 |
Previous Article | Next Article 
The Journal of Neuroscience, October 1, 2002, 22(19):8347-8351
BRIEF COMMUNICATION
Repressor Element-1 Silencing Transcription/Neuron-Restrictive
Silencer Factor Is Required for Neural Sodium Channel Expression
during Development of Xenopus
Ricardo
Armisén*,
Rómulo
Fuentes*,
Patricio
Olguín,
María E.
Cabrejos, and
Manuel
Kukuljan
Programa de Fisiología y Biofísica, Instituto de
Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile,
Independencia 1027, Santiago, Chile
 |
ABSTRACT |
The ability of neurons to fire rapid action potential relies on the
expression of voltage-gated sodium channels; the onset of the
transcription of genes that encode these channels occurs during early
neuronal development. The factors that direct and regulate the specific
expression of ion channels are not well understood. Repressor element-1
silencing transcription/neuron-restrictive silencer factor
(REST/NRSF) is a transcriptional regulator characterized as a repressor
of the expression of NaV1.2, the gene encoding the voltage-gated sodium channel most abundantly expressed in the CNS,
as well as of the expression of numerous other neuronal genes. In
mammals, REST/NRSF is expressed mostly in non-neural cell types and
immature neurons, and it is downregulated on neural maturation. To
understand the mechanisms that govern sodium channel gene transcription
and to explore the role of REST/NRSF in vivo, we
inhibited REST/NRSF action in developing Xenopus
laevis embryos by means of a dominant negative protein
or antisense oligonucleotides. Contrary to what was expected, these
maneuvers result in the decrease of the expression of the
NaV1.2 gene, as well as of other neuronal genes in the
primary spinal neurons and cranial ganglia, without overt perturbation
of neurogenesis. These results, together with the demonstration of
robust REST/NRSF expression in primary spinal neurons, suggest that
REST/NRSF is required for the acquisition of the differentiated
functional neuronal phenotype during early development. Furthermore,
they suggest that REST/NRSF may be used to activate or repress
transcription of neuronal genes in distinct cellular and developmental contexts.
Key words:
primary spinal neurons; neuronal differentiation; repressor element silencer of transcription; dominant negative; antisense oligonucleotides; sodium channels
 |
INTRODUCTION |
The generation of rapid action
potentials relies on the adequate expression of particular
voltage-gated ion channels. During embryonic development of
Xenopus laevis, primary spinal neurons transit from an
electrically silent state to a condition in which they can fire mature
neuronal action potentials (Spitzer and Lamborghini, 1976 ).
Underlying this transition is the onset of the expression of
voltage-gated channels (O'Dowd et al., 1988 ; Desarmenien et al., 1993 ;
Olson, 1996 ), particularly the beginning of the expression of
voltage-gated sodium currents and the rapid increase in the density of
potassium currents. This process is inhibited by blockers of RNA
synthesis, indicating that activation of transcription is fundamental
in the acquisition of electrical activity in neurons (Ribera and
Spitzer, 1989 ). The identity of the potassium channels upregulated
during these stages has been unveiled (Ribera, 1990 ; Burger and Ribera,
1996 ; Gurantz et al., 1996 ; Vincent et al., 2000 ), but the mechanisms
that govern the transcription of ion channels are unknown.
Repressor element silencing transcription/neuron-restrictive silencer
factor (REST/NRSF) was identified as a factor that influences the
expression of voltage-gated sodium channels (Chong et al., 1995 ) and
also as a regulator of the expression of other genes (Schoenherr and
Anderson, 1995 ). REST/NRSF binds a DNA element (RE-1) contained in the
regulatory regions of numerous neuronal genes, including
NaV1.2 (Kraner et al., 1992 ; Mori et al., 1992 ; Schoenherr
et al., 1996 ). The extensive characterization of REST/NRSF has led to
the current view of this protein as a repressor of neural-specific gene
expression; REST/NRSF is expressed in non-neural cells and
undifferentiated neurons and downregulated on differentiation. REST/NRSF interacts with the corepressors Sin3 and CoREST, assembling complexes that recruit histone deacetylase activity to regions of genes
that bear the RE-1 sequence (Andrés et al., 1999 ; Huang et al.,
1999 ; Naruse et al., 1999 ; Grimes et al., 2000 ; Ballas et al., 2001 ).
The in vivo role of REST/NRSF has been difficult to
ascertain, given the early embryonic lethality of mice bearing a
homozygous deletion of the REST/NRSF gene (Chen et al.,
1998 ). Expression of the DNA-binding domain (DBD) of REST/NRSF in
chicken embryos associates with derepression of neural genes
(Chen et al., 1998 ), whereas constitutive expression of the murine
isoform in developing neurons associates with repression of some
neuronal genes and defects in axon guidance (Paquette et al., 2000 ).
