 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 2002, 22(17):7380-7388
Lack of Neurodegeneration in Transgenic Mice Overexpressing
Mutant Amyloid Precursor Protein Is Associated with Increased Levels of
Transthyretin and the Activation of Cell Survival Pathways
Thor D.
Stein1 and
Jeffrey A.
Johnson1, 2, 3, 4
1 Neuroscience Training Program,
2 Environmental Toxicology Center, 3 School of
Pharmacy, and 4 Waisman Center, University of Wisconsin,
Madison, Wisconsin 53705
 |
ABSTRACT |
Tg2576 mice overexpress a mutant form of human amyloid precursor
protein with the Swedish mutation (APPSw), resulting
in high -amyloid (A ) levels in the brain. Despite this, amyloid
plaques do not develop until 12 months of age, and there is no neuronal loss in mice as old as 16 months. Gene expression profiles in the
hippocampus and cerebellum of 6-month-old APPSw mice were compared with age-matched controls. The expression of transthyretin, a
protein shown to sequester A and prevent amyloid fibril formation in vitro, and several genes in the insulin-signaling
pathway, e.g., insulin-like growth factor-2, were increased
selectively in the hippocampus of APPSw mice.
Concomitant activation of the insulin-like growth factor-1 receptor,
Akt, and extracellular signal-regulated protein kinase 1 and 2 as well
as increased phosphorylation of Bad also were unique to the hippocampus
of APPSw mice. In addition, the increased expression of
transthyretin and insulin-like growth factor-2 and the increased
phosphorylation of Bad in hippocampal neurons were maintained in
12-month-old APPSw mice when compared with age-matched
controls. These results suggest that the slow progression and lack of
full-fledged Alzheimer's disease pathology in the hippocampal neurons
of APPSw mice result from the genetic reprogramming of
neural cells to cope with increased levels of A .
Key words:
Alzheimer's disease; neuroprotection; insulin-like
growth factor; transthyretin; Tg2576; microarray
 |
INTRODUCTION |
Alzheimer's disease (AD) is the
most common cause of senile dementia. AD is associated with -amyloid
(A ) plaques, neurofibrillary tangles, and large-scale neuronal cell
loss. Multiple lines of evidence implicate A as the causative agent
in AD. For instance, familial AD is linked to mutations in the amyloid
precursor protein (APP), presenilin 1, and presenilin 2, all of which
lead to increased levels of A . In addition, transgenic mice
overexpressing the mutant genes linked to familial AD produce high
levels of A , exhibit some of the pathological features of AD, and
demonstrate behavioral and learning deficits later in life (Duff et
al., 1996 ; Hsiao et al., 1996 ; Holcomb et al., 1998 ). Both the density
of plaques and the cognitive changes can be reversed by vaccination against A (Janus et al., 2000 ; Morgan et al., 2000 ). Finally, A
leads to neuronal death in cell culture and in vivo (Yankner et al., 1990 ; Giovannelli et al., 1995 ; Calhoun et al., 1998 ). The
formation of extracellular plaques is common to all lines of transgenic
mice overexpressing high levels of mutant APP. However, in contrast to
the human disease, most lack neurofibrillary tangles (NFTs) and
demonstrate little or no neuronal cell loss (Duff et al., 1996 ; Hsiao
et al., 1996 ; Irizarry et al., 1997a ,b ; Holcomb et al., 1998 ). These
mice, therefore, may not be a good model of the complete pathologic
process of AD but rather may be an excellent model for understanding
how the brain can adapt to and survive high levels of A .
Tg(HuAPP695.K670N-M671L)2576 mice overexpressing APP with the Swedish
mutation (APPSw) have markedly increased A
levels beginning as early as 2 months of age, and extracellular plaques
begin to form in the cortex and hippocampus between 8 and 12 months
(Hsiao et al., 1996 ; Kawarabayashi et al., 2001 ). In addition,
8,12-iso-iPF2 -VI, a marker for lipid
peroxidation, is increased beginning at 7-8 months of age (Pratico et
al., 2001 ), and the levels of oxidized proteins are 12-fold higher
compared with nontransgenic animals (Lim et al., 2001 ). Despite the
well characterized toxicity of A as well as the evidence of
increased oxidative stress and other pathologies in
APPSw mice, there is no neuronal cell loss
(Irizarry et al., 1997a ). Therefore, we were interested in early gene
expression changes that might mediate neuroprotection in these mice. In
both humans and APPSw mice the hippocampus is
highly susceptible to A accumulation and plaque development, whereas
the cerebellum does not develop significant amyloid deposits (Irizarry
et al., 2001 ; Pratico et al., 2001 ). Thus the present study was
designed to determine gene expression profiles in the hippocampus and
cerebellum of 6-month-old APPSw mice compared
with age-matched controls and to identify potential mechanisms
responsible for protecting neurons from A toxicity.
 |
MATERIALS AND METHODS |
Animals. Tg2576 mice were created as described
previously (Hsiao et al., 1996 ). Briefly, they contain the human APP
695 with the double mutation K670N and M671L (Swedish mutation) and are driven by the prion protein promoter. In this study, transgenic and nontransgenic control mice were generated from C57B6/SJL N2 generation Tg2576 mice backcrossed to C57B6/SJL breeders. Mice were
killed at 6 and 12 months of age.
Oligonucleotide microarray. Male mice were killed with
CO2 and immediately perfused through the heart
with PBS. The hippocampus and cerebellum were dissected and
stored in liquid nitrogen. Total RNA was extracted with Trizol
(Invitrogen, Carlsbad, CA) after tissue homogenization. Double-stranded
cDNA was synthesized from the total RNA by using a Superscript choice
kit (Invitrogen) with a T7-dT24 primer
incorporating a T7 RNA polymerase promoter. The cRNA was prepared and
biotin-labeled by in vitro transcription (Enzo Biochem, New
York, NY). Labeled cRNA was fragmented by incubation at 94°C for 35 min in the presence of 40 mM Tris-acetate, pH
8.1, 100 mM potassium acetate, and 30 mM magnesium acetate. Then 15 µg of fragmented
cRNA was hybridized for 16 hr at 45°C to a MG-74Av2 array
(Affymetrix, Santa Clara, CA). After hybridization the gene chips were
washed automatically and stained with streptavidin-phycoerythrin by
using a fluidics station. Finally, probe arrays were scanned at 3 µm
resolution by using the Genechip System confocal scanner made for
Affymetrix by Aligent. Affymetrix Microarray Suite 4.1 was used to scan
and analyze the relative abundance of each gene from the average
difference of intensities (Lipshutz et al., 1999 ). Analysis parameters
used by the software were set to values corresponding to moderate
stringency (SDT = 30; SRT = 1.5). We scaled the data from
each array to normalize for comparisons. Output from the microarray
analysis was merged with the Unigene or GenBank descriptor. Each sample
was run on a single array, and the comparisons were crossed such that
each APPSw transgenic animal was compared with each control for a total of nine comparisons (3 × 3 matrix). The average difference change (ADC) is defined as the difference between the relative level of transcript expression in
APPSw mice versus nontransgenic control mice. The
definition of increase, decrease, or no change of expression for
individual genes was based on ranking the Difference Call (as
determined by the Affymetrix software) from three intergroup
comparisons (3 × 3), namely, No Change = 0, Marginal
Increase/Decrease = 1/ 1, Increase/Decrease = 2/ 2. The
final rank was calculated by summing up the individual ranks from each
comparison, and the value varied from 18 to 18. The cutoff value for
the final determination of Increase/Decrease was set as 9/ 9. Genes
for which the coefficient of variance was >1.0 were not included in
the final list, and changes of <1.5-fold also were eliminated. Using
this kind of data analysis with three replicates generated a
conservative list of genes with changed expression levels. RT-PCR of
selected genes confirmed the microarray results. Gene classification
was based on a literature review.
