pallium and in
a small subset of LGE and MGE cells.
In the adult, reproducible (n = 4) and extensive
recombination was seen in the cortical and ependymal layers of the
derivatives of the lateral pallium (piriform cortex) (Fig.
2B-E), dorsal pallium (medial limbic allocortex and neocortex), and medial pallium
(hippocampal structures) (Fig.
2E,F). In contrast, only a
subset of cells underwent recombination in putative ventral pallial
structures (ventral endopiriform nucleus and parts of the amygdala)
(Fig. 2B-F).

View larger version (104K):
[in this window]
[in a new window]
|
Figure 2.
Recombination in the adult
Emx1IREScre;R26R
brain. A-F, Coronal sections (40 µm)
of X-gal-stained adult
Emx1IREScre;R26R
brain. AA, Anterior amygdaloid area; ac,
anterior commissure; ACo, anterior cortical amygdaloid
nucleus; AHip, amygdalohippocampal area;
BL, basolateral amygdala; BM, basomedial
amygdala; Bst, bed nucleus of stria terminalis;
C, central amygala; cc, corpus callosum;
ch, choroid plexus; Cing.Cx, cingulate
cortex; CLdl, dorsolateral claustrum;
CLvm, ventromedial claustrum; CxA,
cortex-amygdala transition zone; DP, dorsal pallidum;
DTT, dorsal tenia tectum; EPd, dorsal
endopiriform nucleus; EPv, ventral endopiriform nucleus;
ERCx, ectorhinal cortex; f, fimbria;
Hy, hypothalamus; L, lateral amygdala;
LP, lateral pallidum; LSD, lateral septal
nucleus dorsal; LSI, intermediate lateral septal
nucleus; M, medial amygdala; MS, medial
septum; NAOT, bed nucleus of the accessory olfactory
tract; NLOT (2), nucleus of lateral olfactory tract,
layer II; Pal, pallidum; PCol,
posterolateral cortical amygdaloid nucleus; PCom,
posteromedial amygdaloid nucleus; PirCx, piriform cortex;
PLd, paralamboid septal nucleus dorsal; St,
striatum; Th, thalamus; VP, ventral pallidum;
VTT, ventral tenia tectum. Also see supplemental material at
http://www.jneurosci.org.
|
|
In the rostral telencephalon, recombination was present in the
olfactory bulb, orbital cortex, anterior olfactory nuclei, indusium
griseum, and tenia tecta (Fig.
2A,B). The olfactory bulb had
extensive recombination in the mitral cell layer and partial recombination in the granular, internal plexiform, and periglomerular layers. In the septum, the septohippocampal, septofimbrial, and intermediate lateral septal nuclei contained the highest proportion of
recombined cells, whereas the main lateral septal nuclei (dorsal and
ventral parts) had a lower density, and the medial septal area was
negative (Fig. 2C).
In central and caudal regions of the telencephalon, the entire
hippocampus, neocortex, and layer II of piriform cortex showed extensive recombination, whereas subcortical structures had only a few
recombined cells. The pallial structures that are located between the
piriform cortex and the striatum showed a mixed phenotype. Although the
dorsolateral claustrum and dorsal endopiriform nucleus showed extensive
recombination, the ventral endopiriform nucleus and adjacent deep layer
III of the piriform cortex had only scattered X-gal-positive cells
(Fig. 2B,C). More caudally, this
region contains pallial portions of the amygdala. Recombination was
detected in a subset of cells in the lateral, basolateral, and
basomedial nuclei of the amygdala (Fig.
2E,F). Superficially, the
cortex-amygdala transition zone, the anterior and posterior cortical
amygdaloid nuclei, layer II of the nucleus of the lateral olfactory
tract, the bed nucleus of the accessory olfactory tract, and the
entorhinal cortex contained blue cells. In addition, the posteroventral
part of the medial amygdala, together with the associated
amygdalo-hippocampal area and amygdalo-piriform area, were also X-gal
positive (Fig. 2D). In contrast, very little
recombination was detected in a large part of the anterior amygdaloid
area and intercalated amygdaloid cell masses (Fig.
2D). No recombination was detected in the ventral endopiriform nucleus (Fig. 2B), the central
amygdaloid nucleus (striatal amygdala), the bed nucleus of stria
terminalis (pallidal amygdal), and the posterodorsal part of the medial
amygdaloid nucleus (Fig. 2E).
Outside of the telencephalon there was little recombination in the
brain. The thalamus contained a few scattered recombined cells,
possibly from the forebrain/midbrain boundary of the dorsal diencephalon. A few scattered recombined cells in the hypothalamus, habenula, midbrain, and hindbrain were observed (Fig.
2E; and data not shown). Within the midbrain, a
subset of cells in the superior colliculus and the periaqueductal gray
were recombined (data not shown).
