 |
Previous Article | Next Article 
The Journal of Neuroscience, August 1, 2002, 22(15):6415-6425
Postsynaptic Targeting of Alternative Postsynaptic Density-95
Isoforms by Distinct Mechanisms
Dane M.
Chetkovich1, 2, *,
Robert C.
Bunn1, *,
Sheng-Han
Kuo1,
Yoshimi
Kawasaki1,
Minoree
Kohwi1, and
David S.
Bredt1
Departments of 1 Physiology and
2 Neurology, University of California, San Francisco, San
Francisco, California 94143
 |
ABSTRACT |
Members of the postsynaptic density-95 (PSD95)/synapse-associated
protein-90 (SAP90) family of scaffolding proteins contain a
common set of modular protein interaction motifs including PDZ (postsynaptic density-95/Discs large/zona occludens-1), Src homology 3, and guanylate kinase domains, which regulate signaling and plasticity
at excitatory synapses. We report that N-terminal alternative splicing
of PSD95 generates an isoform, PSD95 that contains an additional
"L27" motif, which is also present in SAP97. Using yeast two hybrid
and coimmunoprecipitation assays, we demonstrate that this N-terminal
L27 domain of PSD-95 , binds to an L27 domain in the
membrane-associated guanylate kinase calcium/calmodulin-dependent serine kinase, and to Hrs, an endosomal ATPase that regulates vesicular trafficking. By transfecting heterologous cells and hippocampal neurons, we find that interactions with the L27 domain regulate synaptic clustering of PSD95 . Disrupting Hrs-regulated early endosomal sorting in hippocampal neurons selectively blocks synaptic clustering of PSD95 but does not interfere with trafficking of the palmitoylated isoform, PSD95 . These studies identify
molecular and functional heterogeneity in synaptic PSD95 complexes and
reveal critical roles for L27 domain interactions and Hrs regulated
vesicular trafficking in postsynaptic protein clustering.
Key words:
neuron; synapse; protein sorting; endosome; PSD95; Hrs
 |
INTRODUCTION |
Recent studies identify postsynaptic
density-95 (PSD95) and other membrane-associated guanylate kinases
(MAGUKs) as an important class of molecules that regulates assembly and
function of postsynaptic protein networks (Kornau et al., 1997 ; Garner
et al., 2000 ; Lee and Sheng, 2000 ; Tomita et al., 2001 ). PDZ
(postsynaptic density-95/Discs large/zona occludens-1) domains from
PSD95 cluster ion channels (Kim et al., 1995 ; Kornau et al., 1995 ),
signaling enzymes (Brenman et al., 1996a ), and cell adhesion molecules
(Irie et al., 1997 ) at the PSD. PSD95 also contains Src homology 3 (SH3) and guanylate kinase (GK) domains that both mediate regulatory
intramolecular interactions (McGee and Bredt, 1999 ; Shin et al., 2000 )
and recruit additional proteins to the macromolecular complex (Kim et
al., 1997 ; Takeuchi et al., 1997 ; Brenman et al., 1998 ; Hanada et al., 2000 ). Through this network of interactions, PSD95 and related MAGUK
protein complexes regulate postsynaptic development (El-Husseini et
al., 2000b ; Sala et al., 2001 ), plasticity (Guan et al., 1996 ), and
convey retrograde signals (Scheiffele et al., 2000 ) to the presynaptic
nerve terminal.
Because PSD95 participates in multitudes of interactions, it is unclear
whether there are distinct classes of PSD95 protein complexes. Also
uncertain are the sequence and hierarchy of interactions through which
PSD95 assembles and clusters proteins at the PSD (Garner et al., 2000 ;
Kennedy, 2000 ; Sheng and Sala, 2001 ). Developmental studies in cultured
hippocampal neurons indicate that PSD95 traffics on the cytosolic
surface of dendritic endomembranes (El-Husseini et al., 2000c ) and
clusters in dendrites before its interaction with synaptic glutamate
receptors (Rao et al., 1998 ). Postsynaptic targeting involves endosomal
sorting, because an endocytosis signal at the C terminus of PSD95 is
required for proper trafficking (Craven and Bredt, 2000 ). The initial
targeting of PSD95 to endomembranes and its subsequent postsynaptic
clustering require palmitoylation of a pair of N-terminal cysteines
that are present in PSD95 (Craven et al., 1999 ) and its closest
homolog, PSD93 (El-Husseini et al., 2000c ). Cellular studies of other
MAGUKs also suggest that targeting to the surface of endosomal
membranes plays a general role in assembly of MAGUK protein complex
(Thomas et al., 2000 ).
Here, we report that both rodents and human express two alternatively
spliced isoforms of PSD95, a version containing the short palmitoylated
N terminus that we designate PSD95 , and a form containing a longer N
terminus, PSD95 . Interestingly, the unique region of PSD95 is
homologous to the N terminus of MAGUK protein, synapse-associated
protein-97 (SAP97) (Muller et al., 1995 ). Furthermore, this region of
homology between PSD95 and SAP97 has an unexpected similarity to a
recently described protein-protein interaction motif, L27, named for
its presence in PDZ proteins Lin-2 and
Lin-7 (Doerks et al., 2000 ). And, the L27 domains in PSD95 and SAP97 bind to an N-terminal L27 domain in mammalian calcium-calmodulin-dependent serine kinase (CASK).
Despite lacking palmitoylation sites, PSD95 clusters efficiently at
the PSD. Yeast two hybrid analysis shows that the L27 domains of
PSD95 and SAP97 bind to Hrs, an endosomal ATPase that regulates
protein sorting and has been implicated in vesicular endocytosis and
exocytosis (Bean et al., 1997 ; Komada and Soriano, 1999 ; Urbé et
al., 2000 ). A subpopulation of endogenous Hrs colocalizes with PSD95 in
dendrites of hippocampal neurons. Furthermore, collapsing Hrs-positive
early endosomes in hippocampal neurons selectively blocks postsynaptic
clustering of PSD95 and SAP97 but does not disturb PSD95 ,
indicating distinct mechanisms for synaptic trafficking of alternative
PSD95 isoforms. These studies demonstrate that alternative splicing
contributes to the multitude of pathways and functions regulated by
PSD95 at the synapse and identify possible roles for L27 protein
domains and Hrs regulated vesicular trafficking in postsynaptic protein sorting.
 |
MATERIALS AND METHODS |
Antibodies. The human PSD95 N-terminal peptide
corresponding to the second through sixteenth amino acids was
synthesized with an added C-terminal Cys and coupled to
maleimide-activated keyhole limpet hemocyanin, and rabbits were
immunized using standard protocols (Zymed, South San Francisco, CA).
Antibodies were affinity-purified on a Sepharose column to which the
peptide was coupled.
