 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 2002, 22(16):6939-6952
Synaptic Targeting of N-Type Calcium Channels in Hippocampal
Neurons
Anton
Maximov and
Ilya
Bezprozvanny
Department of Physiology, University of Texas Southwestern Medical
Center at Dallas, Dallas, Texas 75390
 |
ABSTRACT |
N-type calcium (Ca2+) channels play a critical
role in synaptic function, but the mechanisms responsible for their
targeting in neurons are poorly understood. N-type channels are formed
by an 1B (CaV2.2) pore-forming subunit
associated with and 2 auxiliary subunits. By expressing
epitope-tagged recombinant 1B subunits in rat
hippocampal neuronal cultures, we demonstrate here that synaptic
targeting of N-type channels depends on neuronal contacts and synapse
formation. We also establish that the C-terminal 163 aa (2177-2339) of
the 1B-1 (CaV2.2a) splice variant contain sequences that are both necessary and sufficient for synaptic targeting. By site-directed mutagenesis, we demonstrate that
postsynaptic density-95/discs large/zona occludens-1 and Src homology
3 domain-binding motifs located within this region of the
1B subunit (Maximov et al., 1999 ) act as synergistic
synaptic targeting signals. We also show that the recombinant modular
adaptor proteins Mint1 and CASK colocalize with N-type channels
in synapses. We found that the 1B-2
(CaV2.2b) splice variant is restricted to soma and
dendrites and postulated that somatodendritic and axonal/presynaptic isoforms of N-type channels are generated via alternative splicing of
1B C termini. These data lead us to propose that during
synaptogenesis, the 1B-1 (CaV2.2a) splice
variant of the N-type Ca2+ channel pore-forming
subunit is recruited to presynaptic locations by means of interactions
with modular adaptor proteins Mint1 and CASK. Our results
provide a novel insight into the molecular mechanisms responsible for
targeting of Ca2+ channels and other synaptic
proteins in neurons.
Key words:
calcium channels; polarized cells; PDZ domains; protein
targeting; axons; synapse
 |
INTRODUCTION |
Neurons are highly polarized cells:
the structural, functional, and molecular differences between their
axonal and somatodendritic domains underlie their ability to receive,
process, and transmit information. The unique complement of ion
channels, receptors, and cytoplasmic and cytoskeleton proteins is
present in neuronal somatodendritic and axonal compartments (Craig and
Banker, 1994 ). Cellular and molecular mechanisms involved in targeting
of neuronal proteins have been elucidated recently (Higgins et al.,
1997 ; Winckler and Mellman, 1999 ). Primary cultures of rat hippocampal neurons are the most widely used model for these studies. Axons and
dendrites of hippocampal neurons display distinctive and characteristic morphologies; axons are consistently presynaptic, and dendrites are
consistently postsynaptic (Craig and Banker, 1994 ). Correct localization of synaptic constituents in hippocampal neurons has been
proposed to result from a two-step process: initial targeting to axonal
or somatodendritic domains based on intrinsic sorting signals, followed
by clustering at presynaptic and postsynaptic sites that depends on
cell-to-cell contacts (Craig and Banker, 1994 ).
Presynaptic voltage-gated Ca2+ channels
mediate rapid Ca2+ influx into the
synaptic terminal that triggers synaptic vesicle exocytosis and
neurotransmitter release (Llinas et al., 1981 ). Multiple types of
Ca2+ channels (N-type, P/Q-type, L-type,
R-type, and T-type) are expressed in neurons (Tsien et al., 1991 ).
N-type Ca2+ channels [encoded by the
1B (CaV2.2) pore-forming
subunit] (Williams et al., 1992 ; Ertel et al., 2000 ) and P/Q-type
Ca2+ channels [encoded by the
1A (CaV2.1) pore-forming
subunit] (Mori et al., 1991 ; Ertel et al., 2000 ) play a predominant
role in supporting chemical neurotransmission in central synapses
(Takahashi and Momiyama, 1993 ; Wheeler et al., 1994 ; Dunlap et al.,
1995 ; Reuter, 1995 ). How are N-type and P/Q-type
Ca2+ channels targeted to synaptic
locations? It has been demonstrated that neuron-to-neuron contact is
required for N-type Ca2+ channel
clustering during synapse formation in rat hippocampal neuronal culture
(Bahls et al., 1998 ). More recently, synaptic targeting of an auxiliary
P/Q-type Ca2+ channel subunit
4 was investigated (Wittemann et al., 2000 ). However, a number of fundamental questions regarding synaptic Ca2+ channel targeting to the synapse
remain unanswered.
Here we investigated targeting of recombinant N-type
Ca2+ channels to synaptic locations in rat
hippocampal neuronal cultures. We found that in immature and in mature
low-density hippocampal cultures, recombinant N-type
Ca2+ channels were uniformly distributed
in both axonal and somatodendritic compartments. In contrast, in mature
high-density cultures, the recombinant N-type
Ca2+ channels were clustered in
presynaptic sites and primarily excluded from the somatodendritic
domain. Synaptic clustering of recombinant N-type channels depended
critically on the most C-terminal region of the "long" splice
variant of the N-type Ca2+ channel
pore-forming subunit 1B-1
(CaV2.2a) (Williams et al., 1992 ; Ertel et al.,
2000 ). In a previous paper, we identified postsynaptic density-95
(PSD-95)/discs large/zona occludens-1 (PDZ) and Src homology 3 (SH3) domain-binding motifs in the same region of the
1B subunit (Maximov et al., 1999 ). Here we
show that these motifs act as synergistic synaptic targeting signals for N-type channels in rat hippocampal neurons. Our results provide a
novel insight into the molecular mechanisms responsible for targeting
of Ca2+ channels and other synaptic
proteins in neurons.
 |
MATERIALS AND METHODS |
Expression constructs. The human
1B (Ellinor et al., 1994 ), rabbit
2/ -1 (Mikami et al., 1989 ), and rabbit
3 (Hullin et al., 1992 ) coding sequences were
subcloned into mammalian expression vectors [pCMV-HA (a gift
from Thomas Südhof, University of Texas Southwestern
Medical Center, Dallas, TX) or pcDNA3 (Invitrogen, San Diego,
CA)]. The following expression constructs were generated: hemagglutinin (HA)- 1B = 1-2339 [the
HA tag is connected to the 1B sequence via
GIPQRNPEPLALCR linker; the first 72 aa in the 1B sequence are replaced by the homologous
sequence from 1A as explained by Ellinor et
al. (1994) ], 1B-II/III-HA = 1-2339 (the
HA tag was introduced between positions
G844 and V845
of the 1B sequence),
HA- 1B-T2038X = 1-2038,
HA- 1B-S2176X = 1-2176,
HA- 1B-D2334X = 1-2333,
HA- 1B-PXXP-A = 1-2339
[(2191PQTPLTPRP2199-(A)9],
HA- 1B-PXXP-A/D2334X = 1-2333
[2191PQTPLTPRP2199-(A)9],
and HA-NC3 = 2021-2339. The
HA- 1B-rat NC2 splice variant (rNC2)
construct was generated by replacing 2164-2339 aa of human HA- 1B construct with 2159-2299 aa of cloned
rat NC2 splice variant (see below). All 1B
C-terminal mutant and chimeric constructs were generated by cassette
mutagenesis of human 1B coding sequence between XhoI (5304) and XbaI sites (3'
untranslated region). Wild-type coding sequence was replaced by
mutated cassettes generated by standard or megaprimer PCR and subcloned
into XhoI/XbaI sites. The locus of mutations was
verified by sequencing. CD4-NC targeting constructs were generated on
the basis of pMACS4.1 (CD4) plasmid (Miltenyi Biotech, Sunnyvale, CA):
CD4-NC = 1743-2339 (1773-2275 and deletion 2306-2334),
CD4-NC-D2334X = 2202-2333; CD4-QC = 2376-2505 of human
1A (Zhuchenko et al., 1997 ), and
CD4-QC-D2501X = 2376-2501 of human 1A.
Green fluorescent protein (GFP) fusion constructs were generated on the
basis of pEGFPC3 (Clontech, Palo Alto, CA) vector: GFP-NC3 = 2021-2339, GFP-Mint1 = 1-839 of rat Mint1 (Okamoto and Sudhof,
1997 ), GFP-CASK = 1-909 of rat CASK (Hata et al., 1996 ). Before
neuronal transfections, the generated
HA- 1B and CD4 expression constructs were
expressed in human embryonic kidney 293 (HEK293) or COS7 cells
and analyzed by Western blotting with anti-HA
(HA- 1B) and anti-CD4 (CD4-NC) antibodies. All
constructs were expressed in COS7 and HEK293 cells at similar levels,
and their apparent molecular weights on the Western blot were in
agreement with their predicted molecular weights (data not shown). In
addition, we tested whether the wild-type and mutated
HA- 1B targeting constructs support functional
Ca2+ currents when expressed in
Xenopus oocytes, as described previously (Bezprozvanny et
al., 1995 ). The size of the peak current and the inactivation
properties of the expressed wild-type and mutant channels measured
3 d after cRNA injection (quantified as ratio of the peak current
to the current at the end of the 50 msec pulse test pulse from 100 mV
to 0 mV) are presented in Table 1.
View this table:
[in this window]
[in a new window]
|
Table 1.
Functional properties of channels supported by the
wild-type and mutant
HA- 1B/ 2 / 3 subunit
combinations expressed in Xenopus oocytes
|
|
Hippocampal neuronal cultures and neuronal transfection.
Hippocampi were isolated from embryonic day 18 rat embryos and
dissociated by digestion with trypsin (Invitrogen) and DNase I
(Sigma, St. Louis, MO) (Goslin et al., 1998 ). Neurons were plated on
glass coverslips coated with poly-L-lysine
(Sigma) and cultured on glial cell monolayer in MEM (phenol red-free)
supplemented with glucose, B-27 (Invitrogen), and sodium pyruvate. The
neurons were plated at high (60-80
neurons/mm2) or low (5-10
neurons/mm2) density as indicated in
Results. Glial cell growth was inhibited by 4 µM AraC (Sigma). For transfection, conditioned
medium was removed from cultures, and neurons were washed once in MEM
and incubated for 30 min with the calcium-phosphate-DNA precipitates formed in HEPES-buffered saline (Crawley et al., 1997 ). Cells were then returned into conditioned medium and analyzed 2-4 d after
transfection. A mixture of
HA- 1B/ 2 / 3
plasmids (molar ratio 3:1:1) was used to express N-type
Ca2+ channels. The
3 subunit expressed as an HA- or GFP-fusion
protein was uniformly distributed in neurons cultured in
vitro for 7-14 d (data not shown), which rules out the
possibility that 3 acts as an N-type
Ca2+ channel targeting subunit.
Antibodies. The following monoclonal antibodies were used
(listed by antibody and working concentration): MAP2 (Sigma) 1:1000; synaptotagmin I (STI) (Synaptic Systems, Göttingen,
Germany) 1:50; CD4 (Zymed, San Francisco, CA) 1:1000; CD4-FITC
(Zymed) 1:100; HA.11 (Covance, Richmond, CA) 1:500; and synapsin
I (Chemicon, Temecula, CA) 1:1000. Polyclonal MAP2 antibodies
(Chemicon) were used at concentration of 1:500. When compared with
monoclonal MAP2 antibodies, labeling with polyclonal MAP2 antibodies
resulted in a more discrete pattern of distribution of marker in
dendrites. In additional control experiments, we confirmed that the
discrete staining pattern observed with polyclonal MAP2 antibodies does not result from fragmentation of neuronal processes. Polyclonal pan-synapsin and PSD-95 antibodies were kindly provided by Dr. Thomas
Südhof and used at 1:1000. rNN antibodies have been
described previously (Maximov et al., 1999 ). N-type
splice-variant-specific C-terminal antibodies (NC1) were generated
against a glutathione S-transferase fusion protein encoding
C-terminal amino acids 2166-2333 of rat 1B.
Antibodies were purified by affinity chromatography and used at 1:200
for immunoblotting and at 1:50 for immunoprecipitation.