Emx1 and neuronal cell lineages in the telencephalon
To further identify cells undergoing recombination in
Emx1IREScre;
R26R mice, we performed double-label immunofluorescence. In
cortex and hippocampus, although many
NeuN+ cells (a marker for neurons) (Mullen
et al., 1992 ) were also -Gal+ (88% in
visual cortex; n = 1567 cells), 12% were not. Because of the evidence supporting an extracortical origin for many GABAergic inhibitory interneurons (Marin et al., 2000 ), we analyzed the relationship between -Gal and interneuron markers in
Emx1IREScre;R26R
mice. There was little evidence for colocalization of GABA and -Gal
in the visual cortex (Fig.
3A-C), where <2% of
GABA+ neurons expressed -Gal, and no
evidence for recombined parvalbumin and calretinin-positive cells
(n = 2 mice; 100-135 cells scored per mouse per
marker). Afferent fibers may have contributed the faint GABA staining
responsible for scoring the few cells as positive. Consistent with
these observations in adult mice, we found that calbindin (expressed by
precursors of cortical GABAergic neurons) and -Gal were not
colocalized in E12.5
Emx1IREScre;R26R
cortical plate (Fig. 3D,F).
The absence of -Gal in GABA+ cells was
not caused by an inability of the R26R reporter to express in these
cells, because -Gal staining was readily detected using a different
Cre transgene that caused recombination in these cells (data not
shown).

View larger version (83K):
[in this window]
[in a new window]
|
Figure 3.
Interneurons originate outside the Emx1 lineage.
A-C, Adult
Emx1IREScre;R26R
visual cortex probed with anti- -Gal and anti-GABA.
D-F, E12.5
Emx1IREScre;R26R
pallium probed with anti-calbindin anti- -Gal.
G-L, Adult
Emx1IREScre;R26R
striatum, probed with anti- -Gal and the other antibodies indicated.
All sections are 10 µm coronal. Arrows indicate
double-labeled cells.
|
|
As a second approach to determine whether interneurons are generated
outside the Emx1 lineage, we analyzed -Gal expression in
Emx1IREScre;Z/AP
mice, which express -Gal in cells that have not undergone Cre-mediated recombination and express alkaline phosphatase in cells
that have (Lobe et al., 1999 ). We found that near-identical proportions
of GABA-positive cells were -Gal positive in Z/AP and
Emx1IREScre;Z/AP
mice (80 and 77%, respectively; n = 145 cells per
genotype). Thus, analysis using both the Z/AP and R26R reporters
indicates that all or nearly all GABAergic neurons originate outside
the Emx1 lineage.
In adult
Emx1IREScre;R26R
striatum, a subpopulation of recombined cells expressed calbindin (Fig.
3G-I), which is used as a marker for medium spiny
neurons. On the other hand, recombined striatal cells did not express
proteins characteristic of striatal interneurons, including choline
acetyltransferase, neuropeptide Y, and parvalbumin (Fig.
3J-L) (n = 2 mice; 100-250 cells per mouse
per marker).
In neocortical layer 1 of perinatal (P4)
Emx1IREScre;R26R
pups, we observed near-complete colocalization between -Gal and
calretinin, likely corresponding to Cajal-Retzius cells (Fig.
4A-F). The few calretinin+/ -Gal
cells could be inhibitory interneurons. In E12.5
Emx1IREScre;R26R
embryos, radial glia, detected with the RC2 antibody, had undergone
recombination (Fig. 4G-I).

View larger version (87K):
[in this window]
[in a new window]
|
Figure 4.
Cajal-Retzius cells, astrocytes, and
oligodendrocytes. A-F, Retrosplenial
cortex (A-C) and visual cortex
(D-F) of P4
Emx1IREScre;R26R
mice probed with anti-calretinin and anti- -Gal.
G-I, E12.5
EmxIREScre;R26R
cortical plate probed with anti-RC2 and anti- -Gal.
Asterisk indicates nucleus.
J-L, Cultured
Emx1IREScre;R26R
astrocytes probed with anti- -Gal and anti-S-100.
M-O, X-gal-stained adult
Emx1IREScre;R26R
corpus callosum (M), fimbria
(N), and anterior commissure
(O). P-U,
Emx1IREScre;R26R
(P-R) and
Emx1IREScre;Z/AP
(S-U) corpus callosum probed with anti- -Gal
and anti-Rip. S, Arrow indicates
blood vessel. V, Adult
Emx1IREScre;Z/AP
neocortex. Blood vessels and scattered cells (arrows)
are X-gal stained.
|
|
Emx1 and glial lineages in the telencephalon
-Gal was expressed in cells in white matter structures of adult
Emx1IREScre;R26R
mice including the corpus callosum, fimbria of the hippocampus, and
layer I of the neocortex (Fig.
4M,N). The location and
morphology of these cells (small soma with compact nuclei) are
characteristic of myelinating oligodendrocytes (Birling and Price,
1998 ). In contrast, very few cells in the anterior commissure expressed -Gal (Fig. 4O). Extensive colocalization of -Gal and
Rip (an antibody that recognizes oligodendrocytes and their processes) was apparent in the corpus callosum (Fig. 4P-R),
indicating that oligodendrocytes had undergone recombination.