Reverse transcription-PCR. RNA was isolated from the
hippocampus of 6- and 12-month-old mice with Trizol (Invitrogen). RNA (1 µg) was reverse transcribed for 1 hr at 42°C by using an
oligo-dT15 primer from the Reverse Transcription
System (Promega, Madison, WI). The resulting cDNA was
amplified by PCR that used primer sets designed with PRIMER3
(available at www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) and
that used sequence data from the National Center for Biotechnology Information (Bethesda, MD) database. Primers (purchased from IDT, Coralville, IA) were designed for APPSw (5'
primer, ACTGGCTGAAGAAAGTGACAAT and 3' primer, AGAGGTGGTTCGAGTTCCTACA),
resulting in a PCR product of 310 base pairs (bp); transthyretin (5',
CCATACTCCTACAGCACCAC and 3', GCATCTACAGCCCTTCAG), resulting in a PCR
product of 488 bp; insulin-like growth factor-2 (5',
AACCCGAGAAGAAAGGAAG and 3', TCACACATAGAGCCAATAAGC), resulting in a PCR
product of 550 bp; and -actin (5', CCCAGAGCAAGAGAGGTATC and 3',
AGAGCATAGCCCTCGTAGAT), resulting in a PCR product of 340 bp.
Immunohistochemistry. Mice were killed with
CO2 and immediately perfused through the heart
with PBS. The right hemispheres were fixed in 4% paraformaldehyde
overnight, sunk in 30% sucrose, and frozen in OCT embedding medium.
Frozen sections with a width of 10 µm were taken through the
hippocampus and cerebellum. Insulin-like growth factor-2 (IGF-2) was
detected with a 1:200 dilution of the polyclonal antibody against IGF-2
(F-20; Santa Cruz Biotechnology, Santa Cruz, CA). Phospho-Akt (Thr308),
Akt, phospho-Erk1/2 (Thr202/Tyr204), Erk1/2, phospho-Bad (Ser112), and
Bad were detected with a 1:100 (phospho-Akt, Akt, phospho-Erk1/2, and
Erk1/2) or 1:1000 (phospho-Bad and Bad) dilution of the respective
polyclonal antibody (Cell Signaling, Beverly, MA). As a control,
preimmune rabbit IgG (Vector Laboratories, Burlingame, CA) was used in
place of the primary antibody. The Vectastain Elite ABC kit and 3, 3'-diaminobenzidine were used to visualize the antibody staining, and
selected sections with each antibody were counterstained with
hematoxylin (Vector Laboratories). The figures are representative of
the results obtained from three APPSw mice and
three nontransgenic controls.
Immunoprecipitation and Western immunoblot. Protein was
isolated with Trizol (Invitrogen) from the dissected hippocampus and cerebellum of three APPSw mice and three
nontransgenic controls. Immunoprecipitation was performed on 500 µg
of protein by using a 1:100 dilution of the phosphotyrosine monoclonal
antibody P-Tyr-100 (Cell Signaling). The precipitated protein then was
run on a gel and immunoblotted with a 1:200 dilution of 24-31, a
monoclonal antibody against IGF-1R (Chemicon, Temecula, CA).
Additional Western immunoblots were performed on 60 µg of protein by
using polyclonal antibodies against Bad and phospho-Bad (Ser112; Cell Signaling). Bands were visualized by using horseradish
peroxidase-conjugated secondary antibodies and SuperSignal West Pico
chemiluminescent substrate (Pierce, Rockford, IL).
 |
RESULTS |
Microarray
Initially, we determined the gene expression profiles of the
hippocampus and cerebellum from 6-month-old APPSw
mice (n = 3) compared with nontransgenic littermates
(n = 3), using oligonucleotide arrays containing 12,427 mouse genes and expressed sequence tags (ESTs). Decreased genes and ESTs totaled 41 in the hippocampus (Table
1) and two in the cerebellum (Table 2).
In the hippocampus 24 transcripts were increased in Tg2576 mice, four
of which were ESTs (Table 1). Two of these genes,
transthyretin and ectonucleotide pyrophosphatase/phosphodiesterase 2, also were increased in the cerebellum, where a total of seven genes had increased expression. However, the magnitude of the increase was reduced greatly in the
cerebellum (see Table 2).
Increased expression of transthyretin
The most dramatic change in gene expression was for the transcript
encoding for transthyretin (TTR), a thyroid hormone binding protein
abundant in serum (see Table 1). Transthyretin is the major A
binding protein in the CSF and inhibits A aggregation and fibril
formation in vitro (Schwarzman et al., 1994 ). In the APPSw mice TTR mRNA was increased 29.5-fold in
the hippocampus and 3.2-fold in the cerebellum. Immunohistochemistry
also revealed markedly increased levels of TTR protein throughout the
hippocampus with concentrations around the neurons of CA1-CA3 and the
dentate gyrus (DG) (Fig. 1).

View larger version (160K):
[in this window]
[in a new window]
|
Figure 1.
Immunohistochemistry for TTR in the hippocampus of
control and APPSw overexpressing mice. Sections from
nontransgenic mice (A, C, E) and APPSw mice
(B, D, F) were immunostained for TTR and
counterstained with hematoxylin. TTR is increased throughout the
hippocampus in APPSw mice (B)
compared with control mice, which contain little to no TTR
(A). TTR levels in APPSw mice are
largest around the neurons in CA1 (D) and
the dentate gyrus (F). There is virtually no
immunostaining for TTR in CA1 (C) and the dentate
gyrus (E) of nontransgenic mice. Scale bars: (in
B) A, B, 150 µm; (in
F) C-F, 10 µm.
|
|
Increased expression of genes involved in growth
factor pathways
Six genes with increased expression are growth factors or related
to growth factor pathways. These include insulin-like growth factor-2 (IGF-2), insulin-like growth factor binding protein
2 (IGFBP-2), adenylate cyclase-activating polypeptide
1, growth hormone receptor, and prolactin
receptor (see Table 1). Because IGF-2 expression was increased
dramatically in the hippocampus of APPSw mice
(see Table 1) and IGF-2 protein has been shown to protect cultured
neurons from A toxicity (Dore et al., 1997 ), we examined cell
survival pathways that may be activated by IGF-2. Immunohistochemistry
revealed a substantial increase of IGF-2 in the hippocampus (Fig.
2A-F), but not
in the cerebellum (Fig. 2G,H), of
APPSw overexpressing mice. A high level of IGF-2
was found throughout the hippocampus but mostly was localized around the pyramidal neurons within CA1-CA3 and the granule cells of the DG
(Fig. 2B,D,F).

View larger version (118K):
[in this window]
[in a new window]
|
Figure 2.