Immunocytochemistry. Neurons were washed once in PBS, fixed
for 10-15 min in 4% paraformaldehyde and 4% sucrose in PBS on ice,
and permeabilized for 5 min at room temperature in 0.25% Triton X-100
in PBS. For labeling with STI antibodies, life neurons were washed once
in PBS and incubated in modified tiroid solution containing (in
mM): 90 NaCl, 45 KCl, 2 CaCl2, 1 MgCl2, 5 HEPES, pH
7.2, and STI antibodies for 3 min. Cells were then washed three times
in PBS, fixed, and permeabilized. Nonspecific binding sites were
blocked by incubation of cells for 30 min in 5% BSA (fraction V;
Sigma). Neurons were covered by primary antibodies diluted in blocking
solution followed by incubation with the corresponding rhodamine- or
FITC-conjugated secondary antibodies (Jackson ImmunoResearch, West
Grove, PA). Slides were washed with PBS and mounted in Moweol-488 (Polysciences Inc., Warrington, PA). For the experiment shown on Figure
5H, life neurons were preincubated with 5 µM -GVIA (Molecular Probes, Eugene,
OR) or -MVIIC (Amersham Pharmacia Biotech, Arlington Heights,
IL) for 30 min before STI labeling. Images were collected with a Zeiss
(Thornwood, NY) microscope with 40× and 63× objectives. Digital
images were captured with a cooled CCD camera (PhotoMetrics, Huntington
Beach CA) and Oncor (Gaithersburg, MD) Image software and analyzed
using Adobe Photoshop (Adobe Systems, San Jose, CA) and Scion
(Frederick, MD) Image software. The fluorescence intensity profiles
shown for Figures 2, 3, and 6 were created by manual tracing
of selected areas of axons. The confocal
images shown for Figures 1D,
2G, and 4C were collected with a confocal Zeiss Axiovert 100 microscope and 63× objective. Neuronal cell bodies were scanned starting from the surface
of the cell with a 0.2-µm-thickness parameter. Confocal images were
collected in Z-stacks using laser-scanning microscope software
(Zeiss).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1.
Distribution of recombinant N-type channels in
immature hippocampal neurons. Hippocampal neurons cultured in high
density were transfected with a mixture of
HA- 1B/ 2 / 3 cDNAs
2 d after plating. At 4 d after transfection, the neurons
were fixed, permeabilized, and labeled with monoclonal anti-HA
(red) and polyclonal anti-MAP2
(green) antibodies for conventional
(A-C) and confocal (D)
imaging. Scale bars, 20 µm. A, Recombinant
HA- 1B is targeted to both axons (arrow,
MAP2-negative) and dendrites (MAP2-positive processes) of immature
neurons. B, Recombinant HA- 1B is
uniformly distributed in axons of transfected neurons (large
arrows, MAP2-negative), with some degree of enrichment in zones
of contacts between axons and dendrites of neighboring nontransfected
cells (small arrows, MAP2-positive). C,
Recombinant HA- 1B is present in cell bodies and
dendrites of transfected neurons. The dendrite of a neighboring
untransfected cell is indicated by a small arrow. Only
weak HA immunoreactivity was typically observed in the proximal axonal
segment. D, Confocal analysis of recombinant
HA- 1B localization in the soma. Stacks of images were
collected starting from the surface of the cell with 0.2 µm
thickness. Every fifth image from the stack is shown.
|
|

View larger version (61K):
[in this window]
[in a new window]
|
Figure 2.
Distribution of recombinant N-type channels in
mature hippocampal neurons. Neurons cultured at high
(A-C, H, I) or low
(D-G) density were transfected with an
HA- 1B/ 2 / 3
plasmid combination at 10 DIV and analyzed 96 hr after transfection.
A, B, Staining for HA- 1B
(red) and MAP2 (green) of
hippocampal neurons cultured at high density for 14 d (14 DIV).
The recombinant channels are primarily excluded from somatodendritic
domain (A) and concentrated in discrete clusters
apposed to dendrites of nontransfected cells (B,
small arrows). Scale bars, 20 µm. C,
Colocalization of HA- 1B clusters (red,
small arrows) with clusters of endogenous synapsin
(green) in axons of 14 DIV hippocampal neurons
cultured at high density. The fluorescence intensity profile
(C'; HA, red; synapsin, green)
is taken from the boxed area in C.
HA-negative clusters of synapsin correspond to synaptic terminals of
nontransfected neurons in the field of view. Scale bar, 10 µm.
D, E, Staining for HA- 1B
(red) and MAP2 (green) of neurons
cultured at low density for 14 d. The N-type channels are present
in the somatodendritic domain (D) and uniformly
distributed in axons (E). The axons (large
arrows) are identified as MAP2-negative processes. Weak
HA- 1B immunoreactivity is observed in the proximal
axonal segment (D), but a strong HA signal was
observed in distal parts of axons (E) and growth
cones (data now shown). In E, a dendrite (MAP2-positive)
of a neighboring transfected cell in indicated by a small
arrow. Scale bars, 20 µm. F, Distribution of
recombinant HA- 1B (red) and endogenous
synapsin (green) in axons of 14 DIV hippocampal
neurons cultured at low density. The fluorescence intensity profile
(F'; HA, red; synapsin,
green) is taken from the boxed area in
F. Scale bar, 10 µm. G, Confocal
analysis of recombinant HA- 1B localization in the soma
of mature neurons cultured at low density. HA- 1B is
shown in red; MAP2 is in green. Images
were collected as described in Figure 1D and
Materials and Methods. Two representative images from the stack are
shown. H, Axon of a neuron cotransfected with
HA- 1B/ 2 / 3
(red) and mGFP (green). Clusters
of HA- 1B are indicated by small arrows.
Scale bar, 10 µm. I, Clusters of recombinant
HA- 1B (red) and endogenous PSD-95
(green) colocalize (small arrows).
The fluorescence intensity profile (I'; HA,
red; PSD-95, green) is taken from the
boxed area in I. HA-negative clusters of
PSD-95 correspond to synaptic terminals of nontransfected neurons in
the field of view. Scale bar, 10 µm.
|
|
Subcellular fractionation of brain. Subcellular brain
fractions were isolated as described previously (Jones and Matus,
1974 ). Briefly, 12 rat brains were homogenized in 0.32 M sucrose and 25 mM HEPES,
pH 7.2, and centrifuged for 10 min at 800 × g to remove the nuclei. The low-speed supernatant was then centrifuged for
20 min at 12,000 × g to separate synaptosomal
supernatant and synaptosomal membrane fractions (P2 pellet). P2 pellets
were incubated for 30 min at 4°C in hypotonic lysis buffer containing 5 mM Tris, pH 7.2, and then centrifuged at
25,000 × g to separate synaptic vesicles and crude
synaptosomal fractions (P3 pellet). P3 pellets were adjusted to 1.1 M sucrose, loaded to the centrifuge tubes, and
layered by solutions of 0.86 and 0.32 M sucrose.
Subcellular fractions were separated by centrifugation of samples for
2.5 hr at 48,000 × g. For Western blot analysis, equal
amounts of protein were loaded to each lane.
Immunoprecipitations. Samples of synaptosomal membranes,
crude synaptosomes, and synaptic plasma membranes (SPMs) were
solubilized in buffer containing 1%
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 25 mM HEPES, pH 7.2, 10% glycerol, 0.16 M sucrose, and protease inhibitors for 2 hr at
4°C. Insoluble material was removed by centrifugation of samples for
20 min at 100,000 × g. Samples were prelabeled with 5 nM 125I- -GVIA
(Amersham Pharmacia Biotech) for 1 hr at 4°C and then incubated with
protein A-Sepharose beads covered with NN or NC1 antibodies or
corresponding preimmune serum for 2 hr at 4°C. Beads were washed
three times with the fivefold diluted solubilization buffer, and the
number of 125I- -GVIA binding sites
precipitated by each antibody was measured with a gamma counter. Data
were normalized to the total protein content in each fraction.
Nonspecific binding measured with preimmune serum was subtracted from
the data.
Cloning of rNC2. Rat brain polyA RNA was isolated
(STAT-60; Tel-Test, Inc., Friendswood, TX), and cDNA was generated from poly-dT primer with a RETROscript kit (Ambion, Austin, TX). Obtained cDNA was used as a template for nested PCR with two pairs of primers specific for rat 1B sequence (Q2294) FP1 = GCGCAGGGACAAGAAGCAGA, RP1 = CTAGCACCAGTGATCCTGGTCT; FP2 = CAGAGAAGCAGCGCTTCTATTCCT; RP2 = TCTGGGTGGTGGTAGCTGTG. The products
of nested PCR were separated on agarose gel, purified, subcloned into
pCR2.1 Topo plasmid (Invitrogen), and sequenced. The novel sequence of
rNC2 splice variant was deposited into GenBank (accession number
AF389419).
 |
RESULTS |
Distribution of N-type Ca2+ channels in immature
rat hippocampal neurons
To study N-type Ca2+ channel
targeting in neurons, we added HA tag to an N terminal of the long
C-terminal splice variant of the human N-type channel pore-forming
subunit 1B-1 (CaV2.2a) (Williams et al., 1992 ; Ellinor et al., 1994 ; Ertel et al., 2000 ) and
expressed the resulting HA- 1B construct in rat
hippocampal neurons by Ca2+
phosphate-mediated transfection (see Materials and Methods). When
expressed without auxiliary subunits, the
HA- 1B construct was restricted to neuronal
soma (data not shown), most likely because of retention in the
endoplasmic reticulum (ER) (Bichet et al., 2000 ). Thus, in all
experiments in this study the HA- 1B construct
was coexpressed with the rabbit 2 -1 (Mikami
et al., 1989 ) and rabbit 3 (Hullin et al.,
1992 ) subunits. We first analyzed distribution of recombinant N-type
channels expressed in immature neurons [5-6 d in vitro
(DIV)], before maturation of synaptic contacts and formation of a
fully polarized phenotype. Both morphological criteria and MAP2
staining were used to discriminate between somatodendritic and axonal
compartments of immature neurons in these experiments. The recombinant
HA- 1B was detected in both somatodendritic and axonal domains of immature neurons (Fig. 1A,C). The
recombinant N-type channels present in axons were diffusely distributed
with some degree of enrichment in zones of contacts between axons and dendrites of neighboring nontransfected cells (Fig.
1B). Similar results were obtained with another
1B construct in which HA tag was inserted into
the intracellular loop between II and III repeats (data not shown).
Thus, targeting of N-type channels in neurons is not likely to be
affected by addition of the N-terminal HA tag.
Overexpression of recombinant N-type channels in neurons may lead to an
artificially strong signal from the channels retained in somatic
intracellular compartments, primarily the ER. Surface labeling
experiments can help to visualize channels in the plasma membrane. We
attempted to incorporate surface-accessible myc tag into
several putative extracellular loops in the 1B
sequence, but these constructs could not be detected by
anti-myc antibodies in neuronal surface labeling experiments
(data not shown). Presumably, myc epitope in these positions
is not accessible to the antibody. Instead, we used confocal imaging to
determine subcellular localization of the
HA- 1B subunit. As expected from the
Xenopus oocyte expression experiments (see Materials and
Methods; Table 1), obtained images were not consistent with the
ER-trapped HA- 1B subunit (Fig.
1D). Thus, we concluded that recombinant N-type
channels are uniformly distributed in immature hippocampal neurons, in
agreement with the previously reported studies of native N-type channel
distribution in immature hippocampal neurons using immunolocalization
(Bahls et al., 1998 ) and functional (Pravettoni et al., 2000 ) methods.
Distribution of N-type Ca2+ channels in mature
rat hippocampal neurons
Neuronal contact-dependent clustering of endogenous N-type
Ca2+ channels (Bahls et al., 1998 ) and
synapsins (Fletcher et al., 1991 ) in synaptic sites has been described
for mature high-density cultures of rat hippocampal neurons. Thus, we
subsequently examined the distribution of recombinant N-type
Ca2+ channels
(HA- 1B/ 2 / 3)
in high-density mature (14 DIV) rat hippocampal neuronal cultures. In
contrast to experiments with immature cultures, we found that in mature
cultures HA- 1B was primarily absent from soma
and dendrites (Fig. 2A). Indeed, in 90 ± 5%
(n = 110; five independent transfections) of neurons
only weak HA immunoreactivity was detected in soma and proximal
dendrites (Fig. 2A). Recombinant N-type channels
expressed in mature neuronal cultures were concentrated in discrete
clusters apposed to dendrites of nontransfected cells (Fig.
2B). When the neurons were cotransfected with
recombinant N-type Ca2+ channels and the
membrane-associated form of GFP (mGFP) (Moriyoshi et al., 1996 ), the
HA- 1B-positive clusters were associated with the long, fine caliber fibers visualized by mGFP fluorescence (Fig.
