 |
Previous Article | Next Article 
The Journal of Neuroscience, August 15, 2002, 22(16):7055-7064
In Vivo Labeling of Parvalbumin-Positive
Interneurons and Analysis of Electrical Coupling in Identified
Neurons
Axel H.
Meyer1,
István
Katona1,
Maria
Blatow1,
Andrei
Rozov2, and
Hannah
Monyer1
1 Department of Clinical Neurobiology,
Interdisciplinary Center for Neurosciences, University of Heidelberg,
69120 Heidelberg, Germany, and 2 Department of Experimental
Neurophysiology, Faculty of Earth and Life Science, Vrije University
Amsterdam, De Boelelaan 1087 1081 HV Amsterdam, The Netherlands
 |
ABSTRACT |
GABAergic interneurons can pace the activity of
principal cells and are thus critically involved in the generation of
oscillatory and synchronous network activity. The specific role of
various GABAergic subpopulations, however, has remained elusive. This is in part attributable to the scarcity of certain GABAergic neurons and the difficulty of identifying them in slices obtained from brain
regions in which anatomical structures are not readily recognizable in
the live preparation. To facilitate the functional analysis of
GABAergic interneurons, we generated transgenic mice in which the
enhanced green fluorescent protein (EGFP) was specifically expressed in
parvalbumin-positive neurons. The high fidelity of expression obtained
using bacterial artificial chromosome transgenes resulted in
EGFP-labeled neurons in nearly all brain regions known to contain
parvalbumin-expressing neurons. Immunocytochemical analysis showed that
EGFP expression was primarily restricted to parvalbumin-positive cells.
In addition to cell body labeling, EGFP expression was high enough in
many neurons to enable the visualization of dendritic structures. With
the help of these mice, we investigated the presence of electrical
coupling between parvalbumin-positive cells in brain slices obtained
from young and adult animals. In dentate gyrus basket cells, electrical
coupling was found in slices from young [postnatal day 14 (P14)] and
adult (P28 and P42) animals, but both strength and incidence of
coupling decreased during development. However, electrical coupling
between parvalbumin-positive multipolar cells in layer II/III of the
neocortex remains unaltered during development. Yet another
developmental profile of electrical coupling was found between layer
II/III parvalbumin-positive cells and excitatory principal cells.
Between these neurons, electrical coupling was found at P14 but not at P28. The results indicate that the presence and strength of electrical coupling is developmentally regulated with respect to brain area and
cell type.
Key words:
interneuron; GABA; parvalbumin; gap junction; EGFP; BAC
 |
INTRODUCTION |
GABAergic interneurons in the
forebrain, although only a small part of the total neuronal population,
are of pivotal importance for the coordinated activity of large
neuronal ensembles. Single inhibitory neurons innervate hundreds of
principal neurons (Halasy et al., 1996 ) and thus are well suited to
synchronize cortical network activity (Galarreta et al., 1999 ; Gibson
et al., 1999 ) in different frequency bands (Cobb et al., 1995 ; Ylinen
et al., 1995 ; Tamas et al., 2000 ; Szabadics et al., 2001 ). In the
mammalian brain, large-scale synchronous and oscillatory activity in
the gamma (30-80 Hz) and fast (200 Hz) range have been identified by
electrophysiological studies (Singer and Gray, 1995 ; Ylinen et al.,
1995 ; Traub et al., 1998 ). It is thought that this oscillatory activity
plays an important role in cognition, memory formation, and other
higher nervous system functions (Gray et al., 1989 ; Miltner et al.,
1999 ; Rodriguez et al., 1999 ). Electrophysiological studies in
hippocampal (Whittington et al., 1995 ; Ylinen et al., 1995 ; Traub et
al., 1996 ; Hormuzdi et al., 2001 ) and neocortical (Galarreta et al.,
1999 ; Gibson et al., 1999 ; Beierlein et al., 2000 ; Tamas et al., 2000 ;
Deans et al., 2001 ) slices suggest that networks of GABAergic
interneurons, connected via chemical and/or electrical synapses, are
critically involved in the generation of these rhythmic activities.
GABAergic interneurons do not represent a homogeneous population but
can be divided into a number of different subtypes. Several criteria
have been used to characterize subpopulations of GABAergic neurons
(Freund and Buzsaki, 1996 ; Cauli et al., 1997 ; Kawaguchi and Kubota,
1997 ; Gupta et al., 2000 ; McBain and Fisahn, 2001 ), the presence of
specific calcium-binding proteins being just one of them.
Parvalbumin-positive neurons constitute an abundant subpopulation and
are found in a number of brain regions (Celio, 1990 ).
Electrophysiologically, they have been characterized as fast-firing
cells (Kawaguchi et al., 1987 ), and, in the hippocampus, most of them
belong to the group of perisomatic inhibitory neurons (Kosaka et al.,
1987 ; Freund and Buzsaki, 1996 ; Maccaferri et al., 2000 ). Recent
studies have shown that these cells form extensive reciprocal synaptic connections in different forebrain regions (Sik et al., 1995 ; Cobb et
al., 1997 ; Tamas et al., 2000 ). In addition, electrophysiological recordings from pairs of fast-spiking interneurons in the neocortex, hippocampus, striatum, and reticular thalamus have provided evidence for electrical coupling (Galarreta et al., 1999 ; Gibson et al., 1999 ;
Koos and Tepper, 1999 ; Venance et al., 2000 ; Landisman et al., 2002 ).
There is electron microscopical evidence that parvalbumin-positive GABAergic interneurons are coupled by gap junctions in the hippocampus (Katsumaru et al., 1988 ; Fukuda and Kosaka, 2000 ). However, it is not
clear whether gap junction-mediated electrical coupling is a signature
of all parvalbumin-positive neurons. Also, the developmental profile of
gap junction coupling in identified neurons has remained elusive.
Extensive functional studies of the parvalbumin-positive cell
population at the cellular and system level in different brain regions
are hampered by the difficulty of identifying these neurons in the
acute slice preparation. To facilitate the identification of
parvalbumin-positive cells, we took advantage of bacterial artificial
chromosome (BAC) technology, which mostly results in transgene
expression patterns closely resembling the wild-type genes (Yang et
al., 1997 ; Heintz, 2001 ). Thus, we introduced the in vivo
marker enhanced green fluorescent protein (EGFP) (Chalfie et al., 1994 )
into the parvalbumin gene carried on a BAC.
Using fluorescence microscopy and immunocytochemistry methods, we show
in two mouse lines that EGFP expression is specifically found in
parvalbumin-positive neurons. We also illustrate that the expression
level of EGFP is high enough to visualize neuronal processes over long
distances. Finally, we investigate in these mice the presence of
electrical coupling between pairs of parvalbumin-positive neurons in
slices obtained from young [postnatal day 14 (P14)] and adult (P28
and P42) brain.
 |
MATERIALS AND METHODS |
Screening of a mouse BAC library and selection of a
suitable BAC. A 392 bp probe encompassing 168 bp of intron 4 and
exon 5 of the mouse parvalbumin gene was generated by PCR using the following primers: Parv5'stop (CTCAGAGCCTCCATTCCCTC) and Parv3'polyA (AGGTGGTGTCCGATTGGTAC). This probe was used to screen the mouse 129SV
strain BAC library (Research Genetics, Inc., Huntsville, AL) spotted
onto high-density filters. Southern blot analysis of
SalI-digested BAC DNA separated by field inversion pulse gel electrophoresis (FIGE Mapper; Bio-Rad, Hercules, CA) was
performed with a 285 bp probe located in the parvalbumin gene promoter
region and generated by PCR with the primers mPvPro-1
(AGGTGTGCCCTGCTTGGACCTTA) and mPvPro-2 (CGGAGCCTATACAGAAAAGCT) to
determine the size of the 5'-flanking DNA. The amount of 3'-flanking
DNA was determined by Southern blot analysis of
HindIII-digested BAC DNA with the probe used to screen the
library. The size of the genomic inserts of the BAC clones was
determined by NotI digestion and pulse-field gel
electrophoresis (PFGE) analysis (CHEF-DRIII; Bio-Rad). Of five
BAC clones containing the parvalbumin gene, clone 450D23 was chosen for
subsequent EGFP insertion via bacterial homologous recombination. It
contained the largest genomic insert (~180 kb) with 50 kb upstream
and 15 kb downstream of the parvalbumin gene.
