 |
Previous Article | Next Article 
The Journal of Neuroscience, September 1, 2002, 22(17):7586-7595
Mammalian Achaete Scute Homolog 2 Is Expressed in the Adult
Sciatic Nerve and Regulates the Expression of Krox24, Mob-1, CXCR4, and
p57kip2 in Schwann Cells
Patrick
Küry,
Regine
Greiner-Petter,
Christiane
Cornely,
Tim
Jürgens, and
Hans Werner
Müller
Molecular Neurobiology Laboratory, Department of Neurology,
Heinrich-Heine University of Düsseldorf, D-40225
Düsseldorf, Germany
 |
ABSTRACT |
The molecular control mechanisms and regulatory molecules involved
in nerve repair are not yet well known. Schwann cells have been
attributed an important role in peripheral nerve regeneration; therefore, attention has been drawn to regulatory factors expressed by
these glial cells. Here, we demonstrate that Mash2, a basic helix-loop-helix (bHLH) transcription factor previously shown to be
crucial for placenta development, is expressed by Schwann cells of
adult peripheral nerves. We observed that this gene is downregulated
after nerve lesion and, using cDNA array hybridization technology, we
could demonstrate that Mash2 is a regulator of Krox24, Mob-1, and CXCR4
expression in cultured Schwann cells. In addition, we provide strong
evidence that Mash2 is a negative regulator of Schwann cell
proliferation. Mash2 represents a first candidate for the missing class
B bHLH proteins in peripheral nerves.
Key words:
basic helix-loop-helix; Schwann cell; cDNA array
hybridization; Wallerian degeneration; proliferation; cytokine
 |
INTRODUCTION |
The adult peripheral nervous system
retains the capacity to regenerate after injury, and it has been shown
that this is a consequence of molecular interactions occurring between
axotomized neurons, Schwann cells, and phagocytosing macrophages. After
injury, the axons distal to the lesion site degenerate, myelin sheaths are broken down, and debris is removed by both Schwann cells and macrophages. This so called Wallerian degeneration is essential for
successful nerve regeneration, and during this period, Schwann cells
undergo dedifferentiation and proliferate to generate a guidance
substrate for growing axons (Fawcett and Keynes, 1990 ).
During the past decade, a large number of differentially expressed
genes have been identified that are thought to be involved in
peripheral nervous system repair. However, little information exists
regarding the identity of transcriptional regulators that direct the
coordinated expression of target genes during the distinct stages of
nerve degeneration and regeneration (Gillen et al., 1995 ; Küry et
al., 2001 ). Conversely, Schwann cell differentiation has been shown to
depend primarily on the expression of the transcription factors Pax3,
Sox10, Oct6 (SCIP or Tst-1), and Krox20 (Scherer et al., 1994 ; Topilko
et al., 1994 ; Kioussi et al., 1995 ; Bermingham et al., 1996 ; Jaegle et
al., 1996 ; Britsch et al., 2001 ).
Until now, no cell-specific (class B) basic helix-loop-helix (bHLH)
proteins could be detected in Schwann cells, but several lines of
evidence proposed a role of these transcription factors in peripheral
nerves, such as the observation that class A transcripts of the bHLH
genes REB and E2A occur in mature Schwann cells and the fact that bHLH
transcription factors act as A/B heterodimers. In addition, the
presence of E-box binding sites in promoters of several Schwann cell
genes also argues for a function of bHLH proteins in this glial lineage
(Stewart et al., 1997 ). In addition, non-DNA-binding Id
helix-loop-helix (HLH) proteins known to interact with bHLH
transcription factors and to interfere with their transcriptional activities were found to be expressed throughout development and in
mature Schwann cells (Stewart et al., 1997 ; Thatikunta et al., 1999 ).
Mammalian achaete scute homolog (Mash) genes were initially discovered
in a neural crest-derived cell line (Johnson et al., 1990 ). Whereas
Mash1 was shown to be involved in the determination and differentiation
of neurons (for review, see Guillemot, 1999 ), Mash2 has thus far been
implicated only in trophoblast development during early embryogenesis,
with gene inactivation resulting in embryonic lethality (Guillemot et
al., 1994 ). Here, we demonstrate that the Mash2 gene is expressed by
Schwann cells of the adult peripheral nerve. This transcription factor
represents a first candidate for the missing class B bHLH proteins, and
we found that after sciatic nerve crush, Mash2 expression was
decreased. By applying cDNA array hybridization technology, we
identified Schwann cell-specific downstream target genes of this
transcriptional regulator. We provide strong evidence that Mash2 is
involved in both Schwann cell differentiation and the control of
proliferation occurring in the injured nerve.
 |
MATERIALS AND METHODS |
Antibody generation, immunohistochemistry, and in
situ hybridization. Two different rabbit polyclonal
anti-Mash2 antibodies (rabbit 1 and rabbit 2) were produced using the
peptide MESSGKMESGAGQQPQPPQP corresponding to the 20 N-terminal amino
acids of the rat Mash2 protein. Both immune sera were affinity-purified
using N-terminal Mash2 peptide-coupled Sepharose 4B column
chromatography. SDS-PAGE and Western blotting were performed according
to Laemmli (1970) and Towbin et al. (1979) , respectively, using a
horseradish peroxidase-conjugated goat anti-rabbit antibody (Southern
Biotechnology, Alabaster, AL) and an ECL Western blot detection
system (Amersham Biosciences, Arlington Heights, IL). Immunostainings
of cryostat sections using affinity-purified Mash2 antibodies (rabbit 1 and rabbit 2, diluted 1:50) were performed overnight at 4°C in PBS
containing 3% normal goat serum. Rabbit anti-S100 (Sigma, St. Louis,
MO), rabbit anti-low-affinity nerve growth factor receptor (LNGFR)
(Chemicon, Temecula, CA), rabbit anti-Krox24 (Herdegen et al., 1991 ),
rabbit anti-egr2 (Krox20; Santa Cruz Biotechnology, Santa Cruz, CA),
and mouse anti-p57kip2 (Acris, Hiddenhausen, Germany) antibodies were
used at dilutions of 1:200, 1:50, 1:4000, 1:50, and 1:20, respectively,
using the same incubation buffer. Horseradish peroxidase-, Cy3-, and
Alexa green-conjugated secondary antibodies (Jackson ImmunoResearch, West Grove, PA; Molecular Probes, Eugene, OR) were used for signal visualization. A Sybr Green nucleic acid staining kit was purchased from Molecular Probes. Production of digoxigenin (DIG)-labeled cRNA
probes was performed by in vitro transcription of Mob-1 and CXCR4 cDNA templates (472 and 772 base pairs, respectively) according to the instructions of the supplier (Roche Products, Hertfordshire, UK). In situ hybridization of paraffin sections was
performed at 55°C overnight according to Angerer et al. (1987) .
Visualization using the alkaline phosphatase-coupled anti-DIG antibody
was performed according to the protocol of the supplier (Roche).