The following primary antibodies were used: rabbit polyclonal
antibodies to Kv1.4 (Kim et al., 1995 ) (provided by Lily Jan, University of California, San Francisco, San Francisco, CA),
CASK (Zymed, South San Francisco, CA), sheep polyclonal antibody to PSD95 (Brenman et al., 1996b ), guinea pig antibodies to green fluorescent protein (GFP) (El-Husseini et al., 2000a ) and
monoclonal antibodies to PSD95 (#046; Affinity Bioreagents, Golden,
CO), GFP (Beckton Dickson Biosciences, Palo Alto, CA), Hrs (initially provided by Andrew Bean, University of Texas Health Sciences Center, Houston, TX, and subsequently purchased from Alexis Biochemicals, San
Diego, CA) and synaptophysin (Sigma, St. Louis, MO). The sheep and
mouse PSD95 antibodies recognize both PSD95 and PSD95 because they were prepared against the PDZ domains and are written as anti-PSD95(PDZ) in figures to distinguish them from the
PSD95 -specific antibody. For Western blotting, protein extracts were
resolved by SDS-PAGE and transferred to polyvinylidene
difluoride membranes. Primary antibodies were diluted in block
solution containing 3% BSA, 0.1% Tween 20 in TBS and incubated with
membranes overnight at 4°C. Labeled bands were visualized using ECL
(Amersham Biosciences, Piscataway, NJ).
cDNA cloning and mutagenesis. Constructs coding for
PSD95 , SAP97, SAP102, MALS2, and CASK, as well as their GFP fusions
have been previously described (Topinka and Bredt, 1998 ; Craven et al.,
1999 ). PSD95 was generated by RT-PCR from human cDNA using the
following primers: 5' TACGCCAAGCTTAAGCCACCATGTCCCAGAGACAAGA, and
3' GAGCTCGGTACCGGTATTTCTGACTCTCTGAGAGGGAAG. The resultant 165 bp
fragment was inserted into Hind III, and a silent KpnI site
introduced into PSD95 in the mammalian expression vector, GW1
(El-Husseini et al., 2000a ). N-terminal deletions of PSD95 were
produced by PCR and inserted into the same sites. The N-terminal PSD95 yeast two-hybrid bait vector (pGBKT7-PSD95 (1-53)) was produced by PCR amplification of the initial 159 base pairs of PSD95
and subcloning into pGBKT7 (Beckton Dickson Biosciences, Palo Alto, CA)
at EcoRI/BamHI sites. A cDNA for Hrs, obtained from Dr. Andrew Bean (University of Texas Health Sciences Center, Houston, TX), was amplified by PCR and cloned into GW1 at
HindIII-EcoRI sites. The proper introduction of
all mutations and deletions was verified by DNA sequencing.
Northern blotting and in situ hybridization. RNA
was isolated using the guanidine isothiocyanate-CsCl method, and mRNA
was selected using oligo-dT Sepharose. For Northern blotting, mRNA was
separated on a formaldehyde agarose gel and transferred to a Nylon
membrane. The filter was sequentially hybridized with random-primed
32P probes, which were generated using a
159 bp probe corresponding to the unique N-terminal exons of PSD95 .
In situ hybridization used
35S-labeled RNA probes was performed as
described (Sassoon and Rosenthal, 1993 ). Antisense probes to the unique
N terminus of PSD95 (1-159) or to the common coding region of PSD95
(nucleotides 1212-1444) were synthesized from Bluescript vectors.
Tissue sections were exposed to x-ray film for 4 d.
Yeast two-hybrid assays. Yeast two-hybrid assays
were performed using the Matchmaker kit (Becton Dickinson Biosciences,
Palo Alto, CA), according to the manufacturer's protocols. Briefly, PSD95 (1-53) was subcloned into the bait vector, pGBKT7. Yeast (AH109) were transformed with the bait vector under appropriate selection. A rat cDNA library in the prey vector, pGADT7 (Becton Dickinson Biosciences), was then screened by transformation into AH109
cells carrying bait plasmid and plated onto selective media. Colonies
growing after 3-5 d were screened for -galactosidase expression. Of
6 million colonies screened, 18 colonies growing on selective media
were obtained. Two of these colonies were weakly positive for
-galactosidase activity, whereas one colony was strongly positive
(clone 18.1). Plasmid was successfully isolated from the strongly
positive colony, and sequencing revealed this clone to be a fragment of
Hrs encoding amino acids 349-728. Directed yeast two hybrid assays
were performed by cotransforming engineered plasmids into competent
yeast followed by plating onto selective media.
Cell transfection, metabolic labeling, and
immunoprecipitation. COS7 cells were grown in DMEM
containing 10% fetal bovine serum, penicillin, and streptomycin. Cells
were transfected using lipofectamine reagent according to the
manufacturer's protocol (Invitrogen, Carlsbad, CA). For studies of
palmitoylation, transfected COS7 cells were labeled in serum-free media
containing 1 mCi/ml [3H]palmitic acid
(50 Ci/mmol; Perkin-Elmer Life Sciences, Boston, MA). Cells were washed
with ice-cold PBS and resuspended in 0.4 ml of lysis buffer containing
TEE (50 mM Tris-HCl, pH 7.4, 1 mM EDTA, and 1 mM EGTA) and
150 mM NaCl. To this lysate was added 0.1 ml of
SDS-PAGE sample buffer lacking -mercaptoethanol, and 10 µl was
loaded on 10% SDS-PAGE gels. For immunoprecipitation experiments,
adult rat brains were homogenized in 10 volumes (w/v) of 50 mM HEPES, pH 7.5, containing 10 µg/ml aprotinin
(Sigma, St. Louis, MO), 10 µg/ml leupeptin (Sigma), and 1 mM PMSF (Sigma). Nuclei were removed by
centrifugation at 1000 × g. Crude membranes were
obtained by centrifugation of the postnuclear homogenate at
100,000 × g and were resuspended in 1% SDS in 50 mM Tris-HCl, pH 7.5. This step was followed by a
10-fold dilution in buffer containing 1% Triton X-100. Samples were
then incubated with 2 µg of primary antibodies for 1 hr at 4°C.
After addition of 20 µl of Protein A-Sepharose beads (Sigma), samples
were incubated for 1 hr at 4°C. Immunoprecipitates were washed four
times with wash buffer containing TEE, 150 mM
NaCl, and 0.1% Triton X-100, boiled in SDS-PAGE sample buffer, and
resolved by SDS-PAGE. For COS cell experiments, cells were lysed in TEE
protease inhibitors, then incubated with primary antibodies and Protein
A-Sepharose beads and resolved by SDS-PAGE as for brain lysates. For
fluorography, gels were treated with Amplify (Amersham Biosciences) for
30 min, dried under vacuum, and exposed to Hyperfilm-MP (Amersham
Biosciences) at 80°C for 12-24 hr. Estimation of PSD95
relative abundance was performed by densitometric analysis of Western
blots using the public domain NIH Image program (developed at the U.S.
National Institutes of Health and available on the Internet at
http://rsb.info.nih.gov/nih-image/.)