2H). The latter observation rules out the possibility
that the clusters of HA- 1B represent protein
aggregates formed because of toxicity or fragmentation of neuronal
processes. The morphology of neuronal processes visualized by mGFP fits
with the expected morphology of axonal processes at the corresponding
stage of neuronal culture (Fletcher and Banker, 1989 ). The
HA- 1B-positive clusters were localized to
contacts between axon (MAP2-negative) and dendrites (MAP2-positive)
processes (Fig. 2B). The
HA- 1B-positive clusters were also precisely
colocalized with the clusters of endogenous synapsin (Fig.
2C,C') and endogenous PSD-95 (Fig. 2I,I'),
visualized by the corresponding polyclonal antibody. From all of these
results, we concluded that the recombinant N-type
Ca2+ channels expressed in mature neuronal
cultures are concentrated in axons and clustered at presynaptic locations.
Distribution of recombinant N-type channels was diffuse and uniform in
immature, low-density neuronal cultures (Fig. 1A,B) and punctate and polarized in mature, high-density cultures (Fig. 2A-C,H,I). Is distribution of recombinant
N-type channels in neurons affected by the age of neuronal culture or
by the formation of synapses? To answer this question, we transfected
low-density rat hippocampal neuronal cultures at 10 DIV with the
HA- 1B/ 2 / 3 subunit combination and analyzed HA- 1B
localization 4 d after transfection. At the same age of culture,
the number of synaptic contacts formed by each cell in the low-density
culture was significantly reduced when compared with the high-density
culture. The N-type channels expressed in the low-density mature
cultures were diffusely distributed in soma, dendrites, and axons of
transfected neurons (Fig. 2D,E). Using confocal
imaging, we demonstrated that the immunoreactivity in the somatic
compartment does not result from ER-trapped
HA- 1B protein (Fig. 2G). Axons in
these experiments can be easily identified as
HA- 1B-positive MAP2-negative processes (Fig.
2E). In agreement with previous findings (Fletcher et
al., 1991 ), distribution of endogenous synapsins in axons of these neurons had a granular appearance (Fig. 2F), in
marked contrast to distinct clusters of synapsin observed in mature
high-density cultures (Fig. 2C). Distribution of
HA- 1B in axons of neurons cultured at low
density was similar to distribution of synapsin (Fig.
2F,F'). We concluded from these experiments that
neuronal contacts and synapse formation are essential for recombinant
N-type Ca2+ channel clustering in
hippocampal neurons. It also appears that not only synaptic clustering
but also polarized distribution of recombinant N-type
Ca2+ channels depends on neuronal contacts
(Fig. 2A,D). The latter conclusion is unexpected and
challenges a common view that polarized protein targeting in neurons is
guided by intrinsic sorting signals and happens independently of
cell-to-cell contacts (Craig and Banker, 1994 ).
Structural determinants of N-type Ca2+ channel
targeting to synapse
In the next series of experiments, we searched for the structural
determinants responsible for N-type Ca2+
channel targeting to synapses. In the previous biochemical studies, we
identified SH3 and PDZ domain-binding motifs in the C-terminal region
of the long splice variant of a human N-type
Ca2+ channel pore-forming subunit,
1B-1 (CaV2.2a) (Maximov
et al., 1999 ). We discovered (Maximov et al., 1999 ) that Mint1-PDZ1
binds to the C termini of the 1B subunit (Fig.
3A, black box,
diagram), and that CASK-SH3 binds to the proline-rich region
~300 aa upstream of the 1B C termini (Fig.
3A, dashed box, diagram). The same proline-rich region has been also implicated in interactions with G-protein  subunits (Qin et al., 1997 ), with the auxiliary
Ca2+ channel subunit (Walker et al.,
1998 ) and more recently with the SH3 domain of the Rab3-interacting
molecule (RIM)-binding protein (RBP) (Hibino et al., 2002 ). We
hypothesized previously that the identified PDZ and SH3 domain-binding
motifs may play a role in N-type Ca2+
channel synaptic targeting in neurons (Maximov et al., 1999 ). To test
this hypothesis, a series of C-terminal mutants of HA-tagged 1B subunit was generated and expressed in
mature, high-density hippocampal cultures (Fig. 3). The
1B mutants used in these experiments were
expressed at levels similar to the wild-type channels when transfected
into COS7 or HEK293 cells and supported functional Ca2+ currents of similar size when
expressed in Xenopus oocytes (see Materials and Methods;
Table 1).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3.
Structural determinants of recombinant
N-type channel synaptic targeting. A-D, The wild-type
(WT) HA- 1B subunit
(A) and C-terminal mutants
HA- 1B-T2038X (B),
HA- 1B-D2334X (C), or
HA- 1B-PXXP-A/D2334X (D)
cotransfected with 2 -1 and 3 subunits
into high-density hippocampal neurons at 10 DIV. At 4 d after
transfection, the axonal distribution of HA- 1B
(red) and endogenous synapsin
(green) was compared. The fluorescence intensity
profiles of the boxed regions are shown on the
right. In A and C,
HA- 1B clusters are indicated by small
arrows. The domain structure of the 1B
C-terminal domain is shown on the left (proline-rich
region, striped box; PDZ domain-binding motif,
black box; PXXP-A mutation, gap in
striped box). Scale bars, 10 µm. E, The
recombinant N-type channels
(HA- 1B/ 2 / 3)
were cotransfected with GFP-NC3 construct (GFP fused to 2021-2339 aa
of 1B) into high-density hippocampal neurons at
10 DIV. At 4 d after transfection, the localization of
HA- 1B (red), GFP-NC3
(green), and endogenous synapsin
(blue) was determined. The fluorescence intensity
profiles of the boxed region for HA- 1B
(red), GFP-NC3 (green), and
synapsin (blue) are on the right. The
domain structure of the HA- 1B and GFP-NC3 constructs is
shown on the left. Scale bar, 10 µm.
F, Quantitative analysis of HA- 1B
wild-type and C-terminal mutant axonal distribution. Based on visual
examination, for each transfected neuron the axonal distribution of
HA- 1B was scored as clustered or diffuse. The percentage
of transfected neurons with clustered axonal distribution of
HA- 1B was calculated for each transfection. The data
from at least two independent transfections for each construct are
presented as mean ± SD, with the total numbers of analyzed cells
shown on the top. For D2334X and PXXP-A mutants, the
p values (when compared with the wild type) are <0.002
and 0.01, respectively (indicated by
asterisks).
|
|
As discussed in the previous section, the wild-type
HA- 1B subunit expressed in mature high-density
cultures was localized in clusters along axonal processes and precisely
colocalized with endogenous synapsins (Fig. 3A). Axonal
clustering of the wild-type HA- 1B subunit was
observed in 95 ± 3% (n = 27) of transfected neurons (Fig. 3F). In contrast, the
HA- 1B-T2038X truncation mutant was diffusely
distributed along the axonal processes (Fig. 3B,F). Thus, the last 301 aa of the 1B sequence
(amino acids 2038-2339) did indeed contain motifs essential for
synaptic targeting of recombinant N-type
Ca2+ channels in hippocampal neurons. To
determine the role played by the PDZ domain-binding motif, we generated
the HA- 1B-D2334X mutant that lacks the last 6 C-terminal amino acids of the 1B sequence.
When the HA- 1B-D2334X mutant was expressed in
neurons, it also formed synaptic clusters along the axonal processes
(Fig. 3C). The synaptic clustering of the
HA- 1B-D2334X mutant was observed only in
48 ± 3% (n = 21) of transfected cells (Fig.
3F), indicating partial impairment of channel
targeting caused by C-terminal truncation.
Alternative splicing of human 1B C termini
occurs within the proline-rich region at position 2163 (Williams et
al., 1992 ). The HA- 1B-S2176X mutant, truncated
close to the alternative splicing site of human
1B subunit, is diffusely distributed in axons
of transfected neurons (Fig. 3F). We noticed that a
strong class I SH3 domain-binding consensus
2188RQLPQTPLTPRP2199
(Dalgarno et al., 1997 ; Mayer, 2001 ) is present in the
1B-1 (CaV2.2a) but not
in the 1B-2 (CaV2.2b)
isoform of the human subunit. We reasoned that this motif may play an
important role in channel targeting and replaced its portion (amino
acids 2191-2199) with the polyalanine sequence (PXXP-A mutation) (Fig.
3D, diagram, gap). In control
biochemical experiments, we established that the region of
1B subunit involved in association with the
3 subunit lies upstream of the area affected
by the PXXP-A mutation (data not shown). Notably, the PXXP-A mutation
is expected to affect the association of 1B
subunit with the RBP-SH3 domain, which binds to the same motif (Hibino
et al., 2002 ). When the HA- 1B-PXXP-A mutant
was expressed in mature neuronal cultures, synaptic clustering of
recombinant channels was observed in 59 ± 1% of transfected
cells (Fig. 3F). Thus, the phenotype of the HA- 1B-PXXP-A mutant is very similar to the
phenotype of the HA- 1B-D2334X mutant; in both
cases, the channels are clustered at synapses, albeit not as
efficiently as the wild-type channel (Fig. 3F).
To further investigate the targeting function of PDZ and SH3
domain-binding motifs in the 1B C-terminal
region, we combined the PXXP-A and D2334X mutations. When the resulting
HA-tagged double mutant was expressed in hippocampal neurons, diffuse
distribution of recombinant N-type channels in axons was observed (Fig.
3D), similar to the HA- 1B-T2038X
truncation mutant (Fig. 3B). Axonal clusters were observed
only in 12 ± 9% of neurons transfected with the
HA- 1B-PXXP-A/D2334X double mutant (Fig.
3F). Thus, deletion of a 6-aa-long PDZ domain-binding
consensus (2334-2339) and mutation of a 9-aa-long SH3 domain-binding
consensus (2191-2199) to polyalanines results in an almost complete
loss of the ability of the N-type channel to cluster at synapses in
hippocampal neurons. We concluded that PDZ and SH3 domain-binding
motifs in 1B-1 C termini act as synergistic
synaptic targeting signals, and that the presence of at least one of
these motifs is necessary for synaptic targeting of N-type
Ca2+ channels.
The most likely explanation for our results is that interaction of the
1B subunit with endogenous adaptor proteins
containing PDZ and SH3 domains is required for synaptic targeting of
N-type channels. If this is indeed the case, then overexpression of the C-terminal portion of the 1B subunit that
contains the PDZ and SH3 domain-binding motifs in neurons should result
in competition for adaptor proteins and cause mislocalization of N-type
channels. To test this hypothesis, we coexpressed the GFP-NC3 construct (GFP fused to the 1B fragment between amino
acids 2021-2339) (Fig. 3E, diagram) with
HA-tagged recombinant N-type Ca2+ channels
(HA- 1B/ 2 / 3)
in mature (14 DIV) neuronal cultures. In agreement with our prediction,
the formation of HA-positive clusters but not clusters of endogenous
synapsins was abolished in GFP-NC3-expressing axons (Fig.
3E,F). The effect of GFP-NC3 was specific, because
coexpression with mGFP did not interfere with synaptic clustering of
recombinant N-type channels (Fig. 2H). We reasoned
that GFP-NC3 exerts its dominant-negative effect by displacing
HA- 1B from complexes with endogenous adaptor
proteins involved in synaptic cluster formation.
Alternative splicing of rat 1B subunit
The phenotypes of HA- 1B-S2176X (Fig.
3F) and HA- 1B-PXXP-A/D2334X
(Fig. 3D,F) mutants suggest that only the long
1B-NC1 ( 1B-1,
CaV2.2a) but not "short"
1B-NC2 ( 1B-2,
CaV2.2b) splice variant of
1B subunit should be targeted to synapses. To
test this hypothesis experimentally, we set out to clone the rat
1B-NC2 splice variant (rNC2). The short C-tail
splice isoform of rat 1B was observed in
biochemical experiments (Hell et al., 1994 ), but only the rNC1 isoform
sequence is present in the GenBank database. By standard molecular
techniques, we isolated rat brain mRNA, synthesized cDNA from oligo-dT
primer, and performed a nested PCR with two pairs of rat
1B-specific primers (see Materials and
Methods). Two distinct products obtained as a result of a nested PCR
were isolated, subcloned, and sequenced. One product corresponded to a
known rNC1 isoform of rat 1B subunit (Dubel et
al., 1992 ). Another product corresponded to a novel rNC2
( 1B-2, CaV2.2b) isoform
(GenBank accession number AF389419). Interestingly, the position of the
C-terminal splicing site and the sequence of
1B-NC1 isoform is highly conserved between
human (Williams et al., 1992 ), chicken (Lu and Dunlap, 1999 ), and rat
(Fig. 4A) clones,
whereas the sequence of the 1B-NC2 isoform
after the splicing site is divergent between species.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4.