Animal surgery. Adult Wistar rats were anesthetized with
chloral hydrate (350 mg/kg body weight) by intraperitoneal
administration. Sciatic nerves were crushed using fine jeweler's
forceps according to Müller et al. (1986) . After nerve
transection, both nerve ends were tied off to prevent axons from
growing into the distal stump. The rats were killed by cervical
dislocation 2-28 d after nerve injury, and the tissue distal to the
site of lesion was dissected with care taken that the lesion zone
itself was omitted. Six to eight sciatic nerves were pooled for each
time point. All animal experiments were performed according to the
guidelines of the German Animal Rights Law.
RNA preparation. Total RNA derived from adult rat sciatic
nerves was prepared according to the method described by Chomczynski and Sacchi (1987) . Total RNA derived from cultured Schwann cells was
prepared using the RNeasy procedure according to the protocols of the
supplier (Qiagen, Hilden, Germany). Before additional use, total RNA
was DNase I-digested according to the instructions of the supplier (Roche).
Transfection and Schwann cell sorting. Rat Schwann cells
were prepared according to Brockes et al. (1979) and grown at a density of 10,000 cells/cm2 on
poly-D-lysine (Sigma) in DMEM (Invitrogen, San
Diego, CA) in the presence of 10% fetal calf serum (FCS;
Invitrogen) and 2 µM forskolin (Sigma). Fugene
6 (Roche) mediated cotransfection of either pMash2-internal ribosome
entry site 2 (IRES2)-enhanced green fluorescent protein (EGFP),
an 882 base pair fragment corresponding to the entire coding region of
the rat Mash2 cDNA cloned in the pIRES2-EGFP vector (Clontech,
Cambridge, UK; see below for oligonucleotides used for amplification)
or pIRES2-EGFP, together with a CD14 expression vector (pMACS-14.1,
Miltenyi Biotec, Bergisch-Gladbach, Germany), was performed at a ratio
of 5:1. Forty-eight hours after transfection, cells were harvested and
incubated with an anti-CD14 antibody coupled to magnetic microbeads.
Cells were then sorted using a magnetic column according to the manual
(Miltenyi Biotec). Using this procedure, we received ~70% pure
populations of transiently transfected Schwann cells. Bromodeoxyuridine
(BrdU) incorporation during DNA replication was used to determine
Schwann cell proliferation (Gratzner, 1982 ). BrdU and anti-BrdU
antibodies were used according to the protocols of the supplier (Roche).
Expression array analysis. The experiments were performed on
rat 1.2 Atlas array filters (Clontech). cDNA probe synthesis using 5 µg of DNA-free total RNA, filter hybridization, and washings were all
performed according to the instructions of the supplier. Hybridized
filters were scanned (BAS reader, Fujifilm; Medical Systems, Stamford,
CT) and analyzed using TINA software (Raytest, Straubenhardt, Germany).
See Results section for a detailed description of the analysis procedure.
Reverse transcription and PCR. Reverse transcription (RT) of
total RNA was performed using the Superscript II enzyme (Invitrogen) and dT19(A/C/G) oligonucleotide primers. PCR
amplification of the rat Mash2 cDNA was performed using the Amplitaq
polymerase (Applied Biosystems, Foster City, CA) with oligonucleotides
at a concentration of 0.33 pmol/µl in a buffer consisting of 1.5 mM MgCl2, 5% DMSO, and 1 mM dNTPs. The amplification profile was 30 sec at
94°C, 1 min at 55°C, and 1 min at 72°C. The sequence of
oligonucleotides was Mash2-forward TGGAATCGCACTTTAACTGG, Mash2-reverse CTAGACAGCATGGGTAAGGC. DNA sequencing was performed on a 310 Genetic Analyser using the reagents of the supplier (Applied Biosystems).
Real-time quantitative PCR was performed on a 5700 GeneAmp (Applied
Biosystems) using the Sybr Green assay according to the protocols of the supplier. The sequence of oligonucleotides
was Mash2-forward AACTTTCCAACCTGGCCAAGGT,
Mash2-reverse AG-CCAGGCATCTTGCCC, glyceraldehyde
3-phosphate dehydrogenase (GAPDH)-forward
GAACGGGAAGCTCACTGGC, GAPDH-reverse GCATGTCAGATCCACAACGG, Krox24-forward
CCCTGTTGAG-TCCTGCGATC, Krox24-reverse GGCGTGTAAGCTCATCCGAG,
Mob-1-forward AGACCGATGGACAGCAGAGAG, Mob-1-reverse
ACACTGGGTAAAGGGAGGTGG, CXCR4-forward CGTCGTGCACAAGTGGATCT, CXCR4-reverse CAGTGGAAGAAGGCGAGGG, p21cip1-forward
TTCTTCTGCTGTGGGTCAGGA, p21cip1-reverse AAGGCTAAGGCAGAAGATGGG,
p27kip1-forward GCGTTTCGC-TTTTGTTTGGT, p27kip1-reverse
ACGTTTGACATCTTCCTCCCC, p57kip2-forward CAGGACGAGAATCAGGAGCTGA, p57kip2-reverse TTGGCGAAGAAGTCGTTCG, Krox20-forward
TTTTTCCATCTCCGTGCCA, and Krox20-reverse GAACGGCTTTCGATCAGGG.
 |
RESULTS |
Mash2 is expressed by Schwann cells of the adult sciatic nerve
Using RT-PCR to selectively amplify cDNA fragments of regulatory
genes, we found that the bHLH transcription factor Mash2 is expressed
in adult rat sciatic nerves and cultured rat Schwann cells (data not
shown). We then used quantitative real-time RT-PCR, using the
expression of GAPDH as an internal standard, and could demonstrate that
after both nerve crush and nerve transection, expression of Mash2 is
transiently downregulated (Fig.
1A). This provides
evidence that decreased Mash2 activity is linked to Wallerian degeneration and not directly to regeneration events. To detect Mash2
protein, we generated two different rabbit polyclonal antisera directed
against the N-terminus of the rat protein. Affinity purification using
this N-terminal Mash2 peptide resulted in two polyclonal anti-Mash2
antibodies (rabbit 1 and rabbit 2), which we subsequently tested by
means of immunocytochemistry on Mash2-transfected Schwann cells
(coexpression of EGFP served as control; data not shown). Western blot
analysis then revealed that both antibodies recognized a band of ~38
kDa in extracts derived from both embryonic day 15.5 (E15.5) rat
placenta (lane 1) and cultured rat Schwann cells (lane
2), which corresponded to a band seen in Mash2-transfected cos-7
cells (lane 4) but was absent in cos-7 cells
transfected with the empty expression vector (lane 3), as
shown for the rabbit 1 anti-Mash2 antibody in Figure
1B. Immunohistochemistry on cryostat sections of
adult rat sciatic nerves revealed that both purified antibodies
produced very similar staining patterns, resembling the distribution of
Schwann cells within adult peripheral nerves (Fig.