Primary neuronal culture and transfection. Hippocampal
cultures were transfected as previously described (Craven et al.,
1999 ). Briefly, acutely dissociated hippocampal neurons from E18 rats were transfected in suspension by lipid-mediated gene transfer based on
the protocol described in (Kaech et al., 1996 ). Cells were then plated
at a density of 600/mm2 on glass
coverslips (Fisher Scientific, Pittsburgh, PA) and maintained in
Neurobasal media supplemented with B27 (Invitrogen, Carlsbad, CA). For
some experiments, neurons were transfected after 10-17 d in
vitro using Effectene (Qiagen, Valencia, CA) according to manufacturer's protocols.
Immunofluorescent labeling. Coverslips were removed from
culture wells and fixed in 2% paraformaldehyde for 15 min or in 100% ice-cold methanol for 10 min. After washing with PBS containing 0.1%
Triton-X-100 (PBST) three times for 5 min, cells were incubated in PBST
containing 3% normal goat serum for 1 hr at room temperature. Primary
antibodies were added in block solution for 1 hr at room temperature,
followed by donkey anti-mouse or goat anti-rabbit secondary antibodies
conjugated to Alexa-488 (Molecular Probes, Eugene, OR) or Cy3 (Jackson
ImmunoResearch, West Grove, PA) (diluted 1:200 in block solution) for 1 hr at room temperature. Coverslips were then mounted on slides
(Superfrost/Plus slides; Fisher Scientific) with Fluoromount-G
(Southern Biotechnology Associates, Inc., Birmingham, AL). Images were
taken under fluorescence microscopy with a 100× oil-immersion
objective (NA = 1.4) affixed to an Axiovert S100 TV inverted
microscope (Zeiss, Thornwood, NY) equipped with a Hamamatsu 12-bit
ORCA, interline CCD camera (Technical Instruments, San Francisco, CA),
an excitation and emission filter-wheel (Sutter, Novato, CA), and
a MetaMorph Imaging system (Universal Imaging Corporation, Downingtown, PA).
 |
RESULTS |
PSD95 and SAP97 contain L27 domains that bind CASK
Previous studies suggested that the extreme N termini of human and
rat PSD95 proteins are different (Cho et al., 1992 ; Kistner et al.,
1993 ; Stathakis et al., 1997 ). To analyze this difference, we compared
the genomic sequences and found that both species contain exons that
encode two isoforms in an organization that suggests alternative
splicing (Fig. 1A). The
N terminus of the shorter isoform, PSD95 , which contains two
palmitoylated cysteines, is contained in a single exon encoding 10 residues that is upstream of exon 2. The larger N terminus of 53 residues in PSD95 is encoded by three exons that occur just upstream
and are also spliced into the common exon 2.

View larger version (76K):
[in this window]
[in a new window]
|
Figure 1.
PSD95 and SAP97 contain N-terminal L27 domains.
A, Scheme showing 5' genomic structure of PSD95
(top). Three exons ( 1, 1', and
1") encode the N-terminal 53 amino acids of PSD95 ;
immediately downstream is a single exon ( 1) that
encodes the N-terminal 10 amino acids of PSD95 . These alternatively
spliced isoforms of PSD95 splice into a common exon 2. The nucleotide
and predicted amino acid sequences of these exons are shown
(bottom); introns are in italics.
B, Alignment of N termini of PSD95 and SAP97 with
representative L27 domains. Identical residues are shaded
darkly, and homologous residues are shaded
lightly. Predicted helical regions underlie gray
cylinders. C, Domain structures of PSD95 and
L27-containing proteins. Jagged lines denote N-terminal
palmitates on PSD95 . Note that DLG3 has a similar domain structure
as PALS (protein associated with Lin-7). CaMK,
Calcium-calmodulin kinase domain.
|
|
Sequence analysis shows that the unique region of PSD95 shares 36%
sequence identity with the N terminus of SAP97 (Fig.
1B). This region of homology is not present in the
other two paralogs PSD93/chapsyn-110 (Kim et al., 1996 ) and SAP102
(Muller et al., 1996 ). We searched the SMART protein domain database to
determine whether the region of overlap between PSD95 and SAP97
resembles any known protein domain. Interestingly, significant homology was found to the "L27" motif, a 40-50 amino acid domain identified in PDZ proteins Lin-2 and Lin-7 (Doerks et al., 2000 ). L27 domains are
predicted to have three acidic -helical segments (Doerks et al.,
2000 ). Sequence alignment and secondary structural predictions indicate
that the third predicted helical segment shows greatest homology to
PSD95 and SAP97 (Fig. 1B).
L27 domains occur in several families of PDZ proteins (Fig.
1C). They appear to form specific heterodimers and mediate
interaction between Lin-2 and Lin-7 (Doerks et al., 2000 ). To determine
whether the L27 domains in PSD95 and SAP97 share this functional
property, we evaluated their binding to mammalian Lin-2 and Lin-7
homologs, CASK (Hata et al., 1996 ) and MALS/Veli (Butz et al., 1998 ; Jo et al., 1999 ), respectively. In transfected COS cells, the L27 domains
of PSD95 and SAP97 bind selectively to CASK but do not bind to MALS2
(Fig.
2A,B).
In brain, antibodies to PSD95 coimmunoprecipitate CASK, consistent with
an interaction between CASK and PSD95 (Fig. 2C). CASK
contains two L27 domains that occur in tandem between its
calcium-calmodulin kinase and PDZ domains. We found that PSD95 and
SAP97 bind selectively to the first L27 domain in CASK (L27A) whereas
MALS2 binds to the second L27 domain (L27B) (Fig.
2D).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 2.
PSD95 and SAP97 can bind to CASK via L27
heteromultimerization. A, COS cells were transfected
with PSD95 , PSD95 , or SAP97 in the presence or absence of
CASK-GFP, cell lysates were prepared, and CASK-GFP was
immunoprecipitated with an antibody to GFP. Whereas PSD95 showed no
interaction with CASK-GFP, PSD95 and SAP97 coimmunoprecipitated
with CASK-GFP. B, Lysates were prepared from COS cells
cotransfected with MALS2 and PSD95 -GFP, PSD95 -GFP, SAP97-GFP,
CASK-GFP, or empty vector. Western blotting after GFP
immunoprecipitation shows that MALS2 binds only to CASK-GFP.
C, Lysates were prepared from rat brain, and PSD95 was
immunoprecipitated. Western blotting after immunoprecipitation shows
that CASK binds to PSD95. D, Table showing domains of
CASK that bind to SAP97, PSD95 , or MALS2 by yeast two-hybrid assay.