Introduction of the EGFP into the parvalbumin gene on the
BAC. The targeting cassette consisted of the EGFP coding sequence followed by a bovine growth hormone polyadenylation signal flanked by
two homologous stretches of genomic DNA located upstream
and downstream of the translational start. To obtain DNA sequence information for the generation of recombinogenic arms, the region around the translational start of the parvalbumin gene was sequenced with the following primers: mPvEx2-5'Seq (GCGGGCAGAGCAAGTGCGAA), mPvEx2-5'Seqb (GGAGGAGGTTGTTGGACTATC), and mPvEx2-3'Seq
(GCTGGTGAGCAATGCACCCC). Recombinogenic arms were generated by PCR
using the following primers: mPv5'RA-1
(GTCGACCAGGGCTCAGCTAAGGAA), mPv5'RA-2 (CTGCAACTGTTTGAGCGGGCAGAG), mPv3'RA-1 (GCCTTTGCTGGTGAGCAATGCAC), and mPv3'RA-2
(AAGAGATCACACAGCCGAGTGGGT). The amplified 5' recombinogenic arm
consisted of 1194 bp; the 3' recombinogenic arm was 612 bp.
The Pv5' recombinogenic arm was cloned into pIRES-EGFP (BD Bioscience
Clontech, Palo Alto, CA), partially digested with NcoI, and
filled in with Klenow enzyme to give rise to pIRES-EGFP-5'RA. The 3'
recombinogenic arm was inserted into the EcoRV site of
pBluescript II SK (Stratagene, La Jolla, CA) to generate pBS-3'RA.
pIRES-EGFP-5'RA was digested with XhoI, filled in with
Klenow enzyme, and digested again with BamHI to release a
fragment containing the 5' recombinogenic arm, the EGFP coding region,
and a bovine growth hormone polyadenylation signal. This fragment was
inserted into pBS-3'RA digested with BamHI and
SmaI to create pBS-Pv5'3'RA-EGFP. The final recombination cassette was released via SalI digestion and cloned into
SalI-digested pSV1recA to generate pSV1recA-PvCassette. The
method used for the integration of the PvCassette into the
translational start of the parvalbumin gene of BAC 450D23 has been
described previously (Yang et al., 1997 ).
Preparation of linearized BAC DNA for pronuclear injection.
BAC DNA was prepared by cesium chloride gradient centrifugation. After
centrifugation, DNA was taken off the gradient by cutting the top of
the tube and taking off the DNA with a 2-ml-wide bore plastic pipette
to avoid shearing of the DNA. To release the BAC insert, 50 µg of BAC
DNA were digested overnight with NotI at 37°C. A
CL4B-Sepharose (Amersham Biosciences, Amersham Place, UK) column was
equilibrated with 30 ml of injection buffer (in mM: 10 Tris-HCl, pH 7.5, 0.1 EDTA, and 100 NaCl)
and used to separate the released insert from the vector band. Aliquots
of the collected 0.5 ml fractions were run on a PFGE gel to select the
fractions used for pronuclear injection.
Generation of transgenic mice. Isolated BAC insert
was injected into the pronuclei of B6D2F2 mouse zygotes at
a concentration of 0.7 µg/ml. Founder animals were analyzed by PCR
for the presence and integrity of the integrated BAC using the
following primers: EGFP-1 (CCACTAGTGTGAGCAAGGGCGAGGAGCT), EGFP-2
(GGACTAGTGCCGAGAGTGATCCCGGCGGCGGT), BACL-1
(TAACTATGCGGCATCAGAGC), BACL-2 (GCCTGCAGGTCGACTCTAGAG), BACR-1
(GTGTCACCTAAATAGCTTGGCG), and BACR-2 (GGGGTTCGCGTTGGCCGATTC). In
the animal with multiple integrated copies, both vector
sequences were detected, indicating an intact integration of the BAC.
In the animal with a single integrated copy, one vector arm was
missing, indicating that the genomic insert of the modified BAC450D23
was not completely integrated into the genome. Copy numbers of the integrated transgene were determined via Southern blot after
HindIII digestion of genomic DNA and hybridization with a 5'
recombinogenic arm probe. Transgenic mice were bred with C57BL/6 mice.
Transmission of the transgene was monitored in the offspring either by
PCR using the primers BACL-1/BACL-2, BACR-1/BACR-2, and EGFP-1/EGFP-2 or by detecting EGFP fluorescence through the skin via ultraviolet illumination of the hindlimbs at a wavelength of 366 nm. In both lines,
inheritance of the transgene followed Mendelian ratios. In the line
with multiple integrated copies, the transgene was detected in 48.2%
(n = 205 animals) of the offspring, whereas in the line
with the single integrated copy, 46.4% (n = 114 animals) of the offspring carried the transgene. Transgenic animals of the F2 generation were used for the evaluation of
the EGFP expression pattern. Electrophysiological recordings were
obtained from transgenic animals of the F4 and
F5 generation. No changes in transgene expression pattern were observed between the different generations.
Immunocytochemical analysis of transgenic mice. Five
transgenic animals from each line were used to analyze EGFP expression and coexpression with parvalbumin. Animals were perfused with 4%
paraformaldehyde/PBS, pH 7.4, and 50-µm-thick coronal sections were
obtained from brain using a Leica (Nussloch, Germany) VT1000S vibratome. The sections were washed in PBS four times for 10 min at
room temperature, permeabilized by incubation in PBS plus 0.2% Triton
X-100 for 30 min at room temperature, and then incubated with a mouse
monoclonal parvalbumin antibody (Sigma-Aldrich, Inc., St. Louis, MO) at
a dilution of 1:2000 in PBS for 48 hr at 4°C. Incubated slices were
washed three times with PBS for 10 min at room temperature, incubated
for 2.5 hr at room temperature with a 1:400 dilution of a Texas
Red-conjugated anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA)
in PBS, and subsequently washed twice in PBS for 10 min at room
temperature. Slices were protected from light during the procedure.
Slices were then mounted on slides, embedded in Mowiol, coverslipped,
and analyzed using an upright fluorescent microscope (Zeiss Axioplan 2;
Zeiss, Göttingen, Germany) equipped with a Zeiss filter set 10 for detection of EGFP (excitation filter BP 450-490; dichroic mirror
FT 510; emission filter BP 515-565) and filter set 15 for detection of
Texas Red (excitation filter BP 546/12; dichroic mirror FT 580;
emission filter LP 590). The confocal image of dentate gyrus basket
cells was captured with a Leica (Heidelberg, Germany) TCS-SP2 using an
argon laser at 488 nm.
Electrophysiology. The preparation of brain slices from
young (P14) and adult (P28 and P42) mice was done as described for rats
by Markram et al. (1997) . P42 was the oldest age chosen for recordings,
because it is widely accepted that neuronal circuits are mature at this
age. Recordings were performed at room temperature, and slices were
continuously superfused with an extracellular solution containing (in
mM): 125 NaCl, 2.5 KCl, 25 glucose, 1.25 NaH2PO4, 2 CaCl2, and 1 MgCl2, bubbled
with 95% O2/5% CO2.
The pipette (intracellular) solution contained (in
mM): 105 potassium gluconate, 30 KCl, 10 HEPES, 10 phosphocreatinine, 4 ATP-Mg, and 0.3 GTP (adjusted to a pH of
7.3 with KOH).
For electrophysiological recordings, slices were placed in the
recording chamber under an upright microscope (Axioskop; Zeiss). Individual neurons were identified at 80× magnification using fluorescence microscopy and subsequent infrared-differential
interference contrast (IR-DIC) microscopy. Basket cells and multipolar
cells were readily identifiable by EGFP expression, morphology, and action potential firing pattern. No difference in average input resistance, spike width, and firing frequency was observed between EGFP-positive basket cells and multipolar cells and unlabeled basket
cells and multipolar cells from wild-type mice (data not shown).
Pyramidal cells were identified by morphology and action potential
firing pattern.
After we established the whole-cell mode, using patch pipettes with a
resistance of 4-8 M , hyperpolarizing current pulses were applied to
one of the potentially coupled neurons. Voltage responses recorded in
current-clamp mode from the other cell indicated electrical coupling
between these neurons. Recordings were done as described previously
(Venance et al., 2000 ), filtered at 3 kHz and digitized at 10 kHz,
using an ITC-18 interface (Instrutech, Mineola, NY) and the program
PULSE (version 8.21; Heka Elektronik, Lambrecht/Pfalz, Germany).