Some studies have found the expression of REST/NRSF mRNA in adult
neurons (Palm et al., 1998 ); furthermore, it has been shown that it can act as a transcriptional activator for some genes (Bessis et al., 1997 ;
Kallunki et al., 1998 ; Seth and Majzoub, 2001 ). Some reports also
indicate that REST/NRSF may be involved in the regulation of the
expression of non-neural genes (Scholl et al., 1996 ; Kuwahara et al.,
2001 ). These data suggest that the actual function of REST/NRSF may be
more complex than originally envisioned and that it could vary
according to the cellular context in which it is studied.
 |
MATERIALS AND METHODS |
xREST-DBD construction. The DNA-binding
domain of xREST (GenBank accession AF096301), comprising the sequence
that encodes K138 to Q440, was amplified by PCR with the primers
GCGGAATTCAAAAAGGACACCCAGCCCAAC and
CGCCTCGAGTCATTGCTTATTTGCATCAACATCTG, adding one
EcoRI and one XhoI restriction sites (underlined
in the primers sequences). The PCR product was cloned into the plasmid
CS2+NLSMT, kindly provided by Dr. D. Turner (University of Michigan,
Ann Arbor, MI). This vector adds a nuclear localization signal
and six Myc epitopes to the N-terminal coding region.
Embryo manipulation, injection, and in situ
hybridization. X. laevis embryos were generated by
in vitro fertilization, dejellied, and incubated following
standard procedures. A portion (0.5-2 ng) of in vitro
transcribed xREST-DBD RNA or 2-20 ng of a morpholino-modified antisense oligonucleotide (sequence ACTGGTTGACCATTTGAGTGGC) (Gene Tools, Philomath, OR) were injected in a total volume of 10 nl, in one
cell at the two cell stage or in two cells at the four cell stage. The
RNA encoding -galactosidase (0.5 ng) was coinjected in all cases.
Embryos were incubated at 18°C until neurula stage and then prefixed;
the injected side was detected by developing the -galactosidase
reaction, and the whole-mount in situ hybridization (ISH)
procedure, using 11-UTP digoxigenin (Boehringer Mannheim, Mannheim,
Germany)-labeled probes, was followed according to described methods
(Sive et al., 2000 ).
ISH probes. xNaV1.2 was generated by
reverse transcription-PCR (RT-PCR) using primers designed
on the basis of the conserved sequences in vertebrate homologs and RNA
isolated from X. laevis neural tube as input. The primers
sequence was CCIRYIAAYGGIAARATGA and GGIGCIYTNGCNTTYGARGAY. PCR
fragments were cloned (Topo-TA; Invitrogen, Carlsbad, CA) and
sequenced (GenBank access code AY121368). The X. laevis
SCG10 (GenBank X71434) probe was also generated by RT-PCR with the
primers GCTCGCTACCCTCTCCACT and CATACTGATATCGCATGATCCGT. Other probes
were obtained from the sources indicated: Xslug, Xsox2, and N- II
tubulin from Roberto Mayor (Universidad de Chile, Santiago, Chile);
Hox11L2 from Paul Krieg (University of Arizona Health Sciences Center,
Tucson, AZ); Pax3 from Andre Brandli (Swiss Federal Institute of
Technology, Zurich, Switzerland); and xREST8 from Gail Mandel (Howard
Hughes Medical Institute, State University of New York, Stony Brook, NY).
RT-PCR, cell culture, and single-cell RT-PCR. RT-PCR
detection of the REST/NRSF transcript was performed using
total RNA isolated from whole embryos or dissected tissues and the
following primers: F1, AGAACGACCATATCAGTGTATTC; R2,
CTGAGTAGATGACAAGCGCC; R1, AATCAGATTTTCTTTTCACACAACTAGA.
Neural plate cell cultures were prepared, and subsequent single-cell
RT-PCR of morphologically differentiated neurons was conducted as
described (Ribera and Spitzer, 1989 ; Gurantz et al., 1996 ). Two
different nested PCR reactions were performed with the
samples obtained from one cell, one for neuronal tubulin
(N-tubulin) mRNA (231 bp product) and the other for xREST/NRSF.
The primers for N-tubulin were as follows: F1, GCCAGTGCGGTAACCAAATTG;
F2, ACACGGCATTGATCCTACAG; R2, AGCTCCTTCGGTGTAATGAC; R1, TCATGATTCGGTCTGGGTACTC.
To discard contamination with genomic DNA, xREST/NRSF primers were
designed flanking an intron; amplification of genomic DNA results in
fragments of ~2 kb, in contrast with the 557 and 660 bp fragments
resulting from the amplification of cDNA. PCR products were cloned and
sequenced to confirm their identities.
