 |
Previous Article | Next Article 
The Journal of Neuroscience, September 15, 2002, 22(18):8101-8109
Extrasynaptic 7-Nicotinic Acetylcholine Receptor Expression in
Developing Neurons Is Regulated by Inputs, Targets, and
Activity
Craig L.
Brumwell,
James L.
Johnson, and
Michele H.
Jacob
Department of Neuroscience, Tufts University, Sackler School of
Biomedical Sciences, Boston, Massachusetts 02111
 |
ABSTRACT |
7-Nicotinic acetylcholine receptors (nAChRs) are widely
expressed in the vertebrate nervous system. 7-nAChR functions
include postsynaptic transmission, modulating neurotransmitter release, reinforcing nicotine addiction, and a role in neurological disorders, such as schizophrenia and Alzheimer's disease. In chick
parasympathetic ciliary ganglion (CG) neurons, 7-nAChRs are excluded
from the synapse and localize perisynaptically. Despite their
extrasynaptic distribution, the highly
Ca2+-permeable 7-nAChRs have important
synapse-related Ca2+-dependent signaling functions
in the CG. We show here that the synaptic partners regulate 7-nAChR
expression during synapse formation in embryonic CG neurons in
situ. The absence of inputs and target tissues cause reductions
in 7-nAChR mRNA and protein levels that primarily resemble
those seen for synaptic 3-nAChRs. However, there is a difference in
their regulation. 7-nAChR levels are downregulated by reduced
activity, whereas 3-nAChR levels are not. We propose that the
activity-dependent regulation of extrasynaptic 7-nAChR levels may be
an important mechanism for postsynaptic CG neurons to detect changes in
presynaptic activity levels and respond with
Ca2+-dependent plasticity changes in gene expression.
Key words:
nicotinic acetylcholine receptor; nAChR; 7; 3; neuron-specific gene expression; synapse formation; innervation; target
tissue interactions; induction; electrical activity; visual
deprivation; ciliary ganglion; neuron
 |
INTRODUCTION |
Synapses are essential for
intercellular communication and rapid information processing in the
nervous system. Given their central role in neural function, it is
surprising that the mechanisms that regulate interneuronal synapse
differentiation are still primarily undefined. Within a single neuron,
multiple types of neurotransmitter receptors are active and targeted to
discrete synaptic regions for proper function. The expression of
receptors that concentrate at the postsynaptic membrane is regulated by both presynaptic inputs and retrograde signals from the target tissues
(Levey et al., 1995 ; Broide et al., 1996 ; Levey and Jacob, 1996 ; Zhou
et al., 1998 , 2001 ; Devay et al., 1999 ). We define here the regulatory
effects of synaptic partners on the expression of receptors that are
excluded from the synapse and restricted to perisynaptic regions of the
neuron surface membrane.
Nicotinic acetylcholine receptors (nAChRs) mediate fast excitatory
synaptic transmission through the chick parasympathetic ciliary
ganglion (CG). Chick CG neurons express two distinct types of nAChRs,
3-nAChRs and 7-nAChRs, that differ in their subunit composition
and spatial distribution. 3-nAChRs, composed of 3, 5, and 4
(occasionally 2) subunits, are concentrated in the specialized
postsynaptic membrane (Jacob et al., 1986 ; Loring and Zigmond, 1987 ;
Vernallis et al., 1993 ). In contrast, 7-nAChRs, composed of 7
subunits, are excluded from the synapse at all ages ranging from early
embryonic to reproductively mature adult CGs (Jacob and Berg, 1983 ;
Loring et al., 1985 ; Vernallis et al., 1993 ; Conroy and Berg, 1995 ;
Horch and Sargent, 1995 ; Shoop et al., 1999 ). The 7-nAChRs are
restricted to perisynaptic regions in which they accumulate on the
surface membrane of short dendrites that emerge from the postsynaptic
neuron in the region of innervation. Presynaptically released
acetylcholine activates both nAChR types, but their functional
properties differ. Compared with 3-nAChRs, the 7-nAChRs have
higher calcium permeability and faster activation and desensitization
kinetics (Ullian et al., 1997 ; Chang and Berg, 1999 ). The different
properties and spatial segregation of the two receptor types are likely
to create functionally specialized synapse-associated microregions.
Perisynaptic 7-nAChR activation is required for reliable synaptic
transmission and synchronous firing at early embryonic ages (Chang and
Berg, 1999 ). However, during synapse maturation at older embryonic
ages, 7-nAChRs are not required for reliable synaptic transmission
but have other synapse-related,
Ca2+-dependent functions in CG neurons.
Specifically, extrasynaptic 7-nAChRs mediate process remodeling,
neuron survival, and Ca2+-dependent
synaptically regulated changes in gene expression (Pugh and Berg, 1994 ;
Pugh and Margiotta, 2000 ; Chang and Berg, 2001 ).
We report here the first in vivo analysis of the role of
innervation and target tissues in regulating 7-nAChR expression during interneuronal synapse formation. We show that synaptic partners
regulate the developmental expression of receptors that are excluded
from the synapse. The absence of innervation and target tissues produce
changes in extrasynaptic 7-nAChR subunit mRNA and protein levels
that primarily parallel those seen for synaptic 3-nAChR subunits in
embryonic chick CG neurons (Levey at al., 1995 ). However, there is a
difference in the regulation of the two nicotinic receptor types.
7-nAChR levels are downregulated by visual deprivation-reduced
activity, whereas 3-nAChR levels are not. Our findings suggest that
7-nAChRs have a unique synapse-related function as activity sensors
in postsynaptic CG neurons.
 |
MATERIALS AND METHODS |
Chick embryos, staging, and surgical manipulations.
White Leghorn embryonated chick eggs (Spafas, Norwich, CT) were
maintained at 37°C in a forced-draft turning incubator until use.
Embryos were staged according to the classification scheme of Hamburger and Hamilton (1951) . Surgical micromanipulations to prevent
preganglionic innervation or postganglionic target tissue interactions
were performed as described in detail previously (Arenella et al., 1993 ; Dourado et al., 1994 ). Briefly, the sole source of presynaptic input, the accessory oculomotor nucleus, was ablated bilaterally at
embryonic day 3.5 (E3.5) to E4, or the developing optic vesicle, which
contains the target muscles, was unilaterally removed at E2. The
surgeries are timed to precede synaptogenesis. To obtain ganglia
deprived of both innervation and target tissues, the developing eye was
removed at E2 and the preganglionic nucleus at E3.5-E4 in the same
embryo (Levey et al., 1995 ). To ensure the complete removal of
preganglionic and postganglionic tissues, ganglia were only dissected
from embryos lacking visible preganglionic connections to the CG and
residual eye structures. The complete removal of all preganglionic
neurons and the absence of aberrant innervation from other sources or
intraganglionic contacts were established by paraffin histological
examination of the brain of operated embryos, by immunocytochemical
labeling with monoclonal antibodies (mAbs) to synaptic vesicle
antigens, and by ultrastructural analysis (Engisch and Fischbach, 1992 ;
Arenella et al., 1993 ). CGs from normal-developing, operated and
sham-operated embryos were dissected at selected stages of synapse
formation and maturation, ranging from E5 to E15. CGs were immediately
frozen in liquid nitrogen and stored at 80°C until use for reverse
transcription (RT)-PCR or were fixed and processed for histochemical staining.
Quantitative RT-PCR. Quantitative RT-PCR was performed as
described previously, with the following modifications to optimize amplification of 7 mRNA in individual CGs (Levey et al., 1995 ; Levey
and Jacob, 1996 ). Briefly, total RNA was extracted from individual
ganglia by the guanidinium isothiocyanate-hot phenol method (Feramisco
et al., 1982 ) as modified by the addition of glycogen as carrier. Known
concentrations of an 7-nAChR mutated cRNA internal standard,
equivalent to the quantity of that transcript present in that age
operated or control ganglion (as determined initially by competitive
RT-PCR), were added to the ganglion at the start of RNA extraction. The
use of serial dilutions of internal standard in competitive PCR
demonstrated that PCR amplification of 7 is linear over the
concentration range of 7 transcripts in operated and control CGs.