Yeast were transformed with plasmids encoding the N termini of MAGUK
proteins or full-length MALS2 and L27 domains of CASK. MAGUK N
termini and MALS were fused to the GAL4 DNA binding domain, and CASK
L27 domains were fused to the GAL4 activation domain. Colonies that
grew on plates lacking Leu, Trp, adenine, and His were scored as
positives (+).
|
|
Previous cDNA cloning has isolated only PSD95 from brain. To
determine whether PSD95 is also expressed in brain, we performed Northern blotting, using a probe to the unique N-terminal domain. This
probe labeled a single band of 4.2 kb in poly(A+) mRNA from rat brain
(Fig. 3D). In situ
hybridization histochemistry was used to determine the cellular
expression of PSD95 . In sagittal sections of rat brain, PSD95
mRNA was found at high levels in a variety of neuronal populations
(Fig. 3A,B). Highest levels of
PSD95 were detected in cerebellum, cortex, hippocampus, and corpus
striatum. These neuronal localizations resembled closely those that
contain PSD95 (Fig. 3C). To evaluate the presence of
PSD95 protein in the brain, we generated a polyclonal antibody against a peptide corresponding to amino acids 2-16 of PSD95 . In
Western blots of crude brain extracts, this antibody detects a weak
band of 97 kDa that may correspond to PSD95 ; however, this required
prolong exposure times (data not shown). To detect more sensitively
PSD95 in brain, we immunoprecipitated brain homogenates with an
antibody to the PDZ domains of PSD-95. We found that the
PSD95 -specific antibody readily detected a 97 kDa band in these
PSD95 immunoprecipitates (Fig. 3E). Furthermore, the
PSD95 -specific antibody immunoprecipitates an appropriately sized
band, which is recognized by the anti-PDZ domain PSD-95 antibody (Fig.
3E). Quantitating the relative intensities of the bands
using NIH Image revealed that PSD95 represents ~10% of total
PSD95 in brain.

View larger version (48K):
[in this window]
[in a new window]
|
Figure 3.
Expression of PSD95 in rat brain.
A-C, In situ hybridization in sagittal
sections of rat brain shows that PSD95 is expressed in diverse
populations of neurons. Both PSD95 and PSD95 occur at high levels
in cerebellum (Cb), hippocampus
(H), corpus striatum
(S), and cerebral cortex (Ctx).
D, Northern blotting shows that the unique region of
PSD95 hybridizes to a single 4.2 kb band in
poly(A+) RNA. E, Brain lysates were
prepared and subjected to immunoprecipitation. A PSD95 -specific
antibody recognizes a 95 kDa band in brain lysates immunoprecipitated
with a general PSD95 antibody raised to the PDZ domains
[anti-PSD-95(PDZ)]. Conversely, the PSD-95 antibody
immunoprecipitates an appropriately sized band that is recognized by
the general PSD-95(PDZ) antibody.
|
|
The L27 domain of PSD95 regulates synaptic clustering
Previous studies have shown that N-terminal palmitoylation of the
pair of N-terminal cysteines of PSD95 determines receptor clustering
(Hsueh et al., 1997 ; Topinka and Bredt, 1998 ) and postsynaptic targeting (Craven et al., 1999 ) of PSD95. We therefore wondered whether
PSD95 , which lacks N-terminal cysteines and is not palmitoylated (Fig. 4A), would still
mediate these functions. To monitor ion channel clustering we
transfected COS cells with PSD95 or PSD95 together with Kv1.4.
Whereas PSD95 forms patch-like clusters on the surface of the cells
together with Kv1.4 (Kim et al., 1995 ), PSD95 forms intracellular
aggregates of both proteins in a perinuclear distribution (Fig.
4B). These intracellular aggregates resemble those
formed when Kv1.4 is cotransfected with SAP97 (Kim and Sheng, 1996 ). To
evaluate postsynaptic clustering, we transfected hippocampal neurons
with PSD95 and compared distribution with that of a synaptic protein, synaptophysin. Surprisingly, despite lacking the N-terminal palmitoylated sites, PSD95 clustered efficiently at postsynaptic sites (Fig. 5D-F). To
determine the region in PSD95 that determines postsynaptic
targeting, we transfected N-terminal deletion constructs. We found that
a construct lacking the first 19 residues was efficiently clustered,
like PSD95 , whereas a construct lacking the first 44 residues was
diffusely expressed in the dendrites (Fig. 5G-L). These
data indicated that residues between 19 and 44 are critical for
postsynaptic targeting by the unique N terminus of PSD95 .

View larger version (45K):
[in this window]
[in a new window]
|
Figure 4.
PSD95 is not palmitoylated and fails to form
plasma membrane clusters with Kv1.4. A, COS cells were
transfected with constructs encoding PSD95 fused to GFP
(PSD95 -GFP), PSD95 -GFP, or empty vector, and were metabolically
labeled with [3H]palmitate. Cells were then lysed,
proteins were separated by SDS-PAGE, and gels were analyzed by
autoradiography (left panel) or Western blotting
(right panel). Arrows indicate the
predicted molecular weight for PSD95 -GFP and PSD95 -GFP.
B, COS cells were transfected with Kv1.4 and
PSD95 -GFP, SAP97-GFP, or PSD95 -GFP. Cells were fixed 48 hr
after transfection and labeled with antibodies to Kv1.4. When
coexpressed with PSD95 -GFP (a-c) or SAP97-GFP
(d-f), Kv1.4 (red) accumulates on
the nuclear membrane and on round perinuclear vesicles. In contrast,
when transfected with PSD95 -GFP (g-i), Kv1.4
clusters in plasma membrane patches. Merged images are shown in
panels on right (c, f, i).
Scale bar, 10 µm.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
Figure 5.
PSD95 and PSD95 synaptically cluster in
primary hippocampal neurons. Constructs encoding PSD95 -GFP or
PSD95 -GFP were transfected into neurons that were then fixed and
stained for synaptophysin (red). After 11-17 d
in vitro, PSD95 -GFP (A-C) and
PSD95 -GFP (D-F) cluster at synaptic sites.
PSD95 -GFP lacking the N-terminal 19 residues
[PSD95 ( 1-19)-GFP] retains synaptic localization
(G-I), whereas deleting the N-terminal 44 residues from [PSD95 - (1-44)-GFP] disrupts synaptic targeting
(J-L). Merged images are shown in panels on
right (C, F, I, L). Scale bar, 10 µm.
|
|
The L27 domains of PSD95 and SAP97 bind Hrs
Because postsynaptic targeting of PSD95 requires
palmitoylation-dependent association with endosomes (El-Husseini et
al., 2000c ), we wondered whether postsynaptic sorting of PSD95 also involves a vesicular trafficking pathway. To address this and to
identify possible mediators, we screened a rat brain yeast two-hybrid
library for proteins that interact with the first 53 residues of
PSD95 . Of 6 × 10 6 clones
screened, we obtained one clone that showed robust -galactosidase activity. This clone was a fragment of Hrs, a FYVE finger protein that
localizes to endosomes and regulates vesicular trafficking (Komada and
Soriano, 1999 ). In addition to the FYVE domain, Hrs has VHS,
coiled-coil, proline-rich and glutamine/proline-rich domains. The
PSD95 interacting clone encoded the second coiled-coil domains as
well as some N and C-terminal flanking sequences (Fig. 6A). To map the region
on Hrs that confers binding, we deleted residues from either the N- or
C terminus. Deleting as few as 20 residues from the N terminus
prevented binding. Deleting up to 228 residues from the C terminus
retained binding, whereas deleting 248 residues blocked it. Therefore,
the PSD95 binding region of Hrs comprises residues 349-500, which
includes the coiled-coil domain as well as some flanking sequences
(Fig. 6A).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 6.