Electrophoretical mobility shift assays. Gel retardation
assays were performed using 0.1-1 ng of a 3'-end
32P-labeled DNA fragment containing two
RE-1 motifs in tandem, kindly provided by Dr. G. Mandel (Chong et al.,
1995 ). Crude protein extracts were prepared by freon extraction of
uninjected or injected embryos homogenized in the presence of a mixture
of protease inhibitors. The protein extracts and the antibody against
the Myc epitope (monoclonal antibody 9E10; Sigma, St. Louis, MO) were
added to the mix and incubated at 4°C for 15 min. Then, the labeled
probe was added, and the reactions were incubated at 30°C for 25 min. The resulting complexes were analyzed in 4% polyacrylamide gels containing 5% glycerol and 0.5 × Tris-borate-EDTA buffer.
The gels were dried, and the complexes were visualized by autoradiography.
 |
RESULTS |
REST and NaV1.2 are expressed in primary neurons
during neurulation
To study the regulation of the expression of sodium channel genes
by REST/NRSF during neurulation, we generated a probe for the X. laevis NaV1.2 ortholog (xNaV1.2). xNaV1.2 is expressed from stage
16 in neural plate, as evaluated by RT-PCR, whereas ISH detects
transcripts from stage 18 in spinal neurons, which is consistent with
functional studies of the onset of sodium current expression in this
system (Fig.
1a d,g). Analysis
of sections shows the expression of this transcript restricted to the
neural tube, particularly to its lateral and ventral regions (Fig.
1d). At later stages, xNaV1.2 is also expressed in the
cranial ganglia primordia (Fig. 1c).

View larger version (62K):
[in this window]
[in a new window]
|
Figure 1.
NaV1.2 and REST/NRSF are expressed in neural
tissues during development of X. laevis.
a-d, ISH for xNaV1.2: expression is restricted to
primary spinal neurons (sn), cranial ganglia primordia
(cg), and olfactory placodes (op). In a
section of a stage 18 embryo, xNaV 1.2 expression is observed in the
lateral and ventral regions of the neural tube. a,
Dorsal view, stage 18; b, lateral view, stage 18;
c, anterior view, stage 24; d, central
transversal section, stage 18; n, notochord;
m, presomitic mesoderm; e,
left, ISH showing diffuse expression of REST during
neurulation (stage 18), including neural folds; right, a
sense REST probe does not produce significant labeling in a stage 18 embryo; f, at stage 35, REST/NRSF expression is stronger
in the anterior neural tissue; g, RT-PCR showing the
coexpression of xNaV1.2 and REST/NRSF in dissected tissues at the
stages annotated; np, neural plate; nt,
neural tube; pm, presomitic mesoderm; s,
somites. The constitutively expressed transcript EF1 is shown as a
control.
|
|
We then examined the expression pattern of REST/NRSF. X. laevis REST/NRSF mRNA is widely expressed in the developing
embryo; at the neurula stage, it is found in the neural folds and
neural tube, paraxial mesoderm, and other structures, as revealed by ISH and RT-PCR using RNA obtained from dissected tissues as input (Fig.
1e,g). It is of interest that during neurulation,
the transcripts encoding xREST/NRSF and xNaV1.2 are coexpressed in
developing neural tissues. At later stages of development, during
differentiation of secondary neurons (stage 35), xREST/NRSF expression
is prominent in the nervous system (Fig. 1f). To
confirm that the expression of REST/NRSF detected by ISH actually
occurs in neurons, we analyzed its presence in identified mature
neurons in culture by single-cell RT-PCR. These neurons display fully
differentiated functional and morphological phenotype. In 6 of 14 cells
positively identified as neurons both by morphology and by the
expression of the transcript encoding neuronal tubulin, we detected the
presence of REST/NRSF transcripts (data not shown).
Inhibition of REST/NRSF leads to decreased expression of NaV1.2 and
other neuronal genes
We constructed a mutated version of X. laevis REST/NRSF
cDNA, which encodes a protein devoid of the transrepressor domains described for the mammalian ortholog. This protein comprises only the
DBD (xREST-DBD), which shows an identity of 85% with the human and
murine orthologs, including the amino acids that are critical for
binding RE-1. According to the biochemical characterization of
REST/NRSF, this domain can compete with the endogenous REST/NRSF for
the RE-1 binding sequence, antagonizing the transcriptional effects of
the wild-type protein (Chong et al., 1995 ). Injection of the in
vitro-transcribed xREST-DBD RNA into embryos at the one or two
cell stages resulted in the expression of the recombinant protein
throughout early development and included neurulation, as recognized by
Western analysis (data not shown). We then assayed the ability of the
expressed xREST-DBD protein to bind RE-1. As shown in Figure
2a, crude extracts prepared
from stage 18 embryos injected with the xREST-DBD RNA contain a marked
RE-1 binding activity. Extracts from uninjected embryos also appear to
contain this activity, although in a much lesser amount (Lane
2). The supershift induced by the incubation with the anti-Myc
antibody indicates that the observed RE-1 binding activity is because
of the expressed recombinant form.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 2.