7 mutated standard was generated by site-directed mutagenesis with
PCR (Higuchi et al., 1988 ) and resembles the region of the cellular
7 mRNA targeted for amplification with the exception of two base
pair changes [at nucleotides (nt) 1170 and 1172] required to replace
an existing TaqI restriction endonuclease site with a novel
XbaI site. Mutated 7 product was subcloned in pCR vector
(Invitrogen, San Diego, CA) and sequence verified (Sequenase version
2.0; Stratagene, La Jolla, CA). cRNA was generated by in
vitro transcription (MEGA short script; Ambion, Austin, TX), and
the concentrations were determined by OD260
measurements. Ganglionic RNA and the mutated 7 internal standard
cRNA were amplified by quantitative RT-PCR in the presence of
[ 32-P]dCTP using 7-specific
primers. The 7 sense and antisense primers correspond to regions in
exons 9 and 10 and flank the cytoplasmic domain between transmembrane
regions III and IV (Couturier et al., 1990 ). The sequence of the
forward primer is 5' TGATTATTGTTGGCCTCTCTG (nt 906-926). The reverse
primer is 5' TGGTGCTGACATTAAGATGCC (nt 1457-1477). Briefly,
single-stranded cDNA was synthesized by Moloney murine leukemia virus
reverse transcriptase (MMLV-RT) (Promega, Madison, WI) and specific
priming with the 7 reverse primer. The 20 µl reaction contained
RNA from one CG, 10 µM antisense primer, 250 µM each dNTP, 0.5 U of RNasin (Promega), 0.1 M dithiothreitol, 20 U of MMLV-RT, and buffer.
The RNA and the antisense primer were heat denatured and then reverse
transcribed for 1 hr at 42°C. Single-stranded cDNA was amplified by
PCR in a programmable thermocycler (MJ Research, Watertown, MA) in a
final volume of 20 µl. First, enzyme buffer,
dH20, dNTPs, 1.5 mM
MgCl2, 10 µM sense
primer, and Ampliwax to reduce nonspecific priming (Stratagene) were
heated at 80°C for 5 min and then allowed to cool. To the top of the wax layer, we added buffer, 1.0 U of TaqDNA polymerase
(Promega), 10 nCi of [ 32-P]dCTP
(DuPont NEN, Boston, MA), and 2 µl of the RT product. The samples
were heat denatured at 94°C for 2 min, amplified (30 cycles:
denaturation at 94°C for 40 sec, primer annealing at 63°C for 1 min, and DNA extension at 72°C for 1.5 min), and incubated for a
final 10 min at 72°C to complete extension. For comparison with 7,
3 transcript levels and c 4-tubulin transcript levels, as a
negative control, were also measured by quantitative RT-PCR with 3
and c 4-tubulin mutated internal standard cRNAs, respectively, and
specific primers as reported previously (Levey et al., 1995 ; Levey and
Jacob, 1996 ), but using Ampliwax and the higher annealing temperature
detailed above. Restriction enzyme mapping and gel electrophoresis were
used to distinguish PCR products derived from the mutated standards and
the ganglionic mRNAs. Fragments were transferred to a Zeta probe
blotting membrane (Bio-Rad, Hercules, CA) and exposed x-ray film. The
ratio of the ganglionic mRNA products and the mutated standard products
was determined by densitometric scanning (PDI densitometer; PDI,
Huntington Station, NY) of the resulting autoradiogram.
Neuronal cell counts. Neuron numbers in normal developing
ganglia were taken from Landmesser and Pilar (1974) and Furber et al.
(1987) . Neuron numbers in CGs from operated and sham-operated embryos
at E8 and E12-E14 were determined as described previously (Levey et
al., 1995 ). Briefly, ganglia were fixed, processed for paraffin
histology, serially sectioned at 8 µm, and stained with toluidine
blue (Arenella et al., 1993 ). All neurons possessing a nucleus with a
distinct nucleolus were counted in each section of the ganglion. Cell
counts were corrected for double counting by the method of Abercrombie
(1946) .
Histochemical staining procedures. 7-nAChR levels were
examined in CG neurons of operated and control embryos by histochemical staining of frozen ganglion sections. CGs were dissected from normal,
sham-operated and operated embryos at ages ranging from E5 to E18
(stages 25-44). Ganglia were lightly fixed with 0.25% paraformaldehyde in PBS under vacuum for 1 hr, embedded, and frozen sectioned as described previously (Jacob, 1991 ; Arenella et al., 1993 ).
Sections (8-µm-thick) of age-matched CGs from operated and control
embryos were mounted on the same slide and processed in parallel for
comparison of 7-nAChR staining. The sections were rinsed in PBS
containing 0.75% glycine to reduce nonspecific staining, incubated
with biotinylated -bungarotoxin ( -Bgt) (Molecular Probes, Eugene,
OR) at 1:100 or 1:200 dilution in PBS for 1 hr, rinsed in PBS with 0.5 M NaCl, and incubated for 40 min with an avidin-biotinylated horseradish peroxidase (HRP) complex (Vectastain Elite ABC kit; Vector Laboratories, Burlingame, CA) that was prepared in PBS according to the instructions of the manufacturer.
Alternatively, some sections were incubated with biotinylated -Bgt
at 1:40 dilution and streptavidin-HRP conjugate (Vector Laboratories)
at 1:20 dilution in PBS. The sections were then reacted for peroxidase
activity and mounted as described previously (Jacob, 1991 ; Arenella et al., 1993 ) and viewed by bright-field microscopy with a Zeiss (Thornwood, NY) Axioskop microscope. To establish the
specificity of -Bgt staining, a few slides from each experiment were
processed as described above, except that biotinylated -Bgt was
replaced with PBS.
For comparison with the 7-nAChR staining levels, alternate frozen
ganglion sections from the operated, sham-operated and normal embryos
were immunolabeled for three other neuron-specific components, synaptic
vesicle protein SV2 and two microtubule-associated proteins, MAP1B and
MAP2, as described previously (Arenella et al., 1993 ). The anti-SV2
mouse mAb to the synaptic vesicle transmembrane transporter (generously
provided by Dr. Kathleen Buckley, Harvard Medical School, Boston, MA)
was used at a 1:100 dilution in PBS. The anti-MAP1B-2 mouse mAb to
MAP1B and the anti-MAP2 mouse mAb (the generous gift from Dr. Richard
Vallee, Columbia University, New York, NY) were both used at a 1:200
dilution in PBS.
Visual deprivation. White Leghorn chicks were hatched in a
darkened incubator in our laboratory, raised in complete darkness (dark
reared) in temperature-controlled brooders, and force-fed as described
previously (Gottlieb et al., 1987 ). All other newly hatched chicks were
maintained on a 12 hr light/dark cycle (diurnally reared). In one group
of the diurnally reared chicks, we covered one eye with an opaque black
plastic dome-like goggle (light-tight occluder) to prevent light entry
and visual function. The occluder (kindly provided by Dr. Josh Wallman
of City College of New York, New York, NY) was glued to the
circumorbital feathers and skin surrounding the eye (Wallman et al.,
1978 ; Gottlieb et al., 1987 ; Shih et al., 1993 ). The CG from the
contralateral untreated eye served as an internal control. To control
for nonspecific effects of covering the eye, a clear occluder was
applied over one eye in separate chicks. Treatments started at hatching
and lasted for 1 or 2 weeks. In all conditions, food and water were
available ad libitum.
nAChR assays. The total number of 7-nAChRs (surface plus
internal) in CGs from visually deprived and control newly hatched chicks was determined. A filter assay was used to measure specific binding of 125I- -Bgt to CG detergent
extracts as described previously (Jacob and Berg, 1987 ). For comparison
with 7-nAChRs, 3-nAChR levels were measured using
125I-mAb-35 binding to CG detergent
extracts and separation of the bound
125I-mAb-35 by ion exchange chromatography
on DEAE-cellulose (Jacob and Berg, 1987 ). Specific binding was
calculated as the difference between total binding and nonspecific
binding, in which nonspecific binding was determined by including a
40-fold excess of cold ligand in the binding reaction. The amount of
specific binding per ganglion was normalized for the relative amount of
total protein. Total ganglionic protein was measured in detergent
extracts by the microtiter protein assay (Bio-Rad) as performed
according to the instructions of the manufacturer.
 |
RESULTS |
7 subunit mRNA levels increase dramatically
during synaptogenesis
7 transcript levels in individual chick CGs were established at
landmark stages of synapse formation and maturation, ranging from E5 to
E15 (Fig. 1). Innervation precedes target
tissue synapse formation in the CG. Innervation begins at E4.5, and, by
E8, functional chemical synapses are present on every neuron
(Landmesser and Pilar, 1972 ; Jacob, 1991 ). From E8.5 to E14, CG neurons
establish functional connections with their target cells, striated and
smooth muscles in the eye (Meriney and Pilar, 1987 ; Pilar et al.,
1987 ).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1.