The L27 domains of PSD95 and SAP97 bind the
coiled-coil domain of Hrs. A, Yeast two-hybrid screening
with PSD95 (1-53) yielded a clone of Hrs containing the second
coiled-coil domain and flanking sequences. Deletions of up to 228 residues from the C terminus of this clone preserve binding whereas
removing as few as 20 residues from the N terminus disrupts binding.
B, Hrs binds to PSD95 and SAP97 but not PSD95 or
SAP102. COS cells were cotransfected with constructs encoding Hrs and a
GFP-tagged MAGUK protein or fragment. Cells were lysed, and
immunoprecipitation with anti-GFP was followed by immunoblotting. Hrs
coimmunoprecipitates with full-length PSD95 -GFP and SAP97-GFP, as
well as N-terminal GFP-fusion constructs of PSD95
[PSD95 (1-53)-GFP, PSD95 (11-53)-GFP, and
PSD95 (21-53)-GFP], but does not interact with PSD95 -GFP or
SAP102-GFP (top panel). INPUT
represents 10% of the COS cell lysate used for immunoprecipitation
(bottom panels). C, Brain lysates were
prepared and subjected to immunoprecipitation. Antibodies to PSD95
coimmunoprecipitated HRS, and an HRS-specific antibody
coimmunoprecipitated PSD95.
|
|
To identify the regions of PSD95 that determine binding to Hrs, we
performed immunoprecipitation studies. COS cells were cotransfected
with constructs encoding Hrs and a GFP-tagged MAGUK, cell lysates were
immunoprecipitated for GFP, and interaction with Hrs was assessed by
Western blotting. These experiments showed that full-length PSD95
and a construct containing residues 20-53 of PSD95 bind to Hrs,
whereas PSD95 does not (Fig. 6B). Residues 20-53
of PSD95 show strong homology to the N-terminal L27 domain of SAP97.
This suggested that Hrs would likely interact with SAP97. Indeed,
coimmunoprecipitation shows robust interaction between Hrs and SAP97.
On the other hand, SAP102 lacks an L27 domain and does not interact
with Hrs (Fig. 6B). To confirm a physiological interaction between Hrs and PSD95 , we performed immunoprecipitation studies with Hrs and PSD95-specific antibodies using brain homogenates. We found that antibodies to PSD95 coimmunoprecipitated HRS, and an
HRS-specific antibody coimmunoprecipitated PSD95, consistent with the
predicted interaction of HRS with PSD95 (Fig. 6C).
Hrs specifically regulates trafficking of PSD95 and SAP97
Because Hrs occurs on the cytosolic surface of vesicular
structures in neurons (Bean et al., 2000 ) and regulates vesicle
endocytosis (Komada and Soriano, 1999 ) and exocytosis (Bean et al.,
1997 ), we wondered whether interaction with Hrs might regulate
trafficking of PSD95 . We first evaluated this in transfected COS
cells. Previous studies have shown that overexpressed Hrs collapses
early endosomes and induces formation of large vesicles (Bean et al.,
2000 ; Urbé et al., 2000 ) that resemble abnormal endosomes of Hrs
null cells (Komada and Soriano, 1999 ). Transfected Hrs localizes to
these perinuclear endosomes, whereas PSD95 localizes diffusely in
transfected cells (Fig.
7A,B).
Cotransfection causes PSD95 to redistribute to the surface of large
Hrs-positive vesicles (Fig. 7C-E). A PSD95 mutant
lacking the first 19 amino acids also localizes to Hrs vesicles whereas
deleting the first 44 residues of PSD95 prevents this colocalization
(Fig. 7F-K). PSD95 , which does not interact with
Hrs remains diffuse in cells cotransfected with Hrs (Fig. 7L-N). Taken together with the results in Figure 5,
these experiments suggest that residues 19 and 44 of PSD95 determine
both postsynaptic targeting and association with Hrs-positive
vesicles.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 7.
PSD95 colocalizes with Hrs in neurons and
transfected COS Cells. A, When expressed alone in COS
cells, PSD95 shows perinuclear and diffuse cellular staining.
B, In contrast, Hrs-GFP localizes to large
intracellular vesicles. C-E, When cotransfected,
Hrs-GFP colocalizes with PSD95 at these large vesicles.
F-H, Deleting the first 19 amino acids of PSD95
maintains its colocalization with Hrs, whereas deleting the first 44 amino acids of PSD95 disrupts this colocalization
(I-K). L-N, PSD95 does not
colocalize with cotransfected Hrs-GFP. O-Q,
Immunohistochemistry of endogenous Hrs and PSD95 shows colocalization
to a subpopulation of puncta in dendrites of hippocampal neurons
(arrows). Merged images are shown in E, H, K,
N, and Q. Scale bar, 10 µm.
|
|
To determine directly whether Hrs might regulate postsynaptic targeting
of PSD95, we performed immunohistochemical analysis of Hrs. In cultured
neurons, endogenous Hrs occurs on large somatic vesicles and also on
synaptic puncta in dendrites that partially overlap with PSD-95 (Fig.
7O-Q). Many PSD95-positive synapses are not associated with
Hrs puncta. This observation is consistent with the presence of
distinct pools of alternatively spliced forms of PSD95 and with the
hypothesis that the interaction between Hrs and PSD95 is transient.
To explore possible roles for Hrs in PSD95 trafficking, we transfected
hippocampal neurons with Hrs. When transfected into hippocampal
neurons, Hrs induces formation of large vesicles in the soma and
proximal dendrites (Fig.
8A-C) that resemble
the vesicles formed by Hrs transfection in COS cells. These vesicles do
not occur at synapses, because they do not colocalize with synaptophysin (Fig. 8A-C), and they resemble
collapsed endosomes previously described for Hrs overexpression (Bean
et al., 2000 ; Urbé et al., 2000 ). Double-labeling transfected
cells shows that PSD95 is recruited to Hrs-positive vesicles, but that
PSD95 is also present in distal synaptic sites (Fig.
8D-F). This dual localization further
supported the model that Hrs-regulated trafficking differentially influences distinct populations of endogenous PSD95. Unfortunately, the
small unique N termini of PSD-95 and PSD-95 were not sufficiently antigenic to generate isoform-specific antibodies (data not shown), so
we could not differentially visualize endogenous PSD-95 isoforms. As an
alternative approach, neurons were cotransfected with Hrs and either
PSD95 or PSD95 . These experiments showed that PSD95 traffics
normally to the PSD despite the presence of Hrs (Fig. 8G-I). On the other hand, cotransfection with Hrs
blocks postsynaptic targeting of PSD95 , which instead accumulates on
large endosomal vesicles that colocalize with transfected Hrs (Fig.
8J-L). Trafficking of SAP97, whose N terminus
resembles PSD95 , is also disrupted by Hrs overexpression, as SAP97
also accumulates on the proximal vesicles (Fig.
8M-O).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 8.