1C,C'). Additional staining in the perineurium
was found to be nonspecific and a consequence of the staining procedure and could also be observed in control stainings in which the first antibody was omitted (Fig. 1D). However, we also
found Mash2 being expressed by endothelial cells (open arrow
in Fig. 1C'). This signal appeared to be specific and was
not affected by the nerve lesion, because we also detected it in blood
vessels of injured nerves stumps (data not shown). To prove that the
anti-Mash2 antibodies selectively labeled Schwann cells, we applied
anti-S100 antibodies (Haimoto et al., 1987 ) to adjacent sections and
found that the two signals overlapped (Fig.
1E,F). Direct comparison of the Mash2 signals
with Sybr Green-stained Schwann-cell nuclei was performed using
confocal microscopy and demonstrated that most of the Mash2 protein was
located in the nucleus, but with a smaller fraction residing outside
the nucleus (Fig. 1G-I). Similarly, Mash2
immunocytochemistry on cultured Schwann cells revealed a strong nuclear
signal and some staining outside the nucleus (Fig.
1J).

View larger version (110K):
[in this window]
[in a new window]
|
Figure 1.
Mash2 is expressed in Schwann cells of the adult
sciatic nerve. A, Quantitative RT-PCR analysis revealed
a transient downregulation of Mash2 expression after both nerve crush
(black columns) and nerve transection
(gray columns; 2-28d, days after
nerve injury). B, Western blot analysis using the rabbit
1 anti-Mash2 antibody on E15.5 placenta (lane 1, 15 µg
of protein), Schwann cell (lane 2, 40 µg of protein),
control, and Mash2 transfected cos-7 cell extracts (lanes
3 and 4, 5 µg of protein each) demonstrated
that a 38 kDa band corresponding to the rat Mash2 protein occurred in
placenta and in Schwann cells. C, C',
Immunostainings of adult rat sciatic nerve cross sections using rabbit
1 anti-Mash2 (C) and rabbit 2 anti-Mash2
(C') antibodies. D, Control
immunostaining in which anti-Mash2 antibodies were omitted.
E, Rabbit 1 anti-Mash2 immunostaining; F,
anti-S100 immunostaining of a section adjacent to the one shown in
E demonstrating that Mash2 is expressed by S100-positive
Schwann cells. G-I, Rabbit 1 anti-Mash2 immunostaining
(G), Sybr Green nuclear staining of the same
section (H), and the merged pictures as
revealed by confocal microscopy (I).
J, Rabbit 1 anti-Mash2 immunocytochemistry of cultured
rat Schwann cells. Arrows mark double-labeled Schwann
cells, and open arrows in C and
D mark the perineurium and Mash2 expression in
endothelial cells (C'), respectively. Scale bars:
C, C', D, 50 µm; E, F, 20 µm;
G-J, 10 µm.
|
|
Gene expression arrays reveal Mash2 downstream target genes in
Schwann cells
As a transcription factor, the primary role of Mash2 is to
regulate gene activities, and identifying those target genes will provide important information about the function of Mash2 in the peripheral nerve. We therefore aimed to identify which genes were affected in Schwann cells overexpressing this regulatory factor. Because three different attempts to generate stably transfected Schwann
cells failed (data not shown), we developed a transient expression assay.
Schwann cells were transfected with a Mash2-EGFP expression vector
(pMash2-IRES2-EGFP) or, in parallel, with an EGFP control expression
vector (pIRES2-EGFP). After 48 hr in culture, transfected cells were
sorted and lysed (see Materials and Methods). The initial transfection
efficiency was up to 20%, and after the sorting procedure, ~70% of
the Schwann cells were EGFP-positive. Subsequently, DNA-free total RNA
was prepared and reverse transcribed to generate
32P-labeled cDNA pool probes. Those probes
were used to hybridize gene expression arrays (Clontech rat 1.2 Atlas
array filters) to detect differences in the expression levels among the
1176 dotted gene fragments. Six independent experiments were performed in which Mash2-EGFP-overexpressing cells were directly compared with
EGFP-overexpressing control cells. Hybridized array filters were
scanned, and the signal intensities were quantified. Each hybridization
signal was scored using a threshold value that we defined as the
background signal plus two SDs. This threshold value was used as
a quality criterion and helped to decide whether a given signal was
reliable and could be discriminated unambiguously from background
radiation. Then, each signal was compared with the expression level of
five reference genes, such as GAPDH, ornithine decarboxylase (ODC),
-tubulin, and -actin, as well as a virtual reference gene, which
was the calculated average signal intensity. In addition, we defined a
regulation threshold, which means that only those genes were scored
that had expression levels upregulated or downregulated at least
threefold. Finally, a visual inspection of regulated gene spots was
performed. Applying these criteria, we found that of the 1176 dotted
genes, the expression levels of 711 genes could be quantified and
analyzed. Of those, we detected three genes whose expression was
changed specifically in Mash2-overexpressing Schwann cells. In six of
six experiments, we found that the transcription factor gene Krox24
(Topilko et al., 1997 ) was suppressed at elevated Mash2 levels (Fig.
2, compare A, A'). In five of
six experiments, we observed that expression levels of the chemokine
Mob-1-IP10-CRG-2 (Liang et al., 1994 ) were decreased (Fig. 2, compare
C, C'), whereas the chemokine receptor gene CXCR4 (Nagasawa
et al., 1996 ) was upregulated by Mash2 (Fig. 2, compare E,
E'). Interestingly, none of the other known Schwann cell genes
present on the array filter, such as P0, PMP22, LNGFR, erbB2, erbB3,
and integrin 4 (all reviewed in Jessen and Mirsky, 1999 ), were found
to be affected by Mash2 (data not shown), indicating that the
Mash2-induced changes in gene expression were specific but also
suggesting that the expression of myelin genes is not under the control
of Mash2.

View larger version (69K):
[in this window]
[in a new window]
|
Figure 2.
Krox24, Mob-1, and CXCR4 are downstream target
genes of Mash2 in cultured Schwann cells. A-E', Gene
expression array of Schwann cells transiently transfected with
pMash2-IRES2-EGFP (A, C, and E) or
Schwann cells transfected with the control vector pIRES2-EGFP
(A', C', and E'). Krox24
(arrows in A and A') and
Mob-1 (arrows in C and C')
are downregulated by Mash2 and the CXCR4 gene is upregulated
(arrows in E and E').
B, D, F, Quantitative RT-PCR analysis confirmed that
Mash2 is a downregulator of Krox24 (B) and Mob-1
(D) and upregulates CXCR4
(F). For each gene, cDNA quantification of two
separate experiments is shown. GAPDH expression was used as reference,
and data are mean values ± SD. Mash2,
pMash2-IRES2-EGFP; control, pIRES2-EGFP-transfected
cells.
|
|
We then used quantitative RT-PCR to verify that these three genes were,
indeed, affected by Mash2. We used GAPDH (Fig. 2) and ODC (data not
shown) as reference genes. As shown for two separate experiments (Fig.