Electrically coupled cells were <100 µm apart both in the tangential
and in the vertical dimension. The coupling coefficient was calculated
as the ratio of the voltage response in cell 2 divided by the voltage
response in cell 1 under steady-state conditions. It was obtained by
averaging 15-30 consecutive sweeps and did not depend on which cell
from each pair was stimulated. The success rate of finding electrical
coupling was calculated as the percentage of electrically coupled pairs
out of the total number of pairs tested. Calculation of the statistical
significance of differences was performed using unpaired, two-tailed
Student's t test.
Biocytin filling. For morphological characterization of the
recorded EGFP-positive dentate gyrus basket cells and cortical layer
II/III fast-spiking multipolar cells, neurons were filled with biocytin
(1-4 mg/ml) dissolved in an internal pipette solution. Subsequently,
the slices were fixed overnight in 4% paraformaldehyde at 4°C. The
biocytin-filled cells were visualized using a Vectastain ABC Elite kit
(Vector Laboratories, Burlingame, CA). Slices were then mounted on
slides, embedded in Mowiol, coverslipped, and analyzed under a light
microscope (Axioplan 2; Zeiss).
 |
RESULTS |
Generation and expression analysis of EGFP in the transgenic
parvalbumin-EGFP mice
To express the in vivo marker EGFP under the control of
the parvalbumin gene promoter, we used BAC transgene technology. The parvalbumin gene consists of five exons spanning a region of ~15 kb
of genomic DNA (Schleef et al., 1992 ). The EGFP coding region was
inserted into the parvalbumin start codon located on exon 2 (Fig.
1A). Two founder
animals generated from pronuclear injection of the modified BAC clone,
one with a single and one with multiple integrated copies of the
transgene (Fig. 1B), were bred and further analyzed.
The distribution of parvalbumin-expressing cells in the brain is well
established (Kosaka et al., 1987 ; Celio, 1990 ). To assess the
distribution pattern of EGFP expression in the line with multiple
integrated copies, various brain regions known to contain
parvalbumin-positive neurons were analyzed by EGFP fluorescence.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1.
Generation of BAC transgenic animals with EGFP
expression in parvalbumin-positive neurons. A, Schematic
representation of the parvalbumin gene structure, the recombination
cassette, and the modified parvalbumin gene located on a BAC. Positions
of HindIII and NotI restriction sites are
indicated. The PCR fragment used as probe for the Southern blot is
indicated as a black bar.
B, Southern blot analysis of tail DNA isolated from
wild-type and transgenic mice and digested with HindIII
to compare signal intensities of the wild-type (6 kb) and transgene (7 kb) band. wt, Wild-type; sgl, line with a
single integrated copy of the transgene; mult, line with
multiple integrated copies of the transgene.
|
|
In the neoortex, parvalbumin-positive neurons are in layers II to VI.
EGFP-fluorescent cells could be seen accordingly throughout all
cortical layers except layer I (Fig.
2A). In the
hippocampus, parvalbumin-positive neurons are located in the stratum
oriens, stratum pyramidale, and occasionally in the stratum radiatum of the CA3 and CA1 subfields. Accordingly, the majority of
EGFP-fluorescent cells were found in the stratum pyramidale and oriens,
with single dispersed cells in the stratum radiatum and at the border
of the stratum radiatum and lacunosum-moleculare. In the dentate
gyrus, parvalbumin-positive cells are known to be located most
frequently at the border between the stratum granulosum and the hilar
region, where the EGFP-fluorescent cells were found (Fig.
2B). The reticular thalamic nucleus, where all
neurons have been described to contain parvalbumin, was visible as a
crescent-shaped band of brightly fluorescent cells (Fig.
2C). In the globus pallidus, a population of spatially
separated EGFP-fluorescent cells was found (Fig. 2D),
which corresponds well with the known distribution of
parvalbumin-positive neurons in this region. In the cerebellum,
parvalbumin expression is known to be present in Purkinje, stellate,
and basket cells, and accordingly, EGFP expression could be found in
all three cell types (Fig. 2E).

View larger version (109K):
[in this window]
[in a new window]
|
Figure 2.
EGFP expression in different brain regions of the
line with multiple integrated copies. A, In the
neocortex, fluorescent cells are visible throughout layers II to VI.
CX, Cortex; I, II,
III, IV, V, cortical
layers. B, In the dentate gyrus (DG),
fluorescent cells are visible at the border of the granule cell layer
and hilus (h). m, Stratum
moleculare; g, stratum granulosum. C, The
reticular thalamic nucleus (RT) is visible as a
bright band of fluorescent cells. D, Dispersed cells
express EGFP in the internal globus pallidus (GP).
E, In the cerebellum (CB), EGFP
fluorescence is detected in Purkinje (p),
stellate, and basket cells. g, Granule cell layer;
m, molecular layer. Scale bars: A, C, 100 µm; B, D, 50 µm; E, 20 µm.
|
|
Likewise, several other areas known to contain parvalbumin-positive
neurons were also analyzed and showed correct EGFP expression (the
striatum, nucleus accumbens, basolateral amygdala, zona incerta, substantia nigra, and anterior pretectal nucleus) (Table
1). Interestingly, the olfactory bulb,
where parvalbumin-positive neurons have been described in the external
plexiform layer (Celio, 1990 ), was the only brain region lacking EGFP
expression. Brain regions in which parvalbumin is not expressed (e.g.,
specific thalamic nuclei) were devoid of EGFP labeling. These results
demonstrate that the expression of EGFP is indeed restricted to brain
areas in which native parvalbumin expression occurs.
Given the very good correspondence between regional EGFP expression
patterns and patterns of parvalbumin expression described previously,
we also analyzed the fidelity of transgene expression at the cellular
level. Coexpression of parvalbumin and EGFP was evaluated by combining
the intrinsic green fluorescence of EGFP with red fluorescent
immunostaining for parvalbumin. An almost complete overlap of EGFP and
parvalbumin expression was found in most brain regions (Table 1). We
could not detect any parvalbumin-positive neurons that were EGFP
negative. Conversely, there were only few EGFP-positive neurons that
were parvalbumin negative. Thus, in the neocortex, EGFP was coexpressed
with parvalbumin in 94% of the EGFP-expressing cells
(n = 1418) (Fig.
3A,B). In the reticular thalamic nucleus, the coexpression analysis of EGFP and parvalbumin showed an almost complete overlap; 98% of the EGFP-positive cells were
parvalbumin positive (n = 50) (Fig. 3C,D).
In the internal globus pallidus, EGFP expression was also primarily
restricted to parvalbumin-positive cells, showing a 96% overlap
(n = 72) (Fig. 3E,F). In the
cerebellum, 92% of the EGFP-expressing cells were parvalbumin positive
(n = 129) (Fig. 3G,H). In the
hippocampus (Fig. 4A,B)
and amygdala, EGFP and parvalbumin colocalized to a lesser degree
(Table 1). However, in the mouse line with the single integrated copy
of the transgene, a complete overlap of EGFP and parvalbumin was found
in these brain regions as well (Fig. 4C,D; Table 1).

View larger version (123K):
[in this window]
[in a new window]
|
Figure 3.
EGFP and parvalbumin expression patterns strongly
overlap in several brain regions. Coexpression is determined in
50-µm-thick sections, which were immunocytochemically processed for
parvalbumin, by comparing EGFP fluorescence (A, C, E, G)
with parvalbumin antibody staining (B, D, F, H).
Representative examples are shown from the cortex (CX;
A, B), reticular thalamic nucleus (RT;
C, D), globus pallidus (GP; E,
F), and cerebellum (CB; G,
H). Scale bars: A-H, 20 µm.
|
|

View larger version (135K):
[in this window]
[in a new window]
|
Figure 4.