Hrs overexpression disrupts synaptic clustering of
PSD95 and SAP97 in hippocampal neurons. A-C, Hrs
expressed in hippocampal neurons (green)
localizes to the surface of large vesicles in the proximal dendrites
that do not overlap with synaptophysin-staining synaptic clusters
(red). D-F, These proximal Hrs-positive
vesicles are positive for PSD95, which is also clustered at distal
synaptic sites that lack Hrs. G-I, When cotransfected
with Hrs (red), PSD95 -GFP
(green) staining retains its synaptically
clustered distribution. J-L, In contrast, Hrs disrupts
synaptic clustering of PSD95 -GFP, which instead colocalizes with
the proximal Hrs-positive vesicles. M-O, SAP97-GFP
also accumulates at the site of Hrs-positive vesicles. Merged images
are shown in C, F, I, and
L. Scale bar, 10 µm.
|
|
 |
DISCUSSION |
This study identifies two evolutionarily conserved isoforms of
PSD95 that traffic to the PSD via distinct mechanisms. Whereas postsynaptic targeting of palmitoylated PSD95 is well characterized, this work illustrates a distinct pathway for targeting PSD95 . Also,
the presence of a L27 domain at the N termini of PSD95 and SAP97
demonstrate that this recently described motif (Doerks et al., 2000 )
plays an important general role in assembly of postsynaptic MAGUK complexes.
Previous studies emphasized the critical role for the N termini of
neuronal MAGUKs in cellular sorting. A pair of critical cysteine
residues at the N terminus of PSD95 was first noted to be critical
for receptor clustering (Hsueh et al., 1997 ) and postsynaptic targeting
(Craven et al., 1999 ). Palmitoylated cysteines are also important in
clustering PSD93 (El-Husseini et al., 2000c ), which also displays
N-terminal splicing to form two isoforms PSD93 and PSD93 (Brenman
et al., 1996b ), respectively. Although SAP102 contains a cluster of
N-terminal cysteine residues (Muller et al., 1996 ), it is not
palmitoylated, but instead its cysteines can coordinate zinc
(El-Husseini et al., 2000c ). Finally, SAP97, which lacks N-terminal
cysteines and is not palmitoylated (El-Husseini et al., 2000c ), is
dependent on its N-terminal residues for sorting to the lateral
membrane of epithelial cells (Wu et al., 1998 ).
Postsynaptic targeting of PSD95 relies on its N-terminal L27 motif.
This domain was recently described as a small heterodimerization motif
in the PDZ proteins Lin-2 and Lin-7 (Doerks et al., 2000 ). These
proteins, together with Lin-10, form a conserved ternary protein
complex that mediates receptor trafficking in epithelial cells and
neurons (Butz et al., 1998 ; Kaech et al., 1998 ; Borg et al., 1999 ).
Lin-2 contains a pair of tandem L27 domains that occur between its
N-terminal calcium-calmodulin kinase motif and its first PDZ domain,
whereas Lin-7 has a single L27 domain near its extreme N terminus
(Doerks et al., 2000 ). Although the three dimensional structures of L27
domains are unknown, secondary structure prediction suggests that these
motifs are primarily -helical, consistent with a coiled-coil mode
for interaction (Doerks et al., 2000 ). Heterodimerization of L27
domains in Lin-2 and Lin-7 mediates their interaction. Similarly, the
N-terminal L27 domains in PSD95 and SAP97 bind to CASK, the
mammalian homolog of Lin-2. Previous studies have shown that SAP97 and
CASK associate in vivo through interaction of their SH3 and
GK domains (Nix et al., 2000 ). Mutations in SAP97 and CASK in mice both
result in perinatal lethality associated with a cleft palate (Laverty
and Wilson, 1998 ; Caruana and Bernstein, 2001 ), which may reflect
interaction of these proteins during development. We find that PSD95
and CASK associate in vivo. Whether this interaction
reflects binding of CASK to PSD95 via an L27 interaction or to
either PSD95 isoform by SH3-GK interactions (Nix et al., 2000 ) is
unclear. The functional implications of and mechanisms for PSD95 and
SAP97 interacting with CASK, as well as how these interactions affect
interactions with Hrs warrant future study.
In addition to binding to CASK, the L27 domains of PSD95 and SAP97
also bind to Hrs, a protein involved in endosomal sorting (Komada and
Soriano, 1999 ). The PSD95 binding domain on Hrs includes a large
coiled-coil region, which is consistent with a coiled coil interaction
with an -helical L27 domain (Doerks et al., 2000 ). Hrs was
originally identified as a tyrosine phosphorylated protein in cells
stimulated with hepatocyte growth factor (Komada and Kitamura, 1995 ),
suggesting a role in the signaling and endocytic processing of tyrosine
kinase receptors (TKR). The presence of a double zinc finger domain in
Hrs, which is highly similar to those in endosomal proteins EEA1 and
Vps27p (Stenmark et al., 1996 ), and the interaction of Hrs with Eps15
of the endocytic pathway (Bean et al., 2000 ) suggests roles for Hrs in
regulating vesicular transport. Eps15 plays an essential role in
receptor-mediated endocytosis via an interaction with -adaptin. Hrs
competes with -adaptin in Eps15 binding, and overexpression of Hrs
inhibits transferrin endocytosis. This inhibition is abrogated by
coexpression of -adaptin, suggesting that Hrs acts as a negative
regulator of endocytosis. Indeed, targeting disruption of Hrs in mouse
causes early embryonic death attributable to deficiencies in
vesicular transport via endosomes (Komada and Soriano, 1999 ).
Another role for Hrs in vesicle trafficking was recently demonstrated
by Bellen and coworkers (Lloyd et al., 2002 ). Mutation of Hrs in
Drosophila enhances TKR signaling during development because
of impaired endosomal membrane invagination and deficient formation of
multiple vesicular bodies. hrs mutant flies lack lysosomal
degradation of active Torso and epidermal growth factor TKRs,
suggesting a critical role for Hrs in receptor downregulation (Lloyd et
al., 2002 ). That PSD95 can binds to both CASK and Hrs and that Hrs
has multiple partners is consistent with these coiled-coil interactions
being promiscuous, akin to the promiscuity of PDZ interactions. The
cellular context and relevant physiological conditions likely determine
the specificity for these interactions. Indeed, Hrs is expressed
ubiquitously (Lloyd et al., 2002 ), and likely plays a role in
trafficking of many different proteins. In neurons, Hrs localizes to
specific endosomes in somatodendritic and axonal domains (Bean et al.,
2000 ). Overexpression of Hrs collapses these endosomes (Bean et al.,
2000 ; Urbé et al., 2000 ), a phenotype similar to that seen in
Hrs-deficient cells (Komada and Soriano, 1999 ). Our data demonstrate
that PSD95 can bind directly to Hrs and is partially colocalized
with PSD-95 in hippocampal neurons. Additionally, condensation of Hrs
vesicles by overexpression selectively disrupts the trafficking of
PSD95 but does not disturb that of PSD95 . Taken together, these
data suggest distinct mechanisms for postsynaptic targeting of
alternative PSD-95 isoforms; PSD95 uses coiled-coil interactions
with CASK, Hrs and perhaps other proteins, whereas PSD95 depends on
palmitoylation and an Hrs-independent pathway.