7 subunit transcript levels increase during
preganglionic and postganglionic synapse formation and then plateau in
embryonic CG neurons in situ. Absolute amounts of 7
subunit mRNAs were measured in individual ganglia at landmark stages of
synaptogenesis by using quantitative RT-PCR with a mutated 7 cRNA
internal standard. Values are normalized to the number of transcript
copies per neuron to account for developmental changes in neuron
number. Each value represents the mean ± SEM of the number of
separate determinations indicated for each time point. For comparison,
synaptic 3 subunit mRNA levels were measured at three key stages of
preganglionic and postganglionic synapse formation. 7 transcript
levels increase ninefold from E5 to E15 and are twofold greater than
3 mRNA levels at all stages of synaptogenesis examined.
|
|
The absolute levels of 7 mRNA per ganglion were measured using
quantitative RT-PCR and known concentrations of a mutated 7 cRNA
internal standard. The internal standard differed from the targeted
7 sequence by two base pair changes introduced to create a novel
restriction enzyme site (XbaI) and remove an existing site
(TaqI). 7 transcript levels were normalized to account
for declines in CG neuron number attributable to naturally
occurring cell death from E9 to E14, with greater declines occurring in CGs surgically deprived of synaptic interactions (see below)
(Landmesser and Pilar, 1974 ; Furber et al., 1987 ; Levey et al.,
1995 ).
7 subunit mRNA levels per CG neuron increase ninefold during
preganglionic and postganglionic synapse formation in situ, from E5 to E15 (Fig. 1). The greatest rise occurs between E8.25 and
E12, during the time of target tissue innervation and maturational changes in the efficacy and morphology of preganglionic inputs, with
calyces forming on the ciliary neurons (Landmesser and Pilar, 1972 ).
Similar to the developmental increases in extrasynaptic 7 subunit
mRNA, synaptic 3, 4, and 5 subunit transcript levels per CG
neuron rise 7-, 5-, and 16-fold, respectively, over the same time
course, from E4 to E15 (Fig. 1) (Corriveau and Berg, 1993 ; Levey and
Jacob, 1996 ). 7 mRNA levels are twofold more abundant than 3
transcripts at all of the stages of synapse formation examined (Fig.
1). A similar difference between 7 and 3 mRNA levels in embryonic
CG neurons was observed by quantitative RNase protection assays
(Corriveau and Berg, 1993 ). The temporal correlation of the increases
in 7 subunit mRNA levels with preganglionic and postganglionic
synapse formation suggests that innervation and target tissues may
induce the rise.
7 transcript levels are lower in the absence of
synaptic partners
To determine the respective roles of innervation and target
tissues in inducing the developmental increases in 7, we measured 7 subunit mRNA levels in CG neurons surgically deprived of these synaptic partners in situ. To prevent innervation, we
bilaterally ablated the sole source of presynaptic inputs, the
accessory oculomotor nucleus in the midbrain. To prevent target tissue
interactions, we unilaterally removed the developing optic vesicle,
with the contralateral ganglion serving as an internal control (Levey
et al., 1995 ). Surgeries were performed before synaptogenesis and cause
no direct damage to CG neurons or transection of their processes. Neuron numbers are reduced because of the removal of sources of trophic
support (data not shown) (Landmesser and Pilar, 1974 ; Furber et al.,
1987 ; Levey et al., 1995 ). Importantly, a stable population of neurons
is retained in all operated conditions. These neurons are healthy based
on ultrastructural and electrophysiological criteria and the
demonstration of normal levels of specific mRNAs and proteins (Engisch
and Fischbach 1990 , 1992 ; Arenella et al., 1993 ; Dourado et al., 1994 ;
Levey et al., 1995 ; Ikonomov et al., 1998 ). Input-deprived CG neurons
form synapses on their target tissues, whereas innervation is
established and maintained on target-deprived neurons (Landmesser and
Pilar, 1974 ; Furber et al., 1987 ).
7 subunit mRNA levels are decreased in CG neurons that have
developed in the absence compared with the presence of synaptic partners in situ (Fig. 2,
Table 1). In presynaptic
input-deprived neurons, the number of 7 transcript copies is
reduced to 70 and 80% of sham-operated control neuron values at E8 and
E12-E14, respectively. Compared with input deprivation, there are
greater decreases in 7 mRNA levels in CG neurons that developed in
the absence of the target tissues. Specifically, in target-deprived neurons, 7 transcript levels are 50% of contralateral control neuron values at both E8 and E12-E14. E8 precedes the time of peripheral synapse formation, but axons from CG neurons are already in
the vicinity of the developing target tissues (Meriney and Pilar, 1987 ;
Pilar et al., 1987 ). Thus, the decrease in 7 transcripts in E8
target-deprived neurons suggests that soluble factors from the target
muscles retrogradely influence 7 transcript levels before synaptic
contact. Overall, both inputs and target tissues regulate 7 mRNA
levels during synapse formation and maturation in CG neurons.

View larger version (35K):
[in this window]
[in a new window]
|
Comparison of the decreases in extrasynaptic 7 subunit mRNA
levels relative to those seen for synaptic 3, 4, and 5 subunit
mRNAs in CG neurons deprived of input, targets, and both synaptic
partners. Data are expressed as the fold change in the absolute levels
of nAChR subunit mRNA per neuron in the test condition relative to
controls. For input-deprived CGs and both input- and target-deprived
CGs, the sham-operated age-matched CGs are used as controls, whereas
target-deprived CGs are compared with the contralateral control CG from
the same embryo. The 7 mRNA data are from Figure 2, and the 3,
4, and 5 mRNA values are from Levey et al. (1995) .
, Not significantly different from control values; Student's
t test.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2.
7 transcript levels are reduced in CG neurons
that have developed in the absence versus the presence of innervation,
target tissues, or both synaptic partners. The absolute amounts of 7
subunit mRNA were determined in individual ganglia from operated
(gray) and control (black) embryos
at E8 and E12-E14 using quantitative RT-PCR. The values are expressed
as the number of transcript copies per neuron to normalize for changes
in neuron number after the surgeries. Results represent the mean ± SEM. The number of ganglia assayed is shown above each
bar. Ganglia deprived of inputs and both inputs and
targets are compared with age-matched, sham-operated ganglia, whereas
ganglia deprived of targets are compared with their contralateral
control ganglia. Asterisks indicate statistically
significant differences based on the Student's two-sided
t test; **p < 0.01;
***p < 0.001.
|
|
To test for additive effects, both innervation and target tissue
interactions were prevented from forming in single embryos. 7
transcript levels per neuron are lowest in CGs from these
double-operated embryos, being decreased to 30-35% of control neuron
values at both E8 and E12-E14 (Fig. 2, Table 1). Input and target
tissue interactions have additive effects because 7 mRNA levels are significantly lower in CGs from double-operated embryos compared with
the levels in CGs deprived of input alone and target alone (for
input-deprived CGs, p < 0.005 for E8 and
p < 0.001 for E12-E13; for target-deprived CGs,
p < 0.05 for E8 and p < 0.01 for
E12-E13; Student's t test). In the absence of both
synaptic partners, 7 transcript levels remain low relative to
control values but increase threefold over time in situ,
from E8 to E14 (Fig. 2), indicating that other regulatory influences,
in addition to inputs and target tissues, induce 7 expression. As
independent confirmation of the quantitative RT-PCR results, Northern
blot analyses show similar declines in 7 mRNA levels for all
operated conditions when the data are normalized per neuron number
(data not shown).