Immunohistochemistry for IGF-2 in
control and APPSw overexpressing mice. Sections from
nontransgenic mice (A, C, E, G) and APPSw
mice (B, D, F, H) were immunostained for IGF-2
and counterstained with hematoxylin. IGF-2 is increased
throughout the hippocampus in APPSw mice
(B) compared with control mice, which contain
little to no IGF-2 (A). IGF-2 levels in
APPSw mice are largest around the neurons in CA1
(D) and the dentate gyrus
(F). The arrows highlight examples
of IGF-2-positive neurons in APPSw mice. There is little
immunostaining for IGF-2 in CA1 (C) and the
dentate gyrus (E) of nontransgenic mice.
IGF-2 expression is unchanged in the cerebellum in which there is
little immunostaining in either nontransgenic mice
(G) or APPSw mice
(H). Scale bars: (in B)
A, B, 150 µm; (in H)
C-H, 10 µm.
|
|
Activated pathways downstream of IGF-2
The -subunit of the IGF-1 receptor (IGF-1R ) is tyrosine
phosphorylated with the binding of IGF-1, IGF-2, or insulin. Consistent with the increase of IGF-2 in APPSw mice, the
level of tyrosine-phosphorylated IGF-1R is increased in the
hippocampus when compared with control animals (Fig.
3A). Phosphatidyl inositol
3-kinase (PI3-K) is activated by receptor tyrosine kinases such as
IGF-1R and subsequently can activate the serine/threonine kinase
Akt. Akt protects cells from a variety of death-promoting insults,
including A toxicity (Martin et al., 2001 ). Akt is activated by
phosphorylation at threonine 308, and the neuronal fields in CA1-CA3
and in the DG expressed low levels of Thr308 phospho-Akt in control
animals (Fig. 3B,E). In contrast, the level of phospho-Akt
was increased markedly in these neurons in mice overexpressing
APPSw (Fig. 3C,F). When
activated, Akt translocates to the nucleus (Kawano et al., 2001 ), and,
in fact, much of the phospho-Akt was within the nucleus of hippocampal
neurons in APPSw mice (Fig. 3D,G).
Furthermore, Akt phosphorylates and inhibits glycogen synthase kinase-3
(GSK-3), an enzyme thought to contribute to tau hyperphosphorylation in AD, suggesting that, in APPSw mice, tau
phosphorylation may be inhibited through this pathway.

View larger version (130K):
[in this window]
[in a new window]
|
Figure 3.
Activation of the IGF-1 receptor, Akt, and Erk1/2
in the hippocampus of APPSw mice. A,
Immunoprecipitation for phosphorylated tyrosine and subsequent
immunoblotting for the -subunit of the insulin-like growth factor-1
receptor (IGF-1R ) revealed an increase in
tyrosine-phosphorylated IGF-1R in APPSw mice
(+APPSw) when compared with nontransgenic controls
( APPSw) in the hippocampus but not in the
cerebellum. B-G, Hippocampal neurons in CA1 stain
faintly or not at all for Akt phosphorylated at Thr308 in nontransgenic
control animals (B), but neurons in CA1 in
APPSw mice are phospho-Akt positive (C, D).
Hippocampal neurons in the dentate gyrus (DG) are faintly positive for
phospho-Akt in control mice (E), but this
staining is increased in the DG of APPSw mice (F,
G). A hematoxylin counterstain of C and
F reveals the laminar organization of the CA1 and DG
neurons and the nuclear localization of phospho-Akt within these
neurons in APPSw mice (D, G).
H-M, Hippocampal neurons in CA1
(H) or DG (K) in
control mice do not show significant staining for Erk1 phosphorylated
at Thr202 and Tyr204 or Erk2 phosphorylated at Thr183 and Tyr185.
However, APPSw mice do show positive staining for
phospho-Erk1/2 in CA1 (I, J) and DG (L,
M). A hematoxylin counterstain of I and
L reveals the laminar organization of the CA1 and DG
neurons and the nuclear localization of phopsho-Erk1/2 within these
neurons in APPSw mice (J, M). Scale
bars: J (for H-J), M (for B-G,
K, L), 10 µm.
|
|
Tyrosine receptor kinases, e.g., IGF-1, growth hormone (GH), and
prolactin receptors, can activate mitogen-activated protein kinase
(MAPK) by sequential activation of Ras, Raf, MEK, and the MAPK
extracellular signal-regulated protein kinase 1 and 2 (Erk1/2). Akt
also can activate Ras, leading to increased Erk1/2 activity. Erk1
activity is dependent on phosphorylation at threonine 202 and tyrosine
204, whereas Erk2 activity is induced by phosphorylation at
threonine 183 and tyrosine 185. A previous report demonstrated by
immunoblotting that APPSw mice have increased
phospho-Erk1/2 in the DG at 4 and 13 months of age (Dineley et al.,
2001 ). Consistent with this and with activation of IGF-1R (Fig.
3A), we show increased immunostaining for phospho-Erk1/2 in
the neurons in CA1 and DG of 6-month-old APPSw
mice (Fig. 3H-M). Similar to phospho-Akt, phospho-Erk1/2 is found predominantly in the nucleus of these neurons
(Fig. 3J,M) while being virtually undetectable in the hippocampus of control mice.
Interestingly, both activated Akt and Erk1/2 can lead to the
phosphorylation of the proapoptotic protein Bad (Datta et al., 1997 ;
Bonni et al., 1999 ). When phosphorylated at serine 112 or 136, Bad
binds to 14-3-3 proteins and releases the anti-apoptotic Bcl-2 family
members, Bcl-xl and Bcl-2. Immunohistochemistry for phospho-Bad shows a
dramatic increase in the neurons of CA1 and DG in 6-month-old
APPSw mice compared with nontransgenic controls (Fig. 4). Similar to the immunostaining
for IGF-2 and immunoprecipitation for activated IGF-1R ,
immunohistochemistry in the cerebellum for phospho-Akt, phospho-Erk1/2,
and phospho-Bad also showed no difference between nontransgenic and
APPSw mice (data not shown).

View larger version (146K):
[in this window]
[in a new window]
|
Figure 4.
The 6-month-old APPSw mice have
increased levels of phosphorylated Bad in hippocampal neurons.
Nontransgenic mice have low levels of Bad phosphorylated at Ser112 in
CA1 (A) and dentate gyrus
(C) neurons, but levels of phospho-Bad are
increased in CA1 (B) and the dentate gyrus
(D) of APPSw mice. Scale bars:
B (for A, B), D (for
C, D), 10 µm.
|
|
The microarray analysis indicated no change in the expression of Bad
(rank = 0), Akt1 (rank = 2), Akt2 (rank = 2), Erk1
(rank = 0), and Erk2 (rank = 0) (data not shown).
Immunohistochemistry in the hippocampus for Akt1, Akt2, and Akt3
demonstrated similar levels in both nontransgenic and
APPSw mice. Antibodies directed against total Bad
and Erk1/2 did not stain hippocampal neurons with any greater intensity
than preimmune rabbit IgG, implying that, under the conditions
described here, these antibodies were unable to recognize their
antigen. Alternatively, Western immunoblot for total Bad and Erk1/2
demonstrated specific bands in hippocampal extracts that were unchanged
in intensity between nontransgenic and APPSw mice
(data not shown).