The interactions described here may also dynamically regulate PSD95
complexes at the synapse. Recent studies indicate that the PSD is not
static but rather displays robust structural plasticity (Fischer et
al., 1998 ; Marrs et al., 2001 ). Furthermore, rapid changes in synaptic
expression of AMPA receptors through regulated exocytosis and
endocytosis underlies aspects of activity-dependent synaptic plasticity
including long-term potentiation and long-term depression, respectively
(Malenka and Nicoll, 1999 ; Malinow et al., 2000 ). PSD95 appears to play
a central role in synaptic plasticity as overexpression of PSD95
selectively enhances synaptic AMPA receptors (El-Husseini et al.,
2000b ) and targeted mutation of PSD95 enhances long-term potentiation
and eliminates long-term depression (Migaud et al., 1998 ). This
regulation of AMPA receptors by PSD95 likely involves stargazin, an
AMPA receptor trafficking protein that interacts with PDZ domains of
PSD95 (Chen et al., 2000 ).
How might PSD95-stargazin-dependent trafficking of AMPA receptors be
regulated by synaptic strength? The intramolecular SH3-GK domain
interaction represents a potential regulatory site (McGee and Bredt,
1999 ; Shin et al., 2000 ; McGee et al., 2001 ; Tavares et al., 2001 ). For
PSD95 , dynamic and reversible changes in palmitoylation provide an
important mechanism for regulating synaptic AMPA receptors (El-Husseini
et al., 2002 ). By analogy, the L27 domains of PSD95 and SAP97 may
provide sites for regulation. One intriguing mechanism involves TKRs,
which robustly phosphorylate Hrs (Komada and Kitamura, 1995 ) and are
implicated in LTP (Kang and Schuman, 1995 ). Future studies of mice with
conditional mutation of Hrs in neurons or with specific targeted
mutations of PSD95 or PSD95 will help define the roles for these
interactions in synapse assembly and plasticity.
 |
FOOTNOTES |
Received Feb. 8, 2002; revised April 24, 2002; accepted April 29, 2002.
*
D.M.C. and R.C.B. contributed equally to this work
This research was supported by grants from the Human Frontiers Science
Program and the Christopher Reeves Paralysis Foundation (D.S.B) and
from the National Institutes of Health (D.S.B. and D.M.C). D.S.B. is an
established investigator of the American Heart Association. D.M.C. was
a physician postdoctoral fellow of the Howard Hughes Medical Institute
and is supported by a National Alliance for Research on Schizophrenia
and Depression Young Investigator Award. R.C.B. was a postdoctoral
fellow of the American Heart Association. We thank Drs. Lily Jan and
Andrew Bean for antibodies to Kv1.4 and Hrs, respectively. We thank Dr.
Mingjie Zhang and Roger Nicoll for comments on this manuscript and
Michele Bondi for excellent secretarial work.
Correspondence should be addressed to Dr. David S. Bredt, University of
California at San Francisco School of Medicine, Box 0444, 513 Parnassus
Avenue, San Francisco, CA 94143-0444. E-mail: bredt{at}itsa.ucsf.edu.
R. C. Bunn's present address: Arkansas Children's Hospital,
Department of Endocrinology, 1120 Marshall Street, Little Rock, AR 72202.
 |
REFERENCES |
-
Bean AJ,
Seifert R,
Chen YA,
Sacks R,
Scheller RH
(1997)
Hrs-2 is an ATPase implicated in calcium-regulated secretion.
Nature
385:826-829[Medline].
-
Bean AJ,
Davanger S,
Chou MF,
Gerhardt B,
Tsujimoto S,
Chang Y
(2000)
Hrs-2 regulates receptor-mediated endocytosis via interactions with Eps15.
J Biol Chem
275:15271-15278[Abstract/Free Full Text].
-
Borg J-P,
Lõpez-Figueroa MO,
de Taddèo-Borg M,
Kroon DE,
Turner RS,
Watson SJ,
Ben Margolis B
(1999)
Molecular analysis of the X11-mLin-2/CASK complex in brain.
J Neurosci
19:1307-1316[Abstract/Free Full Text].
-
Brenman JE,
Chao DS,
Gee SH,
McGee AW,
Craven SE,
Santillano DR,
Huang F,
Xia H,
Peters MF,
Froehner SC,
Bredt DS
(1996a)
Interaction of nitric oxide synthase with the postsynaptic density protein PSD-95 and
-1 syntrophin mediated by PDZ motifs.
Cell
84:757-767[ISI][Medline]. -
Brenman JE,
Christopherson KS,
Craven SE,
McGee AW,
Bredt DS
(1996b)
Cloning and characterization of postsynaptic density 93 (PSD-93), a nitric oxide synthase interacting protein.
J Neurosci
16:7407-7415[Abstract/Free Full Text].
-
Brenman JE,
Topinka JR,
Cooper EC,
McGee Cooper,
Rosen J,
Milroy T,
Ralston HJ,
Bredt DS
(1998)
Localization of postsynaptic density-93 to dendritic microtubules and interaction with microtubule-associated protein 1A.
J Neurosci
18:8805-8813[Abstract/Free Full Text].
-
Butz S,
Okamoto M,
Südhof TC
(1998)
A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain.
Cell
94:773-782[ISI][Medline].
-
Caruana G,
Bernstein A
(2001)
Craniofacial dysmorphogenesis including cleft palate in mice with an insertional mutation in the discs large gene.
Mol Cell Biol
21:1475-1483[Abstract/Free Full Text].
-
Chen L,
Chetkovich DM,
Petrailia R,
Sweeney Petrailia,
Kawaski Y,
Wenthold R,
Bredt DS,
Nicoll RA
(2000)
Stargazin mediates synaptic targeting of AMPA receptors by two distinct mechanisms.
Nature
408:936-943[Medline].
-
Cho KO,
Hunt CA,
Kennedy MB
(1992)
The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein.
Neuron
9:929-942[ISI][Medline].
-
Craven SE,
Bredt DS
(2000)
Synaptic targeting of the postsynaptic density protein PSD-95 mediated by a tyrosine-based trafficking signal.
J Biol Chem
275:20045-20051[Abstract/Free Full Text].
-
Craven SE,
Husseini AE,
Bredt DS
(1999)
Synaptic targeting of the postsynaptic density protein PSD-95 mediated by lipid and protein motifs.
Neuron
22:497-509[ISI][Medline].
-
Doerks T,
Bork P,
Kamberov E,
Makarova O,
Muecke S,
Margolis B
(2000)
L27, a novel heterodimerization domain in receptor targeting proteins Lin-2 and Lin-7.
Trends Biochem Sci
25:317-318[ISI][Medline].
-
El-Husseini AE,
Craven SE,
Chetkovich DM,
Firestein BL,
Schnell E,
Aoki C,
Bredt DS
(2000a)
Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.
J Cell Biol
148:159-172[Abstract/Free Full Text].
-
El-Husseini AE,
Schnell E,
Chetkovich DM,
Nicoll RA,
Bredt DS
(2000b)
PSD-95 involvement in maturation of excitatory synapses.