Supporting this conclusion, Rip-positive oligodendrocytes in the corpus
callosum of adult
Emx1IREScre;Z/AP
mice did not detectably express -Gal, also consistent with recombination in oligodendrocytes (Fig. 4S-U). In
Emx1IREScre;Z/AP
mice, -Gal expression was detected in blood vessels (Fig. 4V), indicating that endothelial cells had not
undergone recombination.
We next sought to determine whether astrocytes are part of the Emx1
lineage. Because S-100-positive astrocytes did not express robust
levels of -Gal in brain sections prepared from fully Cre-recombined R26R mice (data not shown), we isolated astrocytes from the neocortex of perinatal (P1)
Emx1IREScre;R26R
pups and cultured them for 4 d in vitro. Under these
conditions, all S-100-positive cells also expressed -Gal, indicating
that neocortical astrocytes had undergone recombination (Fig.
4J-L). To corroborate this result,
S-100+/ -Gal+
cells were not detected in the cortex of adult
Emx1IREScre;Z/AP
mice (data not shown).
 |
DISCUSSION |
The
Emx1IREScre
mouse is a sensitive tool for determining the fate of Emx1-expressing
cells. The specificity of this approach is supported by the fact that
the
Emx1IREScre-induced
recombination was primarily restricted to telencephalic regions known
to express Emx1 mRNA and protein. Recombination was found in a few
telencephalic regions that previously were not reported to express
Emx1. These discrepancies could result from the high sensitivity of
X-gal staining, transient expression of Emx1 mRNA not previously noted,
or migration of transiently Emx1-expressing progenitors. It is also
possible that Emx1 is spuriously expressed because of the insertion of
the IREScre, but this seems unlikely because mis-expression was not
detected elsewhere in the animal.
Emx1IREScre-induced
recombination in regions of the pallium
High levels of recombination were detected in progenitor cells and
projection neurons of most regions of the pallium, including the
medial, dorsal, and lateral pallium. Lower levels of recombination were
present in the putative ventral pallial progenitors and their derivatives. In situ hybridization did not detect clear
expression in the ventral pallium in midgestation mice (Puelles et al.,
2000 ). The derivatives of the ventral pallium have been hypothesized to
include parts of the claustrum, endopiriform nuclei, and amygdalar complex (Fernandez et al., 1998 ; Puelles et al., 1999 , 2000 ). Within
the amygdala, the basomedial, lateral, anterior, and intercalated nuclei are postulated to be produced in part by the ventral pallium (Puelles et al., 2000 ). Here we found some support for this model (e.g., the ventral endopiriform nucleus and the anterior and
intercalated amygdalar nuclei were mostly unrecombined) (Fig.
2B-D), but we also found a significant degree of
recombination in the area of the claustrum and some recombination in
the basomedial and lateral nuclei of the amygdala (Fig.
2C-F).
Two mechanisms may underlie the large number of recombined cells in
these regions. First, either induction of Emx1 expression or tangential
migration/intercalation of Emx1+
progenitors from the adjacent lateral pallium can give rise to recombined clones in the progenitor zone of the ventral pallium. Notably, Fernandez et al. (1998) reported that the ventral pallium was
Emx1 at mid-gestation but later became
Emx1+ in the mouse. Second, tangential
migration of recombined cells from more dorsal pallial regions could
also contribute recombined cells to the ventral pallium. This type of
migration has been observed in guidepost cells of the lateral olfactory
tract (Tomioka et al., 2000 ).
EmxIREScre-induced recombination in regions of
the subpallium
We were surprised to find occasional recombined cells in the
subpallium at E12.5 because expression of Emx1 has not been reported previously in this region. The recombined cells have the appearance of
radially migrating clones. The mechanisms underlying the origin of
these recombined cells can be the same as discussed above for the
ventral pallium. The fate of these cells could be the recombined cells
found in the adult striatum, pallidum, central and medial amygdala, bed
nucleus of the stria terminalis, and septal nuclei. Within the
striatum, they do not appear to be interneurons, because no
colocalization was detected between -Gal and choline acetyl transferase, neuropeptide Y, or parvalbumin.
Identity of EmxIREScre recombined neurons in
the pallium
In the neocortex and hippocampus, ~88% of neurons underwent
recombination. The vast majority of these must be projection neurons, because >98% of GABAergic local circuit neurons did not undergo recombination, indicating that Emx1 is not expressed at any time during
development of these cells. A similar finding was reported by Iwasato
et al. (2000) . This result extends recent studies suggesting that most
GABAergic cortical neurons tangentially migrate from the subpallial
telencephalon (for review, see Marin and Rubenstein, 2001 ).
We showed that Cajal-Retzius cells originate within the Emx1 lineage.