Cloning and subcellular
localization of rat 1B-NC2 splice variant.
A, Diagram of human (Williams et al., 1992 ), chicken (Lu
and Dunlap, 1999 ), and rat 1B C-terminal splice
variants. The sequence of rat 1B-NC2 has been deposited
in GenBank (accession number AF389419). The position of PDZ and SH3
domain-binding motifs is indicated as in Figure 3A.
B, Recombinant HA- 1B-rNC2
(red) and endogenous MAP2 (green)
localization in mature neurons cultured at high density. Scale bars, 20 µm. C, Confocal analysis of recombinant
HA- 1B-rNC2 localization in the soma of mature neurons
cultured at low density. Three representative images from the stack are
shown. D, Western blot of rat brain subcellular
fractions with antibodies against rat 1B-NC1 and the
neuronal markers PSD-95, synapsin I, and MAP2. Equal amounts of protein
were loaded to each lane. Arrows
indicate samples on the synaptic plasma membrane fraction.
E, The ratio of 125I- -GVIA binding site
amounts precipitated by NC1 and NN antibodies from P2, P3, and SPM
fractions solubilized in CHAPS. *p < 0.001.
|
|
To obtain information about localization of the
1B-NC2 isoform in neurons, we fused the
C-terminal tail of the short rat 1B-NC2 splice
variant with the HA-tagged human 1B clone. The resulting HA- 1B-rNC2 construct was coexpressed
with auxiliary 2 and
3 subunits in immature (5-6 DIV) (data not
shown) and mature (14 DIV) (Fig. 4B) high-density rat
hippocampal neurons. We found that the short
HA- 1B-rNC2 splice variant was primarily excluded from axons of both immature (data not shown) and mature neurons and formed aggregates in neuronal soma and proximal dendrites (Fig. 4B). Confocal image analysis (Fig.
4C) and Xenopus oocyte expression experiments
(see Materials and Methods; Table 1) confirmed that the
HA- 1B-rNC2 protein was not trapped in the ER.
The localization of the HA- 1B-rNC2 isoform in
mature high-density neuronal cultures differs dramatically from the
localization of the HA- 1B-NC1 isoform (Fig.
2A-C). The distribution of
HA- 1B-rNC2 also differs from the distribution
of HA- 1B-T2038X and
HA- 1B-S2176X truncation mutants, which were
diffusely and uniformly distributed in both axonal (Fig.
3B,F) and somatodendritic (data not shown) domains. Thus, somatodendritic retention and aggregation motifs are likely to be
encoded by C termini of the 1B-NC2 splice
variant. From these results, we concluded that the
1B-NC1 ( 1B-1,
CaV2.2a) splice variant encodes the
axonal/synaptic isoform, and that the 1B-NC2
( 1B-2, CaV2.2b) splice
variant encodes the somatodendritic isoform of the N-type
Ca2+ channels.
To test this hypothesis further, we generated NC1
splice-variant-specific antibodies against the C-terminal region of the rat 1B subunit (see Materials and Methods).
Generated NC1 antibodies were not appropriate for immunostaining of
hippocampal cultures (data not shown). However, NC1 antibodies could be
used for Western blotting and immunoprecipitation experiments. To
analyze the subcellular distribution of the NC1 splice variant, we
fractionated rat brain cortical homogenate (Jones and Matus, 1974 ) and
analyzed the resulting fractions by Western blotting with NC1
antibodies (Fig. 4D, first row), PSD-95
antibodies (Fig. 4D, second row), synapsin
I antibodies (Fig. 4D, third row), and
MAP2 antibodies (Fig. 4D, fourth row). We
found that the distribution of NC1 immunoreactivity was parallel to
that of PSD-95 (Fig. 4D), suggesting that the
endogenous NC1 splice variant is concentrated in synaptic locations.
What is a relative distribution of NC1 and NC2 splice variants? We
could not generate NC2-specific antibodies to address this question directly. Instead, we performed experiments with NN antibodies directed
against the N-terminal region of the rat 1B
subunit (Maximov et al., 1999 ). The NN antibodies recognized both
C-terminal splice variants of the rat 1B
subunit. To quantify the relative distribution of NC1 and NC2
splice variants, in the next series of experiments we compared the
relative ability of NC1 and NN antibodies to immunoprecipitate
125I- -GVIA-labeled N-type
Ca2+ channels from different subcellular
fractions. We found that the fraction of
125I- -GVIA binding sites precipitated
by NC1 antibodies from the SPM fraction was significantly elevated when
compared with P2 and P3 fractions (Fig. 4E). Thus, we
concluded that the NC1 splice variant is enriched in synaptic locations
in comparison with the NC2 splice variant.
Dominant negative effects of 1B C termini on
synaptic function
The C-terminal GFP-NC3 construct disrupts the synaptic clustering
of recombinant N-type Ca2+ channels (Fig.
3E,F). In the next series of experiments, we analyzed the effects of GFP-NC3 overexpression on synaptic function. To measure
synaptic activity, we monitored the depolarization-induced uptake of
antibodies against the lumenal domain of STI in synapses of hippocampal
neurons. In these experiments, we followed the previously
described STI labeling procedure (Matteoli et al., 1992 )
(Fig. 5A). The STI antibodies,
trapped inside endocytosed synaptic vesicles, report locations of
synapses capable of depolarization-induced exocytosis. Opening of
synaptic voltage-gated Ca2+ channels and
Ca2+ influx into the presynaptic terminal
is an essential step leading from depolarization to exocytosis. When
extracellular Ca2+ was omitted from
depolarization media, no signal with STI antibodies was observed in
response to KCl depolarization (data not shown). In additional control
experiments, we demonstrated that STI-positive clusters were
concentrated in points of contact between axons and the MAP2-positive
postsynaptic target (Fig. 5B), and that STI- and
synapsin-positive clusters were colocalized (Fig. 5C), confirming the specificity of the STI staining pattern.

View larger version (72K):
[in this window]
[in a new window]
|
Figure 5.
Dominant-negative effect of 1B
C-terminal fragment on synaptic function. A, The
experimental protocol for live labeling of active synapses with
synaptotagmin luminal antibodies (STI) was adapted from Matteoli et al.
(1992) . The hippocampal neuronal cultures were preincubated with STI
antibodies for 3 min in the presence of 45 mM KCl and 2 mM Ca2+. After stimulation, STI
antibodies were washed out, and neurons were fixed, permeabilized, and
stained with rhodamine-conjugated anti-mouse secondary antibody to
visualize STI antibody localization. The intraluminal epitope of
synaptotagmin is shown as a black box. B,
Live labeling for STI (red) followed by fixation and
labeling for MAP2 (green). Note that all
STI-positive clusters are apposed to cell body and dendrites
(MAP2-positive). Scale bar, 20 µm. C, Live staining
for STI (left panel, red in merged
image) followed by fixation and staining for synapsin
(center panel, green on merged
image) shows colocalization of STI clusters with presynaptic
sites. On average, 93% of STI and synapsin clusters were colocalized
(n = 200). Scale bar, 10 µm. D,
Live staining for STI (red) of GFP-NC3
(green)-transfected neurons followed by fixation
and staining for MAP2 (blue). Axons of transfected cells
(green, MAP2-negative) are indicated by
large arrows. The boxed portion of the
image is enlarged in the D' inset. Note that the
intensity of individual STI clusters associated with axons of
transfected neurons is reduced when compared with control clusters
formed by GFP-NC3-negative axons. Small arrows in
D' indicate synapses of transfected cells. Scale bars:
D, 20 µm; D', 10 µm.
E, Live staining for STI (red) of neurons
expressing mGFP (green). Note that the intensity
of individual STI clusters associated with axons of mGFP-transfected
neurons is not affected. Small arrows in E
indicate synapses of transfected cells. Scale bar, 10 µm.
F, Quantitative analysis of the intensity of individual
clusters of STI (left panel), synapsin
(center panel), and PSD-95 (right
panel) associated with control (nontransfected) cells
and cells transfected with mGFP or GFP-NC3 as indicated. For each
transfection, the fluorescence intensity of individual STI, synapsin,
and PSD-95 clusters was normalized to the average fluorescence
intensity of corresponding clusters observed for control
(nontransfected) cells in the same field. The normalized intensities
are shown as mean ± SEM (n = number of
clusters analyzed). For STI plot: control, n = 309;
mGFP, n = 55; GFP-NC3, n = 90 (*p < 0.001 when GFP-NC3 is compared with
control and mGFP). For synapsin and PSD-95, n 75 for controls and n 25 for mGFP and GFP-NC3.
G, Cumulative distribution of intensities of individual
STI clusters associated with axons of nontransfected neurons (control,
) or axons of neurons expressing mGFP ( ) and GFP-NC3 ( ).
H, Effect of GFP-NC3 expression on STI uptake by neurons
preincubated with 5 µM -GVIA or 5 µM
-MVIIC (n 25 for each group).
|
|
To test the effect of GFP-NC3 overexpression on synaptic function, we
compared the signal reported by STI antibodies for nontransfected (control) neurons and for neurons transfected with GFP-NC3 or mGFP.
When compared with control neurons, we observed a significant reduction
in the intensity of individual STI-positive clusters in axons
expressing GFP-NC3 (Fig. 5D,D') but not in axons expressing mGFP (Fig. 5E). On average, the intensity of STI-positive
clusters was 40% weaker in axons of GFP-NC3-transfected cells than in
the axons of nontransfected or mGFP-expressing cells (Fig.
5F). The effect of GFP-NC3 on STI staining was not
caused by loss of the ability of the axons of transfected neurons to
form synaptic contacts, because synapsin and PSD-95 staining was not
affected by GFP-NC3 overexpression (Fig. 5F). A
similar conclusion can be drawn by comparing the cumulative
distribution of individual STI cluster intensities between control,
mGFP-expressing, and GFP-NC3-expressing neurons (Fig. 5G).
We reasoned from these data that depolarization-induced exocytosis is
suppressed in synapses of neurons overexpressing GFP-NC3 but not mGFP
construct. To explain these results, we reasoned that depression of
synaptic function by the GFP-NC3 construct is caused by its
interference with targeting and/or the synaptic function of endogenous
Ca2+ channels in hippocampal neuronal cultures.
Overexpression of GFP-NC3 completely abolished the clustering of
recombinant N-type channels (Fig. 3E,F) but had only
a partial effect on the synaptic activity reported by STI antibody
uptake (Fig. 5F). Previous experiments with FM1-43
imaging dye indicated that in hippocampal neuronal cultures ~45% of
synapses rely solely on N-type Ca2+
channels; the remaining 55% are supported by a mixture of N-type and
P/Q-type Ca2+ channels (Reuter, 1995 ). One
possible explanation for the partial effect of GFP-NC3 on STI antibody
uptake is that GFP-NC3 causes only partial suppression of endogenous
N-type and P/Q-type Ca2+ channel function
at synapses. An alternative explanation is that GFP-NC3 interferes with
the synaptic function of N-type but not P/Q-type
Ca2+ channels. To discriminate between
these possibilities, we compared effects of GFP-NC3 on STI antibody
uptake after preincubation of neuronal cultures with 5 µM -GVIA or 5 µM
-MVIIC conotoxins. The -GVIA conotoxin is a selective inhibitor
of N-type Ca2+ channels (Boland et al.,
1994 ), whereas -MVIIC conotoxin blocks both N-type and P/Q-type
Ca2+ channels (McDonough et al., 1996 ).