2B,D,F), Krox24 and Mob-1 were confirmed to be
suppressed, and CXCR4 was shown to be induced by Mash2. Considering
that our sorting procedure did not result in pure populations of
transiently transfected cells, the actual differences in transcript
levels of these three genes may even be higher.
Cellular colocalization of Mash2, Krox24, Mob-1, and CXCR4
After the observation that in cultured Schwann cells, Krox24
expression is suppressed by Mash2 (Fig. 2), we wanted to discover whether in the adult rat sciatic nerve, these two transcription factors
are coexpressed or whether they are mutually exclusive. We performed
immunohistochemistry on adjacent adult nerve sections using rabbit
polyclonal antibodies directed to Krox24 (Herdegen et al., 1991 )
and Mash2. We noticed that the number of Mash2-expressing cells
exceeded the number of Krox24-positive cells (Fig.
3A,B), which is in agreement
with the distribution of Krox24 in the adult peripheral nerve, as
published by Topilko et al. (1997) . A few cells, however, were found to
express both transcription factors (Fig. 3A',B'). Because
these authors have proposed that these Krox24-positive cells are
nonmyelinating Schwann cells, we performed immunohistochemistry on
adjacent nerve sections using antibodies directed against LNGFR (Jessen
et al., 1990 ) as a marker for nonmyelinating Schwann cells and Mash2.
As shown in Figure 3, G and H, no cells expressing both proteins could be detected. Conversely, we also performed additional parallel stainings using rabbit anti-Krox20 antibodies and found numerous Schwann cell nuclei that expressed both
proteins, Krox20 and Mash2 (Fig. 3C,D), thus demonstrating that myelinating Schwann cells express the Mash2 gene in
vivo. Applying real-time quantitative RT-PCR, the expression
profiles of Krox20 after nerve crush and nerve transection were
established (Fig. 3E). This demonstrated that although in
the crushed nerve Mash2 and Krox20 displayed almost identical
expression profiles, in the transected nerve Krox20 remained
downregulated, whereas Mash2 was again upregulated beyond postlesion
day 7 (Fig. 1A). This provides additional evidence
that Mash2 is not part of the myelination program as such but that its
downregulation is linked to molecular and cellular events occurring
during Wallerian degeneration. We then wanted to know whether Mash2
could also affect the expression of this gene and determined levels of
Krox20 expression in transiently transfected Schwann cells. No
differences in Krox20 transcript levels could be detected (Fig.
3F), indicating that the effect on Krox24 expression
was highly specific.

View larger version (135K):
[in this window]
[in a new window]
|
Figure 3.
Mash2 is expressed in myelinating Schwann cells.
A, Immunostaining of an adult rat sciatic nerve cross
section using anti-Krox24 antibodies. B, Same field on a
section adjacent to the one shown in A stained with the
rabbit 1 anti-Mash2 antibody. A', B', Enlargements of
boxed areas in A and B,
respectively, demonstrating that Krox24 and Mash2 are expressed in some
Schwann cells (arrows). C, Immunostaining
of an adult rat sciatic nerve section using anti-Krox20 antibodies.
D, Same field on an adjacent section stained with the
rabbit 1 anti-Mash2 antibody revealing many myelinating Schwann cells
expressing Mash2 (arrows). E,
Quantitative RT-PCR analysis demonstrating a transient downregulation
of Krox20 expression after nerve crush (black columns)
and a continued downregulation on nerve transection (gray
columns; 2-28 d after nerve injury). F,
Quantitative RT-PCR analysis indicates that Mash2 is not a regulator of
Krox20 expression. cDNA quantification of two separate experiments is
shown; GAPDH expression was used as reference, and data are mean
values ± SD. Mash2, pMash2-IRES2-EGFP;
control, pIRES2-EGFP-transfected cells.
G, Immunostaining of an adult rat sciatic nerve section
using anti-LNGFR antibodies. H, Section adjacent to the
one shown in G, demonstrating that nonmyelinating
Schwann cells do not express Mash2. Arrows mark
Mash2-labeled Schwann-cell nuclei; open arrows mark
LNGFR signals. Scale bars: A, 50 µm; A', C,
G, 20 µm.
|
|
A combination of in situ hybridization and
immunofluorescence was used to perform colocalization studies for CXCR4
and Mob-1. Adult rat sciatic nerve sections were hybridized with
digoxigenin-labeled antisense cRNA probes and subsequently subjected to
immunofluorescence using anti-Mash2 antibodies (Fig.
4). This demonstrated that not only in
cultured Schwann cells but also in the sciatic nerve, both genes CXCR4
and Mob-1 are coexpressed with their transcriptional regulator Mash2.
No specific signals were detected using the sense cRNA probes (Fig.
4E,F).

View larger version (135K):
[in this window]
[in a new window]
|
Figure 4.
CXCR4 and Mob-1 are expressed in Mash2-positive
Schwann cells. A, In situ hybridization
of an adult rat sciatic nerve section using an antisense CXCR4 cRNA
probe. B, Mash2 immunofluorescence (rabbit 1 anti-Mash2
antibody) on the same section, demonstrating overlapping expression
patterns. C, Sciatic nerve section hybridized with an
antisense Mob-1 cRNA probe. D, Same section
immunostained for Mash2, revealing coexpression of both genes.
E, F, Sense cRNA probe hybridization as controls.
Arrows mark double-labeled Schwann cells. Scale bars, 20 µm.
|
|
Mash2 acts as a regulator of Schwann cell proliferation
Depending on the culture conditions, Schwann cells can adopt
different morphologies and proliferation rates. In the presence of high
serum and the cAMP agonist forskolin, rat Schwann cells are flat and
nonpolar and proliferate quickly. If forskolin is withdrawn and the
serum content is reduced to the minimum necessary to ensure survival,
these cells become elongated and bipolar or tripolar and stop
proliferating. We prepared cDNA from rat Schwann cells that were
cultured in DMEM for 48 hr under four different conditions: 10% FCS
and 2 µM forskolin, 10% FCS only, 0.5% FCS and 2 µM forskolin, and 0.5% FCS only, and performed real-time quantitative RT-PCR to determine relative levels of gene expression using GAPDH as reference gene. Schwann cells were cultured under subconfluent conditions, and we observed that Mash2 expression gradually increased as mitogenic stimuli were reduced (Fig.
5A), suggesting that Schwann
cell proliferation and Mash2 expression are linked. To reveal whether
increased Mash2 levels could directly influence proliferation, we
performed S-phase labeling using BrdU. Schwann cells were transfected
with the Mash2 expression vector (pMash2-IRES2-EGFP) and the EGFP
control expression vector (pIRES2-EGFP), sorted, and subjected to an 8 hr BrdU pulse. This revealed that although fully stimulated by serum
and forskolin, increased Mash2 expression significantly reduced the
number of proliferating Schwann cells (Fig. 5B), thus
providing evidence that the capacity of the cell to undergo mitosis is
directly linked to Mash2 expression. The control of the mammalian cell
cycle is dependent primarily on the expression and activity of protein
complexes consisting of cyclins and cyclin-dependent kinases (CDKs).