Changes in TTR, IGF-2, and phospho-Bad before and after
plaque deposition
Levels of TTR and IGF-2 mRNA are increased in the hippocampus of
mice that express the human APPSw transcript
(Fig. 5). In agreement with our
microarray data, RT-PCR reveals a slight increase of TTR mRNA levels in
the cerebellum of two of three APPSw mice. There
is no consistent change in IGF-2 levels in the cerebellum, however
(Fig. 5A). In the hippocampus both TTR and IGF-2 have increased expression at 6 months of age (preplaque) (Fig.
5A) and 12 months of age (postplaque) (Fig. 5B).
Consistent with the increase in IGF-2 and with the activation of
downstream kinase pathways in 6-month-old APPSw
mice, 12-month-old APPSw mice also have increased
levels of phospho-Bad in the neurons of CA1 and the DG when compared
with nontransgenic littermates (Fig.
6).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5.
RT-PCR from the hippocampus and cerebellum
of APPSw and nontransgenic mice. A, The
6-month-old mice that contain and express the human APPSw
transgene (lanes 2, 4, 6) have increased levels
of transthyretin (TTR) and insulin-like growth factor-2
(IGF-2) in the hippocampus when compared with
nontransgenic littermates (lanes 1, 3, 5). In the
cerebellum the increase in TTR expression is reduced and the increase
in IGF-2 is eliminated when comparing APPSw mice
(lanes 2, 4, 6) with nontransgenic littermates
(lanes 1, 3, 5). B, At 12 months the
increased expression of TTR and IGF-2 in the hippocampus of
APPSw mice remains (lanes 2, 4) when
compared with nontransgenic controls (lanes 1, 3).
|
|

View larger version (158K):
[in this window]
[in a new window]
|
Figure 6.
The 12-month-old APPSw mice have
increased levels of phosphorylated Bad in hippocampal neurons.
Nontransgenic mice have low levels of Bad phosphorylated at Ser112 in
CA1 (A) and dentate gyrus
(C) neurons, but levels of phospho-Bad are
increased in CA1 (B) and the dentate gyrus
(D) of APPSw mice. Scale bar: (in
D) A-D, 10 µm.
|
|
 |
DISCUSSION |
We have shown that the expression of a number of protective genes
and a protective pathway culminating in Bad phosphorylation are
increased in mice that overexpress APPSw and have
no neuronal loss. Increased levels of IGF-2 mRNA and protein correspond
to increased activation of the IGF-1 receptor, activation of Akt and
Erk1/2, and phosphorylation of Bad in APPSw mice.
The increased expression of TTR and IGF-2 as well as increased
phospho-Bad staining in hippocampal neurons was consistent in both
preplaque (6 months) and postplaque (12 months) Tg2576 mice. Other
conditions, such as the presence of a human tau gene, may be necessary
for complete AD pathology. However, taken together, these data imply
that the lack of neurodegeneration in APPSw mice
is a result of the activation of known cell survival pathways
associated with the overexpression of APPSw.
Transthyretin has been shown to bind A and inhibit A aggregation
(Schwarzman et al., 1994 ). In human AD patients the concentration of
TTR is significantly lower than in age-matched controls (Serot et al.,
1997 ). This, in part, may contribute to the increased levels of A in
AD brains. In contrast, one reason why significant plaque deposition
does not occur until 12 months of age in the mice overexpressing
APPSw may be the dramatic increase of TTR.
Several growth factors and growth factor pathways that can culminate in
cell survival and the activation of Akt or Erk1/2 kinase pathways are
upregulated in APPSw mice. For example, pituitary adenylate cyclase-activating polypeptide (PACAP) has been shown to
stimulate neurite outgrowth, regulate neurotransmitter production, and
promote neuronal survival via the inhibition of caspase-3 activity
(Vaudry et al., 2000 ). Growth hormone receptor is expressed on multiple
cell types throughout the brain, and intraventricular injection of GH
has reduced neuronal loss in the frontoparietal cortex and hippocampus
after an ischemic brain injury (Scheepens et al., 2001 ). In cell lines,
GH has inhibited apoptosis induced by the withdrawal of survival
factors via the activation of the receptor-associated tyrosine kinase
Janus kinase 2 (JAK2), PI3-K, and the serine-threonine kinase Akt
(Costoya et al., 1999 ). Similarly, prolactin acts via its receptor to
activate JAK2 and PI3-K (Berlanga et al., 1997 ). IGF-2 has been shown
to protect against A toxicity in culture, and its protective action
is thought to be mediated via the activation of the IGF-1 receptor and
subsequent activation of Akt and MAPK (Webster et al., 1994 ; Dore et
al., 1997 ; Zheng et al., 2000 ). IGF-2 receptors also are abundant on
the hippocampal neurons of CA1-CA3 and the DG and may be important in
regulating acetylcholine release in these regions (Kar et al., 1997 ).
In addition, IGF-2 and IGFBP-2 are expressed coordinately in many tissues (Logan et al., 1994 ) and in response to brain injury (Beilharz et al., 1998 ). IGFBP-2 has been suggested to prolong the biological activity and to be a key transport protein for IGF-2. Our data indicate
that the principal components of multiple signal transduction cascades
known to promote cell survival are increased selectively in the
hippocampus of APPSw mice, suggesting that the
cell death signals associated with A -induced neurodegeneration can
be balanced successfully by increasing those that are advancing cell life.
Interestingly, some of the decreased genes have been well characterized
and appear to contribute to apoptosis. For example, protein
tyrosine phosphatase, nonreceptor-type substrate 1 (SHPS-1), is
decreased by 2.9-fold in the hippocampus and has been shown to regulate
growth factor pathways negatively. In glioblastoma cells the human
homolog of SHPS-1, SIRP , inhibits epidermal growth factor-induced
activation of PI3-K and leads to reduced transformation and migration
and enhanced apoptosis (Wu et al., 2000 ). Two other decreased genes,
c-fos and mitogen-activated protein kinase kinase kinase 4 (MEKK4b), also are involved in apoptosis. In addition to
playing a role in cell growth and development, c-fos has
been shown to mediate apoptosis in response to growth factor
deprivation and cell injury (Estus et al., 1994 ; Preston et al., 1996 ;
Hafezi et al., 1997 ). In AD c-Fos and c-Jun are increased within
neurons of the hippocampus where significant apoptosis occurs, but not in the cerebellum where there is no increase in apoptotic cells (Marcus
et al., 1998 ). In a separate pathway, MEKK4b activates the c-Jun
NH2-terminal kinase cascade that is thought to
contribute to apoptosis and neurodegeneration (Gerwins et al., 1997 ).
Thus in combination with the increased genes and survival pathways discussed above, the decreased expression of these genes also may help
to prevent the activation of apoptotic pathways by A in the
APPSw mice.
Two recent publications have suggested an association between folate
and AD. An increased level of homocysteine, which can result from
folate deficiency, is a strong risk factor for the development of
Alzheimer's disease (Seshadri et al., 2002 ). In addition, a
folate-deficient diet in a transgenic mouse model overexpressing
APPSw results in neurodegeneration in the CA3
region of the hippocampus, and in hippocampal cultures homocysteine
augmented A -induced neuronal death (Kruman et al., 2002 ). Folate
binding protein 1 is increased in the hippocampus of
APPSw mice (see Table 1) and acts as a receptor
to mediate the delivery of 5-methyltetrahydrofolate to the interior of
cells. Based on the findings discussed above, the almost fourfold
increase in folate binding protein may prevent the accumulation of
homocysteine in the hippocampus and help to prevent A -induced neurodegeneration.