The block of N-type Ca2+ channels by
-MVIIC is rapidly reversible, with the time constant of ~30 sec
(McDonough et al., 1996 ). In contrast, the block of P/Q-type channels
by -MVIIC and the block of N-type Ca2+
channels by -GVIA reverses on a time scale of hours (Boland et al.,
1994 ; McDonough et al., 1996 ). We took advantage of these kinetic differences in the design of our experiments. Before exposure of hippocampal neuronal cultures to KCl and STI antibody, we removed the toxins and washed the cultures for 3-5 min in PBS. During the wash
period, the block of N-type channels by -MVIIC, but not the block of
P/Q-type channels by -MVIIC or the block of N-type channels by
-GVIA, was reversed. Thus, in our experiments P/Q-type
Ca2+ channels were selectively blocked by
-MVIIC conotoxin during KCl stimulation and STI labeling. The latter
conclusion was supported by our observation that the mixture of both
-GVIA and -MVIIC conotoxins abolished STI clusters in our
cultures (data not shown), whereas a large number of STI clusters were
observed in the presence of -GVIA or -MVIIC conotoxins alone.
When cultures were preincubated with either -GVIA or -MVIIC
conotoxins, overexpression of GFP-NC3 caused a significant suppression
of the average intensity of observed STI clusters when compared with
nontransfected neurons (Fig. 5H). From these data, we
concluded that GFP-NC3 has similar inhibitory effects on the synaptic
function of either N-type or P/Q-type Ca2+
channels, and that the synaptic function of endogenous
Ca2+ channels is only partially disrupted
by GFP-NC3 overexpression in hippocampal neuronal cultures.
Synaptic targeting of CD4- 1B-NC chimeric constructs
in hippocampal neurons
In the previous sections, we established that the C-terminal
region of the 1B subunit (amino acids
2177-2339) is necessary for synaptic clustering of N-type
Ca2+ channels in mature high-density
neuronal cultures. Are N-type Ca2+ channel
C termini also sufficient for synaptic targeting? To answer this
question, we generated a model chimeric construct, CD4-NC, composed of
an extracellular human CD4 receptor ectodomain, a single human CD4
receptor transmembrane domain, and a short fragment of human
1B cytosolic tail (Fig.
6E,
diagram). In the resulting CD4-NC construct, most of the
1B-NC1 C terminus, including the proline-rich
region, was removed from the sequence, leaving the short region in the
beginning of the C-tail and the most C-terminal region containing the
PDZ domain-binding consensus. To evaluate the role of the PDZ
domain-binding motif, the control CD4-NC-D2334X construct, which lacked
the last 6 aa, was also generated (Fig. 6E,
diagram). The human truncated CD4 receptor construct (CD4) served as a negative control in these experiments.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 6.
Synaptic targeting of CD4-NC construct. CD4,
CD4-NC, and CD4-NC-D2334X chimeric constructs were transfected into
high-density rat hippocampal neurons at 10-11 DIV, and their
subcellular localization was visualized by immunostaining with CD4 or
CD4-FITC antibodies 3-4 d after transfection. A, C,
MAP2 (red) and CD4 (green)
staining of high-density hippocampal neuronal cultures transfected with
CD4 (A) and CD4-NC (C).
Scale bars, 20 µm. B, D, F, CD4 (left
panel, red in merged image) and
synapsin (center panel, green in
merged image) localization in axons of neurons
transfected with CD4 (B), CD4-NC
(D), or CD4-NC-D2334X (F).
CD4 clusters are indicated by small arrows
(D). CD4-negative clusters of synapsin correspond
to synaptic terminals of nontransfected neurons in the field of view.
The fluorescence intensity profiles (CD4, red; synapsin,
green) of the boxed regions in
B, D, and F are shown on
B', D', and F',
respectively. Scale bars, 10 µm. E, Topological models
of CD4, CD4-NC, and CD4-NC-D2334X targeting constructs.
|
|
The CD4, CD4-NC, and CD4-NC-D2334X constructs were transfected into
mature high-density rat hippocampal neurons. Double labeling with
CD4-FITC and MAP2 antibodies demonstrated that the expressed CD4
receptor was diffusely distributed in all processes of transfected cells (Fig. 6A). In contrast, the CD4-NC protein was
clustered in axons (Fig. 6C). Double labeling with
monoclonal CD4 and polyclonal synapsin antibodies revealed that CD4-NC
clusters colocalize with synaptic sites (Fig. 6D,D').
In contrast, diffuse distribution of CD4 immunoreactivity did not
correlate with synapsin localization (Fig. 6B,B').
The presence of the PDZ domain-binding motif appears to be essential
for synaptic clustering of CD4-NC, because the CD4-NC-D2334X construct
was diffusely distributed and did not colocalize with synapsin (Fig.
6F,F'). It is important to note that the CD4-NC and
CD4-NC-D2334X constructs lack a proline-rich region (amino acids
P2039-P2194) in their sequence, which probably accounts for the
differences observed in HA- 1B-D2334X and
CD4-NC-D2334X distribution (Figs. 3C, 6F).
Indeed, a diffuse axonal distribution of the CD4-NC-D2334X construct
(Fig. 6F) is similar to diffuse localization of the
HA- 1B-PXXP-A/D2334X double mutant (Fig.
3D). It is interesting to note that the soluble GFP-NC3
construct was diffusely distributed in hippocampal neurons (Figs.
3E, 5D), indicating that the presence of the
transmembrane domain in the CD4-NC construct is essential for synaptic
targeting. From experiments with the CD4-NC targeting constructs, we
concluded that the C-terminal region of 1B is
sufficient for targeting of the CD4 receptor to the presynaptic sites
in mature high-density hippocampal neuronal cultures. In the absence of
the proline-rich region, the synaptic targeting function of
1B C termini is completely determined by the
presence of the PDZ domain-binding motif.
The PDZ domain-binding motif is conserved between
1B and 1A
pore-forming subunits (Maximov et al., 1999 ). Does the C terminal of
the 1A subunit also act as synaptic targeting
signal? To answer this question, we generated CD4-QC and CD4-QC-D2501X
constructs (see Materials and Methods), expressed these constructs in
mature hippocampal neuronal cultures, and performed double labeling
with monoclonal CD4 and polyclonal synapsin antibodies. Similar to the
CD4-NC construct, we found that the CD4-QC construct was clustered at
synaptic locations, whereas the CD4-QC-D2501X construct was diffusely
distributed in axons (data not shown). Thus, the PDZ domain-binding
consensus at C termini of 1A (P/Q-type
Ca2+ channels) also functions as synaptic
targeting signal.
Potential role of Mint1 and CASK adaptor proteins in N-type
Ca2+ channel targeting to synapse
Our experiments (Figs. 3, 6) established the importance of PDZ and
SH3 domain-binding motifs in 1B C termini for
N-type Ca2+ channel synaptic targeting in
hippocampal neurons. In a previous paper (Maximov et al., 1999 ), we
demonstrated that the same motifs specifically associate with the
Mint1-PDZ1 and CASK-SH3 adaptor domains. To determine whether Mint1 and
CASK can play a role in N-type Ca2+
channel targeting in neurons, we expressed GFP-tagged Mint1 and CASK in
mature high-density hippocampal neuronal cultures. GFP-Mint1 and
GFP-CASK were present in both axonal (MAP2-negative) and
somatodendritic (MAP2-positive) domains (Fig.
7A,C). In axons, GFP-Mint1 and
GFP-CASK form distinct clusters (Fig. 7B,D). The observed
clusters were juxtaposed to MAP2-positive processes (Fig.
7B,D) and precisely colocalized with synapsin clusters (data
not shown). Thus, similar to recombinant N-type channels, recombinant
Mint1 and CASK are clustered in presynaptic terminals of mature rat
hippocampal neurons.

View larger version (55K):
[in this window]
[in a new window]
|
Figure 7.
Colocalization of recombinant Mint1 and CASK with
N-type channels in mature hippocampal neurons. A-D,
High-density hippocampal neuronal cultures transfected with GFP-Mint1
(A, B) and GFP-CASK (B, D) plasmids at 9 DIV. At 3-5 d after transfection, the localization of GFP-Mint1 or
GFP-CASK (green) and endogenous MAP2
(red) was determined. The somatodendritic domain
(A, C) and distal axonal segment (B, D)
of transfected cells are shown. Proximal axonal segments are indicated
by arrows (A, C). Presynaptic clusters of
GFP-Mint1 (B) and GFP-CASK
(D) associated with axons of transfected neurons
apposed to dendrites (MAP2-positive) are indicated by small
arrows. Scale bars, 20 µm. E, F, High-density
mature hippocampal neurons cotransfected with
HA- 1B/ 2 / 3 and
GFP-Mint1 (E) or GFP-CASK
(F) at 9 DIV. At 4 d after transfection, the
axonal distribution of HA- 1B (top panel,
red in merged image) and GFP-Mint1
(E, center panel, green in
merged image) or GFP-CASK (F,
center panel, green in merged
image) was determined. Synaptic clusters of
HA- 1B, GFP-Mint1, and GFP-CASK are indicated by
small arrows. Axonal growth cones are indicated by
asterisks in E. Scale bars, 20 µm.
|
|
Do Mint1, CASK, and N-type Ca2+ channels
cluster in the same locations? To answer this question, we coexpressed
recombinant HA-tagged N-type Ca2+ channels
with GFP-Mint1 or GFP-CASK. We found that GFP-Mint1, GFP-CASK, and
HA- 1B were coclustered at mature synapses
formed by the same cell (Fig. 7E,F). Is it possible
that N-type channels clustered at synaptic sites bind GFP-Mint1 and
GFP-CASK, leading to their concentration at synapses? To address this
question, we coexpressed GFP-Mint1 and GFP-CASK with HA-NC3 construct
(HA tag fused to the 1B fragment between amino
acids 2021-2339). In interpretation of these experiments, we assumed
that the HA-NC3 construct is expressed at levels far above the levels
of endogenous N-type Ca2+ channels. If
binding of Mint1 and/or CASK to 1B C termini
is required for their synaptic clustering, then the soluble HA-NC3 construct is expected to have a dominant negative effect on their synaptic targeting. However, we did not observe any changes in the
subcellular distribution of GFP-Mint1 and GFP-CASK in the presence of
HA-NC3 (data not shown). Thus, we concluded that Mint1 and CASK are
likely to be targeted to synaptic sites independently of their
association with N-type Ca2+ channels.
 |
DISCUSSION |
Targeting of N-type Ca2+ channels to
synaptic locations in rat hippocampal neuronal cultures was
investigated in this study. The main conclusions of our paper are: (1)
that polarized distribution of N-type Ca2+
channels in neurons depends on the formation of synapses; (2) that the
C-terminal 163 aa (amino acids 2177-2339) of the long splice variant
of the N-type pore-forming subunit 1B
( 1B-1, CaV2.2a) is
necessary and sufficient for synaptic targeting of N-type
Ca2+ channels; (3) that PDZ and SH3
domain-binding motifs in the 1B C termini
constitute synergistic synaptic targeting signals; (4) that
somatodendritic and axonal/synaptic isoforms of N-type channels are
generated via alternative splicing of 1B C
termini; and (5) that it is likely that Mint1 and CASK adaptor proteins
play a role in N-type Ca2+ channel
synaptic targeting.
Structural determinants of N-type channel synaptic targeting in
hippocampal neurons
Polarized sorting of dendritic proteins in neurons appears to be
guided by intrinsic sorting signals (Craig and Banker, 1994 ; Burack et
al., 2000 ; Silverman et al., 2001 ). The mechanisms involved in
targeting of axonal proteins appear to be more diverse. Neuronal sorting of axonal protein neuron-glia cell adhesion molecule (NgCAM) (Burack et al., 2000 ), the synaptic vesicle components synapsin and
synaptophysin (Fletcher et al., 1991 ), and the presynaptic metabotropic
glutamate receptor 7 (mGluR7) (Stowell and Craig, 1999 ; Boudin
et al., 2000 ) has been investigated previously. It was concluded that
the axonal selection of NgCAM happens at the step downstream of
vesicular transport, either as a result of selective membrane fusion or
selective retention. The axonal sorting of mGluR7 happens by a
nonexclusion mechanism with the receptors present in both dendrites and
axons (Stowell and Craig, 1999 ). Targeting of synaptic vesicle proteins
appears to proceed as two-step process: initial axonal targeting based
on intrinsic sorting signals followed by clustering at presynaptic
sites that depend on cell contacts (Fletcher et al., 1991 ; Craig and
Banker, 1994 ). In our experiments with recombinant N-type
Ca2+ channels expressed in immature or
low-density hippocampal cultures, we observed uniform distribution of
channels in axonal and somatodendritic compartments (Figs. 1,
2D). Similar uniform distribution of native N-type
channels in immature hippocampal neurons was reported using immunostaining (Bahls et al., 1998 ) and functional (Pravettoni et al.,
2000 ) methods. In contrast, in mature, high-density cultures recombinant N-type Ca2+ channels (Fig.