Conversely, CDK inhibitors, such as p21cip1, p27kip1, and p57kip2,
control the G1-S transition and act as
antiproliferative agents (for review, see Sherr and Roberts, 1999 ).
Using real-time quantitative RT-PCR, we could demonstrate that
overexpression of Mash2 in Schwann cells results in a strong induction
of p57kip2 transcript levels (Lee et al., 1995 ; Matsuoka et al., 1995 ),
whereas expression of p21cip1 and p27kip1 remained unaffected (shown
for two separate experiments each in Fig. 5C). Double
immunofluorescence on adult sciatic nerve sections then demonstrated
the coexpression of p57kip2 and Mash2 proteins in Schwann cell nuclei
(Fig. 5D).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 5.
Mash2 regulates Schwann cell proliferation.
Quantitative RT-PCR analysis of Mash2 expression levels in Schwann
cells grown under different conditions was performed. A,
Stepwise withdrawal of serum and forskolin resulted in a strong
increase of Mash2 expression, whereas the percentage of BrdU-labeled
nuclei decreased (16 hr pulse). One representative experiment of five
is shown; GAPDH expression was used as reference, and data are mean
values ± SD. B, Forced expression of Mash2 results
in a reduction of proliferating Schwann cells, as revealed by the
percentage of BrdU-labeled nuclei. control,
pIRES2-EGFP-transfected Schwann cells. One representative experiment
out of four is shown. C, Quantitative RT-PCR analysis of
cyclin-dependent kinase inhibitor genes in Mash2-overexpressing Schwann
cells, demonstrating that p57kip2 is a specific target of Mash2. For
each gene, the result of two separate experiments is shown. GAPDH
expression was used as reference, and data are mean values ± SD.
D, Double immunohistofluorescence of an adult
sciatic nerve cross section using rabbit 1 anti-Mash2 antibody
(left) and mouse anti-p57kip2 antibody
(right), demonstrating that these two proteins are
coexpressed. Arrows indicate double-labeled
Schwann cells. Scale bars, 20 µm.
|
|
Gene expression profiles after sciatic nerve injury
We used quantitative RT-PCR (using GAPDH as reference gene) to
compare the expression levels of Mash2 with its target genes after
sciatic nerve crush. We measured transcript levels of Krox24, Mob-1,
CXCR4, and p57kip2 within the same RNA preparations and found that
Krox24 and Mob-1 were induced after sciatic nerve crush, being highest
at day 7 (Fig. 6A,B).
This is in agreement with previous data published by Topilko et al.
(1997) for Krox24 and with a role for Mash2 as a transcriptional
suppressor of Krox24 and Mob-1. However, we also observed
that both gene expression profiles experienced strong oscillations,
with transient minima at postlesion days 4 and 21. Currently, this
oscillatory expression behavior of Krox24 and Mob-1 cannot be
explained, but it indicates that apart from Mash2, other
transcriptional regulators influence the expression of these genes.
p57kip2 and CXCR4 expression, conversely, were found to decrease 2 d after the nerve was injured and to increase again thereafter (Fig.
6C,D), which supports our findings that both genes are
induced by Mash2. However, for CXCR4, no steady increase could be
observed, because 3 weeks after the lesion, expression levels were
found to be low again, suggesting additional transcriptional
regulator(s) with regeneration-associated activity acting on the
expression of this receptor gene.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 6.
Quantitative RT-PCR was used to determine relative
gene expression levels after sciatic nerve crush (control, unlesioned
adult rat sciatic nerve; 2-28 d, distal nerve stumps of lesioned
sciatic nerves 2-28 d after injury). A-D, In contrast
to Mash2, both genes, Krox24 (A) and Mob-1
(B), displayed increased transcript levels after
sciatic nerve crush, whereas CXCR4 (C) and
p57kip2 (D) were transiently downregulated. One
representative experiment of four is shown. GAPDH expression was used
as reference, and data are mean values ± SD.
|
|
 |
DISCUSSION |
Here, we describe the expression of the first cell-specific bHLH
factor found in Schwann cells. During Wallerian degeneration, this gene
becomes transiently downregulated, suggesting that high Mash2 activity
is linked to Schwann cell quiescence and maturation, an observation
that is in agreement with the lesion-induced expression of Id
transcriptional antagonists (Stewart et al., 1997 ). Although it has
been proposed that bHLH proteins control myelin gene expression (Thatikunta et al., 1999 ), we could demonstrate that Mash2 does not
affect PMP22 and P0 transcription, which suggests that additional bHLH
proteins must exist in Schwann cells. This is also supported by the
observation that in contrast to myelin genes or the myelination factor
Krox20 (Fig. 3E), the expression of Mash2 after nerve
transection is induced again (Fig. 1A). Nevertheless,
it appears that in lesion-induced dedifferentiation and
redifferentiation of Schwann cells, bHLH-mediated transcriptional
activities must be reduced, which is in agreement with Mash2 acting as
a negative regulator of Schwann cell proliferation. This might also
explain why it was not possible to generate stably transfected Schwann
cells (data not shown). In vivo, we found that myelinating
Schwann cells express this gene, which is of further interest
considering recent data about the role of bHLH transcription factors
and HLH proteins in oligodendrocyte differentiation (Kondo and Raff,
2000 ; Wang et al., 2001 ). Future experiments will reveal whether Mash2
is also expressed by oligodendrocytes and whether it affects their
differentiation and/or proliferation. It will also be interesting to
investigate whether the observed localization of a small fraction of
Mash2 proteins outside of the nucleus is a sign of posttranslational
regulation by means of protein shuttling, similar to what has been
proposed for Krox24 (Topilko et al., 1997 ). Conversely, endothelial
cells of nerve blood vessels were also found to express Mash2, but no
apparent regulation after nerve lesion was observed. Because Krox24 is known to be expressed by endothelial cells and to be induced after vascular injury (Khachigian et al., 1996 ), it remains to be shown whether Mash2 also responds to such lesions.
As our results demonstrate, Mash2 can act as both a transcriptional
repressor (for Krox24 and Mob-1) and activator (for CXCR4 and p57kip2),
and it is conceivable that, depending on the dimerization partner(s) or
the context of the regulatory element, Mash2-containing heterodimers
exert different regulatory functions. However, it must be emphasized
that there is no proof for direct interactions of the Mash2 protein
with the four target genes. Nevertheless, we noticed that the genomic
sequences of all four targets contain multiple E-box binding sites,
some of them occurring in the 5' upstream regions. Although their
functionality has yet to be demonstrated, our data indicate that Mash2
controls their transcriptional activities. In this respect, it is
important to note that the bHLH factors USF, c-myc, and YY1 were
recently shown to regulate CXCR4 expression by interacting with an
E-box located within the promoter region (Moriuchi et al., 1999 ).