In addition to the potentially protective gene expression changes
discussed above, the aging gene, klotho, was increased more than sixfold in the hippocampus of APPSw mice
(see Table 1). Mice containing a knock-out of the gene
klotho develop several age-related disorders and die
prematurely. Abnormalities in the mutant klotho mice include
growth retardation, arteriosclerosis, and atrophy of the growth
hormone-producing cells in the pituitary gland (Kuro-o et al., 1997 ).
Many of these disorders may contribute to and/or be augmented by
A -induced pathology. Systemic administration of the
klotho gene reversed the pathology in the mutant
klotho mice (Shiraki-Iida et al., 2000 ). Thus, in
APPSw mice increased klotho may help
to protect against high A levels.
Despite the lack of NFTs and neuron loss, A levels are high in
APPSw mice, and some cognitive deficits have been
documented. Behavioral testing reveals spatial learning and memory
deficits beginning at 9 months of age (Hsiao et al., 1996 ). Our
microarray analysis shows expression changes in some genes that may
mediate part of this cognitive decline. Specifically, chloride
channel protein 3 (CLCN3) was decreased in the hippocampus of
APPSw mice (see Table 1). CLCN3 is expressed on
the synaptic vesicles of hippocampal neurons, and its disruption in
mice results in severe degeneration of the hippocampus and consequent
memory impairments (Stobrawa et al., 2001 ). Numerous other genes
encoding for proteins involved in the cell cycle, transcription
regulation, DNA replication, tissue remodeling, and cell-to-cell
communication were changed selectively in the hippocampus of
APPSw mice (see Table 1). The contribution of
these genes to the limited pathology or to the delayed plaque
deposition and lack of neuronal loss in the APPSw mice requires further investigation.
Many of the neuroprotective genes and signaling pathways described here
have not been characterized fully in the human disease, and it is not
clear what role they have in AD. We speculate that the surviving
neurons without tau pathology (phospho-tau-negative neurons) would have
neuroprotective gene expression changes, Akt and Erk1/2 activation, and
Bad phosphorylation. In contrast, dying neurons (phospho-tau-positive
neurons) would not show these changes because of an apoptosis-induced
shutdown of these protective pathways. In support of this hypothesis, a
recent publication found that phospho-Erk1/2 is increased in a
subpopulation of neurons with little or no phospho-tau staining,
whereas Erk1/2 was unchanged in neurons with dense NFTs or DNA
fragmentation (Ferrer et al., 2001 ). In addition, preliminary data show
a lack of increased Bad phosphorylation in the hippocampal neurons of
human AD patients (T. D. Stein and J. A. Johnson, unpublished
observations). A diagram proposing how these pathways could interact to
confer protection is shown in Figure
7.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 7.
Hypothetical schema showing integration of
neuroprotective Akt and Erk1/2 pathways in APPSw mice. All
differentially expressed genes or proteins (grayed
text) that have been shown previously to have a role in the
inhibition or activation of apoptosis or are involved in A
sequestration are shown. Also indicated is the increased ( ) or
decreased ( ) gene expression or protein activation in
APPSw mice. Between proteins the black
arrows represent the activation of one protein by another, and
the bars represent inhibition. AC,
Adenylate cyclase; GHR, growth hormone receptor;
IRS-1, insulin receptor substrate 1;
MKK4, MAPK kinase 4; NFT, neurofibrillary
tangles; p-IGF-1R , tyrosine-phosphorylated IGF-1
receptor ; p90RSK, 90 kDa ribosomal S6 kinases;
PAC1R, type I PACAP receptor;
PKA, protein kinase A; PRLR, prolactin
receptor.
|
|
The changes in gene expression in the APPSw
overexpressing mice may be induced by APP or its metabolites such as
A . Expression levels of the APPSw transgene
were similar in the hippocampus and cerebellum (Fig. 5A).
However, gene expression changes were markedly different between these
two tissues, suggesting that it may be a cleavage product of
APPSw and not the APPSw
transgene itself that drives these changes. In fact, cleavage of APP by -secretase generates a secreted form of APP, which is
neuroprotective in cultured hippocampal neurons (Mattson et al., 1993 ).
Furthermore, secreted APP has been shown to activate Erk1/2 in PC-12
cells in a Ras-dependent manner (Greenberg et al., 1994 ), and
phosphorylated Erk1/2, in turn, is important in growth factor-induced
secretion of -secretase-cleaved APP (Mills et al., 1997 ). One
difference between the APPSw mouse model and AD
is the fivefold to sixfold overexpression of
APPSw in the mouse (Hsiao et al., 1996 ).
Therefore, it may be the subsequent increase in the secreted form of
APP that drives the protective gene expression changes described here.
Substantial evidence indicates a protective role for TTR, IGF-2, Akt,
Erk, and Bad phosphorylation in vitro. Here we provide evidence that suggests these mechanisms are neuroprotective against A in vivo. Thus, regulating the transcription of these
genes and/or the identified signal transduction pathways may have an important role in the design of potential AD therapeutics.
 |
FOOTNOTES |
Received April 1, 2002; revised May 30, 2002; accepted June 14, 2002.
This study was supported by Grants ES08089 (J.A.J.), ES10042 (J.A.J.),
and ES09090 (Environmental Health Sciences Center) from the National
Institute of Environmental Health Sciences and by the Burroughs
Wellcome New Investigator in Toxicological Sciences Award (J.A.J.). We
thank Karen Hsiao Ashe for providing Tg2576 mice and Charles Nicholson,
Matthew Slattery, and the Molecular Biology Core Facility of the
University of Wisconsin Environmental Health Science Center for
conducting the gene array hybridizations.
Correspondence should be addressed to Jeffrey A. Johnson, University of
Wisconsin-Madison, School of Pharmacy, 6125 Rennebohm Hall, 777 Highland Avenue, Madison, WI 53705-2222. E-mail:
jajohnson{at}pharmacy.wisc.edu.
 |
REFERENCES |
-
Beilharz EJ,
Russo VC,
Butler G,
Baker NL,
Connor B,
Sirimanne ES,
Dragunow M,
Werther GA,
Gluckman PD,
Williams CE,
Scheepens A
(1998)
Co-ordinated and cellular-specific induction of the components of the IGF/IGFBP axis in the rat brain following hypoxic-ischemic injury.
Brain Res Mol Brain Res
59:119-134[Medline].
-
Berlanga JJ,
Gualillo O,
Buteau H,
Applanat M,
Kelly PA,
Edery M
(1997)
Prolactin activates tyrosyl phosphorylation of insulin receptor substrate 1 and phosphatidylinositol-3-OH kinase.
J Biol Chem
272:2050-2052[Abstract/Free Full Text].
-
Bonni A,
Brunet A,
West AE,
Datta SR,
Takasu MA,
Greenberg ME
(1999)
Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and -independent mechanisms.
Science
286:1358-1362[Abstract/Free Full Text].
-
Calhoun ME,
Wiederhold KH,
Abramowski D,
Phinney AL,
Probst A,
Sturchler-Pierrat C,
Staufenbiel M,
Sommer B,
Jucker M
(1998)
Neuron loss in APP transgenic mice.
Nature
395:755-756[Medline].