Previous studies have been contradictory about whether these cells are
produced in the pallium or subpallium. Anatomical and marker expression
analyses suggested that Cajal Retzius cells originate in the MGE
(Lavdas et al., 1999 ) or have a pallial origin behind the olfactory
bulb (Meyer et al., 1998 ). However, genetic analyses of transcription
factors expressed in the pallium and subpallium have suggested a
pallial origin (Sussel et al., 1999 ; Marin and Rubenstein, 2001 ).
Identity of
Emx1IREScre
recombined glia in the pallium
We observed recombination in cortical astrocytes and
oligodendrocytes. Oligodendrocytes in the corpus callosum and fimbria underwent near-complete recombination, but only scattered
oligodendrocytes in the anterior commissure underwent recombination.
The anterior commissure forms within the subpallium (Cobos-Sillero et
al., 2002 ), whereas the corpus callosum and fimbria lie in the pallium. Thus, Emx1+ pallial progenitors produce
oligodendrocytes that specifically interact with axon tracts in the
pallium, and Emx1 progenitors produce
subpallial oligodendrocytes. Our results are consistent with two models
for the origin of oligodendrocytes: that oligodendrocyte precursor
cells are restricted to neuroepithelium near the
telencephalic-diencephalic junction or that all telencephalic neuroepithelium is able to generate oligodendrocytes (Timsit et al.,
1995 ; Hardy and Friedrich, 1996 ; Birling and Price, 1998 ; Spassky et
al., 1998 ). Our data are consistent with the hypothesis that
Emx1-expressing progenitors produce projection neurons,
oligodendrocytes, and astrocytes, but not inhibitory interneurons, and
supports the data indicating that radial glia are precursors for both
cortical neurons and astrocytes (for review, see Chanas-Sacre et al.,
2000 ).
 |
FOOTNOTES |
Received Jan. 29, 2002; revised April 8, 2002; accepted April 15, 2002.
This work was supported by a Burroughs-Wellcome New Investigator in
Pharmacology Award and grants from the American Cancer Society and the
Colorado Council for Research and Creative Work (K.R.J.), National
Institutes of Health (J.L.R.R.), and the Spanish Dirección
General de Enseñanza Superior and Séneca Foundation (L.P.). We thank Susan Tamowski and Ryan Hebert for technical assistance, Gino Corte for anti-Emx1 antibody, Andras Nagy and Susan
Dymecki for mouse strains, and Min Han for fluorescence microscope access.
Correspondence should be addressed to Kevin R. Jones, 347 UCB,
Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309. E-mail:
krjones{at}stripe.colorado.edu.
 |
REFERENCES |
-
Birling MC,
Price J
(1998)
A study of the potential of the embryonic rat telencephalon to generate oligodendrocytes.
Dev Biol
193:100-113[Web of Science][Medline].
-
Briata P,
Di Blas E,
Gulisano M,
Mallamaci A,
Iannone R,
Boncinelli E,
Corte G
(1996)
EMX1 homeoprotein is expressed in cell nuclei of the developing cerebral cortex and in the axons of the olfactory sensory neurons.
Mech Dev
57:169-180[Web of Science][Medline].
-
Chai Y,
Jiang X,
Ito Y,
Bringas Jr P,
Han J,
Rowitch DH,
Soriano P,
McMahon AP,
Sucov HM
(2000)
Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis.
Development
127:1671-1679[Abstract].
-
Chan CH,
Godinho LN,
Thomaidou D,
Tan SS,
Gulisano M,
Parnavelas JG
(2001)
Emx1 is a marker for pyramidal neurons of the cerebral cortex.
Cereb Cortex
11:1191-1198[Abstract/Free Full Text].
-
Chanas-Sacre G,
Rogister B,
Moonen G,
Leprince P
(2000)
Radial glia phenotype: origin, regulation, and transdifferentiation.
J Neurosci Res
61:357-363[Web of Science][Medline].
-
Cobos-Sillero I,
Shimamura K,
Rubenstein JLR,
Martinez S,
Puelles L
(2002)
Fate map of the avian forebrain at stage 8 with quail-chick chimeras.
Dev Biol
239:46-67.
-
Dymecki SM
(1996)
Flp recombinase promotes site-specific DNA recombination in embryonic stem cells and transgenic mice.
Proc Natl Acad Sci USA
93:6191-6196[Abstract/Free Full Text].
-
Fernandez AS,
Pieau C,
Reperant J,
Boncinelli E,
Wassef M
(1998)
Expression of the Emx-1 and Dlx-1 homeobox genes defines three molecularly distinct domains in the telencephalon of mouse, chick, turtle and frog embryos: implications for the evolution of telencephalic subdivisions in amniotes.
Development
125:2099-2111[Abstract].
-
Gorski JA,
Jones KR
(1999)
Efficient bicistronic expression of cre in mammalian cells.
Nucleic Acids Res
27:2059-2061[Abstract/Free Full Text].