The identification of downstream target genes is one way to reveal
molecular pathways that Mash2 is acting on and provides evidence for
possible cellular functions of this protein. Although our sorting
procedure resulted in only an enriched but not in a pure population of
transiently Mash2-transfected cells, we were able to demonstrate
unambiguously that Mash2 is a specific regulator of the Krox24, Mob-1,
CXCR4, and p57kip2 genes. The observed effect must be specific,
because, for example, the LNGFR gene was previously reported to be a
direct target of bHLH proteins (Chiaramello et al., 1995 ) but was not
affected by Mash2 in our assays (data not shown). Similarly, Krox24 was
proposed to act on the expression of LNGFR gene. Nevertheless, when
Mash2 suppressed Krox24 levels in our in vitro Schwann cell
model, we found that LNGFR expression was not changed, which is in
contrast to the antisense experiments performed by Nikam et al. (1995) .
During nerve development, Krox24 is found in Schwann cell precursors,
and after a second phase of expression after birth, this gene becomes
downregulated as myelination is initiated and resides in a small
cellular subpopulation (Topilko et al., 1997 ). These authors suggested
that these are nonmyelinating Schwann cells and Krox24 and Krox20
mutually suppressing each other. However, this latter assumption was
shown by Nagarajan et al. (2001) to be wrong. They used a similar DNA
array approach to identify Krox20 targets. Apart from myelin genes such
as P0 and PMP22, which we found not to be affected by Mash2, NGFI-A (Krox24) was among the induced genes. Therefore, Mash2 is thus far the
only known repressor of Krox24 in Schwann cells and can thus be
regarded as being involved in the maturation process, but not
necessarily as a myelination factor. Because we did not find
LNGFR-positive Schwann cells that expressed Mash2, we conclude that
this transcription factor is confined to the myelinating Schwann cell
lineage. This indicates that Krox24 is probably not specific to
non-myelin-forming cells and that it might be expressed at low levels
in some myelinating cells.
Our experiments revealed that the CDK inhibitor p57kip2 is highly
inducible by Mash2, and this is likely to be the reason for the reduced
proliferation rate of Mash2-overexpressing cells. We have recently
observed that after nerve crush, a number of cell cycle-specific
proteins were transiently upregulated, among them cyclinD1, cyclinD4,
and CDK4 (Bosse et al., 2001 ), providing additional evidence that tight
control of Schwann cell proliferation is important for nerve
regeneration. Interestingly, Mash2 and p57kip2 share a number of
features, for example, their expression in spongiotrophoblasts
(Takahashi et al., 2000 ) and colocalization in a cluster of imprinted
genes on human chromosome 11p15.5 and on mouse distal chromosome 7 (Guillemot et al., 1995 ; Hatada and Mukai, 1995 ; Matsuoka et al.,
1995 ). The analysis of p57kip2 knock-out mice and mutation screenings
implied that this gene is involved in the pathology of the
Beckwith-Wiedemann syndrome in humans, which is characterized by
congenital malformations, organomegaly, and childhood neoplasms (Reik
and Maher, 1997 ). Whether Mash2, as a potent activator of p57kip2
transcription, can be assigned a similar role is a tempting hypothesis
and awaits future analysis.
Furthermore, we found that chemokine signaling in peripheral nerves is
controlled by Mash2. The Mob-1 gene is the rat homolog of human and
mouse IP10 and CRG2 genes, respectively, and a number of different
studies have shown that this -chemokine binds to the CXCR3 receptor,
mediates the inflammatory response after tissue injury or infection,
and acts as chemoattractant for activated T-lymphocytes and monocytes
(Taub et al., 1993 ; Farber, 1997 ). IP10 was also proposed to play a
role in smooth muscle cell migration and proliferation and in astrocyte
chemoattraction (Wang et al., 1996 , 1998 ). In the CNS, IP10 expression
was found to be specifically induced both in focal stroke (Wang et al.,
1998 ) and in multiple sclerosis (MS) lesions (Simpson et al., 2000 ).
The finding that Schwann cells produce this proinflammatory cytokine is
new and implies that Mob-1 secretion after peripheral nerve injury is involved in the onset of degenerative events that are crucial for nerve
regeneration as both macrophages and lymphocytes invade the injured
nerve stump (Stoll et al., 1989 ; Moalem et al., 1999 ). Thus, Mash2
appears to be a Schwann cell-specific mediator of the injury-related
immune response. Future experiments will reveal whether cells other
than those of the immune system express the CXCR3 receptor and are thus
likely to respond to Mob-1.
The CXCR4 receptor is the murine counterpart of fusin, an HIV-1
entry coreceptor that is naturally activated on binding of the
-chemokine SDF-1 (Bleul et al., 1996 ; Nagasawa et al., 1996 ). A
number of different functions have been attributed to this signaling pathway, such as B-cell differentiation, T-lymphocyte attraction, and
induction of neuronal apoptosis (Nagasawa et al., 1996 ; Aiuti et al.,
1997 ; Hesselgesser et al., 1998 ). We recently demonstrated that the
expression of the three splice variants SDF-1 , SDF-1 , and
SDF-1 is widespread and that gene transcripts are also found in
oligodendrocytes and neurons of the adult brain and in Schwann cells of
peripheral nerves, suggesting functions outside of the immune system
(Gleichmann et al., 2000 ). The finding that CXCR4 is also expressed on
Schwann cells implies autocrine or paracrine signaling mechanisms, and
it is possible that the modulation of expression levels, such as the
transient downregulation after nerve lesion, is implicated in Schwann
cell differentiation, proliferation, or survival.
In conclusion, we have shown that Schwann cell dedifferentiation and
redifferentiation as it occurs in the injured peripheral nervous system
is accompanied by significant changes in Mash2 expression. We show that
Mash2 is a negative regulator of proliferation and provide strong
evidence that in cultured Schwann cells and in the peripheral nerves,
Mash2 is an upstream regulator of Krox24, Mob-1, CXCR4, and p57kip2.
Future experiments will reveal whether Mash2 exerts a similar role in
the myelinating glial cells of the CNS, and the construction and
detailed analysis of conditional mouse mutants should elucidate the
functional role or roles of Mash2 in vivo.
 |
FOOTNOTES |
Received December 19, 2001; revised March 27, 2002; accepted
May 29, 2002.
This work was supported by Deutsche Forschungsgemeinschaft Grant Mu
630/8-1. We thank B. Ziegler for preparation of rat Schwann cells, F. Bosse and M. Czardybon for supplying the CXCR4 cDNA, D. Abankwa for
help with gene expression array analysis, and T. Herdegen for the kind
gift of anti-Krox24 antibody.
Correspondence should be addressed to Dr. Patrick Küry,
Molecular Neurobiology Laboratory, Department of Neurology,
Heinrich-Heine University of Düsseldorf, Moorenstrasse 5, D-40225
Düsseldorf, Germany. E-mail:
kuery{at}uni-duesseldorf.de.
 |
REFERENCES |
-
Aiuti A,
Webb IJ,
Bleul C,
Springer T,
Gutierrez-Ramos JC
(1997)
The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood.