The declines in 7 transcript levels in the absence of inputs and
target tissues are specific. mRNA levels for c 4-tubulin, a
neuron-specific form of -tubulin (Sullivan et al., 1986 ; Lee et al.,
1990 ), are not altered over the same time course in CGs from operated
embryos, resembling our previous findings for c 4-tubulin (data not
shown) (Levey et al., 1995 ; Ikonomov et al., 1998 ).
These regulatory changes in extrasynaptic 7 subunit transcript
levels closely resemble the declines in synaptic 3-nAChR subunit
mRNA levels in CGs from operated embryos (Levey et al., 1995 ).
Transcripts encoding subunits of the extrasynaptic nAChRs and synaptic
nAChRs, 7, and 3, 4, and 5, respectively, are reduced to a
similar extent, 1.4- to 2-fold, in the absence of inputs and targets.
The only exception is that 5 mRNA levels are not significantly
altered in target-deprived embryonic CG neurons but are decreased by
input deprivation (Table 1) (Levey et al., 1995 ). Thus, the
developmental expression of extrasynaptic 7-nAChR and synaptic
3-nAChR subunit mRNAs is primarily regulated in parallel by synaptic interactions.
Altogether, the data demonstrate that innervation and target tissues
induce increases in perisynaptic 7 subunit mRNA levels during
synapse formation in embryonic chick CG neurons in situ. Retrograde signals from the target tissues have the greater regulatory effects. The additive effects of removing both inputs and targets suggest that the two different synaptic partners provide distinct regulatory signals.
7-nAChR protein levels are reduced in the absence of
synaptic partners
For comparison with 7 transcripts, we examined the regulatory
changes in 7-nAChR protein levels after the surgical manipulations. Qualitative changes in 7-nAChR levels were detected by histochemical staining of frozen ganglionic sections using -Bgt that specifically binds to 7 subunits in chick CG neurons and HRP for visualization (Jacob and Berg, 1983 ; Smith et al., 1985 ; Conroy and Berg, 1995 ). The
7-nAChR staining is primarily intracellular and associated with
organelles that function in the synthesis, processing, and transport of
integral plasma membrane proteins (Carbonetto and Fambrough, 1979 ;
Jacob et al., 1986 ). In comparison, surface 7-nAChRs are not readily
detected in the thin cryostat sections.
In neurons deprived of synaptic partners, less intense 7-nAChR
staining is present in the somata relative to age-matched control
neurons, suggesting a decline in the number of 7-nAChRs in the
internal biosynthetic pool (Fig. 3).
Compared with the declines in input-deprived neurons (Fig.
3B), greater decreases in 7-nAChR protein levels are seen
in the absence of target tissues (Fig. 3D). The lowest
7-nAChR levels are present in neurons deprived of both inputs and
targets (Fig. 3F). The declines are specific: there
are no detectable differences in the relative levels of soma
immunoreactivity for three other neuron-specific components, the
synaptic vesicle protein SV2 and two microtubule-associated proteins
MAP1B and MAP2 in synaptic partner-deprived CG neurons compared with
control neurons (Fig. 3G,H) (Arenella et
al., 1993 ). In summary, the histochemical staining data demonstrate
qualitative reductions in 7-nAChR protein levels that resemble the
quantitative changes in 7 mRNA levels in CG neurons from operated
embryos. The correlation suggests that the regulation of 7-nAChR
expression may occur at the level of gene transcription.

View larger version (189K):
[in this window]
[in a new window]
|
Figure 3.
7-nAChR staining is specifically
reduced in CG neurons deprived of synaptic partners compared with
control neurons. Cryostat sections of CGs from operated and control
embryos at E12-E14 were incubated with biotinylated -Bgt followed
by streptavidin-HRP. The sections were then reacted for peroxidase
activity and examined by bright-field microscopy. A,
Sham-operated E14 CG; B, input-deprived E14 CG;
C, contralateral control E12 CG; D,
target tissue-deprived E12 CG; E, staining control E14
CG; F, both input- and target-deprived E12 CG. Most of
the neuronal somata are intensely stained in the unoperated control
ganglion sections (A, C). The interiors
of the somata are filled with HRP reaction product deposits, with the
exception of the nuclei, which, when visible, are not stained above
background levels (E). In contrast, the majority
of the neuronal somata are moderately stained in the input-deprived
ganglion section (B), only lightly stained in the
target-deprived ganglion section (D), and just
slightly stained above background levels in the input- and
target-deprived ganglion section (F). Specific
-Bgt staining is demonstrated by the absence of HRP reaction product
in the sham-operated E14 ganglion section that was incubated with PBS
in place of biotinylated -Bgt (C). In contrast
to the declines in 7-nAChRs, similar relative levels of MAP2
immunolabeling are present in the input- and target-deprived E8
ganglion section (H) and the sham-operated
E8 ganglion section (G). Intense MAP2
immunoperoxidase labeling fills the soma and dendrites of the
developing CG neurons in G and H. The
decreases in 7-nAChR levels are specific. Scale bar:
A-F, 30 µm; G, H, 35 µm.
|
|
Reduced activity specifically lowers 7-nAChR, but not
3-nAChR, levels
To identify the regulatory signals provided by synaptic partners,
we examined the effects of activity on 7-nAChR protein levels in CGs
neurons of newly hatched chicks. We used visual deprivation to greatly
reduce activity in the retinal input pathway to the CG without directly
damaging the intercellular connections (Shih et al., 1993 : Pendrak et
al., 1995 ). Visual deprivation was achieved by either dark rearing of
chicks immediately after hatching in a darkened incubator or
application of a light-tight occluder over one eye, with the
contralateral uncovered eye serving as an internal control. These
approaches prevent light entry and greatly reduce activity in the
retina that drives the central visual pathway that innervates the CG
neurons (Gamlin et al., 1982 , 1984 ; Gamlin and Reiner, 1991 ). Previous
reports show that visual deprivation (monocular occlusion or lid
suture) significantly reduces by 28% the activity of choline
acetyltransferase (ChAT), the acetylcholine biosynthetic enzyme, in the
CG (Pendrak et al., 1995 ).
Visual deprivation decreases the total number of 7-nAChRs per
ganglion as detected by specific
125I- Bgt binding in ganglionic
detergent extracts and normalizing for protein. Dark rearing for 1 week
reduces 7-nAChR levels per ganglion to 75% of control diurnally
reared chick CG values (p < 0.05; Student's
t test) (Fig. 4). No
additional decline is observed at 2 weeks of dark rearing. Similarly,
light-tight patching one eye for 1 week reduces 7-nAChRs to 85% of
the contralateral control CG value, a small but significant decrease
(p < 0.025; Student's paired t
test) (Fig. 4). Compared with dark rearing, monocular occlusion is less
effective at reducing activity because there are some bilateral
afferent projections in the central visual pathway to the CG (Gamlin et
al., 1982 ; Gamlin and Reiner, 1991 ). As a negative control, covering
the eye with a clear occluder for 1 week, which permits light entry and
visual function, has no significant effect on 7-nAChR levels (Fig.
4). The declines in 7-nAChRs observed after visual deprivation
represent reductions in the number of receptors rather than decreases
in the affinity of receptor for the toxin probe as determined by
increasing the concentration of
125I- Bgt threefold in the standard
binding assay (data not shown). In all of these experiments, the number
of 7-nAChRs was calculated assuming, for convenience, a 1:1
stoichiometry of -Bgt bound to receptor. The number of -Bgt
binding sites per receptor is not known (Chen and Patrick, 1997 ;
Rangwala et al., 1997 ). However, the exact stoichiometry is not
important for the present studies, which depend only on a comparison of
the relative amounts of 7-nAChRs.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 4.