Comparison of the coexpression of EGFP and
parvalbumin in the CA1 region of the hippocampus in the two transgenic
mouse lines. Coexpression is determined as in Figure 3. Comparison of
EGFP fluorescence (A, C) with parvalbumin
immunocytochemistry (B, D) showed an incomplete overlap
in the mouse line with multiple integrated copies of the transgene
(A, B), whereas in the mouse line with a single
integrated copy of the transgene, a complete overlap was found
(C, D). Arrows, Representative examples
of EGFP and parvalbumin coexpression; arrowheads,
nonoverlapping expression of EGFP and parvalbumin. Scale bars:
A-D, 20 µm. CA1, CA1 subfield of the
hippocampus; o, stratum oriens; p,
stratum pyramidale; r, stratum radiatum.
|
|
In the line with multiple integrated copies of the transgene, EGFP
expression was high enough to visualize neuronal processes. Dentate gyrus basket cells have large cell bodies located at the border
of the granular layer and the hilar region, with a prominent apical
dendrite projecting into the granule cell layer. Apart from the cell
body, the apical dendrites projecting into the granule cell layer as
well as the basal dendrites of EGFP-labeled basket cells were readily
visible under a confocal microscope (Fig.
5A).

View larger version (46K):
[in this window]
[in a new window]
|
Figure 5.
Morphology of EGFP-expressing neurons in the line
with multiple integrated copies. A, The fluorescently
labeled dendrites of EGFP-positive dentate gyrus (DG)
basket cells located at the border of the granule cell layer and the
hilus (h) are clearly visible under a confocal
microscope. B, Light microscopic image of a
biocytin-filled, EGFP-positive dentate gyrus basket cell reveals the
typical morphology. C, Light microscopic image of a
biocytin-filled, EGFP-positive layer II multipolar cell. Scale bars:
A-C, 20 µm. m, Stratum moleculare;
g, stratum granulosum; Cx, cortex;
I, II, cortical layers.
|
|
Next, we investigated whether the expression of the transgene resembles
not only the regional but also the temporal expression pattern of
parvalbumin. Parvalbumin expression is first detected in several
neocortical regions at P10 in single neurons in layer V from which it
spreads to the other cortical regions and layers until P14 (Del Rio,
1994 ). In accordance with this study, we could detect the first visible
EGFP-expressing cells in layer V of the neocortex at P11. At P14, EGFP
expression is detectable throughout all cortical layers except layer I
(data not shown). These results indicate that the BAC harboring the
parvalbumin gene contained all necessary control elements that ensure
correct temporal and regional expression of the transgene.
Electrical coupling between identified labeled neurons
In the dentate gyrus, basket cells were easily identified by EGFP
fluorescence (Fig. 6A).
Recorded EGFP-positive cells exhibited high-frequency action potential
firing patterns (Kawaguchi et al., 1987 ; Koh et al., 1995 ). Recorded
cells, which were filled with biocytin, showed the typical morphology
and location of dentate gyrus basket cells (Figs. 5B,
6B). In slices obtained from P14 mice, the majority
of dentate gyrus basket cells was coupled via gap junctions, as has
been shown previously in juvenile rats (Venance et al., 2000 ).
Reciprocal electrical coupling was present in 12 of 13 pairs (92.3%)
of EGFP-positive, fast-spiking interneurons (Fig. 6C,E). The
voltage responses in the first basket cell in response to current
injection were reflected in the second basket cell and vice versa.
Action potentials elicited in one cell were reflected in the other cell
(Fig. 6D). Hyperpolarizing responses in pairs of
dentate gyrus basket cells were transmitted in a strongly attenuated
manner from one cell to the other [coupling coefficient, 0.029 ± 0.017 (mean ± SD; n = 12 pairs)]. On average,
the coupling coefficient did not depend on which of the two cells in a
pair was stimulated, indicating that electrical coupling was
symmetrical (data not shown). Both incidence and strength of electrical
coupling decrease with age. At P28, 5 of 10 tested basket cell pairs
(50%) were found to be coupled (Fig. 6E). The
coupling coefficient was 0.017 ± 0.016 (n = 5 pairs). A further reduction of both incidence and strength of coupling
was detected in P42 brain slices, in which we found that only 4 of 13 tested basket cell pairs (30.7%) were coupled with a coupling
coefficient of 0.012 ± 0.004 (n = 4 pairs). The
coupling coefficient was significantly reduced in P42 compared with P14
animals (p = 0.034).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 6.
Electrical coupling between pairs of dentate gyrus
(DG) basket cells in young (P14)
and adult (P28 and P42) mice.
A, IR-DIC (top) and fluorescence
microscopy image (bottom) of an EGFP-positive dentate
gyrus basket cell showing the typical morphology. B,
Light microscopic image of a biocytin-filled, EGFP-positive pair of
dentate gyrus basket cells. C, Firing patterns of basket
cells from a P14 and P42 brain that were electrically coupled. The
voltage response of cell 1 after current injection
|
|
In the neocortex, electrically coupled, fast-spiking multipolar cells
have been described in deep cortical layers (Galarreta et al., 1999 ;
Gibson et al., 1999 ). We extended our analysis to other layers and
investigated gap junction coupling between identified parvalbumin-positive, EGFP-positive, fast-spiking multipolar
cells in layer II/III. Biocytin filling of recorded fast-spiking
multipolar cells revealed the typical morphology of this cell type
(Figs. 5C, 7A).
Unlike in dentate gyrus basket cells, we found that in layer II/III
fast-spiking multipolar cells, the high degree of electrical coupling
observed in P14 brain slices is maintained in the adult brain at P28
and P42. Electrical coupling was detected in 9 of 10 pairs (90%) (Fig.
7B,C) in P14 brain slices. At P28, eight of eight pairs
(100%) were found to be coupled, and at P42, eight of nine pairs of
multipolar cells (89%) showed electrical coupling (Fig.
7B,C). Also, the strength of electrical coupling remains
unchanged between coupled pairs of layer II/III fast-spiking multipolar
cells during development. The coupling coefficient was 0.025 ± 0.018 (n = 9 pairs), 0.02 ± 0.014 (n = 8 pairs), and 0.034 ± 0.025 (n = 8 pairs) at P14, P28, and P42, respectively (Fig.
7C). The coupling coefficient was not significantly
different in P42 compared with P14 animals (p = 0.16).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 7.
Electrical coupling between layer II/III
neocortical neurons. A, Light microscopic image of a
biocytin-filled, EGFP-positive pair of layer II/III fast-spiking
multipolar cells. B, Firing patterns of layer II/III
fast-spiking multipolar cells from a P14 and P42 brain that were
electrically coupled. The voltage response of cell 1 after current
injection is also detectable in cell 2, although with a significantly
reduced amplitude. C, Two histograms showing the success
rate of finding electrical coupling in layer II/III fast-spiking
multipolar cells and the coupling coefficients found in these pairs at
P14 (white boxes), P28 (gray
boxes), and P42 (hatched boxes). Error bars
represent SD. Scale bar: A, 20 µm; Cx,
Cortex; I, II, cortical layers.
|
|
In the adult mouse hippocampus and neocortex, the major gap
junction-forming neuronal connexin, connexin 36 (Cx36), appears to be
preferentially expressed in GABAergic interneurons (Belluardo et al.,
2000 ). In situ hybridization studies, however, show a wider
distribution at earlier developmental stages (Belluardo et al., 2000 ).
Given the lack of developmental changes regarding electrical coupling
between fast-spiking multipolar cells in layer II/III, we subsequently
tested whether gap junction coupling between fast-spiking multipolar
cells and principal cells in layer II/III of the neocortex could be
found. Although not frequent, this type of connection was found in the
P14 brain in 5 of 57 tested pairs (8.7%) (Fig.
8A,B). The strength of
electrical coupling between these two cell types was weaker than the
connection between layer II/III fast-spiking multipolar cells (coupling
coefficient, 0.014 ± 0.009; n = 5 pairs) (Figs.
7C, 8B). This type of connection seems to
be absent from the adult brain already at P28, because we could not
detect electrical coupling between fast-spiking multipolar cells and
pyramidal cells in 50 tested pairs (Fig. 8B).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 8.
Electrical coupling between neocortical layer
II/III fast-spiking multipolar and pyramidal cells. A,
Firing patterns of a layer II/III fast-spiking multipolar cell and
principal cell. The voltage response of the pyramidal cell after
current injection is also detectable in the multipolar cell.