J Exp Med
185:111-120[Abstract/Free Full Text].
-
Angerer LM,
Cox KH,
Angerer RC
(1987)
Demonstration of tissue-specific gene expression by in situ hybridization.
Methods Enzymol
152:649-661[Web of Science][Medline].
-
Bermingham Jr JR,
Scherer SS,
O'Connell S,
Arroyo E,
Kalla KA,
Powell FL,
Rosenfeld MG
(1996)
Tst-1/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration.
Genes Dev
10:1751-1762[Abstract/Free Full Text].
-
Bleul CC,
Farzan M,
Choe H,
Parolin C,
Clark-Lewis I,
Sodroski J,
Springer TA
(1996)
The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry.
Nature
382:829-833[Medline].
-
Bosse F,
Küry P,
Müller HW
(2001)
Gene expression profiling and molecular aspects in peripheral nerve regeneration.
Restor Neurol Neurosci
18:1-14[Medline].
-
Britsch S,
Goerich DE,
Riethmacher D,
Peirano RI,
Rossner M,
Nave KA,
Birchmeier C,
Wegner M
(2001)
The transcription factor Sox10 is a key regulator of peripheral glial development.
Genes Dev
15:66-78[Abstract/Free Full Text].
-
Brockes JP,
Fields KL,
Raff MC
(1979)
Studies on cultured rat Schwann cells. I. Establishment of purified populations from cultures of peripheral nerve.
Brain Res
165:105-118[Web of Science][Medline].
-
Chiaramello A,
Neuman K,
Palm K,
Metsis M,
Neuman T
(1995)
Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.
Mol Cell Biol
15:6036-6044[Abstract].
-
Chomczynski P,
Sacchi N
(1987)
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:156-159[Web of Science][Medline].
-
Farber JM
(1997)
Mig and IP-10: CXC chemokines that target lymphocytes.
J Leukoc Biol
61:246-257[Abstract].
-
Fawcett JW,
Keynes RJ
(1990)
Peripheral nerve regeneration.
Annu Rev Neurosci
13:43-60[Web of Science][Medline].
-
Gillen C,
Gleichmann M,
Spreyer P,
Müller HW
(1995)
Differentially expressed genes after peripheral nerve injury.
J Neurosci Res
42:159-171[Web of Science][Medline].
-
Gleichmann M,
Gillen C,
Czardybon M,
Bosse F,
Greiner-Petter R,
Auer J,
Müller HW
(2000)
Cloning and characterization of SDF-1
, a novel SDF-1 chemokine transcript with developmentally regulated expression in the nervous system.
Eur J Neurosci
12:1857-1866[Web of Science][Medline]. -
Gratzner HG
(1982)
Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: a new reagent for detection of DNA replication.
Science
218:474-475[Abstract/Free Full Text].
-
Guillemot F
(1999)
Vertebrate bHLH genes and the determination of neuronal fates.
Exp Cell Res
253:357-364[Web of Science][Medline].
-
Guillemot F,
Nagy A,
Auerbach A,
Rossant J,
Joyner AL
(1994)
Essential role of Mash-2 in extraembryonic development.
Nature
371:333-336[Medline].
-
Guillemot F,
Caspary T,
Tilghman SM,
Copeland NG,
Gilbert DJ,
Jenkins NA,
Anderson DJ,
Joyner AL,
Rossant J,
Nagy A
(1995)
Genomic imprinting of Mash2, a mouse gene required for trophoblast development.
Nat Genet
9:235-242[Web of Science][Medline].
-
Haimoto H,
Hosoda S,
Kato K
(1987)
Differential distribution of immunoreactive S100-
and S100- proteins in normal nonnervous human tissues.
Lab Invest
57:489-498[Web of Science][Medline]. -
Hatada I,
Mukai T
(1995)
Genomic imprinting of p57KIP2, a cyclin-dependent kinase inhibitor, in mouse.
Nat Genet
11:204-206[Web of Science][Medline].
-
Herdegen T,
Kovary K,
Leah J,
Bravo R
(1991)
Specific temporal and spatial distribution of JUN, FOS and KROX-24 proteins in spinal neurons following noxious transsynaptic stimulation.
J Comp Neurol
313:178-191[Web of Science][Medline].
-
Hesselgesser J,
Taub D,
Baskar P,
Greenberg M,
Hoxie J,
Kolson DL,
Horuk R
(1998)
Neuronal apoptosis induced by HIV-1 gp120 and the chemokine SDF-1 alpha is mediated by the chemokine receptor CXCR4.
Curr Biol
8:595-598[Web of Science][Medline].
-
Jaegle M,
Mandemakers W,
Broos L,
Zwart R,
Karis A,
Visser P,
Grosveld F,
Meijer D
(1996)
The POU factor Oct-6 and Schwann cell differentiation.
Science
273:507-510[Abstract].
-
Jessen KR,
Mirsky R
(1999)
Schwann cells and their precursors emerge as major regulators of nerve development.
Trends Neurosci
22:402-410[Web of Science][Medline].
-
Jessen KR,
Morgan L,
Stewart HJ,
Mirsky R
(1990)
Three markers of adult non-myelin-forming Schwann cells, 217c(Ran-1), A5E3 and GFAP: development and regulation by neuron-Schwann cell interactions.
Development
109:91-103[Abstract].
-
Johnson JE,
Birren SJ,
Anderson DJ
(1990)
Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors.
Nature
346:858-861[Medline].
-
Khachigian LM,
Lindner V,
Williams AJ,
Collins T
(1996)
Egr-1-induced endothelial gene expression: a common theme in vascular injury.
Science
271:1427-1431[Abstract].
-
Kioussi C,
Gross MK,
Gruss P
(1995)
Pax3: a paired domain gene as a regulator in PNS myelination.
Neuron
15:553-562[Web of Science][Medline].
-
Kondo T,
Raff M
(2000)
Basic helix-loop-helix proteins and the timing of oligodendrocyte differentiation.
Development
127:2989-2998[Abstract].
-
Küry P,
Bosse F,
Müller HW
(2001)
Transcription factors in nerve regeneration.
Prog Brain Res
132:579-595.
-
Laemmli UK
(1970)
Cleavage of structural proteins during assembly of the head of bacteriophage T4.
Nature
227:680-682[Medline].
-
Lee MH,
Reynisdottir I,
Massague J
(1995)
Cloning of p57KIP2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution.
Genes Dev
9:639-649[Abstract/Free Full Text].
-
Liang P,
Averboukh L,
Zhu W,
Pardee AB
(1994)
Ras activation of genes: Mob-1 as a model.
Proc Natl Acad Sci USA
91:12515-12519[Abstract/Free Full Text].
-
Matsuoka S,
Edwards MC,
Bai C,
Parker S,
Zhang P,
Baldini A,
Harper JW,
Elledge SJ
(1995)
p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene.