Visual deprivation downregulates 7-nAChR
levels, but not 3-nAChRs, in newly hatched chick CG neurons. Visual
deprivation was used to reduce activity in retinal inputs to CG
neurons. Chicks were either dark reared immediately after hatching, or
a light-tight occluder was applied over one eye, with the contralateral
uncovered eye serving as an internal control. Dark-reared chick CGs are
compared with diurnally reared chick CGs at matched ages. To control
for nonspecific effects of covering the eye with a plastic goggle, a
clear occluder was applied on separate chicks. The total number of
7-nAChRs per ganglion was determined by the specific binding of
125I- -Bgt in ganglionic detergent extracts. Results
represent the mean ± SEM of the specific activity (the number of
binding sites per ganglionic protein) of the test, with both the mean
and SEM values normalized to the mean of the appropriate control. The
number of separate determinations is indicated above each
bar. The hatched line represents the
control diurnally reared chick CG value. For comparison with
7-nAChRs, the total number of 3-nAChRs was assayed in separate
ganglia using 125I-mAb-35. 7-nAChR levels are reduced in
visually deprived chick CGs, whereas 3-nAChR levels are not.
Asterisks indicate statistically significant differences
in the raw data of Bgt-specific activities in test versus control CGs
based on the Student's t test for dark-reared chicks
and the Student's paired t test for monocular occluded
chicks; **p < 0.05 and *p < 0.025, respectively.
|
|
In contrast to the declines in 7-nAChRs seen with visual
deprivation, 3-nAChR levels are not altered. Neither dark rearing nor monocular occlusion produce a significant change in the total number of 3-nAChRs per ganglion as detected by specific
125I-mAb-35 binding in ganglionic
detergent extracts and normalizing for protein (Fig. 4). These
unexpected results suggest that reduced activity regulates the levels
of extrasynaptic 7-nAChRs but has no effect on synaptic 3-nAChR
levels, in CG neurons in situ.
 |
DISCUSSION |
Two major findings are reported here. One, although 7-nAChRs
are excluded from the synapse, their developmental expression is
regulated by innervation and target tissue interactions in embryonic
chick CG neurons in situ. Two, reduced activity
downregulates perisynaptic 7-nAChR levels but not synaptic
3-nAChRs. Innervation and target tissue interactions both induce
increases in 7 transcript and protein levels during synapse
formation in the CG, with retrograde signals from the target tissues
having the greater inductive effect. The absence of synaptic partners
causes changes in perisynaptic 7-nAChR expression that primarily
parallel that seen for synaptic 3-nAChRs (Table 1). However, there
are some differences in their regulation. Most striking, reduced
activity has unique effects on 7-nAChR levels. These results
establish a difference in the signals that mediate the regulatory
effects of synaptic partners on the two nicotinic receptor types. The
parallel expression of 7-nAChRs and 3-nAChRs, mediated at least
in part by different regulatory signals, suggests that perisynaptic
7-nAChRs are likely to have important and distinct synapse-related
functions in vertebrate autonomic neurons.
The present study establishes the parallel regulation of the subunits
of perisynaptic 7-nAChRs and synaptic 3-nAChRs, with one
exception. Innervation induces increases in 7 mRNA that closely resemble in time course and extent those seen for all of the 3-nAChR subunit mRNAs, 3, 4, and 5, suggesting that innervation
coordinately regulates the developmental expression of perisynaptic and
synaptic nAChRs (this study; Levey et al., 1995 ). In contrast, the
target tissues have some differential regulatory effects. 7 mRNA
levels are upregulated in a manner resembling 3 and 4, whereas
5 mRNA is not affected by target tissue interactions in embryonic CG neurons (this study; Levey et al., 1995 ). The parallel regulation of
perisynaptic 7 and synaptic 3 and 4, but not 5, is
interesting. For 3-nAChR complexes, 3 is the essential subunit,
being required for surface expression of functional 3-nAChRs and
their targeting to the synapse (De Koninck and Cooper, 1995 ; Levey et
al., 1995 ; Williams et al., 1998 ; Xu et al., 1999a ). The 4 subunit
is required for 3-nAChR complex assembly (Xu et al., 1999b ). In
contrast, 5 is needed for the formation of high-conductance
3-nAChR channels and appears to be a developmentally late component
of the 3-nAChR complex in CG neurons (Margiotta and Gurantz, 1989 ;
Levey et al., 1995 ; Ramirez-Latorre et al., 1996 ; Wang et al., 1996 ).
For perisynaptic 7-nAChRs, 7 is the critical ligand-binding
subunit, and, in many neural tissues, 7-nAChRs are homopentamers
(Chen and Patrick, 1997 ; Drisdel and Green, 2000 ). In summary, our
results show that the transcript levels of 7 and 3, the key
subunits of the perisynaptic and synaptic nAChR complexes,
respectively, are regulated in parallel during synapse formation in
chick CG neurons.
At mature ages, perisynaptic 7-nAChR expression continues to be
regulated by innervation and target tissue interactions. In newly
hatched chickens, the disruption of functional synaptic connections
(preganglionic denervation or postganglionic axotomy) causes specific
declines in 7-nAChR protein levels (Jacob and Berg, 1987 ;
Zhou et al., 2001 ). Again, perisynaptic 7-nAChR and synaptic
3-nAChR levels are regulated similarly at these later ages but, in
this case, with distinct time courses. After denervation and axotomy,
the decreases in 7-nAChRs are steeper and more rapid than those seen
for 3-nAChRs (Jacob and Berg, 1987 ). Altogether, this study and our
previous work demonstrate that signals from both presynaptic inputs and
target tissues are required for the initial induction and the
maintenance of mature levels of 7-nAChR expression in CG neurons
in situ.
The regulatory signals that mediate the effects of innervation and
target tissues on 7-nAChR expression are as yet primarily undefined.
We focused on the role of electrical activity as a potential regulatory
signal. Precedence demonstrates that electrical activity regulates
neural expression of other neurotransmitter receptor types (Philpot et
al., 2001 ; Kilman et al., 2002 ). We used visual deprivation to greatly
reduce activity in the retinal inputs to the CG neurons via
multisynaptic central visual pathways (Gamlin et al., 1982 , 1984 ;
Gamlin and Reiner, 1991 ). Precedence shows that visual deprivation
significantly reduces the levels of particular synapse-related proteins
in the CG. Specifically, the activity of ChAT, the acetylcholine
biosynthetic enzyme, is reduced by 28% (Pendrak et al., 1995 ). We show
here that visual deprivation selectively regulates perisynaptic
7-nAChR levels, but not synaptic 3-nAChRs, in CG neurons of newly
hatched chicks. Similar to these in vivo effects of visual
deprivation, in vitro studies show that activity (membrane
depolarization) specifically influences 7, but not 3, nAChR
transcript and protein levels in neonatal rat sympathetic neurons (De
Koninck and Cooper, 1995 ). 7-nAChR levels in the rodent
somatosensory cortex are also regulated by sensory deprivation, the
removal of all vibrissa on one side of the face (Bina et al., 1998 ). In
the chick CG, the declines in 7-nAChR protein levels caused by
visual deprivation in vivo are modest (1.3-fold) but
significant. In comparison, there are greater declines in 7-nAChR
protein levels (twofold) after the disruption of functional connections
(preganglionic denervation) in newly hatched chick CGs (Jacob and Berg,
1987 ). It should be noted that visual deprivation is likely to reduce,
but not eliminate, synaptic activation of CG neurons (Jackson, 1983 ).
The effects of reduced activity may be direct or indirect, possibly
involving other regulatory signals (Loeb et al., 2002 ). Thus, factors
other than activity may mediate the regulatory effects of visual
deprivation on 7-nAChR levels. Intercellular signals, such as
specific factors, influence 7-nAChR levels in neurons. Neuregulin
(the neural-specific cysteine-rich domain-containing isoform) is a
presynaptic input-derived soluble factor that increases 7-nAChR
levels in sympathetic neurons in vitro (Yang et al., 1998 ;
Liu et al., 2001 ). Neuregulin splice variants are expressed in
presynaptic inputs to the CG (Corfas et al., 1995 ). They are also
likely expressed in CG neurons, suggesting the possible contribution of
autocrine and paracrine actions of this soluble factor (Corfas
et al., 1995 ; Sandrock et al., 1995 ). In addition, two distinct target
tissue-derived factors have been isolated that influence 7-nAChR
levels in opposite ways (Nishi, 1994 ; Finn and Nishi, 1996 ). Ciliary
neurotrophic factor, a trophic factor, specifically downregulates
7-nAChRs, whereas a soluble component of 50 kDa increases 7
levels in CG neurons in vitro (Halvorsen and Berg, 1989 ;
Halvorsen et al., 1991 ). In the present study, we show additive effects
of inputs and target tissues on 7-nAChR levels, suggesting that the
two different synaptic partners may provide distinct regulatory
signals. Overall, the combinatorial regulatory effects of activity and
multiple factors are likely to govern 7 subunit levels during
synapse formation and maturation in chick autonomic neurons in
situ.