Science
290:1364-1368[Abstract/Free Full Text].
-
El-Husseini AE,
Topinka JR,
Lehrer-Graiwer JE,
Firestein BL,
Craven SE,
Aoki C,
Bredt DS
(2000c)
Ion channel clustering by membrane-associated guanylate kinases. Differential regulation by N-terminal lipid and metal binding motifs.
J Biol Chem
275:23904-23910[Abstract/Free Full Text].
-
El-Husseini AE,
Schnell E,
Dakoji S,
Sweeney N,
Zhou Q,
Prange O,
Gauthier-Campbell C,
Aguilera-Moreno A,
Nicoll RA,
Bredt DS
(2002)
Synaptic strength regulated by palmitate cycling on PSD-95.
Cell
108:849-863[ISI][Medline].
-
Fischer M,
Kaech S,
Knutti D,
Matus A
(1998)
Rapid actin-based plasticity in dendritic spines.
Neuron
20:847-854[ISI][Medline].
-
Garner CC,
Nash J,
Huganir RL
(2000)
PDZ domains in synapse assembly and signalling.
Trends Cell Biol
10:274-280[ISI][Medline].
-
Guan B,
Hartmann B,
Kho YH,
Gorczyca M,
Budnik V
(1996)
The Drosophila tumor suppressor gene, dlg, is involved in structural plasticity at a glutamatergic synapse.
Curr Biol
6:695-706[ISI][Medline].
-
Hanada T,
Lin L,
Tibaldi E V,
Reinherz EL,
Chishti AH
(2000)
GAKIN, a novel kinesin-like protein associates with the human homologue of the Drosophila discs large tumor suppressor in T lymphocytes.
J Biol Chem
275:28774-28784[Abstract/Free Full Text].
-
Hata Y,
Butz S,
Sudhof TC
(1996)
CASK: a novel dlg/PSD95 homolog with an N-terminal calmodulin-dependent protein kinase domain identified by interaction with neurexins.
J Neurosci
16:2488-2494[Abstract/Free Full Text].
-
Hsueh YP,
Kim E,
Sheng M
(1997)
Disulfide-linked head-to-head multimerization in the mechanism of ion channel clustering by PSD-95.
Neuron
18:803-814[ISI][Medline].
-
Irie M,
Hata Y,
Takeuchi M,
Ichtchenko K,
Toyoda A,
Hirao K,
Takai Y,
Rosahl TW,
Sudhof TC
(1997)
Binding of neuroligins to PSD-95.
Science
277:1511-1515[Abstract/Free Full Text].
-
Jo K,
Derin R,
Li M,
Bredt DS
(1999)
Characterization of MALS/Velis-1, -2, and -3: a family of mammalian LIN-7 homologs enriched at brain synapses in association with the postsynaptic density-95/NMDA receptor postsynaptic complex.
J Neurosci
19:4189-4199[Abstract/Free Full Text].
-
Kaech S,
Ludin B,
Matus A
(1996)
Cytoskeletal plasticity in cells expressing neuronal microtubule-associated proteins.
Neuron
17:1189-1199[ISI][Medline].
-
Kaech SM,
Whitfield CW,
Kim SK
(1998)
The LIN-2/LIN-7/LIN-10 complex mediates basolateral membrane localization of the C. elegans EGF receptor LET-23 in vulval epithelial cells.
Cell
94:761-771[ISI][Medline].
-
Kang H,
Schuman EM
(1995)
Long-lasting neurotrophin-induced enhancement of synaptic transmission in the adult hippocampus.
Science
267:1658-1662[Abstract/Free Full Text].
-
Kennedy MB
(2000)
Signal-processing machines at the postsynaptic density.
Science
290:750-754[Abstract/Free Full Text].
-
Kim E,
Sheng M
(1996)
Differential K+ channel clustering activity of PSD-95 and SAP97, two related membrane-associated putative guanylate kinases.
Neuropharmacology
35:993-1000[ISI][Medline].
-
Kim E,
Niethammer M,
Rothschild A,
Jan YN,
Sheng M
(1995)
Clustering of Shaker-type K+ channels by direct interaction with the PSD-95/SAP90 family of membrane-associated guanylate kinases.
Nature
378:85-88[Medline].
-
Kim E,
Cho K-O,
Rothschild A,
Sheng M
(1996)
Heteromultimerization and NMDA receptor clustering activity of chapsyn-110, a novel member of the PSD-95 family of synaptic proteins.
Neuron
17:103-113[ISI][Medline].
-
Kim E,
Naisbitt S,
Hsueh YP,
Rao A,
Rothschild A,
Craig AM,
Sheng M
(1997)
GKAP, a novel synaptic protein that interacts with the guanylate kinase-like domain of the PSD-95/SAP90 family of channel clustering molecules.
J Cell Biol
136:669-678[Abstract/Free Full Text].
-
Kistner U,
Wenzel BM,
Veh RW,
Cases-Langhoff C,
Garner AM,
Appeltauer U,
Voss B,
Gundelfinger ED,
Garner CC
(1993)
SAP90, a rat presynaptic protein related to the product of the Drosophila tumor suppressor gene dlg-A.
J Biol Chem
268:4580-4583[Abstract/Free Full Text].
-
Komada M,
Kitamura N
(1995)
Growth factor-induced tyrosine phosphorylation of Hrs, a novel 115-kilodalton protein with a structurally conserved putative zinc finger domain.
Mol Cell Biol
15:6213-6221[Abstract].
-
Komada M,
Soriano P
(1999)
Hrs, a FYVE finger protein localized to early endosomes, is implicated in vesicular traffic and required for ventral folding morphogenesis.
Genes Dev
13:1475-1485[Abstract/Free Full Text].
-
Kornau H-C,
Schenker LT,
Kennedy MB,
Seeburg PH
(1995)
Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD-95.
Science
269:1737-1740[Abstract/Free Full Text].
-
Kornau H-C,
Seeburg PH,
Kennedy MB
(1997)
Interaction of ion channels and receptors with PDZ domains.
Curr Opin Neurobiol
7:368-373[ISI][Medline].
-
Laverty HG,
Wilson JB
(1998)
Murine CASK is disrupted in a sex-linked cleft palate mouse mutant.
Genomics
53:29-41[ISI][Medline].
-
Lee SH,
Sheng M
(2000)
Development of neuron-neuron synapses.
Curr Opin Neurobiol
10:125-131[ISI][Medline].
-
Lloyd TE,
Atkinson R,
Wu MN,
Zhou Y,
Pennetta G,
Bellen HJ
(2002)
Hrs regulates endosome membrane invagination and tyrosine kinase receptor signaling in Drosophila.
Cell
108:261-269[ISI][Medline].
-
Malenka RC,
Nicoll RA
(1999)
Long-term potentiation
a decade of progress?
Science
285:1870-1874[Abstract/Free Full Text]. -
Malinow R,
Mainen ZF,
Hayashi Y
(2000)
LTP mechanisms: from silence to four-lane traffic.
Curr Opin Neurobiol
10:352-357[ISI]
|