2A-C,H,I) and mGluR7 (Boudin et al., 2000 )
were clustered in synapses and primarily excluded from soma and
dendrites. Contact-dependent clustering of endogenous N-type
Ca2+ channels (Bahls et al., 1998 ) and
synapsin (Fletcher et al., 1991 ) was described previously. From these
results it appears that the targeting of axonal (NgCAM) proteins is
guided by intrinsic sorting signals (Burack et al., 2000 ), but
polarized distribution of presynaptic proteins (mGluR7 and N-type
Ca2+ channels) depends on cell-to-cell
contact and synapse formation.
Human (Williams et al., 1992 ), chicken (Lu and Dunlap, 1999 ), and rat
(this study) 1B subunits undergo alternative
splicing in the C-terminal region. Our results suggest that in mature
high-density cultures, the long 1B-NC1 splice
variant ( 1B-1, CaV2.2a)
is the axonal/presynaptic isoform (Fig.
2A-C,H,I), and the short 1B-NC2 splice variant
( 1B-2, CaV2.2b) is the
somatodendritic isoform (Fig. 4B). Similar to the
1B subunit, the P/Q-type channel pore-forming
subunit 1A (CaV2.1) is
alternatively spliced at the C termini (Zhuchenko et al., 1997 ). The
long C-terminal splice variant of the 1A
subunit ( 1A-1, CaV2.1a),
but not the short splice variants, contains a similar PDZ
domain-binding motif (Maximov et al., 1999 ). We suggest that the N-type
and the P/Q-type Ca2+ channels are
targeted to synapses via interactions with a similar or identical set
of adaptor proteins. We also suggest that an alternative splicing of
the 1B and 1A subunit
C termini provides a potential regulatory mechanism of N-type and
P/Q-type Ca2+ channel sorting. In the case
of P/Q-type Ca2+ channels, association of
1A C terminal with an auxiliary
4 subunit (Walker et al., 1998 ) may play an
additional role in synaptic targeting (Wittemann et al., 2000 ). It is
also possible that truncation of SH3, PDZ, and
4 binding motifs in the
1A subunit (Fletcher et al., 1996 ) may lead to
mistargeting of P/Q-type Ca2+ channels in
the leaner mice, resulting in severe neurological phenotype.
A recent report suggested the importance of alternative splicing in the
1A subunit II/III loop region for P/Q-type
Ca2+ channel sorting between axonal and
somatodendritic compartments of GABAergic cortical neurons (Timmermann
et al., 2002 ). Novel II/III splice variants of human
1B subunit that lack the soluble SNARE-binding synprint site were identified recently (Kaneko et al., 2002 ). At the moment it is not clear whether alternative splicing
of the 1B and 1A
II/III loop and C-terminal regions are independent or correlated
events, and future studies will be needed to answer this question.
However, these data suggest that the alternative splicing-dependent
sorting of Ca2+ channels in neurons may be
a general phenomenon.
The role of modular adaptor proteins in synaptic targeting of
N-type channels
PDZ domain-containing proteins play an important role in protein
sorting in polarized cells (Yeaman et al., 1999 ) and in
synaptic organization (Fanning and Anderson, 1996 ; Kornau
et al., 1997 ; Craven and Bredt, 1998 ). The PKC-interacting
protein-1 (PICK1)-PDZ domain-binding motif in the mGluR7 C
terminal is essential for presynaptic clustering of mGluR7 (Boudin et
al., 2000 ). In the case of N-type Ca2+
channels, the synaptic targeting function of the PDZ domain-binding motif is synergistic with the function of the upstream SH3
domain-binding motif (Fig. 3C-F), most likely
because the corresponding PDZ and SH3 domain-containing adaptor
proteins form a complex with each other. Removal of both motifs or
expression of a dominant-negative GFP-NC3 construct containing both
motifs prevents clustering of recombinant N-type
Ca2+ channel (Fig. 3). The same GFP-NC3
construct exerts a dominant-negative effect on synaptic function (Fig.
5). Thus, in cases of both mGluR7 receptors and N-type
Ca2+ channels, C-terminal-mediated
interactions with PDZ domain adaptor proteins are involved in synaptic
clustering. Axonal sorting of NgCAM is not likely to use a similar
mechanism, because addition of GFP to the NgCAM C terminal did not
affect its targeting to axons (Burack et al., 2000 ).
What adaptor proteins are involved in N-type channel targeting? We
reported previously (Maximov et al., 1999 ) that there was specific
association of the 1B C-terminal region with
the first PDZ domain in the neuronal adaptor protein Mint1 and with the SH3 domain of the adaptor protein CASK. More recently, we have shown that 1B C termini also bind to INADL-5,
PAR6, and MUPP1-9 PDZ domains (Bezprozvanny and
Maximov, 2001 ). The proline-rich region of the
1B C terminal has been implicated recently in
interactions with the SH3 domain of RBP (Hibino et al., 2002 ). Thus, a
number of adaptor proteins may play a role in N-type
Ca2+ channel synaptic targeting. At
present, Mint1 and CASK are the best candidates for an important role
in N-type Ca2+ channel synaptic targeting.
Indeed, in Caenorhabditis elegans, the tripartite complex of
the Mint1 homolog lin-10 with adaptor proteins
lin-2 (CASK homolog) and lin-7 (veli homolog)
mediates targeting of the LET-23 receptor in polarized
epithelia (Rongo et al., 1998 ). Mint1/CASK/veli forms a homologous
complex in the brain (Borg et al., 1998 , 1999 ; Butz et al., 1998 ).
Direct association of Mint1 and CASK may explain the synergism in the
synaptic targeting function of the PDZ and SH3 domain-binding motifs in
the 1B C termini (Fig. 3). When expressed in
neurons, GFP-Mint1 and GFP-CASK clustered at synapses (Fig.
7B,D) and colocalized in presynaptic locations with
recombinant N-type Ca2+ channels (Fig.
7E,F). Recent analysis by electron microscopy reported the presence of endogenous Mint1 in presynaptic terminals (Okamoto et al., 2000 ). A potential role for Mint1 in targeting of the
NMDA receptor to postsynaptic density has also been suggested (Setou et al., 2000 ), and the Mint1-binding partner CASK has been found
on both sides of the synaptic cleft (Hsueh et al., 1998 ). Thus, it is
possible that the Mint1/CASK/veli complex or a similar complex is
involved in targeting of ion channels and receptors on both sides of
the synapse. A similar conclusion has been drawn regarding the PICK1
protein, implicated in mGluR7 clustering at presynaptic terminals
(Boudin et al., 2000 ), which is found at both sides of the synapse
(Torres et al., 1998 ; Xia et al., 1999 ). Future experiments, which will
likely use the knock-out mice approach, should help to dissect the role
played by Mint1, CASK, and other adaptor proteins in
Ca2+ channel targeting to the axonal
compartment and recruitment to synapses.
The model of N-type channel synaptic targeting in
hippocampal neurons
The main conclusions of our study can be summarized in the form of
a model (Fig. 8). We suggest that before
synaptogenesis, N-type Ca2+ channels
containing 1B-NC1
( 1B-1, CaV2.2a) subunit
are diffusely and uniformly distributed in both axonal and
somatodendritic compartments of immature neurons, whereas
1B-NC2 ( 1B-2,
CaV2.2b) subunits are only present in neuronal
soma and dendrites (Fig. 8, top). After synapse formation,
the channels formed by 1B-NC1 subunit are
concentrated at axons and clustered at synapses, and the channels formed by 1B-NC2 splice variant are restricted
to soma and dendrites (Fig. 8, bottom). Analogous
redistribution of native N-type Ca2+
channels during synaptogenesis in rat hippocampal neuronal cultures has
been suggested previously on the basis of immunolocalization (Bahls et
al., 1998 ) and functional (Pravettoni et al., 2000 ) experiments.
Clustering of N-type Ca2+ channels in
synaptic locations appears to be mediated by extrinsic regulatory cues,
which most likely involve neuronal adhesion molecules. The
Mint1/CASK/veli complex in the brain is associated with the neurexin-neuroligin synaptic junctional complex (Irie et al., 1997 ;
Nguyen and Sudhof, 1997 ; Butz et al., 1998 ; Song et al., 1999 ; Biederer
and Sudhof, 2000 ). Recent results suggest a primary role of
neurexin-neuroligin association in the induction of presynaptic differentiation (Rao et al., 2000 ; Scheiffele et al., 2000 ). The association of 1B-NC1 C termini with the
Mint1/CASK/veli-neurexin/neuroligin complex (Maximov et al., 1999 )
(Fig. 8, inset) provides a possible molecular mechanism for
N-type Ca2+ channel synaptic targeting
during synaptogenesis.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 8.
Model of N-type Ca2+ channel
synaptic targeting in neurons. N-type Ca2+ channels
formed by 1B-NC1 ( 1B-1,
CaV2.2a) (black) pore-forming subunit are
distributed diffusely and uniformly in immature neurons,
whereas 1B-NC2 ( 1B-2,
CaV2.2b) (white) is localized in the
somatodendritic domain (top). After synaptogenesis
(bottom), the 1B-NC1 subunits are
clustered at synapses, and the 1B-NC2 subunits remain
restricted to soma and dendrites. The association of
1B-NC1 C terminal with Mint1-PDZ1 and CASK-SH3 domains
(Maximov et al., 1999 ) (inset) links synaptic N-type
channels to neurexin-neuroligin neuronal adhesion complex (Irie et
al., 1997 ; Nguyen and Sudhof, 1997 ; Butz et al., 1998 ; Song et al.,
1999 ) and is likely to play a role in the synaptic clustering
of the channels.
|
|
 |
FOOTNOTES |
Received Feb. 21, 2002; revised May 17, 2002; accepted May 21, 2002.
This work was supported by the Robert A. Welch Foundation and by
National Institutes of Health Grant R01 NS39552 (I.B.). We are grateful
to Ege Kavalali, Marcus Missler, Thomas Biederer, Gary Banker, and
Thomas C. Südhof for helpful discussions, experimental advice,
and comments on this manuscript, and to Nan Wang and Phyllis Foley for
expert technical and administrative assistance. We thank R. W. Tsien for N-type Ca2+ channel clones, Thomas C. Südhof for Mint1, CASK, and pCMV-HA plasmids and synapsin and
PSD-95 antibodies, Boris Shtonda for the CD4-NC construct, Koki
Moriyoshi and Ann Marie Craig for mGFP construct, Nikolay Shcheynikov
for the help with oocyte expression, and Elena Nosyreva for assistance
with experiments.
Correspondence should be addressed to Dr. Ilya Bezprozvanny, Department
of Physiology, University of Texas Southwestern Medical Center at
Dallas, Dallas, TX 75390-9040. E-mail:
Ilya.Bezprozvanny{at}UTSouthwestern.edu.
 |
REFERENCES |
-
Bahls FH,
Lartius R,
Trudeau LE,
Doyle RT,
Fang Y,
Witcher D,
Campbell K,
Haydon PG
(1998)
Contact-dependent regulation of N-type calcium channel subunits during synaptogenesis.
J Neurobiol
35:198-208[Web of Science][Medline].
-
Bezprozvanny I,
Maximov A
(2001)
Classification of PDZ domains.
FEBS Lett
509:457-462[Web of Science][Medline].
-
Bezprozvanny I,
Scheller RH,
Tsien RW
(1995)
Functional impact of syntaxin on gating of N-type and Q-type calcium channels.
Nature
378:623-626[Medline].
-
Bichet D,
Cornet V,
Geib S,
Carlier E,
Volsen S,
Hoshi T,
Mori Y,
De Waard M
(2000)
The I-II loop of the Ca2+ channel
1 subunit contains an endoplasmic reticulum retention signal antagonized by the subunit.
Neuron
25:177-190[Web of Science][Medline]. -
Biederer T,
Sudhof TC
(2000)
Mints as adaptors. Direct binding to neurexins and recruitment of munc18.
J Biol Chem
275:39803-39806[Abstract/Free Full Text].
-
Boland LM,
Morrill JA,
Bean BP
(1994)
-Conotoxin block of N-type calcium channels in frog and rat sympathetic neurons.