Our findings that innervation and target tissue interactions induce
increases in 7-nAChR expression during synapse differentiation suggest that the perisynaptic receptors may have synapse-related functions. Recent electrophysiological studies show that 7-nAChR activation is required for reliable synaptic transmission in the early
embryonic chick CG (Chang and Berg, 1999 ). Greater activity may
stabilize the newly formed synaptic connections, resulting in the
uptake of essential trophic factors and survival of the neurons during
the critical developmental period of synapse formation and elimination
(Meriney et al., 1987 : Maderdrut et al., 1988 ; Pugh and Margiotta,
2000 ). However, during synapse maturation at older embryonic ages,
7-nAChR activation is no longer required for reliable synaptic
transmission (Chang and Berg, 1999 ). Other synapse-related functions
are likely as suggested by the 7-nAChR abundant surface expression,
spatial segregation, and distinct functional properties relative to
3-nAChRs on CG neurons. In particular, 7-nAChRs have a higher
Ca2+ permeability and faster kinetics of
activation and desensitization (Zhang et al., 1996 ; Ullian et al.,
1997 ). Our findings that visual deprivation causes declines in
7-nAChRs, but not 3-nAChRs, suggest that 3-nAChRs are required
to maintain synaptic transmission, whereas 7-nAChRs are activity
sensors in the postsynaptic neuron. A recent report demonstrates that
nicotinic signaling to CG neurons can induce
Ca2+-dependent plasticity changes
(prolonged activation of phosphorylated cAMP response element-binding
protein and gene expression) under certain conditions (Chang and
Berg, 2001 ). Activation of nAChRs is required, whereas voltage-gated
Ca2+ channels are silent, with
intracellular Ca2+ levels being the
critical determinant. In particular, the amounts and the temporal and
spatial patterns of internal Ca2+
elevations are important. Activity-dependent changes in 7-nAChR levels are likely to affect the critical variable of
Ca2+ influx in CG neurons. We propose that
7-nAChRs have the unique function of activity sensors in CG neurons.
The activity-dependent regulation of extrasynaptic 7-nAChRs may be
an important mechanism for CG neurons to detect alterations in
presynaptic activity levels and respond by
Ca2+-dependent plasticity changes in gene expression.
In summary, our data demonstrate that, within single CG neurons, the
coexpression of extrasynaptic 7-nAChRs and synaptic 3-nAChRs is
induced by innervation and target tissue interactions, with some
differences in the underlying regulatory signals. The coexpression of
the two nicotinic receptor subtypes is important for optimal synaptic
signaling and plasticity in neural circuits of the vertebrate autonomic
nervous system.
 |
FOOTNOTES |
Received April 9, 2002; revised July 1, 2002; accepted July 10, 2002.
This work was supported by National Institutes of Health Grant 21725 (M.H.J.). We thank Marjory Levey for designing and testing the primers,
Ogi Ikonomov for optimizing PCR conditions, Rachel Blitzblau and Brian
Williams for generous help in preparing the figures, and Madelaine
Rosenberg for insightful comments on this manuscript.
Correspondence should be addressed to Dr. Michele Jacob, Department of
Neuroscience, Tufts University, Sackler School of Biomedical Sciences,
136 Harrison Avenue, Boston, MA 02111. E-mail:
michele.jacob{at}tufts.edu.
C. L. Brumwell's present address: University of Massachusetts
Medical Center, Department of Biochemistry and Molecular Pharmacology, Biotech 4, Worcester, MA 01605.
J. L. Johnson's present address: Department of Anesthesia,
Tri-City Medical Center, 4002 Vista Way, Oceanside, CA 92056.
 |
REFERENCES |
-
Abercrombie M
(1946)
Estimation of nuclear population from microtome sections.
Anat Rec
94:239-247.
-
Arenella LS,
Oliva JM,
Jacob MH
(1993)
Reduced levels of acetylcholine receptor expression in chick ciliary ganglion neurons developing in the absence of innervation.
J Neurosci
13:4525-4537[Abstract].
-
Bina KG,
Park M,
O'Dowd DK
(1998)
Regulation of
7 nicotinic acetylcholine receptors in mouse somatosensory cortex following whisker removal at birth.
J Comp Neurol
397:1-9[Medline]. -
Broide RS,
Robertson RT,
Leslie FM
(1996)
Regulation of alpha7 nicotinic acetylcholine receptors in the developing rat somatosensory cortex by thalamocortical afferents.
J Neurosci
16:2956-2971[Abstract/Free Full Text].
-
Carbonetto S,
Fambrough DM
(1979)
Synthesis, insertion into the plasma membrane, and turnover of alpha-bungarotoxin receptors in chick sympathetic neurons.
J Cell Biol
81:555-569[Abstract/Free Full Text].
-
Chang KT,
Berg DK
(1999)
Nicotinic acetylcholine receptors containing alpha7 subunits are required for reliable synaptic transmission in situ.
J Neurosci
19:3701-3710[Abstract/Free Full Text].
-
Chang KT,
Berg DK
(2001)
Voltage-gated channels block nicotinic regulation of CREB phosphorylation and gene expression in neurons.
Neuron
32:855-865[Web of Science][Medline].
-
Chen D,
Patrick JW
(1997)
The alpha-bungarotoxin-binding nicotinic acetylcholine receptor from rat brain contains only the alpha7 subunit.
Biol Chem
272:24024-24029.
-
Conroy WG,
Berg DK
(1995)
Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions.
J Biol Chem
270:4424-4431[Abstract/Free Full Text].
-
Corfas G,
Rosen KM,
Aratake H,
Krauss R,
Fischbach GD
(1995)
Differential expression of ARIA isoforms in the rat brain.
Neuron
14:103-115[Web of Science][Medline].
-
Corriveau RA,
Berg DK
(1993)
Coexpression of multiple acetylcholine receptor genes in neurons: quantification of transcripts during development.
J Neurosci
13:2662-2671[Abstract].
-
Couturier S,
Bertrand D,
Matter J-M,
Hernandez M-C,
Bertrand S,
Millar N,
Valera S,
Barkas T,
Ballivet M
(1990)
A neuronal nicotinic acetylcholine receptor subunit (
7) is developmentally regulated and forms a homo-oligomeric channel blocked by -Btx.
Neuron
5:847-856[Web of Science][Medline]. -
De Koninck P,
Cooper E
(1995)
Differential regulation of neuronal nicotinic ACh receptor subunit genes in cultured neonatal rat sympathetic neurons: specific induction of
7 by membrane depolarization through a Ca2+/calmodulin-dependent kinase pathway.
J Neurosci
15:7966-7978[Abstract]. -
Devay P,
McGehee DS,
Yu CR,
Role LW
(1999)
Target-specific control of nicotinic receptor expression at developing interneuronal synapses in chick.
Nat Neurosci
2:528-534[Web of Science][Medline].
-
Dourado MM,
Brumwell C,
Wisgirda ME,
Jacob MH,
Dryer SE
(1994)
Target tissues and innervation regulate the characteristics of K+ currents in chick ciliary ganglion neurons developing in situ.
J Neurosci
14:3156-3165[Abstract].
-
Drisdel RC,
Green WN
(2000)
Neuronal
-bungarotoxin receptors are 7 subunit homomers.
J Neurosci
20:133-139[Abstract/Free Full Text]. -
Engisch KL,
Fischbach GD
(1990)
The development of ACH- and GABA-activated currents in normal and target-deprived embryonic chick ciliary ganglia.
Dev Biol
139:417-426[Web of Science][Medline].
-
Engisch KL,
Fischbach GD
(1992)
The development of ACh- and GABA-activated currents in embryonic chick ciliary ganglion neurons in the absence of innervation in vivo.
J Neurosci
12:1115-1125[Abstract].