B, Two histograms showing the success rate of finding
electrical coupling in layer II/III fast-spiking multipolar cells and
the coupling coefficients found in these pairs at P14 (white
boxes) and P28 (gray boxes). Error bars
represent SD. C, Estimation of the gap-junctional
contribution to low-pass filtering. Voltage traces were fitted with a
monoexponential fit (gray curves), and the
normalized time constant ( norm) was calculated by
dividing 2 by 1.
|
|
Since we observed that gap junction coupling is differentially
regulated during development, we compared the basic
electrophysiological properties of the studied cells in P14 and P42
animals. No age-dependent difference in average input resistance and
firing frequency was found for EGFP-positive basket cells and
multipolar cells. In both cell types, the half-width of an action
potential became significantly shorter at later developmental stages
(Table 2). The fact that input resistance
does not change in basket cells from P14 to P42 strongly suggests that
the observed decrease in coupling coefficient is not attributable to
changes of membrane properties in these cells. However, functional
properties of gap junctions themselves could change with age and
thereby lead to a reduced conductance of electrical synapses and
consequently to a decrease in coupling coefficient. In addition to the
resistance of electrical synapses, a number of other factors contribute
to low-pass filtering, including voltage-gated channels, dendritic length constant, and dendritic arborization. Because the latter parameters can be considered to be the same in cells of the same type,
the contribution of the gap junctions can be estimated by calculating
the ratio of the time constants of the rising component of the voltage
responses measured in cell 1 and cell 2. These values can be compared
between ages to estimate possible changes in the functional properties
of the electrical synapse. The logic behind this analysis is the
following: the time constant of the rising component of the voltage
response in the receiving cell ( 2) depends on
membrane capacity (Cm), membrane resistance (Rm), and resistance of gap
junctions (Rg) and can be described as 2 = (Rm + Rg)(Cm), whereas tau of the response measured in the injected cell is
1 = (Rm)(Cm). The ratio
2/ 1 is 1 + (Rg/Rm).
Obviously, the ratio strongly depends on the resistance of electrical
synapses (Rg), especially because we showed that input resistance (Rm) does not change during development. Time constants were calculated by
fitting the voltage traces with a monoexponential fit (Fig. 8C). The ratios calculated for P14 and P42 dentate gyrus
basket cells were 2.52 ± 0.32 (mean ± SD; n = 5) and 2.62 ± 0.11 (n = 4; p = 0.69), respectively. These values were similar to ratios obtained for
layer II/III multipolar cells [2.79 ± 0.37 (n = 5) for P14 and 2.73 ± 0.38 (n = 5;
p = 0.8) for P42]. Thus, the conductance of gap
junctions does not change during development and does not differ
between different cell types. The reduction in the coupling coefficient
that we observed between dentate gyrus basket cells at later
developmental stages therefore most likely reflects a reduced
expression level of connexins rather than a functional modification of
electrical synapses themselves.
View this table:
[in this window]
[in a new window]
|
Table 2.
Comparison of basic electrophysiological parameters
obtained for dentate gyrus basket cells and layer II/III fast-spiking
multipolar cells at two developmental stages (P14 and P42)
|
|
 |
DISCUSSION |
We have demonstrated in this study how subsets of GABAergic
interneurons can be targeted and functionally analyzed by generating transgenic mice in which the marker EGFP is expressed under the control
of a cell type-defining gene carried on a BAC. We chose to label the
parvalbumin-positive neurons because functional studies had indicated
that this subpopulation of GABAergic interneurons may play an important
role in network synchrony (Tamas et al., 2000 ). Identification of
parvalbumin-positive neurons in the live slice or animal before
commencing electrophysiological or anatomical studies would be a
significant aid for the systematic study of this cell population at the
cellular and system level.
The EGFP expression pattern in the transgenic mice largely corresponds
to that of the defining parvalbumin gene because the BAC with its large
DNA insert contains the regulatory elements of the gene embedded in
their natural DNA environment. Therefore, untoward effects on EGFP
expression, such as ectopic and mosaic expression caused by chromosomal
sequences surrounding the insertion site of the transgene, are
minimized (Heintz, 2001 ). Attempts to specifically label neuronal
populations with GFP or its spectral variants by using short promoter
fragments have been reported previously (Feng et al., 2000 ; Oliva et
al., 2000 ). These attempts were either not successful in labeling the
complete set of targeted neurons or resulted in a strong line-to-line
variation of EGFP expression. The high specificity and reliability of
the EGFP expression pattern we found confirms the expectation that the
use of BACs allows the creation of an expression pattern closely
resembling that of the original gene (Yang et al., 1997 ; Zuo et al.,
1999 ; Heintz, 2000 ). Therefore, BAC transgenes are particularly well suited for labeling complete neuronal populations defined by the expression of certain marker genes. However, BAC transgenes do not
guarantee a perfect recapitulation of the expression pattern of the
cell type-defining gene, as evidenced by the lack of EGFP expression in
the olfactory bulb.
Remarkably, in our study, EGFP was expressed at high enough levels to
allow visualization of dendritic structures, without EGFP being fused
to dendritic marker proteins such as growth-associated protein-43
(Moriyoshi et al., 1996 ).
Using these mice as a tool, we analyzed electrical coupling of labeled
neurons in the dentate gyrus and neocortex. A number of recent studies
demonstrated electrical coupling between specific GABAergic interneuron
subtypes in the postnatal brain (Galarreta et al., 1999 ; Gibson et al.,
1999 ; Venance et al., 2000 ; Landisman et al., 2002 ). For technical
reasons, these studies, our own included, were preferentially performed
in brain slices from young animals, because the viability of cells in
slices obtained from adult animals is significantly reduced. Thus,
functional studies of specific cell types that are not readily found
are a difficult if not impossible enterprise in the adult. Because
parvalbumin-positive interneurons can easily and quickly be found in
acute slices of the transgenic mice that we generated, persistence and
strength of electrical coupling in the adult could be analyzed.
Electrical coupling is mediated by gap junctions (for review, see
Bennett, 1997 ); in GABAergic interneurons, gap junction channels are
primarily formed of Cx36, which is primarily a neuronal connexin
(Condorelli et al., 1998 ; Söhl et al., 1998 ). Its expression can
be detected as early as embryonic day 9.5, with a rise in the postnatal
brain until P7 and a subsequent decrease to adult levels (Söhl et
al., 1998 ; Gulisano et al., 2000 ). Nothing is known, however, about the
developmental regulation of Cx36 expression in parvalbumin-positive
neurons. It is not clear whether the overall decrease in Cx36 mRNA
expression as indicated by in situ hybridization x-ray film
autoradiography is also reflected at the cellular level in this
specific cell population. From studies on slices from Cx36 knock-out
mice, it could be inferred indirectly that electrical coupling persists
in adult GABAergic interneurons, because gamma oscillatory activity is
altered in slices from knock-out mice (Hormuzdi et al., 2001 ). However,
nothing is known about the developmental change regarding the degree
and incidence of coupling in parvalbumin-positive interneurons. The
transgenic mice with EGFP-labeled GABAergic interneurons enabled us to
address these questions. We chose to analyze the strength and incidence
of coupling between identified interneurons in slices obtained from
young (P14) and adult (P28 and P42) animals. By P42, the maturation of
the cortex can be considered completed even in the visual cortex, which
is known to mature later than other cortical structures (Gordon et al., 1996 ; Fagiolini et al., 2000 ).
Electrical coupling was first investigated in parvalbumin-positive
dentate gyrus basket cells. In these cells, electrical coupling
persists in the adult (P42), although both the incidence and the
strength of coupling are reduced compared with the young (P14) animals.
This is in contrast to the results obtained in a neocortical type of
parvalbumin-positive cell, the layer II/III fast-spiking multipolar
interneurons. In these cells, the incidence and strength of electrical
coupling are comparable in the young (P14) and adult (P42) animals. Of
note is that at P14, layer II/III multipolar interneurons are not
coupled only among themselves but also with pyramidal cells. Electrical
coupling between pyramidal and multipolar neurons, however, is absent
already at P28. Thus, in the three types of neuronal pairs studied
here, electrical coupling showed a cell type-specific change during
development: reduced coupling in pairs of basket cells, unaltered
coupling in pairs of multipolar cells, and disappearance of coupling in pairs of multipolar-pyramidal cells.
These results support the notion that cell type-specific electrical
coupling serves different functions in the young and adult brain.