Genes Dev
9:650-662[Abstract/Free Full Text].
-
Moalem G,
Monsonego A,
Shani Y,
Cohen IR,
Schwartz M
(1999)
Differential T cell response in central and peripheral nerve injury: connection with immune privilege.
FASEB J
13:1207-1217[Abstract/Free Full Text].
-
Moriuchi M,
Moriuchi H,
Margolis DM,
Fauci AS
(1999)
USF/c-Myc enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a coreceptor for HIV-1 entry.
J Immunol
162:5986-5992[Abstract/Free Full Text].
-
Müller HW,
Ignatius MJ,
Hangen DH,
Shooter EM
(1986)
Expression of specific sheath cell proteins during peripheral nerve growth and regeneration in mammals.
J Cell Biol
102:393-402[Abstract/Free Full Text].
-
Nagarajan R,
Svaren J,
Le N,
Araki T,
Watson M,
Milbrandt J
(2001)
EGR2 mutations in inherited neuropathies dominant-negatively inhibit myelin gene expression.
Neuron
30:355-368[Web of Science][Medline].
-
Nagasawa T,
Nakajima T,
Tachibana K,
Iizasa H,
Bleul CC,
Yoshie O,
Matsushima K,
Yoshida N,
Springer TA,
Kishimoto T
(1996)
Molecular cloning and characterization of a murine pre-B-cell growth-stimulating factor/stromal cell-derived factor 1 receptor, a murine homolog of the human immunodeficiency virus 1 entry coreceptor fusin.
Proc Natl Acad Sci USA
93:14726-14729[Abstract/Free Full Text].
-
Nikam SS,
Tennekoon GI,
Christy BA,
Yoshino JE,
Rutkowski JL
(1995)
The zinc finger transcription factor Zif268/Egr-1 is essential for Schwann cell expression of the p75 NGF receptor.
Mol Cell Neurosci
6:337-348[Medline].
-
Reik W,
Maher ER
(1997)
Imprinting in clusters: lessons from Beckwith-Wiedemann syndrome.
Trends Genet
13:330-334[Web of Science][Medline].
-
Scherer SS,
Wang DY,
Kuhn R,
Lemke G,
Wrabetz L,
Kamholz J
(1994)
Axons regulate Schwann cell expression of the POU transcription factor SCIP.
J Neurosci
14:1930-1942[Abstract].
-
Sherr CJ,
Roberts JM
(1999)
CDK inhibitors: positive and negative regulators of G1-phase progression.
Genes Dev
13:1501-1512[Free Full Text].
-
Simpson JE,
Newcombe J,
Cuzner ML,
Woodroofe MN
(2000)
Expression of the interferon-
-inducible chemokines IP-10 and Mig and their receptor, CXCR3, in multiple sclerosis lesions.
Neuropathol Appl Neurobiol
26:133-142[Web of Science][Medline]. -
Stewart HJ,
Zoidl G,
Rossner M,
Brennan A,
Zoidl C,
Nave KA,
Mirsky R,
Jessen KR
(1997)
Helix-loop-helix proteins in Schwann cells: a study of regulation and subcellular localization of Ids, REB, and E12/47 during embryonic and postnatal development.
J Neurosci Res
50:684-701[Medline].
-
Stoll G,
Griffin JW,
Li CY,
Trapp BD
(1989)
Wallerian degeneration in the peripheral nervous system: participation of both Schwann cells and macrophages in myelin degradation.
J Neurocytol
18:671-683[Web of Science][Medline].
-
Takahashi K,
Kobayashi T,
Kanayama N
(2000)
p57kip2 regulates the proper development of labyrinthine and spongiotrophoblasts.
Mol Hum Reprod
6:1019-1025[Abstract/Free Full Text].
-
Taub DD,
Lloyd AR,
Conlon K,
Wang JM,
Ortaldo JR,
Harada A,
Matsushima K,
Kelvin DJ,
Oppenheim JJ
(1993)
Recombinant human interferon-inducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells.
J Exp Med
177:1809-1814[Abstract/Free Full Text].
-
Thatikunta P,
Qin W,
Christy BA,
Tennekoon GI,
Rutkowski JL
(1999)
Reciprocal Id expression and myelin gene regulation in Schwann cells.
Mol Cell Neurosci
14:519-528[Medline].
-
Topilko P,
Schneider-Maunoury S,
Levi G,
Baron-Van Evercooren A,
Chennoufi AB,
Seitanidou T,
Babinet C,
Charnay P
(1994)
Krox-20 controls myelination in the peripheral nervous system.
Nature
371:796-799[Medline].
-
Topilko P,
Levi G,
Merlo G,
Mantero S,
Desmarquet C,
Mancardi G,
Charnay P
(1997)
Differential regulation of the zinc finger genes Krox-20 and Krox-24 (Egr-1) suggests antagonistic roles in Schwann cells.
J Neurosci Res
50:702-712[Web of Science][Medline].
-
Towbin H,
Staehelin T,
Gordon J
(1979)
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc Natl Acad Sci USA
76:4350-4354[Abstract/Free Full Text].
-
Wang S,
Sdrulla A,
Johnson JE,
Yokota Y,
Barres BA
(2001)
A role for the helix-loop-helix protein Id2 in the control of oligodendrocyte development.
Neuron
29:603-614[Web of Science][Medline].
-
Wang X,
Yue TL,
Ohlstein EH,
Sung CP,
Feuerstein GZ
(1996)
Interferon-inducible protein-10 involves vascular smooth muscle cell migration, proliferation, and inflammatory response.
J Biol Chem
271:24286-24293[Abstract/Free Full Text].
-
Wang X,
Ellison JA,
Siren AL,
Lysko PG,
Yue TL,
Barone FC,
Shatzman A,
Feuerstein GZ
(1998)
Prolonged expression of interferon-inducible protein-10 in ischemic cortex after permanent occlusion of the middle cerebral artery in rat.
J Neurochem
71:1194-1204[Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22177586-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
A. Heinen, D. Kremer, P. Gottle, F. Kruse, B. Hasse, H. Lehmann, H. P. Hartung, and P. Kury
The cyclin-dependent kinase inhibitor p57kip2 is a negative regulator of Schwann cell differentiation and in vitro myelination
PNAS,
June 24, 2008;
105(25):
8748 - 8753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Thurston, J. Taylor, J. Gardner, K. D Sinclair, and L. E Young
Monoallelic expression of nine imprinted genes in the sheep embryo occurs after the blastocyst stage
Reproduction,
January 1, 2008;
135(1):
29 - 40.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. D. Alonso, G. Zoidl, C. Taveggia, F. Bosse, C. Zoidl, M. Rahman, E. Parmantier, C. H. Dean, B. S. Harris, L. Wrabetz, et al.
Identification and Characterization of ZFP-57, a Novel Zinc Finger Transcription Factor in the Mammalian Peripheral Nervous System
J. Biol. Chem.,
June 11, 2004;
279(24):
25653 - 25664.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|