-
Feramisco JR,
Smart JE,
Burridge K,
Helfman DM,
Thomas GP
(1982)
Co-existence of vinculin and a vinculin-like protein of higher molecular weight in smooth muscle.
J Biol Chem
257:11024-11031[Abstract/Free Full Text].
-
Finn TP,
Nishi R
(1996)
Expression of a chicken ciliary neurotrophic factor in targets of ciliary ganglion neurons during and after the cell-death phase.
J Comp Neurol
366:559-571[Web of Science][Medline].
-
Furber S,
Oppenheim RW,
Prevette D
(1987)
Naturally occurring neuron death in the ciliary ganglion of the chick embryo following removal of preganglionic input: evidence for the role of afferents in ganglion cell survival.
J Neurosci
7:1816-1832[Abstract].
-
Gamlin PD,
Reiner A
(1991)
The Edinger-Westphal nucleus: sources of input influencing accommodation, pupilloconstriction, and choroidal blood flow.
J Comp Neurol
306:425-438[Web of Science][Medline].
-
Gamlin PD,
Reiner A,
Karten H
(1982)
Substance P-containing neurons of the avian suprachiasmatic nucleus project directly to the nucleus of Edinger-Westphal.
Proc Natl Acad Sci USA
79:3891-3895[Abstract/Free Full Text].
-
Gamlin PD,
Reiner A,
Erichsen JT,
Karten HJ,
Cohen DH
(1984)
The neural substrate for the pupillary light reflex in the pigeon (Columba livia).
J Comp Neurol
226:523-543[Web of Science][Medline].
-
Gottlieb MD,
Fugate-Wentzek LA,
Wallman J
(1987)
Different visual deprivations produce different ametropias and different eye shapes.
Invest Ophthalmol Vis Sci
28:1225-1235[Abstract/Free Full Text].
-
Halvorsen SW,
Berg DK
(1989)
Specific down-regulation of the
-bungarotoxin binding component on chick autonomic neurons by ciliary neuronotrophic factor.
J Neurosci
9:3673-3680[Abstract]. -
Halvorsen SW,
Schmid HA,
McEachern AE,
Berg DK
(1991)
Regulation of acetylcholine receptors on chick ciliary ganglion neurons by components from the synaptic target tissue.
J Neurosci
11:2177-2186[Abstract].
-
Hamburger V,
Hamilton HL
(1951)
A series of normal stages in the development of the chick embryo.
J Morphol
88:49-82[Web of Science].
-
Higuchi R,
Krummel B,
Saiki RK
(1988)
A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions.
Nucleic Acids Res
16:7351-7367[Abstract/Free Full Text].
-
Horch HL,
Sargent PB
(1995)
Perisynaptic surface distribution of multiple classes of nicotinic acetylcholine receptors on neurons in the chicken ciliary ganglion.
J Neurosci
15:7778-7795[Abstract].
-
Ikonomov OC,
Kulesa MC,
Shisheva AC,
Jacob MH
(1998)
Innervation and target tissue interactions induce Rab-GDP dissociation inhibitor (GDI) expression during peripheral synapse formation in developing chick ciliary ganglion neurons in situ.
J Neurosci
18:6331-6339[Abstract/Free Full Text].
-
Jackson PC
(1983)
Reduced activity during development delays the normal rearrangement of synapses in the rabbit ciliary ganglion.
J Physiol (Lond)
345:319-327[Abstract/Free Full Text].
-
Jacob MH
(1991)
Acetylcholine receptor expression in developing chick ciliary ganglion neurons.
J Neurosci
11:1701-1712[Abstract].
-
Jacob MH,
Berg DK
(1983)
The ultrastructural localization of
-bungarotoxin binding sites in relation to synapses on chick ciliary ganglion neurons.
J Neurosci
3:260-271[Abstract]. -
Jacob MH,
Berg DK
(1987)
Effects of preganglionic denervation and postganglionic axotomy on acetylcholine receptors in the chick ciliary ganglion.
J Cell Biol
105:1847-1854[Abstract/Free Full Text].
-
Jacob MH,
Lindstrom JM,
Berg DK
(1986)
Surface and intracellular distribution of a putative neuronal nicotinic acetylcholine receptor.
J Cell Biol
103:205-214[Abstract/Free Full Text].
-
Kilman V,
van Rossum MC,
Turrigiano GG
(2002)
Activity deprivation reduces miniature IPSC amplitude by decreasing the number of postsynaptic GABAA receptors clustered at neocortical synapses.
J Neurosci
22:1328-1337[Abstract/Free Full Text].
-
Landmesser L,
Pilar G
(1972)
The onset and development of transmission in the chick ciliary ganglion.
J Physiol (Lond)
222:691-713[Abstract/Free Full Text].
-
Landmesser L,
Pilar G
(1974)
Synaptic transmission and cell death during normal ganglionic development.
J Physiol (Lond)
241:737-749[Abstract/Free Full Text].
-
Lee MK,
Tuttle JB,
Rebhun LI,
Cleveland DW,
Frankfurter A
(1990)
The expression and posttranslational modification of a neuron-specific beta-tubulin isotype during chick embryogenesis.
Cell Motil Cytoskeleton
17:118-132[Web of Science][Medline].
-
Levey MS,
Jacob MH
(1996)
Changes in the regulatory effects of cell-cell interactions on neuronal AChR subunit transcript levels after synapse formation.
J Neurosci
16:6878-6885[Abstract/Free Full Text].
-
Levey MS,
Brumwell CL,
Dryer SE,
Jacob MH
(1995)
Innervation and target tissue interactions differentially regulate acetylcholine receptor subunit mRNA levels in developing neurons in situ.
Neuron
14:153-162[Web of Science][Medline].
-
Liu Y,
Ford B,
Mann MA,
Fischbach GD
(2001)
Neuregulins increase
7 nicotinic acetylcholine receptors and enhance excitatory synaptic transmission in GABAergic interneurons of the hippocampus.
J Neurosci
21:5660-5669[Abstract/Free Full Text]. -
Loeb JA,
Hmadcha A,
Fischbach GD,
Land SJ,
Zakarian VL
(2002)
Neuregulin expression at neuromuscular synapses is modulated by synaptic activity and neurotrophic factors.
J Neurosci
22:2206-2214[Abstract/Free Full Text].
-
Loring RH,
Zigmond RE
(1987)
Ultrastructural distribution of 125I-toxin F binding sites on chick ciliary neurons: synaptic localization of a toxin that blocks ganglionic nicotinic receptors.
J Neurosci
7:2153-2162[Abstract].
-
Loring RH,
Dahm LM,
Zigmond RE
(1985)
Localization of alpha-bungarotoxin binding sites in the ciliary ganglion of the embryonic chick: an autoradiographic study at the light and electron microscopic level.
Neuroscience
14:645-660[Web of Science][Medline].
-
Maderdrut JL,
Oppenheim RW,
Prevette D
(1988)
Enhancement of naturally occurring cell death in the sympathetic and parasympathetic ganglia of the chicken embryo following blockade of ganglionic transmission.
Brain Res
444:189-194[Web of Science][Medline].
-
Margiotta JF,
Gurantz D
(1989)
Changes in the number, function, and regulation of nicotinic acetylcholine receptors during neuronal development.
Dev Biol
135:326-339[Web of Science][Medline].
-
Meriney SD,
Pilar G
(1987)
Cholinergic innervation of the smooth muscle cells in the choroid coat of the chick eye and its development.
J Neurosci
7:3827-3839[Abstract].
-
Meriney SD,
Pilar G,
Ogawa M,
Nunez R
(1987)
Differential neuronal survival in the avian ciliary ganglion after chronic acetylcholine receptor blockade.
J Neurosci
7:3840-3849[Abstract].
-
Nishi R
(1994)
Target-derived molecules that influence the development of neurons in the avian ciliary ganglion.
J Neurobiol
25:612-619[Web of Science][Medline].
-
Pendrak K,
Lin T,
Stone RA
(1995)
Ciliary ganglion choline acetyltransferase activity in avian macrophthalmos.
Exp Eye Res
60:237-243[Web of Science][Medline].