-
Costoya JA,
Finidori J,
Moutoussamy S,
Senaris R,
Devesa J,
Arce VM
(1999)
Activation of growth hormone receptor delivers an antiapoptotic signal: evidence for a role of Akt in this pathway.
Endocrinology
140:5937-5943[Abstract/Free Full Text].
-
Datta SR,
Dudek H,
Tao X,
Masters S,
Fu H,
Gotoh Y,
Greenberg ME
(1997)
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery.
Cell
91:231-241[Web of Science][Medline].
-
Dineley KT,
Westerman M,
Bui D,
Bell K,
Ashe KH,
Sweatt JD
(2001)
-Amyloid activates the mitogen-activated protein kinase cascade via hippocampal 7 nicotinic acetylcholine receptors: in vitro and in vivo mechanisms related to Alzheimer's disease.
J Neurosci
21:4125-4133[Abstract/Free Full Text]. -
Dore S,
Kar S,
Quirion R
(1997)
Insulin-like growth factor I protects and rescues hippocampal neurons against
-amyloid- and human amylin-induced toxicity.
Proc Natl Acad Sci USA
94:4772-4777[Abstract/Free Full Text]. -
Duff K,
Eckman C,
Zehr C,
Yu X,
Prada CM,
Perez-tur J,
Hutton M,
Buee L,
Harigaya Y,
Yager D,
Morgan D,
Gordon MN,
Holcomb L,
Refolo L,
Zenk B,
Hardy J,
Younkin S
(1996)
Increased amyloid-
4243 in brains of mice expressing mutant presenilin 1.
Nature
383:710-713[Medline]. -
Estus S,
Zaks WJ,
Freeman RS,
Gruda M,
Bravo R,
Johnson Jr EM
(1994)
Altered gene expression in neurons during programmed cell death: identification of c-jun as necessary for neuronal apoptosis.
J Cell Biol
127:1717-1727[Abstract/Free Full Text].
-
Ferrer I,
Blanco R,
Carmona M,
Ribera R,
Goutan E,
Puig B,
Rey MJ,
Cardozo A,
Vinals F,
Ribalta T
(2001)
Phosphorylated map kinase (ERK1, ERK2) expression is associated with early tau deposition in neurones and glial cells, but not with increased nuclear DNA vulnerability and cell death, in Alzheimer disease, Pick's disease, progressive supranuclear palsy and corticobasal degeneration.
Brain Pathol
11:144-158[Web of Science][Medline].
-
Gerwins P,
Blank JL,
Johnson GL
(1997)
Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway.
J Biol Chem
272:8288-8295[Abstract/Free Full Text].
-
Giovannelli L,
Casamenti F,
Scali C,
Bartolini L,
Pepeu G
(1995)
Differential effects of amyloid peptides
1-40 and 25-35 injections into the rat nucleus basalis.
Neuroscience
66:781-792[Web of Science][Medline]. -
Greenberg SM,
Koo EH,
Selkoe DJ,
Qiu WQ,
Kosik KS
(1994)
Secreted
-amyloid precursor protein stimulates mitogen-activated protein kinase and enhances tau phosphorylation.
Proc Natl Acad Sci USA
91:7104-7108[Abstract/Free Full Text]. -
Hafezi F,
Steinbach JP,
Marti A,
Munz K,
Wang ZQ,
Wagner EF,
Aguzzi A,
Reme CE
(1997)
The absence of c-fos prevents light-induced apoptotic cell death of photoreceptors in retinal degeneration in vivo.
Nat Med
3:346-349[Web of Science][Medline].
-
Holcomb L,
Gordon MN,
McGowan E,
Yu X,
Benkovic S,
Jantzen P,
Wright K,
Saad I,
Mueller R,
Morgan D,
Sanders S,
Zehr C,
O'Campo K,
Hardy J,
Prada CM,
Eckman C,
Younkin S,
Hsiao K,
Duff K
(1998)
Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes.
Nat Med
4:97-100[Web of Science][Medline].
-
Hsiao K,
Chapman P,
Nilsen S,
Eckman C,
Harigaya Y,
Younkin S,
Yang F,
Cole G
(1996)
Correlative memory deficits, A
elevation, and amyloid plaques in transgenic mice.
Science
274:99-102[Abstract/Free Full Text]. -
Irizarry MC,
McNamara M,
Fedorchak K,
Hsiao K,
Hyman BT
(1997a)
APPSw transgenic mice develop age-related A
deposits and neuropil abnormalities, but no neuronal loss in CA1.
J Neuropathol Exp Neurol
56:965-973[Web of Science][Medline]. -
Irizarry MC,
Soriano F,
McNamara M,
Page KJ,
Schenk D,
Games D,
Hyman BT
(1997b)
A
deposition is associated with neuropil changes, but not with overt neuronal loss in the human amyloid precursor protein V717F (PDAPP) transgenic mouse.
J Neurosci
17:7053-7059[Abstract/Free Full Text]. -
Irizarry MC,
Locascio JJ,
Hyman BT
(2001)
-Site APP cleaving enzyme mRNA expression in APP transgenic mice: anatomical overlap with transgene expression and static levels with aging.
Am J Pathol
158:173-177[Abstract/Free Full Text]. -
Janus C,
Pearson J,
McLaurin J,
Mathews PM,
Jiang Y,
Schmidt SD,
Chishti MA,
Horne P,
Heslin D,
French J,
Mount HT,
Nixon RA,
Mercken M,
Bergeron C,
Fraser PE,
St. George-Hyslop P,
Westaway D
(2000)
A
peptide immunization reduces behavioural impairment and plaques in a model of Alzheimer's disease.
Nature
408:979-982[Medline]. -
Kar S,
Seto D,
Dore S,
Hanisch U-K,
Quirion R
(1997)
Insulin-like growth factors-I and -II differentially regulate endogenous acetylcholine release from the rat hippocampal formation.
Proc Natl Acad Sci USA
94:14054-14059[Abstract/Free Full Text].
-
Kawano T,
Fukunaga K,
Takeuchi Y,
Morioka M,
Yano S,
Hamada J,
Ushio Y,
Miyamoto E
(2001)
Neuroprotective effect of sodium orthovanadate on delayed neuronal death after transient forebrain ischemia in gerbil hippocampus.
J Cereb Blood Flow Metab
21:1268-1280[Medline].
-
Kawarabayashi T,
Younkin LH,
Saido TC,
Shoji M,
Ashe KH,
Younkin SG
(2001)
Age-dependent changes in brain, CSF, and plasma amyloid
protein in the Tg2576 transgenic mouse model of Alzheimer's disease.
J Neurosci
21:372-381[Abstract/Free Full Text]. -
Kruman II,
Kumaravel TS,
Lohani A,
Pedersen WA,
Cutler RG,
Kruman Y,
Haughey N,
Lee J,
Evans M,
Mattson MP
(2002)
Folic acid deficiency and homocysteine impair DNA repair in hippocampal neurons and sensitize them to amyloid toxicity in experimental models of Alzheimer's disease.
J Neurosci
22:1752-1762[Abstract/Free Full Text].
-
Kuro-o M,
Matsumura Y,
Aizawa H,
Kawaguchi H,
Suga T,
Utsugi T,
Ohyama Y,
Kurabayashi M,
Kaname T,
Kume E,
Iwasaki H,
Iida A,
Shiraki-Iida T,
Nishikawa S,
Nagai R,
Nabeshima YI
(1997)
Mutation of the mouse klotho gene leads to a syndrome resembling aging.