J Neurosci
14:5011-5027[Abstract]. -
Borg JP,
Straight SW,
Kaech SM,
de Taddeo-Borg M,
Kroon DE,
Karnak D,
Turner RS,
Kim SK,
Margolis B
(1998)
Identification of an evolutionarily conserved heterotrimeric protein complex involved in protein targeting.
J Biol Chem
273:31633-31636[Abstract/Free Full Text].
-
Borg JP,
Lopez-Figueroa MO,
de Taddeo-Borg M,
Kroon DE,
Turner RS,
Watson SJ,
Margolis B
(1999)
Molecular analysis of the X11-mLin-2/CASK complex in brain.
J Neurosci
19:1307-1316[Abstract/Free Full Text].
-
Boudin H,
Doan A,
Xia J,
Shigemoto R,
Huganir R,
Worley P,
Craig AM
(2000)
Presynaptic clustering of mGluR7a requires the PICK1 PDZ domain binding site.
Neuron
28:485-497[Web of Science][Medline].
-
Burack MA,
Silverman MA,
Banker G
(2000)
The role of selective transport in neuronal protein sorting.
Neuron
26:465-472[Web of Science][Medline].
-
Butz S,
Okamoto M,
Sudhof TC
(1998)
A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain.
Cell
94:773-782[Web of Science][Medline].
-
Craig AM,
Banker G
(1994)
Neuronal polarity.
Annu Rev Neurosci
17:267-310[Web of Science][Medline].
-
Craven SE,
Bredt DS
(1998)
PDZ proteins organize synaptic signaling pathways.
Cell
93:495-498[Web of Science][Medline].
-
Crawley JN
Gerfen CR
McKay R
Rogawski MA
Sibley DR
Skolnick P
editors
(1997)
In: Current protocols in neuroscience. New York: Wiley
-
Dalgarno DC,
Botfield MC,
Rickles RJ
(1997)
SH3 domains and drug design: ligands, structure, and biological function.
Biopolymers
43:383-400[Web of Science][Medline].
-
Dubel SJ,
Starr TV,
Hell J,
Ahlijanian MK,
Enyeart JJ,
Catterall WA,
Snutch TP
(1992)
Molecular cloning of the
-1 subunit of an -conotoxin-sensitive calcium channel.
Proc Natl Acad Sci USA
89:5058-5062[Abstract/Free Full Text]. -
Dunlap K,
Luebke JI,
Turner TJ
(1995)
Exocytotic Ca2+ channels in mammalian central neurons.
Trends Neurosci
18:89-98[Web of Science][Medline].
-
Ellinor PT,
Zhang J-F,
Horne WA,
Tsien RW
(1994)
Structural determinants of the blockage of N-type calcium channels by a peptide neurotoxin.
Nature
372:272-275[Medline].
-
Ertel EA,
Campbell KP,
Harpold MM,
Hofmann F,
Mori Y,
Perez-Reyes E,
Schwartz A,
Snutch TP,
Tanabe T,
Birnbaumer L,
Tsien RW,
Catterall WA
(2000)
Nomenclature of voltage-gated calcium channels.
Neuron
25:533-535[Web of Science][Medline].
-
Fanning AS,
Anderson JM
(1996)
Protein-protein interactions: PDZ domain networks.
Curr Biol
6:1385-1388[Web of Science][Medline].
-
Fletcher CF,
Lutz CM,
O'Sullivan TN,
Shaughnessy Jr JD,
Hawkes R,
Frankel WN,
Copeland NG,
Jenkins NA
(1996)
Absence epilepsy in tottering mutant mice is associated with calcium channel defects.
Cell
87:607-617[Web of Science][Medline].
-
Fletcher TL,
Banker GA
(1989)
The establishment of polarity by hippocampal neurons: the relationship between the stage of a cell's development in situ and its subsequent development in culture.
Dev Biol
136:446-454[Web of Science][Medline].
-
Fletcher TL,
Cameron P,
De Camilli P,
Banker G
(1991)
The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture.
J Neurosci
11:1617-1626[Abstract].
-
Goslin K,
Asmussen H,
Banker G
(1998)
Rat hippocampal neurons in low density culture.
In: Culturing nerve cells (Banker G,
Goslin K,
eds), pp 339-370. Cambridge, MA: MIT.
-
Hata Y,
Butz S,
Sudhof TC
(1996)
CASK: a novel dlg/PSD95 homolog with an N-terminal calmodulin-dependent protein kinase domain identified by interaction with neurexins.
J Neurosci
16:2488-2494[Abstract/Free Full Text].
-
Hell JW,
Appleyard SM,
Yokoyama CT,
Warner C,
Catterall WA
(1994)
Differential phosphorylation of two size forms of the N-type calcium channel
1 subunit which have different COOH termini.
J Biol Chem
269:7390-7396[Abstract/Free Full Text]. -
Hibino H,
Pironkova R,
Onwumere O,
Vologodskaia M,
Hudspeth AJ,
Lesage F
(2002)
RIM binding proteins (RBPs) couple Rab3-interacting molecules (RIMs) to voltage-gated Ca2+ channels.
Neuron
34:411-423[Web of Science][Medline].
-
Higgins D,
Burack M,
Lein P,
Banker G
(1997)
Mechanisms of neuronal polarity.
Curr Opin Neurobiol
7:599-604[Web of Science][Medline].
-
Hsueh YP,
Yang FC,
Kharazia V,
Naisbitt S,
Cohen AR,
Weinberg RJ,
Sheng M
(1998)
Direct interaction of CASK/LIN-2 and syndecan heparan sulfate proteoglycan and their overlapping distribution in neuronal synapses.
J Cell Biol
142:139-151[Abstract/Free Full Text].
-
Hullin R,
Singer-Lahat D,
Freichel M,
Biel M,
Dascal N,
Hofmann F,
Flockerzi V
(1992)
Calcium channel
subunit heterogeneity: functional expression of cloned cDNA from heart, aorta, and brain.
EMBO J
11:885-890[Web of Science][Medline]. -
Irie M,
Hata Y,
Takeuchi M,
Ichtchenko K,
Toyoda A,
Hirao K,
Takai Y,
Rosahl TW,
Sudhof TC
(1997)
Binding of neuroligins to PSD-95.
Science
277:1511-1515[Abstract/Free Full Text].
-
Jones DH,
Matus AI
(1974)
Isolation of synaptic plasma membrane from brain by combined flotation-sedimentation density gradient centrifugation.
Biochim Biophys Acta
356:276-287[Medline].
-
Kaneko S,
Cooper CB,
Nishioka N,
Yamasaki H,
Suzuki A,
Jarvis SE,
Akaike A,
Satoh M,
Zamponi GW
(2002)
Identification and characterization of novel human Cav2.2 (
1B) calcium channel variants lacking the synaptic protein interaction site.
J Neurosci
22:82-92[Abstract/Free Full Text]. -
Kornau HC,
Seeburg PH,
Kennedy MB
(1997)
Interaction of ion channels and receptors with PDZ domain proteins.
Curr Opin Neurobiol
7:368-373[Web of Science][Medline].
-
Llinas R,
Steinberg IZ,
Walton K
(1981)
Relationship between presynaptic calcium current and postsynaptic potential in squid giant synapse.
Biophys J
33:323-351[Web of Science][Medline].
-
Lu Q,
Dunlap K
(1999)
Cloning and functional expression of novel N-type Ca2+ channel variants.
J Biol Chem
274:34566-34575[Abstract/Free Full Text].
-
Matteoli M,
Takei K,
Perin MS,
Sudhof TC,
De Camilli P
(1992)
Exo-endocytotic recycling of synaptic vesicles in developing processes of cultured hippocampal neurons.
J Cell Biol
117:849-861[Abstract/Free Full Text].
-
Maximov A,
Sudhof TC,
Bezprozvanny I
(1999)
Association of neuronal calcium channels with modular adaptor proteins.
J Biol Chem
274:24453-24456[Abstract/Free Full Text].
-
Mayer BJ
(2001)
SH3 domains: complexity in moderation.
J Cell Sci
114:1253-1263[Abstract].
-
McDonough SI,
Swartz KJ,
Mintz IM,
Boland LM,
Bean BP
(1996)
Inhibition of calcium channels in rat central and peripheral neurons by
-conotoxin MVIIC.
J Neurosci
16:2612-2623[Abstract/Free Full Text]. -
Mikami A,
Imoto K,
Tanabe T,
Niidome T,
Mori Y,
Takeshima H,
Narumiya S,
Numa S
(1989)
Primary structure and functional expression of the cardiac dihydropyridine-sensitive calcium channel.
Nature
340:230-233[Medline].
-
Mori Y,
Friedrich T,
Kim M-S,
Mikami A,
Nakai J,
Ruth P,
Bosse E,
Hofmann F,
Flockerzi V,
Furuichi T,
Mikoshiba K,
Imoto K,
Tanabe T,
Numa S
(1991)
Primary structure and functional expression from complementary DNA of a brain calcium channel.
Nature
350:398-402[Medline].
-
Moriyoshi K,
Richards L,
Akazawa C,
O'Leary DD,
Nakanishi S
(1996)
Labeling neural cells using adenoviral gene transfer of membrane-targeted GFP.
Neuron
16:255-260[Web of Science][Medline].
-
Nguyen T,
Sudhof TC
(1997)
Binding properties of neuroligin 1 and neurexin 1
reveal function as heterophilic cell adhesion molecules.
J Biol Chem
272:26032-26039[Abstract/Free Full Text]. -
Okamoto M,
Sudhof TC
(1997)
Mints, Munc18-interacting proteins in synaptic vesicle exocytosis.
J Biol Chem
272:31459-31464[Abstract/Free Full Text].
-
Okamoto M,
Matsuyama T,
Sugita M
(2000)
Ultrastructural localization of mint1 at synapses in mouse hippocampus.
Eur J Neurosci
12:3067-3072[Web of Science][Medline].
-
Pravettoni E,
Bacci A,
Coco S,
Forbicini P,
Matteoli M,
Verderio C
(2000)
Different localizations and functions of L-type and N-type calcium channels during development of hippocampal neurons.
Dev Biol
227:581-594[Web of Science][Medline].
-
Qin N,
Platano D,
Olcese R,
Stefani E,
Birnbaumer L
(1997)
Direct interaction of g
 with a C-terminal g -binding domain of the Ca2+ channel 1 subunit is responsible for channel inhibition by G protein-coupled receptors.
Proc Natl Acad Sci USA
94:8866-8871[Abstract/Free Full Text]. -
Rao A,
Harms KJ,
Craig AM
(2000)
Neuroligation: building synapses around the neurexin-neuroligin link.
Nat Neurosci
3:747-749[Web of Science][Medline].
-
Reuter H
(1995)
Measurements of exocytosis from single presynaptic nerve terminals reveal heterogeneous inhibition by Ca2+-channel blockers.
Neuron
14:773-779[Web of Science][Medline].
-
Rongo C,
Whitfield CW,
Rodal A,
Kim SK,
Kaplan JM
(1998)
LIN-10 is a shared component of the polarized protein localization pathways in neurons and epithelia.
Cell
94:751-759[Web of Science][Medline].
-
Scheiffele P,
Fan J,
Choih J,
Fetter R,
Serafini T
(2000)
Neuroligin expressed in nonneuronal cells triggers presynaptic development in contacting axons.
Cell
101:657-669[Web of Science][Medline].
-
Setou M,
Nakagawa T,
Seog DH,
Hirokawa N
(2000)
Kinesin superfamily motor protein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport.
Science
288:1796-1802[Abstract/Free Full Text].
-
Silverman MA,
Kaech S,
Jareb M,
Burack MA,
Vogt L,
Sonderegger P,
Banker G
(2001)
Sorting and directed transport of membrane proteins during development of hippocampal neurons in culture.
Proc Natl Acad Sci USA
98:7051-7057[Abstract/Free Full Text].
-
Song JY,
Ichtchenko K,
Sudhof TC,
Brose N
(1999)
Neuroligin 1 is a postsynaptic cell-adhesion molecule of excitatory synapses.
Proc Natl Acad Sci USA
96:1100-1105[Abstract/Free Full Text].
-
Stowell JN,
Craig AM
(1999)
Axon/dendrite targeting of metabotropic glutamate receptors by their cytoplasmic carboxy-terminal domains.
Neuron
22:525-536[Web of Science][Medline].
-
Takahashi T,
Momiyama A
(1993)
Different types of calcium channels mediate central synaptic transmission.