-
Philpot BD,
Sekhar AK,
Shouval HZ,
Bear MF
(2001)
Visual experience and deprivation bidirectionally modify the composition and function of NMDA receptors in visual cortex.
Neuron
29:157-169[Web of Science][Medline].
-
Pilar G,
Nunez R,
McLennan IS,
Meriney SD
(1987)
Muscarinic and nicotinic synaptic activation of the developing chicken iris.
J Neurosci
7:3813-3826[Abstract].
-
Pugh PC,
Berg DK
(1994)
Neuronal acetylcholine receptors that bind
-bungarotoxin mediate neurite retraction in a calcium-dependent manner.
J Neurosci
14:889-896[Abstract]. -
Pugh PC,
Margiotta JF
(2000)
Nicotinic acetylcholine receptor agonists promote survival and reduce apoptosis of chick ciliary ganglion neurons.
Mol Cell Neurosci
15:113-122[Web of Science][Medline].
-
Ramirez-Latorre J,
Yu CR,
Qu X,
Perin F,
Karlin A,
Role L
(1996)
Functional contributions of alpha5 subunit to neuronal acetylcholine receptor channels.
Nature
380:347-351[Medline].
-
Rangwala F,
Drisdel RC,
Rakhilin S,
Ko E,
Atluri P,
Harkins AB,
Fox AP,
Salman SS,
Green WN
(1997)
Neuronal alpha-bungarotoxin receptors differ structurally from other nicotinic acetylcholine receptors.
J Neurosci
17:8201-8212[Abstract/Free Full Text].
-
Sandrock Jr AW,
Goodearl AD,
Yin QW,
Chang D,
Fischbach GD
(1995)
ARIA is concentrated in nerve terminals at neuromuscular junctions and at other synapses.
J Neurosci
15:6124-6136[Abstract].
-
Shih YF,
Fitzgerald ME,
Norton TT,
Gamlin PD,
Hodos W,
Reiner A
(1993)
Reduction in choroidal blood flow occurs in chicks wearing goggles that induce eye growth toward myopia.
Curr Eye Res
12:219-227[Web of Science][Medline].
-
Shoop RD,
Martone ME,
Yamada N,
Ellisman MH,
Berg DK
(1999)
Neuronal acetylcholine receptors with
-7 subunits are concentrated on somatic spines for synaptic signaling in embryonic chick ciliary ganglia.
J Neurosci
19:692-704[Abstract/Free Full Text]. -
Smith MA,
Stollberg J,
Lindstrom JM,
Berg DK
(1985)
Characterization of a component in chick ciliary ganglia that cross-reacts with monoclonal antibodies to muscle and electric organ acetylcholine receptor.
J Neurosci
5:2726-2731[Abstract].
-
Sullivan KF,
Havercroft JC,
Machlin PS,
Cleveland DW
(1986)
Sequence and expression of the chicken beta 5- and beta 4-tubulin genes define a pair of divergent beta-tubulins with complementary patterns of expression.
Mol Cell Biol
6:4409-4418[Abstract/Free Full Text].
-
Ullian EM,
McIntosh JM,
Sargent PB
(1997)
Rapid synaptic transmission in the avian ciliary ganglion is mediated by two distinct classes of nicotinic receptors.
J Neurosci
17:7210-7219[Abstract/Free Full Text].
-
Vernallis AB,
Conroy WG,
Berg DK
(1993)
Neurons assemble acetylcholine receptors with as many as three kinds of subunits while maintaining subunit segregation among receptor subtypes.
Neuron
10:451-464[Web of Science][Medline].
-
Wallman J,
Ledoux C,
Friedman MB
(1978)
Simple devices for restricting the visual fields of birds.
Behav Res Methods Instrum
10:401-403.
-
Wang F,
Gerzanich V,
Wells GB,
Anand R,
Peng X,
Keyser K,
Lindstrom J
(1996)
Assembly of human neuronal nicotinic receptor alpha5 subunits with alpha3, beta2, and beta4 subunits.
J Biol Chem
271:17656-17665[Abstract/Free Full Text].
-
Williams BM,
Temburni MK,
Levey MS,
Bertrand S,
Bertrand D,
Jacob MH
(1998)
The long internal loop of the
3 subunit targets nAChRs to subdomains within individual synapses in vivo.
Nat Neurosci
1:557-562[Web of Science][Medline]. -
Xu W,
Gelber S,
Orr-Urtreger A,
Armstrong D,
Lewis RA,
Ou C,
Patrick J,
Role L,
de Biasi M,
Beaudet AM
(1999a)
Megacystis, mydriasis and ion channel deficits in mice lacking the
3 neuronal nicotinic acetyl choline receptor.
Proc Natl Acad Sci USA
96:5746-5751[Abstract/Free Full Text]. -
Xu W,
Orr-Urtreger A,
Nigro F,
Gelber S,
Sutcliffe CB,
Armstrong D,
Patrick JW,
Role LW,
Beaudet AL,
De Biasi M
(1999b)
Multiorgan autonomic dysfunction in mice lacking the
2 and the 4 subunits of neuronal nicotinic acetylcholine receptors.
J Neurosci
19:9298-9305[Abstract/Free Full Text]. -
Yang X,
Kuo Y,
Devay P,
Yu C,
Role L
(1998)
A cysteine-rich isoform of neuregulin controls the level of expression of neuronal nicotinic receptor channels during synaptogenesis.
Neuron
20:255-270[Web of Science][Medline].
-
Zhang ZW,
Coggan JS,
Berg DK
(1996)
Synaptic currents generated by neuronal acetylcholine receptors sensitive to alpha-bungarotoxin.
Neuron
17:1231-1240[Web of Science][Medline].
-
Zhou Y,
Deneris E,
Zigmond RE
(1998)
Differential regulation of levels of nicotinic receptor subunit transcripts in adult sympathetic neurons after axotomy.
J Neurobiol
34:164-178[Medline].
-
Zhou Y,
Deneris E,
Zigmond RE
(2001)
Nicotinic acetylcholine receptor subunit proteins alpha7 and beta4 decrease in the superior cervical ganglion after axotomy.
J Neurobiol
46:178-192[Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22188101-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
N. C Spitzer and L. N Borodinsky
Implications of activity-dependent neurotransmitter-receptor matching
Phil Trans R Soc B,
April 12, 2008;
363(1495):
1393 - 1399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hruska and R. Nishi
Cell-Autonomous Inhibition of {alpha}7-Containing Nicotinic Acetylcholine Receptors Prevents Death of Parasympathetic Neurons during Development
J. Neurosci.,
October 24, 2007;
27(43):
11501 - 11509.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rassadi, A. Krishnaswamy, B. Pie, R. McConnell, M. H. Jacob, and E. Cooper
A Null Mutation for the {alpha}3 Nicotinic Acetylcholine (ACh) Receptor Gene Abolishes Fast Synaptic Activity in Sympathetic Ganglia and Reveals That ACh Output from Developing Preganglionic Terminals Is Regulated in an Activity-Dependent Retrograde Manner
J. Neurosci.,
September 14, 2005;
25(37):
8555 - 8566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. O. Martin, G. Alonso, and N. C. Guerineau
Agrin mediates a rapid switch from electrical coupling to chemical neurotransmission during synaptogenesis
J. Cell Biol.,
May 9, 2005;
169(3):
503 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bibevski and M. E. Dunlap
Prevention of diminished parasympathetic control of the heart in experimental heart failure
Am J Physiol Heart Circ Physiol,
October 1, 2004;
287(4):
H1780 - H1785.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhou, Q. Nai, M. Chen, J. D. Dittus, M. J. Howard, and J. F. Margiotta
Brain-Derived Neurotrophic Factor and trkB Signaling in Parasympathetic Neurons: Relevance to Regulating {alpha}7-Containing Nicotinic Receptors and Synaptic Function
J. Neurosci.,
May 5, 2004;
24(18):
4340 - 4350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Khiroug, R. Giniatullin, R. C. Klein, D. Fayuk, and J. L. Yakel
Functional Mapping and Ca2+ Regulation of Nicotinic Acetylcholine Receptor Channels in Rat Hippocampal CA1 Neurons
J. Neurosci.,
October 8, 2003;
23(27):
9024 - 9031.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|