Nature
390:45-51[Medline].
-
Lim GP,
Chu T,
Yang F,
Beech W,
Frautschy SA,
Cole GM
(2001)
The curry spice curcumin reduces oxidative damage and amyloid pathology in an Alzheimer transgenic mouse.
J Neurosci
21:8370-8377[Abstract/Free Full Text].
-
Lipshutz RJ,
Fodor SP,
Gingeras TR,
Lockhart DJ
(1999)
High density synthetic oligonucleotide arrays.
Nat Genet
21:20-24[Web of Science][Medline].
-
Logan A,
Gonzalez AM,
Hill DJ,
Berry M,
Gregson NA,
Baird A
(1994)
Coordinated pattern of expression and localization of insulin-like growth factor-II (IGF-II) and IGF-binding protein-2 in the adult rat brain.
Endocrinology
135:2255-2264[Abstract].
-
Marcus DL,
Strafaci JA,
Miller DC,
Masia S,
Thomas CG,
Rosman J,
Hussain S,
Freedman ML
(1998)
Quantitative neuronal c-fos and c-jun expression in Alzheimer's disease.
Neurobiol Aging
19:393-400[Web of Science][Medline].
-
Martin D,
Salinas M,
Lopez-Valdaliso R,
Serrano E,
Recuero M,
Cuadrado A
(2001)
Effect of the Alzheimer amyloid fragment A
25-35 on Akt/PKB kinase and survival of PC12 cells.
J Neurochem
78:1000-1008[Web of Science][Medline]. -
Mattson MP,
Cheng B,
Culwell AR,
Esch FS,
Lieberburg I,
Rydel RE
(1993)
Evidence for excitoprotective and intraneuronal calcium-regulating roles for secreted forms of the
-amyloid precursor protein.
Neuron
10:243-254[Web of Science][Medline]. -
Mills J,
Laurent Charest D,
Lam F,
Beyreuther K,
Ida N,
Pelech SL,
Reiner PB
(1997)
Regulation of amyloid precursor protein catabolism involves the mitogen-activated protein kinase signal transduction pathway.
J Neurosci
17:9415-9422[Abstract/Free Full Text].
-
Morgan D,
Diamond DM,
Gottschall PE,
Ugen KE,
Dickey C,
Hardy J,
Duff K,
Jantzen P,
DiCarlo G,
Wilcock D,
Connor K,
Hatcher J,
Hope C,
Gordon M,
Arendash GW
(2000)
A
peptide vaccination prevents memory loss in an animal model of Alzheimer's disease.
Nature
408:982-985[Medline]. -
Pratico D,
Uryu K,
Leight S,
Trojanoswki JQ,
Lee VM
(2001)
Increased lipid peroxidation precedes amyloid plaque formation in an animal model of Alzheimer amyloidosis.
J Neurosci
21:4183-4187[Abstract/Free Full Text].
-
Preston GA,
Lyon TT,
Yin Y,
Lang JE,
Solomon G,
Annab L,
Srinivasan DG,
Alcorta DA,
Barrett JC
(1996)
Induction of apoptosis by c-Fos protein.
Mol Cell Biol
16:211-218[Abstract].
-
Scheepens A,
Sirimanne ES,
Breier BH,
Clark RG,
Gluckman PD,
Williams CE
(2001)
Growth hormone as a neuronal rescue factor during recovery from CNS injury.
Neuroscience
104:677-687[Web of Science][Medline].
-
Schwarzman AL,
Gregori L,
Vitek MP,
Lyubski S,
Strittmatter WJ,
Enghilde JJ,
Bhasin R,
Silverman J,
Weisgraber KH,
Coyle PK,
Zagorski MG,
Talafous J,
Eisenberg M,
Saunders AM,
Roses AD,
Goldgaber D
(1994)
Transthyretin sequesters amyloid
protein and prevents amyloid formation.
Proc Natl Acad Sci USA
91:8368-8372[Abstract/Free Full Text]. -
Serot JM,
Christmann D,
Dubost T,
Couturier M
(1997)
Cerebrospinal fluid transthyretin: aging and late-onset Alzheimer's disease.
J Neurol Neurosurg Psychiatry
63:506-508[Abstract/Free Full Text].
-
Seshadri S,
Beiser A,
Selhub J,
Jacques PF,
Rosenberg IH,
D'Agostino RB,
Wilson PW,
Wolf PA
(2002)
Plasma homocysteine as a risk factor for dementia and Alzheimer's disease.
N Engl J Med
346:476-483[Abstract/Free Full Text].
-
Shiraki-Iida T,
Iida A,
Nabeshima Y,
Anazawa H,
Nishikawa S,
Noda M,
Kuro-o M
(2000)
Improvement of multiple pathophysiological phenotypes of klotho (kl/kl) mice by adenovirus-mediated expression of the klotho gene.
J Gene Med
2:233-242[Medline].
-
Stobrawa SM,
Breiderhoff T,
Takamori S,
Engel D,
Schweizer M,
Zdebik AA,
Bosl MR,
Ruether K,
Jahn H,
Draguhn A,
Jahn R,
Jentsch TJ
(2001)
Disruption of ClC-3, a chloride channel expressed on synaptic vesicles, leads to a loss of the hippocampus.
Neuron
29:185-196[Web of Science][Medline].
-
Vaudry D,
Gonzalez BJ,
Basille M,
Pamantung TF,
Fontaine M,
Fournier A,
Vaudry H
(2000)
The neuroprotective effect of pituitary adenylate cyclase-activating polypeptide on cerebellar granule cells is mediated through inhibition of the CED3-related cysteine protease caspase-3/CPP32.
Proc Natl Acad Sci USA
97:13390-13395[Abstract/Free Full Text].
-
Webster J,
Prager D,
Melmed S
(1994)
Insulin-like growth factor-1 activation of extracellular signal-related kinase-1 and -2 in growth hormone-secreting cells.
Mol Endocrinol
8:539-544[Abstract/Free Full Text].
-
Wu CJ,
Chen Z,
Ullrich A,
Greene MI,
O'Rourke DM
(2000)
Inhibition of EGFR-mediated phosphoinositide-3-OH kinase (PI3-K) signaling and glioblastoma phenotype by signal-regulatory proteins (SIRPs).
Oncogene
19:3999-4010[Medline].
-
Yankner BA,
Duffy LK,
Kirschner DA
(1990)
Neurotrophic and neurotoxic effects of amyloid
protein: reversal by tachykinin neuropeptides.
Science
250:279-282[Abstract/Free Full Text]. -
Zheng WH,
Kar S,
Dore S,
Quirion R
(2000)
Insulin-like growth factor-1 (IGF-1): a neuroprotective trophic factor acting via the Akt kinase pathway.
J Neural Transm Suppl
60:261-272.
Copyright © 2002 Society for Neuroscience 0270-6474/02/22177380-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
S. Freude, M. M. Hettich, C. Schumann, O. Stohr, L. Koch, C. Kohler, M. Udelhoven, U. Leeser, M. Muller, N. Kubota, et al.