Nature
366:156-158[Medline].
-
Timmermann DB,
Westenbroek RE,
Schousboe A,
Catterall WA
(2002)
Distribution of high-voltage-activated calcium channels in cultured
-aminobutyric acidergic neurons from mouse cerebral cortex.
J Neurosci Res
67:48-61[Web of Science][Medline]. -
Torres R,
Firestein BL,
Dong H,
Staudinger J,
Olson EN,
Huganir RL,
Bredt DS,
Gale NW,
Yancopoulos GD
(1998)
PDZ proteins bind, cluster, and synaptically colocalize with Eph receptors and their ephrin ligands.
Neuron
21:1453-1463[Web of Science][Medline].
-
Tsien RW,
Ellinor PT,
Horne WA
(1991)
Molecular diversity of voltage-dependent Ca channels.
Trends Pharm Sci
12:349-354[Medline].
-
Walker D,
Bichet D,
Campbell KP,
De Waard M
(1998)
A
4 isoform-specific interaction site in the carboxyl-terminal region of the voltage-dependent Ca2+ channel 1A subunit.
J Biol Chem
273:2361-2367[Abstract/Free Full Text]. -
Wheeler DB,
Randall A,
Tsien RW
(1994)
Roles of N-type and Q-type Ca channels in supporting hippocampal synaptic transmission.
Science
264:107-111[Abstract/Free Full Text].
-
Williams ME,
Brust PF,
Feldman DH,
Patthi S,
Simerson S,
Maroufi A,
McCue AF,
Velicelebi G,
Ellis SB,
Harpold MM
(1992)
Structure and functional expression of an
-conotoxin-sensitive human N-type calcium channel.
Science
257:389-395[Abstract/Free Full Text]. -
Winckler B,
Mellman I
(1999)
Neuronal polarity: controlling the sorting and diffusion of membrane components.
Neuron
23:637-640[Web of Science][Medline].
-
Wittemann S,
Mark M,
Rettig J,
Herlitze S
(2000)
Synaptic localization and presynaptic function of calcium channel
4-subunits in cultured hippocampal neurons.
J Biol Chem
275:37807-37814[Abstract/Free Full Text]. -
Xia J,
Zhang X,
Staudinger J,
Huganir RL
(1999)
Clustering of AMPA receptors by the synaptic PDZ domain-containing protein PICK1.
Neuron
22:179-187[Web of Science][Medline].
-
Yeaman C,
Grindstaff KK,
Hansen MD,
Nelson WJ
(1999)
Cell polarity: versatile scaffolds keep things in place.
Curr Biol
9:R515-R517[Web of Science][Medline].
-
Zhuchenko O,
Bailey J,
Bonnen P,
Ashizawa T,
Stockton DW,
Amos C,
Dobyns WB,
Subramony SH,
Zoghbi HY,
Lee CC
(1997)
Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the
1A-voltage-dependent calcium channel.
Nat Genet
15:62-69[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22166939-14$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
J. C. Mitchell, B. B. Ariff, D. M. Yates, K.-F. Lau, M. S. Perkinton, B. Rogelj, J. D. Stephenson, C. C.J. Miller, and D. M. McLoughlin
X11{beta} rescues memory and long-term potentiation deficits in Alzheimer's disease APPswe Tg2576 mice
Hum. Mol. Genet.,
December 1, 2009;
18(23):
4492 - 4500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Di Biase, G. J. Obermair, Z. Szabo, C. Altier, J. Sanguesa, E. Bourinet, and B. E. Flucher
Stable Membrane Expression of Postsynaptic CaV1.2 Calcium Channel Clusters Is Independent of Interactions with AKAP79/150 and PDZ Proteins
J. Neurosci.,
December 17, 2008;
28(51):
13845 - 13855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Li and J. P. Horn
Differential Inhibition of Ca2+ Channels by {alpha}2-Adrenoceptors in Three Functional Subclasses of Rat Sympathetic Neurons
J Neurophysiol,
December 1, 2008;
100(6):
3055 - 3063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. M. Leenders, L. Lin, L.-D. Huang, C. Gerwin, P.-H. Lu, and Z.-H. Sheng
The Role of MAP1A Light Chain 2 in Synaptic Surface Retention of CaV2.2 Channels in Hippocampal Neurons
J. Neurosci.,
October 29, 2008;
28(44):
11333 - 11346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-W. Chao, C.-J. Hong, T.-N. Huang, Y.-L. Lin, and Y.-P. Hsueh
SUMOylation of the MAGUK protein CASK regulates dendritic spinogenesis
J. Cell Biol.,
October 23, 2008;
182(1):
141 - 155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Vacher, D. P. Mohapatra, and J. S. Trimmer
Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons
Physiol Rev,
October 1, 2008;
88(4):
1407 - 1447.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. A. K. J. S. Rajapaksha, D. Wang, J. N. Davies, L. Chen, G. W. Zamponi, and T. E. Fisher
Novel Splice Variants of Rat CaV2.1 That Lack Much of the Synaptic Protein Interaction Site Are Expressed in Neuroendocrine Cells
J. Biol. Chem.,
June 6, 2008;
283(23):
15997 - 16003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Xie, X. Li, J. Han, D. L. Vogt, S. Wittemann, M. D. Mark, and S. Herlitze
Facilitation versus depression in cultured hippocampal neurons determined by targeting of Ca2+ channel Cav{beta}4 versus Cav{beta}2 subunits to synaptic terminals
J. Cell Biol.,
July 24, 2007;
178(3):
489 - 502.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Altier, C. S. Dale, A. E. Kisilevsky, K. Chapman, A. J. Castiglioni, E. A. Matthews, R. M. Evans, A. H. Dickenson, D. Lipscombe, N. Vergnolle, et al.
Differential Role of N-Type Calcium Channel Splice Isoforms in Pain
J. Neurosci.,
June 13, 2007;
27(24):
6363 - 6373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Serulle, M. Sugimori, and R. R. Llinas
Imaging synaptosomal calcium concentration microdomains and vesicle fusion by using total internal reflection fluorescent microscopy
PNAS,
January 30, 2007;
104(5):
1697 - 1702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Dudanova, S. Sedej, M. Ahmad, H. Masius, V. Sargsyan, W. Zhang, D. Riedel, F. Angenstein, D. Schild, M. Rupnik, et al.
Important Contribution of {alpha}-Neurexins to Ca2+-Triggered Exocytosis of Secretory Granules
J. Neurosci.,
October 11, 2006;
26(41):
10599 - 10613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Castiglioni, J. Raingo, and D. Lipscombe
Alternative splicing in the C-terminus of CaV2.2 controls expression and gating of N-type calcium channels
J. Physiol.,
October 1, 2006;
576(1):
119 - 134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Diverse-Pierluissi
Assembly and Organization of Macromolecular Complexes
Sci. Signal.,
May 2, 2006;
2006(333):
tr4 - tr4.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Anitei, M. Ifrim, M.-A. Ewart, A. E. Cowan, J. H. Carson, R. Bansal, and S. E. Pfeiffer
A role for Sec8 in oligodendrocyte morphological differentiation
J. Cell Sci.,
March 1, 2006;
119(5):
807 - 818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Tombler, N. J. Cabanilla, P. Carman, N. Permaul, J. J. Hall, R. W. Richman, J. Lee, J. Rodriguez, D. P. Felsenfeld, R. F. Hennigan, et al.
G Protein-induced Trafficking of Voltage-dependent Calcium Channels
J. Biol. Chem.,
January 20, 2006;
281(3):
1827 - 1839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Zordan, M. Massironi, M. G. Ducato, G. te Kronnie, R. Costa, C. Reggiani, C. Chagneau, J.-R. Martin, and A. Megighian
Drosophila CAKI/CMG Protein, a Homolog of Human CASK, Is Essential for Regulation of Neurotransmitter Vesicle Release
J Neurophysiol,
August 1, 2005;
94(2):
1074 - 1083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. L. White, N. P. Franks, and R. Dickinson
Effects of isoflurane and xenon on Ba2+-currents mediated by N-type calcium channels
Br. J. Anaesth.,
June 1, 2005;
94(6):
784 - 790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhang, A. Maximov, Y. Fu, F. Xu, T.-S. Tang, T. Tkatch, D. J. Surmeier, and I. Bezprozvanny
Association of CaV1.3 L-Type Calcium Channels with Shank
J. Neurosci.,
February 2, 2005;
25(5):
1037 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Hu, H. Saegusa, Y. Hayashi, and T. Tanabe
The carboxy-terminal tail region of human Cav2.1 (P/Q-type) channel is not an essential determinant for its subcellular localization in cultured neurones
Genes Cells,
February 1, 2005;
10(2):
87 - 96.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Harkins, A. L. Cahill, J. F. Powers, A. S. Tischler, and A. P. Fox
Deletion of the synaptic protein interaction site of the N-type (CaV2.2) calcium channel inhibits secretion in mouse pheochromocytoma cells
PNAS,
October 19, 2004;
101(42):
15219 - 15224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T.-S. Tang and I. Bezprozvanny
Dopamine Receptor-mediated Ca2+ Signaling in Striatal Medium Spiny Neurons
J. Biol. Chem.,
October 1, 2004;
279(40):
42082 - 42094.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Spafford, J. van Minnen, P. Larsen, A. B. Smit, N. I. Syed, and G. W. Zamponi
Uncoupling of Calcium Channel {alpha}1 and {beta} Subunits in Developing Neurons
J. Biol. Chem.,
September 24, 2004;
279(39):
41157 - 41167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chaudhuri, S.-Y. Chang, C. D. DeMaria, R. S. Alvania, T. W. Soong, and D. T. Yue
Alternative Splicing as a Molecular Switch for Ca2+/Calmodulin-Dependent Facilitation of P/Q-Type Ca2+ Channels
J. Neurosci.,
July 14, 2004;
24(28):
6334 - 6342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Jurkat-Rott and F. Lehmann-Horn
The impact of splice isoforms on voltage-gated calcium channel {alpha}1 subunits
J. Physiol.,
February 1, 2004;
554(3):
609 - 619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Lesage, H. Hibino, and A. J. Hudspeth
Association of {beta}-catenin with the {alpha}-subunit of neuronal large-conductance Ca2+-activated K+ channels
PNAS,
January 13, 2004;
101(2):
671 - 675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Kawasaki, B. Zou, X. Xu, and R. W. Ordway
Active Zone Localization of Presynaptic Calcium Channels Encoded by the cacophony Locus of Drosophila
J. Neurosci.,
January 7, 2004;
24(1):
282 - 285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Millan, E. Castro, M. Torres, R. Shigemoto, and J. Sanchez-Prieto
Co-expression of Metabotropic Glutamate Receptor 7 and N-type Ca2+ Channels in Single Cerebrocortical Nerve Terminals of Adult Rats
J. Biol. Chem.,
June 20, 2003;
278(26):
23955 - 23962.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kitano, Y. Yamazaki, K. Kimura, T. Masukado, Y. Nakajima, and S. Nakanishi
Tamalin Is a Scaffold Protein That Interacts with Multiple Neuronal Proteins in Distinct Modes of Protein-Protein Association
J. Biol. Chem.,
April 18, 2003;
278(17):
14762 - 14768.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Weick, R. D. Groth, A. L. Isaksen, and P. G. Mermelstein
Interactions with PDZ Proteins Are Required for L-Type Calcium Channels to Activate cAMP Response Element-Binding Protein-Dependent Gene Expression
J. Neurosci.,
April 15, 2003;
23(8):
3446 - 3456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mochida, R. E. Westenbroek, C. T. Yokoyama, H. Zhong, S. J. Myers, T. Scheuer, K. Itoh, and W. A. Catterall
Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
PNAS,
March 4, 2003;
100(5):
2819 - 2824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Ho, W. Morishita, R. E. Hammer, R. C. Malenka, and T. C. Sudhof
A role for Mints in transmitter release: Mint 1 knockout mice exhibit impaired GABAergic synaptic transmission
PNAS,
February 4, 2003;
100(3):
1409 - 1414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Spafford, D. W. Munno, P. van Nierop, Z.-P. Feng, S. E. Jarvis, W. J. Gallin, A. B. Smit, G. W. Zamponi, and N. I. Syed
Calcium Channel Structural Determinants of Synaptic Transmission between Identified Invertebrate Neurons
J. Biol. Chem.,
January 31, 2003;
278(6):
4258 - 4267.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|