-
Gulisano M,
Broccoli V,
Pardini C,
Boncinelli E
(1996)
Emx1 and Emx2 show different patterns of expression during proliferation and differentiation of the developing cerebral cortex in the mouse.
Eur J Neurosci
8:1037-1050[Web of Science][Medline].
-
Hardy RJ,
Friedrich Jr VL
(1996)
Oligodendrocyte progenitors are generated throughout the embryonic mouse brain, but differentiate in restricted foci.
Development
122:2059-2069[Abstract].
-
Iwasato T,
Datwani A,
Wolf AM,
Nishiyama H,
Taguchi Y,
Tonegawa S,
Knopfel T,
Erzurumlu RS,
Itohara S
(2000)
Cortex-restricted disruption of NMDAR1 impairs neuronal patterns in the barrel cortex.
Nature
406:726-731[Medline].
-
Lavdas AA,
Grigoriou M,
Pachnis V,
Parnavelas JG
(1999)
The medial ganglionic eminence gives rise to a population of early neurons in the developing cerebral cortex.
J Neurosci
19:7881-7888[Abstract/Free Full Text].
-
Lobe CG,
Koop KE,
Kreppner W,
Lomeli H,
Gertsenstein M,
Nagy A
(1999)
Z/AP, a double reporter for cre-mediated recombination.
Dev Biol
208:281-292[Web of Science][Medline].
-
Marin O,
Rubenstein JL
(2001)
A long, remarkable journey: tangential migration in the telencephalon.
Nat Rev Neurosci
2:780-790[Web of Science][Medline].
-
Marin O,
Anderson SA,
Rubenstein JL
(2000)
Origin and molecular specification of striatal interneurons.
J Neurosci
20:6063-6076[Abstract/Free Full Text].
-
Meyer G,
Soria JM,
Martinez-Galan JR,
Martin-Clemente B,
Fairen A
(1998)
Different origins and developmental histories of transient neurons in the marginal zone of the fetal and neonatal rat cortex.
J Comp Neurol
397:493-518[Web of Science][Medline].
-
Mullen RJ,
Buck CR,
Smith AM
(1992)
NeuN, a neuronal specific nuclear protein in vertebrates.
Development
116:201-211[Abstract].
-
Puelles L,
Kuwana E,
Puelles E,
Rubenstein JL
(1999)
Comparison of the mammalian and avian telencephalon from the perspective of gene expression data.
Eur J Morphol
37:139-150[Web of Science][Medline].
-
Puelles L,
Kuwana E,
Puelles E,
Bulfone A,
Shimamura K,
Keleher J,
Smiga S,
Rubenstein JL
(2000)
Pallial and subpallial derivatives in the embryonic chick and mouse telencephalon, traced by the expression of the genes Dlx-2, Emx-1, Nkx-21, Pax-6, and Tbr-1.
J Comp Neurol
424:409-438[Web of Science][Medline].
-
Qiu M,
Anderson S,
Chen S,
Meneses JJ,
Hevner R,
Kuwana E,
Pedersen RA,
Rubenstein JL
(1996)
Mutation of the Emx-1 homeobox gene disrupts the corpus callosum.
Dev Biol
178:174-178[Web of Science][Medline].
-
Rudnicki MA,
Braun T,
Hinuma S,
Jaenisch R
(1992)
Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development.
Cell
71:383-390[Web of Science][Medline].
-
Simeone A,
Acampora D,
Gulisano M,
Stornaiuolo A,
Boncinelli E
(1992a)
Nested expression domains of four homeobox genes in developing rostral brain.
Nature
358:687-690[Medline].
-
Simeone A,
Gulisano M,
Acampora D,
Stornaiuolo A,
Rambaldi M,
Boncinelli E
(1992b)
Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex.
EMBO J
11:2541-2550[Web of Science][Medline].
-
Soriano P
(1999)
Generalized lacZ expression with the ROSA26 Cre reporter strain.
Nat Genet
21:70-71[Web of Science][Medline].
-
Spassky N,
Goujet-Zalc C,
Parmantier E,
Olivier C,
Martinez S,
Ivanova A,
Ikenaka K,
Macklin W,
Cerruti I,
Zalc B,
Thomas JL
(1998)
Multiple restricted origin of oligodendrocytes.
J Neurosci
18:8331-8343[Abstract/Free Full Text].
-
Sussel L,
Marin O,
Kimura S,
Rubenstein JL
(1999)
Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum.
Development
126:3359-3370[Abstract].
-
Timsit S,
Martinez S,
Allinquant B,
Peyron F,
Puelles L,
Zalc B
(1995)
Oligodendrocytes originate in a restricted zone of the embryonic ventral neural tube defined by DM-20 mRNA expression.
J Neurosci
15:1012-1024[Abstract].
-
Tomioka N,
Osumi N,
Sato Y,
Inoue T,
Nakamura S,
Fujisawa H,
Hirata T
(2000)
Neocortical origin and tangential migration of guidepost neurons in the lateral olfactory tract.