During the first two postnatal weeks, the more widespread and higher
expression level of Cx36 mRNA (Söhl et al., 1998 ; Belluardo et
al., 2000 ; Hormuzdi et al., 2001 ) is also reflected in functional
studies: electrical coupling is found between pairs of various
GABAergic interneurons of the same type but also between pairs of cells
that are different, such as shown here in the case of multipolar
cell-pyramidal cell coupling. In a previous study, we identified the
presence of electrical coupling between two other different cell types:
the fusiform somatostatin-positive cell (a GABAergic interneuron) and
the spiny stellate cell (a glutamatergic neuron) in the somatosensory
cortex in the young brain (Venance et al., 2000 ). In the adult cortex
however, electrical coupling occurs preferentially between interneurons
of the same type. Similar developmental changes occur also in the
hippocampal CA3 region, in which Cx36 is present in pyramidal cells and
GABAergic interneurons in the young but can no longer be detected, at
least by in situ hybridization or single-cell PCR, in adult
pyramidal cells (Hormuzdi et al., 2001 ). More frequent and stronger
electrical coupling occurring in the young may be involved in the
generation of giant GABAergic potentials described in the hippocampus
(Ben-Ari et al., 1989 ; Strata et al., 1997 ). In addition, gap junctions have been shown to mediate the coactivation of small "neuronal domains" (Yuste et al., 1992 , 1995 ; Peinado et al., 1993 ; Kandler and
Katz, 1998 ) as well as cortical large-scale wavelike activity (Peinado,
2000 , 2001 ) during early postnatal development. However, in the adult,
electrical coupling of GABAergic interneurons, which is mediated to a
large extent, if not exclusively, through Cx36 forming gap junctions,
plays an important role in the generation of robust oscillatory
activity in the gamma-range frequencies (Hormuzdi et al., 2001 ).
In summary, we demonstrate in this study the generation of transgenic
mice with specific EGFP labeling of parvalbumin-positive cells. These
mice are a significant aid for the functional characterization of this
cell type in different brain regions in the young and adult animal,
electrical coupling being just one of the many features that warrant a
systematic approach.
 |
FOOTNOTES |
Received March 7, 2002; revised June 3, 2002; accepted June 7, 2002.
This work was supported in part by Novartis Pharma AG and the Schilling
Foundation (H.M.). I.K. was a recipient of a European Molecular Biology
Organization long-term fellowship. M.B. was supported by the Graduate
Program of Molecular and Cellular Neurobiology of the University of
Heidelberg. We thank X. W. Yang and N. Heintz for reagents for BAC
modification, P. H. Seeburg and W. Wisden for critical reading of
this manuscript, N. Shahani for help with confocal microscopy, and E. Fuchs and H. and H. Meyer for help with the mice.
Correspondence should be addressed to Dr. Hannah Monyer, Department of
Clinical Neurobiology, University Hospital for Neurology, Im
Neuenheimer Feld 364, Heidelberg, Germany. E-mail:
monyer{at}urz.uni-hd.de.
 |
REFERENCES |
-
Beierlein M,
Gibson JR,
Connors BW
(2000)
A network of electrically coupled interneurons drives synchronized inhibition in neocortex.
Nat Neurosci
3:904-910[Web of Science][Medline].
-
Belluardo N,
Mudo G,
Trovato-Salinaro A,
Le Gurun S,
Charollais A,
Serre-Beinier V,
Amato G,
Haeflinger JA,
Meda P,
Condorelli DF
(2000)
Expression of connexin36 in the adult and developing rat brain.
Brain Res
865:121-138[Web of Science][Medline].
-
Ben-Ari Y,
Cherubini E,
Corradetti R,
Gaiarsa JL
(1989)
Giant synaptic potentials in immature rat CA3 hippocampal neurones.
J Physiol (Lond)
416:303-325[Abstract/Free Full Text].
-
Bennett MV
(1997)
Gap junctions as electrical synapses.
J Neurocytol
26:349-366[Web of Science][Medline].
-
Cauli B,
Audinat E,
Lambolez B,
Angulo MC,
Ropert N,
Tsuzuki K,
Hestrin S,
Rossier J
(1997)
Molecular and physiological diversity of cortical nonpyramidal cells.
J Neurosci
17:3894-3906[Abstract/Free Full Text].
-
Celio M
(1990)
Calbindin D-28k and parvalbumin in the rat nervous system.
Neuroscience
35:375-475[Web of Science][Medline].
-
Chalfie M,
Tu Y,
Euskirchen G,
Ward WW,
Prasher DC
(1994)
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
-
Cobb SR,
Buhl EH,
Halasy K,
Paulsen O,
Somogyi P
(1995)
Synchronization of neuronal activity in hippocampus by individual GABAergic interneurons.
Nature
378:75-78[Medline].
-
Cobb SR,
Halasy K,
Vida I,
Nyiri G,
Tamas G,
Buhl EH,
Somogyi P
(1997)
Synaptic effects of identified interneurones innervating both interneurones and pyramidal cells in the rat hippocampus.
Neuroscience
79:629-648[Web of Science][Medline].
-
Condorelli DF,
Parenti R,
Spinella F,
Trovato-Salinaro A,
Belluardo N,
Cardile V,
Cicirata F
(1998)
Cloning of a new gap junction gene (Cx36) highly expressed in mammalian brain neurons.
Eur J Neurosci
10:1202-1208[Web of Science][Medline].
-
Deans MR,
Gibson JR,
Sellitto C,
Connors BW,
Paul DL
(2001)
Synchronous activity of inhibitory networks in neocortex requires electrical synapses containing connexin36.
Neuron
31:477-485[Web of Science][Medline].
-
Del Rio JA,
de Lecea L,
Ferre I,
Soriano E
(1994)
The development of parvalbumin-immunoreactivity in the neocortex of the mouse.
Brain Res Dev Brain Res
81:247-259[Medline].
-
Fagiolini M,
Hensch TK
(2000)
Inhibitory threshold for critical-period activation in primary visual cortex.
Nature
404:183-186[Medline].
-
Feng G,
Mellor RH,
Bernstein M,
Keller-Peck C,
Nguyen QT,
Wallace M,
Nerbonne JM,
Lichtman JW,
Sanes J
(2000)
Imaging neuronal subsets in transgenic mice expressing spectral variants of GFP.
Neuron
28:41-51[Web of Science][Medline].
-
Freund TF,
Buzsaki G
(1996)
Interneurons of the hippocampus.
Hippocampus
6:347-470[Web of Science][Medline].
-
Fukuda T,
Kosaka T
(2000)
Gap junctions linking the dendritic network of GABAergic interneurons in the hippocampus.
J Neurosci
20:1519-1528[Abstract/Free Full Text].
-
Galarreta M,
Hestrin S
(1999)
A network of fast-spiking cells in the neocortex connected by electrical synapses.
Nature
402:72-75[Medline].
-
Gibson JR,
Beierlein M,
Connors B
(1999)
Two networks of electrically coupled inhibitory neurons in neocortex.
Nature
402:75-79[Medline].
-
Gordon JA,
Stryker MP
(1996)
Experience-dependent plasticity of binocular responses in the primary visual cortex of the mouse.
J Neurosci
16:3274-3286[Abstract/Free Full Text].
-
Gray CM,
Singer W
(1989)
Stimulus-specific neuronal oscillations in orientation columns of cat visual cortex.
Proc Natl Acad Sci USA
86:1698-1702[Abstract/Free Full Text].
-
Gulisano M,
Parenti R,
Spinella F,
Cicirata F
(2000)
Cx36 is dynamically expressed during early development of mouse brain and nervous system.
NeuroReport
11:3823-3828[Web of Science][Medline].
-
Gupta A,
Wang Y,
Markram H
(2000)
Organizing principles for a diversity of GABAergic interneurons and synapses in the neocortex.
Science
287:273-278[Abstract/Free Full Text].
-
Halasy K,
Buhl EH,
Lorinczi Z,
Tamas G,
Somogyi P
(1996)
Synaptic target selectivity and input of GABAergic basket and bistratified interneurons in the CA1 area of the rat hippocampus.
Hippocampus
6:306-329[Web of Science][Medline].
-
Heintz N
(2000)
Analysis of mammalian central nervous system gene expression and function using bacterial artificial chromosome-mediated transgenesis.
Hum Mol Genet
9:143-147.
-
Heintz N
(2001)
BAC to the future: the use of transgenic mice for neuroscience research.
Nat Rev Neurosci
2:861-870[Web of Science][Medline].