Neuronal IGF-1 resistance reduces A{beta} accumulation and protects against premature death in a model of Alzheimer's disease
FASEB J,
October 1, 2009;
23(10):
3315 - 3324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Liu, J. Hou, J. Du, R. S. Chumanov, Q. Xu, Y. Ge, J. A. Johnson, and R. M. Murphy
Differential modification of Cys10 alters transthyretin's effect on beta-amyloid aggregation and toxicity
Protein Eng. Des. Sel.,
August 1, 2009;
22(8):
479 - 488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Buxbaum, Z. Ye, N. Reixach, L. Friske, C. Levy, P. Das, T. Golde, E. Masliah, A. R. Roberts, and T. Bartfai
Transthyretin protects Alzheimer's mice from the behavioral and biochemical effects of A{beta} toxicity
PNAS,
February 19, 2008;
105(7):
2681 - 2686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Chen, N. A. Kassem, M. Sadeghi, and J. E. Preston
Insulin-Like Growth Factor-II Uptake Into Choroid Plexus and Brain of Young and Old Sheep
J. Gerontol. A Biol. Sci. Med. Sci.,
February 1, 2008;
63(2):
141 - 148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. H. Choi, S. N. Leight, V. M.-Y. Lee, T. Li, P. C. Wong, J. A. Johnson, M. J. Saraiva, and S. S. Sisodia
Accelerated A{beta} Deposition in APPswe/PS1{Delta}E9 Mice with Hemizygous Deletions of TTR (Transthyretin)
J. Neurosci.,
June 27, 2007;
27(26):
7006 - 7010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. N. Green, H. Martinez-Coria, H. Khashwji, E. B. Hall, K. A. Yurko-Mauro, L. Ellis, and F. M. LaFerla
Dietary Docosahexaenoic Acid and Docosapentaenoic Acid Ameliorate Amyloid-{beta} and Tau Pathology via a Mechanism Involving Presenilin 1 Levels
J. Neurosci.,
April 18, 2007;
27(16):
4385 - 4395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Culbert, S. D. Skaper, D. R. Howlett, N. A. Evans, L. Facci, P. E. Soden, Z. M. Seymour, F. Guillot, M. Gaestel, and J. C. Richardson
MAPK-activated Protein Kinase 2 Deficiency in Microglia Inhibits Pro-inflammatory Mediator Release and Resultant Neurotoxicity: RELEVANCE TO NEUROINFLAMMATION IN A TRANSGENIC MOUSE MODEL OF ALZHEIMER DISEASE
J. Biol. Chem.,
August 18, 2006;
281(33):
23658 - 23667.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Choi, J. H. Kim, E.-J. Roh, M.-J. Ko, J.-E. Jung, and H.-J. Kim
Nuclear Factor-{kappa}B Activated by Capacitative Ca2+ Entry Enhances Muscarinic Receptor-mediated Soluble Amyloid Precursor Protein (sAPP{alpha}) Release in SH-SY5Y Cells
J. Biol. Chem.,
May 5, 2006;
281(18):
12722 - 12728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Manczak, T. S. Anekonda, E. Henson, B. S. Park, J. Quinn, and P. H. Reddy
Mitochondria are a direct site of A{beta} accumulation in Alzheimer's disease neurons: implications for free radical generation and oxidative damage in disease progression
Hum. Mol. Genet.,
May 1, 2006;
15(9):
1437 - 1449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. K. Engel and V. Askanas
Inclusion-body myositis: Clinical, diagnostic, and pathologic aspects
Neurology,
January 24, 2006;
66(1_suppl_1):
S20 - S29.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Perez, O. Lazarov, J. B. Koprich, E.-Y. Chen, V. Rodriguez-Menendez, J. W. Lipton, S. S. Sisodia, and E. J. Mufson
Nigrostriatal Dysfunction in Familial Alzheimer's Disease-Linked APPswe/PS1{Delta}E9 Transgenic Mice
J. Neurosci.,
November 2, 2005;
25(44):
10220 - 10229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. P. Lim, F. Calon, T. Morihara, F. Yang, B. Teter, O. Ubeda, N. Salem Jr, S. A. Frautschy, and G. M. Cole
A Diet Enriched with the Omega-3 Fatty Acid Docosahexaenoic Acid Reduces Amyloid Burden in an Aged Alzheimer Mouse Model
J. Neurosci.,
March 23, 2005;
25(12):
3032 - 3040.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. D. Stein, N. J. Anders, C. DeCarli, S. L. Chan, M. P. Mattson, and J. A. Johnson
Neutralization of Transthyretin Reverses the Neuroprotective Effects of Secreted Amyloid Precursor Protein (APP) in APPSw Mice Resulting in Tau Phosphorylation and Loss of Hippocampal Neurons: Support for the Amyloid Hypothesis
J. Neurosci.,
September 1, 2004;
24(35):
7707 - 7717.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. Reddy, S. McWeeney, B. S. Park, M. Manczak, R. V. Gutala, D. Partovi, Y. Jung, V. Yau, R. Searles, M. Mori, et al.
Gene expression profiles of transcripts in amyloid precursor protein transgenic mice: up-regulation of mitochondrial metabolism and apoptotic genes is an early cellular change in Alzheimer's disease
Hum. Mol. Genet.,
June 15, 2004;
13(12):
1225 - 1240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Levenson, S. Choi, S.-Y. Lee, Y. A. Cao, H. J. Ahn, K. C. Worley, M. Pizzi, H.-C. Liou, and J. D. Sweatt
A Bioinformatics Analysis of Memory Consolidation Reveals Involvement of the Transcription Factor c-Rel
J. Neurosci.,
April 21, 2004;
24(16):
3933 - 3943.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schubert, D. P. Brazil, D. J. Burks, J. A. Kushner, J. Ye, C. L. Flint, J. Farhang-Fallah, P. Dikkes, X. M. Warot, C. Rio, et al.
Insulin Receptor Substrate-2 Deficiency Impairs Brain Growth and Promotes Tau Phosphorylation
J. Neurosci.,
August 6, 2003;
23(18):
7084 - 7092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Askanas, W. K. Engel, J. McFerrin, and G. Vattemi
Transthyretin Val122Ile, accumulated A{beta}, and inclusion-body myositis aspects in cultured muscle
Neurology,
July 22, 2003;
61(2):
257 - 260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Dickey, J. F. Loring, J. Montgomery, M. N. Gordon, P. S. Eastman, and D. Morgan
Selectively Reduced Expression of Synaptic Plasticity-Related Genes in Amyloid Precursor Protein + Presenilin-1 Transgenic Mice
J. Neurosci.,
June 15, 2003;
23(12):
5219 - 5226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Y. Shih, D. A. Johnson, G. Wong, A. D. Kraft, L. Jiang, H. Erb, J. A. Johnson, and T. H. Murphy
Coordinate Regulation of Glutathione Biosynthesis and Release by Nrf2-Expressing Glia Potently Protects Neurons from Oxidative Stress
J. Neurosci.,
April 15, 2003;
23(8):
3394 - 3406.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. B. Goodman and A. B. Pardee
Evidence for defective retinoid transport and function in late onset Alzheimer's disease
PNAS,
March 4, 2003;
100(5):
2901 - 2905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. G. Puskas, K. Kitajka, C. Nyakas, G. Barcelo-Coblijn, and T. Farkas
Short-term administration of omega 3 fatty acids from fish oil results in increased transthyretin transcription in old rat hippocampus
PNAS,
February 18, 2003;
100(4):
1580 - 1585.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|