J Neurosci
20:5802-5812[Abstract/Free Full Text].
-
Vigers AJ,
Baquet ZC,
Jones KR
(2000)
Expression of neurotrophin-3 in the mouse forebrain: insights from a targeted LacZ reporter.
J Comp Neurol
416:398-415[Medline].
-
Yamauchi Y,
Abe K,
Mantani A,
Hitoshi Y,
Suzuki M,
Osuzu F,
Kuratani S,
Yamamura K
(1999)
A novel transgenic technique that allows specific marking of the neural crest cell lineage in mice.
Dev Biol
212:191-203[Web of Science][Medline].
-
Yoshida M,
Suda Y,
Matsuo I,
Miyamoto N,
Takeda N,
Kuratani S,
Aizawa S
(1997)
Emx1 and Emx2 functions in development of dorsal telencephalon.
Development
124:101-111[Abstract].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22156309-06$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Boretius, T. Michaelis, R. Tammer, R. Ashery-Padan, J. Frahm, and A. Stoykova
In Vivo MRI of Altered Brain Anatomy and Fiber Connectivity in Adult Pax6 Deficient Mice
Cereb Cortex,
December 1, 2009;
19(12):
2838 - 2847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. K. Hutnick, P. Golshani, M. Namihira, Z. Xue, A. Matynia, X. W. Yang, A. J. Silva, F. E. Schweizer, and G. Fan
DNA hypomethylation restricted to the murine forebrain induces cortical degeneration and impairs postnatal neuronal maturation
Hum. Mol. Genet.,
August 1, 2009;
18(15):
2875 - 2888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. C. Tuoc, K. Radyushkin, A. B. Tonchev, M. C. Pinon, R. Ashery-Padan, Z. Molnar, M. S. Davidoff, and A. Stoykova
Selective Cortical Layering Abnormalities and Behavioral Deficits in Cortex-Specific Pax6 Knock-Out Mice
J. Neurosci.,
July 1, 2009;
29(26):
8335 - 8349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. M. Morozov, M. Torii, and P. Rakic
Origin, Early Commitment, Migratory Routes, and Destination of Cannabinoid Type 1 Receptor-Containing Interneurons
Cereb Cortex,
July 1, 2009;
19(suppl_1):
i78 - i89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhou, Y. Qu, F. Tissir, and A. M. Goffinet
Role of the Atypical Cadherin Celsr3 during Development of the Internal Capsule
Cereb Cortex,
July 1, 2009;
19(suppl_1):
i114 - i119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S.E. Carney, L. A. Cocas, T. Hirata, K. Mansfield, and J. G. Corbin
Differential Regulation of Telencephalic Pallial-Subpallial Boundary Patterning by Pax6 and Gsh2
Cereb Cortex,
April 1, 2009;
19(4):
745 - 759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Barros, B. Calabrese, P. Chamero, A. J. Roberts, E. Korzus, K. Lloyd, L. Stowers, M. Mayford, S. Halpain, and U. Muller
Impaired maturation of dendritic spines without disorganization of cortical cell layers in mice lacking NRG1/ErbB signaling in the central nervous system
PNAS,
March 17, 2009;
106(11):
4507 - 4512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Li, H. Kataoka, S. R. Coughlin, and S. J. Pleasure
Identification of a transient subpial neurogenic zone in the developing dentate gyrus and its regulation by Cxcl12 and reelin signaling
Development,
January 15, 2009;
136(2):
327 - 335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Alvarez-Buylla, M. Kohwi, T.M. Nguyen, and F.T. Merkle
The Heterogeneity of Adult Neural Stem Cells and the Emerging Complexity of Their Niche
Cold Spring Harb Symp Quant Biol,
November 6, 2008;
(2008)
sqb.2008.73.019v1.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Pinon, T. C. Tuoc, R. Ashery-Padan, Z. Molnar, and A. Stoykova
Altered Molecular Regionalization and Normal Thalamocortical Connections in Cortex-Specific Pax6 Knock-Out Mice
J. Neurosci.,
August 27, 2008;
28(35):
8724 - 8734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. S. Brill, M. Snapyan, H. Wohlfrom, J. Ninkovic, M. Jawerka, G. S. Mastick, R. Ashery-Padan, A. Saghatelyan, B. Berninger, and M. Gotz
A Dlx2- and Pax6-Dependent Transcriptional Code for Periglomerular Neuron Specification in the Adult Olfactory Bulb
J. Neurosci.,
June 18, 2008;
28(25):
6439 - 6452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Iwasato, M. Inan, H. Kanki, R. S. Erzurumlu, S. Itohara, and M. C. Crair
Cortical Adenylyl Cyclase 1 Is Required for Thalamocortical Synapse Maturation and Aspects of Layer IV Barrel Development
J. Neurosci.,
June 4, 2008;
28(23):
5931 - 5943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhou, I. Bar, Y. Achouri, K. Campbell, O. De Backer, J. M. Hebert, K. Jones, N. Kessaris, C. L. de Rouvroit, D. O'Leary, et al.