-
Hormuzdi SG,
Pais I,
LeBeau FE,
Towers SK,
Rozov A,
Buhl EH,
Whittington MA,
Monyer H
(2001)
Impaired electrical signaling disrupts gamma frequency oscillations in connexin 36-deficient mice.
Neuron
31:487-495[Web of Science][Medline].
-
Kandler K,
Katz LC
(1998)
Coordination of neuronal activity in developing visual cortex by gap junction-mediated biochemical communication.
J Neurosci
18:1419-1427[Abstract/Free Full Text].
-
Katsumaru H,
Kosaka T,
Heizmann CW,
Hama K
(1988)
Gap junctions on GABAergic neurons containing the calcium-binding protein parvalbumin in the rat hippocampus (CA1 region).
Exp Brain Res
72:363-370[Web of Science][Medline].
-
Kawaguchi Y,
Kubota Y
(1997)
GABAergic cell subtypes and their synaptic connections in rat frontal cortex.
Cereb Cortex
7:476-486[Abstract/Free Full Text].
-
Kawaguchi Y,
Katsumaru H,
Kosaka T,
Heizmann CW,
Hama K
(1987)
Fast spiking cells in the rat hippocampus (CA1 region) contain the calcium-binding protein parvalbumin.
Brain Res
416:369-374[Web of Science][Medline].
-
Koh DS,
Geiger JR,
Jonas P,
Sakmann B
(1995)
Ca(2+)-permeable AMPA and NMDA receptor channels in basket cells of rat hippocampal dentate gyrus.
J Physiol (Lond)
485:383-402[Abstract/Free Full Text].
-
Koos T,
Tepper JM
(1999)
Inhibitory control of neostriatal projection neurons by GABAergic interneurons.
Nat Neurosci
2:467-472[Web of Science][Medline].
-
Kosaka T,
Katsumaru H,
Hama K,
Wu JY,
Heizmann CW
(1987)
GABAergic neurons containing the Ca2+-binding protein parvalbumin in the rat hippocampus and dentate gyrus.
Brain Res
419:119-130[Web of Science][Medline].
-
Landisman CE,
Long MA,
Beierlein M,
Deans MR,
Paul DL,
Connors BW
(2002)
Electrical synapses in the thalamic reticular nucleus.
J Neurosci
22:1002-1009[Abstract/Free Full Text].
-
Maccaferri G,
Roberts JD,
Szucs P,
Cottingham CA,
Somogyi P
(2000)
Cell surface domain specific postsynaptic currents evoked by identified GABAergic neurones in rat hippocampus in vitro.
J Physiol (Lond)
524:91-116[Abstract/Free Full Text].
-
Markram H,
Lübke J,
Frotscher M,
Sakman B
(1997)
Regulation of synaptic efficacy by coincidence of postsynaptic APs and EPSPs.
Science
275:213-215[Abstract/Free Full Text].
-
McBain CJ,
Fisahn A
(2001)
Interneurons unbound.
Nat Rev Neurosci
2:11-23[Web of Science][Medline].
-
Miltner WH,
Braun C,
Arnold M,
Witte H,
Taub E
(1999)
Coherence of gamma-band EEG activity as a basis for associative learning.
Nature
397:434-436[Medline].
-
Moriyoshi K,
Richards LJ,
Akazawa C,
O'Leary DD,
Nakanishi S
(1996)
Labeling neural cells using adenoviral gene transfer of membrane-targeted GFP.
Neuron
16:255-260[Web of Science][Medline].
-
Oliva Jr AA,
Jiang M,
Lam T,
Smith KL,
Swann JW
(2000)
Novel hippocampal interneuronal subtypes identified using transgenic mice that express green fluorescent protein in GABAergic interneurons.
J Neurosci
20:3354-3368[Abstract/Free Full Text].
-
Peinado A
(2000)
Traveling slow waves of neural activity: a novel form of network activity in developing neocortex.
J Neurosci
20:RC54[Abstract/Free Full Text]:1-6.
-
Peinado A
(2001)
Immature neocortical neurons exist as extensive syncitial networks linked by dendrodendritic electrical connections.
J Neurophysiol
85:620-629[Abstract/Free Full Text].
-
Peinado A,
Yuste R,
Katz LC
(1993)
Extensive dye coupling between rat neocortical neurons during the period of circuit formation.
Neuron
10:103-114[Web of Science][Medline].
-
Rodriguez E,
George N,
Lachaux JP,
Martinerie J,
Renault B,
Varela FJ
(1999)
Perception's shadow: long-distance synchronization of human brain activity.
Nature
397:430-433[Medline].
-
Schleef M,
Zühlke C,
Jokusch H,
Schöffl F
(1992)
The structure of the mouse parvalbumin gene.
Mamm Genome
3:217-225[Web of Science][Medline].
-
Sik A,
Penttonen M,
Ylinen A,
Buzsaki G
(1995)
Hippocampal CA1 interneurons: an in vivo intracellular labeling study.
J Neurosci
15:6651-6665[Abstract/Free Full Text].
-
Singer W,
Gray CM
(1995)
Visual feature integration and the temporal correlation hypothesis.
Annu Rev Neurosci
18:555-586[Web of Science][Medline].
-
Söhl G,
Degen J,
Teubner B,
Willecke K
(1998)
The murine gap junction gene connexin36 is highly expressed in mouse retina and regulated during brain development.
FEBS Lett
428:27-31[Web of Science][Medline].
-
Strata F,
Atzori M,
Molnar M,
Ugolini G,
Tempia F,
Cherubini E
(1997)
A pacemaker current in dye-coupled hilar interneurons contributes to the generation of giant GABAergic potentials in developing hippocampus.
J Neurosci
17:1435-1446[Abstract/Free Full Text].
-
Szabadics J,
Lorincz A,
Tamas G
(2001)
and frequency synchronization by dendritic GABAergic synapses and gap junctions in a network of cortical interneurons.
J Neurosci
21:5824-5831[Abstract/Free Full Text]. -
Tamas G,
Buhl EH,
Lorincz A,
Somogyi P
(2000)
Proximally targeted GABAergic synapses and gap junctions synchronize cortical interneurons.
Nat Neurosci
3:366-371[Web of Science][Medline].
-
Traub RD,
Whittington MA,
Stanford IM,
Jefferys JG
(1996)
A mechanism for generation of long-range synchronous fast oscillations in the cortex.
Nature
383:621-624[Medline].
-
Traub RD,
Spruston N,
Soltesz I,
Konnerth A,
Whittington MA,
Jefferys JGR
(1998)
Gamma-frequency oscillations: a neuronal population phenomenon, regulated by synaptic and intrinsic cellular processes, and inducing synaptic plasticity.
Prog Neurobiol
55:563-575[Web of Science][Medline].
-
Venance L,
Rozov A,
Blatow M,
Burnashev N,
Feldmeyer D,
Monyer H
(2000)
Connexin expression in electrically coupled postnatal rat brain neurons.
Proc Natl Acad Sci USA
97:10260-10265[Abstract/Free Full Text].
-
Whittington MA,
Traub RD,
Jefferys JGR
(1995)
Synchronized oscillations in interneuron networks driven by metabotropic glutamate receptor activation.
Nature
373:612-615[Medline].
-
Yang XW,
Model P,
Heintz N
(1997)
Homologous recombination based modification in Escherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome.
Nat Biotechnol
15:859-865[Web of Science][Medline].
-
Ylinen A,
Bragin A,
Nadasdy Z,
Jando G,
Szabo I,
Sik A,
Buzsaki G
(1995)
Sharp wave-associated high-frequency oscillation (200 Hz) in the intact hippocampus: network and intracellular mechanisms.
J Neurosci
15:30-46[Abstract].
-
Yuste R,
Peinado A,
Katz LC
(1992)
Neuronal domains in developing neocortex.
Science
257:665-669[Abstract/Free Full Text].
-
Yuste R,
Nelson DA,
Rubin WW,
Katz LC
(1995)
Neuronal domains in developing neocortex: mechanisms of coactivation.
Neuron
14:7-17[Web of Science][Medline].
-
Zuo J,
Treadaway J,
Buckner TW,
Fritzsch B
(1999)
Visualization of
9 acetylcholine receptor expression in hair cells of transgenic mice containing a modified bacterial artificial chromosome.