Early Forebrain Wiring: Genetic Dissection Using Conditional Celsr3 Mutant Mice
Science,
May 16, 2008;
320(5878):
946 - 949.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Batista-Brito, J. Close, R. Machold, and G. Fishell
The Distinct Temporal Origins of Olfactory Bulb Interneuron Subtypes
J. Neurosci.,
April 9, 2008;
28(15):
3966 - 3975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Costa, N. Kessaris, W. D. Richardson, M. Gotz, and C. Hedin-Pereira
The Marginal Zone/Layer I as a Novel Niche for Neurogenesis and Gliogenesis in Developing Cerebral Cortex
J. Neurosci.,
October 17, 2007;
27(42):
11376 - 11388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Bloom, B. R. Miller, J. R. Sanes, and A. DiAntonio
The requirement for Phr1 in CNS axon tract formation reveals the corticostriatal boundary as a choice point for cortical axons
Genes & Dev.,
October 15, 2007;
21(20):
2593 - 2606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fogarty, M. Grist, D. Gelman, O. Marin, V. Pachnis, and N. Kessaris
Spatial Genetic Patterning of the Embryonic Neuroepithelium Generates GABAergic Interneuron Diversity in the Adult Cortex
J. Neurosci.,
October 10, 2007;
27(41):
10935 - 10946.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Miquelajauregui, T. Van de Putte, A. Polyakov, A. Nityanandam, S. Boppana, E. Seuntjens, A. Karabinos, Y. Higashi, D. Huylebroeck, and V. Tarabykin
Smad-interacting protein-1 (Zfhx1b) acts upstream of Wnt signaling in the mouse hippocampus and controls its formation
PNAS,
July 31, 2007;
104(31):
12919 - 12924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kohwi, M. A. Petryniak, J. E. Long, M. Ekker, K. Obata, Y. Yanagawa, J. L. R. Rubenstein, and A. Alvarez-Buylla
A Subpopulation of Olfactory Bulb GABAergic Interneurons Is Derived from Emx1- and Dlx5/6-Expressing Progenitors
J. Neurosci.,
June 27, 2007;
27(26):
6878 - 6891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Parras, C. Hunt, M. Sugimori, M. Nakafuku, D. Rowitch, and F. Guillemot
The Proneural Gene Mash1 Specifies an Early Population of Telencephalic Oligodendrocytes
J. Neurosci.,
April 18, 2007;
27(16):
4233 - 4242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Ventura and J. E. Goldman
Dorsal Radial Glia Generate Olfactory Bulb Interneurons in the Postnatal Murine Brain
J. Neurosci.,
April 18, 2007;
27(16):
4297 - 4302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Earnheart, C. Schweizer, F. Crestani, T. Iwasato, S. Itohara, H. Mohler, and B. Luscher
GABAergic Control of Adult Hippocampal Neurogenesis in Relation to Behavior Indicative of Trait Anxiety and Depression States
J. Neurosci.,
April 4, 2007;
27(14):
3845 - 3854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Berger, S. Berger, T. C. Tuoc, M. D'Amelio, F. Cecconi, J. A. Gorski, K. R. Jones, P. Gruss, and A. Stoykova
Conditional activation of Pax6 in the developing cortex of transgenic mice causes progenitor apoptosis
Development,
April 1, 2007;
134(7):
1311 - 1322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Long, S. Garel, M. Alvarez-Dolado, K. Yoshikawa, N. Osumi, A. Alvarez-Buylla, and J. L. R. Rubenstein
Dlx-Dependent and -Independent Regulation of Olfactory Bulb Interneuron Differentiation
J. Neurosci.,
March 21, 2007;
27(12):
3230 - 3243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. E. Carney, T. B. Alfonso, D. Cohen, H. Dai, S. Nery, B. Stoica, J. Slotkin, B. S. Bregman, G. Fishell, and J. G. Corbin
Cell Migration along the Lateral Cortical Stream to the Developing Basal Telencephalic Limbic System.
J. Neurosci.,
November 8, 2006;
26(45):
11562 - 11574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Huang, K. Shimazu, N. H. Woo, K. Zang, U. Muller, B. Lu, and L. F. Reichardt
Distinct Roles of the beta1-Class Integrins at the Developing and the Mature Hippocampal Excitatory Synapse
J. Neurosci.,
October 25, 2006;
26(43):
11208 - 11219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Willaime-Morawek, R. M. Seaberg, C. Batista, E. Labbe, L. Attisano, J. A. Gorski, K. R. Jones, A. Kam, C. M. Morshead, and D. van der Kooy
Embryonic cortical neural stem cells migrate ventrally and persist as postnatal striatal stem cells
J. Cell Biol.,
October 9, 2006;
175(1):
159 - 168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yoshida, S. Assimacopoulos, K. R. Jones, and E. A. Grove
Massive loss of Cajal-Retzius cells does not disrupt neocortical layer order
Development,
February 1, 2006;
133(3):
537 - 545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yue, K. Xian, E. Hurlock, M. Xin, S. G. Kernie, L. F. Parada, and Q. R. Lu
A Critical Role for Dorsal Progenitors in Cortical Myelination
J. Neurosci.,
January 25, 2006;
26(4):
1275 - 1280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Jakovcevski and N. Zecevic
Olig Transcription Factors Are Expressed in Oligodendrocyte and Neuronal Cells in Human Fetal CNS
J. Neurosci.,
November 2, 2005;
25(44):
10064 - 10073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Niewmierzycka, J. Mills, R. St-Arnaud, S. Dedhar, and L. F. Reichardt
Integrin-Linked Kinase Deletion from Mouse Cortex Results in Cortical Lamination Defects Resembling Cobblestone Lissencephaly
J. Neurosci.,
July 27, 2005;
25(30):
7022 - 7031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bellion, J.-P. Baudoin, C. Alvarez, M. Bornens, and C. Metin
Nucleokinesis in Tangentially Migrating Neurons Comprises Two Alternating Phases: Forward Migration of the Golgi/Centrosome Associated with Centrosome Splitting and Myosin Contraction at the Rear
J. Neurosci.,
June 15, 2005;
25(24):
5691 - 5699.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. T. Kroll and D. D. M. O'Leary
Ventralized dorsal telencephalic progenitors in Pax6 mutant mice generate GABA interneurons of a lateral ganglionic eminence fate
PNAS,
May 17, 2005;
102(20):
7374 - 7379.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tole, R. Remedios, B. Saha, and A. Stoykova
Selective Requirement of Pax6, But Not Emx2, in the Specification and Development of Several Nuclei of the Amygdaloid Complex
J. Neurosci.,
March 9, 2005;
25(10):
2753 - 2760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tamamaki
Origin of the Neocortical Subependymal Cells Speculated by Emx1 and GAD67 Expression
Chem Senses,
January 1, 2005;
30(suppl_1):
i111 - i112.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zimmer, M.-C. Tiveron, R. Bodmer, and H. Cremer
Dynamics of Cux2 Expression Suggests that an Early Pool of SVZ Precursors is Fated to Become Upper Cortical Layer Neurons
Cereb Cortex,
December 1, 2004;
14(12):
1408 - 1420.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fuccillo, M. Rallu, A. P. McMahon, and G. Fishell
Temporal requirement for hedgehog signaling in ventral telencephalic patterning
Development,
October 15, 2004;
131(20):
5031 - 5040.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. C. Baquet, J. A. Gorski, and K. R. Jones
Early Striatal Dendrite Deficits followed by Neuron Loss with Advanced Age in the Absence of Anterograde Cortical Brain-Derived Neurotrophic Factor
J. Neurosci.,
April 28, 2004;
24(17):
4250 - 4258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Xu, I. Cobos, E. De La Cruz, J. L. Rubenstein, and S. A. Anderson
Origins of Cortical Interneuron Subtypes
J. Neurosci.,
March 17, 2004;
24(11):
2612 - 2622.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Kessaris, F. Jamen, L. L. Rubin, and W. D. Richardson
Cooperation between sonic hedgehog and fibroblast growth factor/MAPK signalling pathways in neocortical precursors
Development,
March 15, 2004;
131(6):
1289 - 1298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Takiguchi-Hayashi, M. Sekiguchi, S. Ashigaki, M. Takamatsu, H. Hasegawa, R. Suzuki-Migishima, M. Yokoyama, S. Nakanishi, and Y. Tanabe
Generation of Reelin-Positive Marginal Zone Cells from the Caudomedial Wall of Telencephalic Vesicles
J. Neurosci.,
March 3, 2004;
24(9):
2286 - 2295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Gorski, S. R. Zeiler, S. Tamowski, and K. R. Jones
Brain-Derived Neurotrophic Factor Is Required for the Maintenance of Cortical Dendrites
J. Neurosci.,
July 30, 2003;
23(17):
6856 - 6865.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Assimacopoulos, E. A. Grove, and C. W. Ragsdale
Identification of a Pax6-Dependent Epidermal Growth Factor Family Signaling Source at the Lateral Edge of the Embryonic Cerebral Cortex
J. Neurosci.,
July 23, 2003;
23(16):
6399 - 6403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Xu, E. de la Cruz, and S. A. Anderson
Cortical Interneuron Fate Determination: Diverse Sources for Distinct Subtypes?
Cereb Cortex,
June 1, 2003;
13(6):
670 - 676.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Stenman, R. T. Yu, R. M. Evans, and K. Campbell
Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon
Development,
March 15, 2003;
130(6):
1113 - 1122.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|