Proc Natl Acad Sci USA
96:14100-14105[Abstract/Free Full Text].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22167055-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
B.-h. Liu, P. Li, Y.-t. Li, Y. J. Sun, Y. Yanagawa, K. Obata, L. I. Zhang, and H. W. Tao
Visual Receptive Field Structure of Cortical Inhibitory Neurons Revealed by Two-Photon Imaging Guided Recording
J. Neurosci.,
August 26, 2009;
29(34):
10520 - 10532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. de Almeida, M. Idiart, and J. E. Lisman
A Second Function of Gamma Frequency Oscillations: An E%-Max Winner-Take-All Mechanism Selects Which Cells Fire
J. Neurosci.,
June 10, 2009;
29(23):
7497 - 7503.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Caputi, A. Rozov, M. Blatow, and H. Monyer
Two Calretinin-Positive GABAergic Cell Types in Layer 2/3 of the Mouse Neocortex Provide Different Forms of Inhibition
Cereb Cortex,
June 1, 2009;
19(6):
1345 - 1359.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Jasnow, K. J. Ressler, S. E. Hammack, J. P. Chhatwal, and D. G. Rainnie
Distinct Subtypes of Cholecystokinin (CCK)-Containing Interneurons of the Basolateral Amygdala Identified Using a CCK Promoter-Specific Lentivirus
J Neurophysiol,
March 1, 2009;
101(3):
1494 - 1506.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Doischer, J. Aurel Hosp, Y. Yanagawa, K. Obata, P. Jonas, I. Vida, and M. Bartos
Postnatal Differentiation of Basket Cells from Slow to Fast Signaling Devices
J. Neurosci.,
November 26, 2008;
28(48):
12956 - 12968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Uematsu, Y. Hirai, F. Karube, S. Ebihara, M. Kato, K. Abe, K. Obata, S. Yoshida, M. Hirabayashi, Y. Yanagawa, et al.
Quantitative Chemical Composition of Cortical GABAergic Neurons Revealed in Transgenic Venus-Expressing Rats
Cereb Cortex,
February 1, 2008;
18(2):
315 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Baude, C. Bleasdale, Y. Dalezios, P. Somogyi, and T. Klausberger
Immunoreactivity for the GABAA Receptor {alpha}1 Subunit, Somatostatin and Connexin36 Distinguishes Axoaxonic, Basket, and Bistratified Interneurons of the Rat Hippocampus
Cereb Cortex,
September 1, 2007;
17(9):
2094 - 2107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Wilson, D. A. Dombeck, M. Diaz-Rios, R. M. Harris-Warrick, and R. M. Brownstone
Two-Photon Calcium Imaging of Network Activity in XFP-Expressing Neurons in the Mouse
J Neurophysiol,
April 1, 2007;
97(4):
3118 - 3125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Devor, A. Trevelyan, and D. Kleinfeld
Is There a Common Origin to Surround-Inhibition as Seen Through Electrical Activity Versus Hemodynamic Changes? Focus on "Duration-Dependent Response in SI to Vibrotactile Stimulation in Squirrel Monkey"
J Neurophysiol,
March 1, 2007;
97(3):
1880 - 1882.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Woodruff and P. Sah
Networks of Parvalbumin-Positive Interneurons in the Basolateral Amygdala
J. Neurosci.,
January 17, 2007;
27(3):
553 - 563.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Zsiros, I. Aradi, and G. Maccaferri
Propagation of postsynaptic currents and potentials via gap junctions in GABAergic networks of the rat hippocampus
J. Physiol.,
January 15, 2007;
578(2):
527 - 544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. I. Verbny, F. Erdelyi, G. Szabo, and M. I. Banks
Properties of a Population of GABAergic Cells in Murine Auditory Cortex Weakly Excited by Thalamic Stimulation
J Neurophysiol,
December 1, 2006;
96(6):
3194 - 3208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Woodruff, H. Monyer, and P. Sah
GABAergic Excitation in the Basolateral Amygdala.
J. Neurosci.,
November 15, 2006;
26(46):
11881 - 11887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Gallopin, H. Geoffroy, J. Rossier, and B. Lambolez
Cortical Sources of CRF, NKB, and CCK and Their Effects on Pyramidal Cells in the Neocortex
Cereb Cortex,
October 1, 2006;
16(10):
1440 - 1452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Rossner, J. Hirrlinger, S. P. Wichert, C. Boehm, D. Newrzella, H. Hiemisch, G. Eisenhardt, C. Stuenkel, O. von Ahsen, and K.-A. Nave
Global Transcriptome Analysis of Genetically Identified Neurons in the Adult Cortex
J. Neurosci.,
September 27, 2006;
26(39):
9956 - 9966.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Freiman, A. Anton, H. Monyer, M. J. Urbanski, and B. Szabo
Analysis of the effects of cannabinoids on identified synaptic connections in the caudate-putamen by paired recordings in transgenic mice
J. Physiol.,
September 15, 2006;
575(3):
789 - 806.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ma, H. Hu, A. S. Berrebi, P. H. Mathers, and A. Agmon
Distinct subtypes of somatostatin-containing neocortical interneurons revealed in transgenic mice.
J. Neurosci.,
May 10, 2006;
26(19):
5069 - 5082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Zsiros and G. Maccaferri
Electrical Coupling between Interneurons with Different Excitable Properties in the Stratum Lacunosum-Moleculare of the Juvenile CA1 Rat Hippocampus
J. Neurosci.,
September 21, 2005;
25(38):
8686 - 8695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Long, S. J. Cruikshank, M. J. Jutras, and B. W. Connors
Abrupt Maturation of a Spike-Synchronizing Mechanism in Neocortex
J. Neurosci.,
August 10, 2005;
25(32):
7309 - 7316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Vandecasteele, J. Glowinski, and L. Venance
Electrical Synapses between Dopaminergic Neurons of the Substantia Nigra Pars Compacta
J. Neurosci.,
January 12, 2005;
25(2):
291 - 298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Collin, M. Chat, M. G. Lucas, H. Moreno, P. Racay, B. Schwaller, A. Marty, and I. Llano
Developmental Changes in Parvalbumin Regulate Presynaptic Ca2+ Signaling
J. Neurosci.,
January 5, 2005;
25(1):
96 - 107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wittner, L. Eross, S. Czirjak, P. Halasz, T. F. Freund, and Zs. Magloczky
Surviving CA1 pyramidal cells receive intact perisomatic inhibitory input in the human epileptic hippocampus
Brain,
January 1, 2005;
128(1):
138 - 152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. O. Mann, C. A. Radcliffe, and O. Paulsen
Hippocampal gamma-frequency oscillations: from interneurones to pyramidal cells, and back
J. Physiol.,
January 1, 2005;
562(1):
55 - 63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Blatow, A. Caputi, and H. Monyer
Molecular diversity of neocortical GABAergic interneurones
J. Physiol.,
January 1, 2005;
562(1):
99 - 105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Gloveli, T. Dugladze, S. Saha, H. Monyer, U. Heinemann, R. D. Traub, M. A. Whittington, and t. l. E. H. Buhl
Differential involvement of oriens/pyramidale interneurones in hippocampal network oscillations in vitro
J. Physiol.,
January 1, 2005;
562(1):
131 - 147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Henderson, A. Boros, G. Janzso, A. J. Westwood, H. Monyer, and K. Halasy
Somato-dendritic nicotinic receptor responses recorded in vitro from the medial septal diagonal band complex of the rodent
J. Physiol.,
January 1, 2005;
562(1):
165 - 182.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Bruzzone, S. G. Hormuzdi, M. T. Barbe, A. Herb, and H. Monyer
Pannexins, a family of gap junction proteins expressed in brain
PNAS,
November 11, 2003;
100(23):
13644 - 13649.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H Pawelzik, D I Hughes, and A M Thomson
Modulation of inhibitory autapses and synapses on rat CA1 interneurones by GABAa receptor ligands
J. Physiol.,
February 1, 2003;
546(3):
701 - 716.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Chu, M. Galarreta, and S. Hestrin
Synaptic Interactions of Late-Spiking Neocortical Neurons in Layer 1
J. Neurosci.,
January 1, 2003;
23(1):
96 - 102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bartos, I. Vida, M. Frotscher, A. Meyer, H. Monyer, J. R. P. Geiger, and P. Jonas
Fast synaptic inhibition promotes synchronized gamma oscillations in hippocampal interneuron networks
PNAS,
October 1, 2002;
99(20):
13222 - 13227.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|