DBD-xREST binds specifically to the RE-1 and
inhibits xNaV1.2 expression. a, Electrophoretical
mobility shift assay analysis of the complex formation
by the use of protein extracts of noninjected embryos (lanes
1-2) and embryos injected with the DBD-xREST RNA (lanes
3-9). Two or 10 µg of total protein was used in each assay.
DBD-xREST binds to RE-1 (lanes 3-6). The
addition of antibody against the Myc epitope produces the
super-retardation of the complex (lanes 7-9). The
binding specificity of the complex was evaluated by the
addition of 2- or 50-fold excess of cold probe (lanes
5-6, 8-9). The probe alone is shown in
Lane 10. Arrows indicate the complexes.
b, Expression of xREST-DBD inhibits xNaV1.2 expression
during neurulation. ISH for xNaV1.2; the injected side is marked by an
asterisk. Notice a single line of xNaV1.2 labeling, in
contrast with Figure 1a. c, Injection of
a morpholino-modified antisense oligonucleotide targeting xREST/NRSF
inhibits xNaV 1.2 expression at the time of neurulation.
d, Detail of a noninjected embryo (top
panel) and embryos injected with xREST-DBD RNA
(middle panel) or the antisense oligonucleotide
(bottom panel) in one of two cells.
|
|
Expression of xREST-DBD resulted in a significant decrease of the
expression of the xNaV1.2 RNA in the spinal territory of the injected
side; this effect was observed in 49% of the studied embryos
(n = 105; three experiments). We did not observe
ectopic expression of xNaV 1.2 or increased normotopic expression, as compared with the uninjected side (Fig. 2b,
middle panel in d). To test in a
mechanistically independent manner the functional role of REST/NRSF
in vivo, we injected a morpholino-modified antisense oligonucleotide against the xREST/NRSF into one cell at the two-cell stage embryos and examined xNaV1.2 expression at the neural tube stage.
We observed a dose-dependent decrease of the transcript encoding this
sodium channel in spinal neurons; at the maximal dose of the
oligonucleotide tested (20 ng/injection), 50% of the embryos displayed
defects in the expression of xNaV1.2 (n = 130; three
experiments); we did not observe extraneural expression of this
transcript (Fig. 2c, bottom panel in
d).
Because many genes contain RE-1 sequences in their regulatory regions,
we assayed the effect of xREST-DBD on the expression of other
neuronal-specific genes known to contain RE-1 sequences in other
species. We found a consistent decrease in the expression of the
N-tubulin and SCG10 transcripts in the primary neural territories. Thus, 58% of the embryos injected with the xREST-DBD RNA displayed partial or complete absence of the N-tubulin transcript in the injected
side (n = 112; four experiments), whereas absence of SCG10 was observed in 61% of the cases (n = 98; three
experiments) (Fig. 3a-d).

View larger version (65K):
[in this window]
[in a new window]
|
Figure 3.
xREST-DBD decreases the expression of other
neuronal genes but does not perturb neural induction.
a-c, ISH for N-tubulin; the injected side is marked by
an asterisk; b, both lateral views;
c, anterior view of the same embryo, where the
arrowheads signal the label of the primary spinal
neurons (sn) and cranial ganglia (cg).
d, xREST-DBD represses SCG10 expression.
Double arrowheads signal the expected
normal position of N-tubulin or SCG10 expression. The spotted
labeling in the injected side (a) and the
diffuse hue in c result from
-galactosidase activity staining. e-h, xREST-DBD
does not affect neural induction and early differentiation. Expression
patterns of Sox2 (e), Slug
(f), Hox11L12 (g), and
Pax-3 (h). e, h,
Anterior views; f, g, dorsal views.
|
|
Inhibition of REST function does not affect neurogenesis
The decreased expression of NaV1.2, N-tubulin, and SCG10
associated to the perturbation of xREST/NRSF function may be explained by decreased transcription of these neural-specific genes in a committed neuron as well as by a failure in neuronal differentiation, leading to the lack of neurons able to express these transcripts. To
differentiate between these alternatives, we evaluated the effect of
xREST-DBD on the expression patterns of genes used as markers of neural
induction and differentiation. We did not find significant
perturbations in the patterns of expression of the neural plate marker
XSox2, the neural crest marker xSlug, and the homeobox genes
Hox11L2 and Pax-3, which are expressed in
Rohon-Beard and a subset of spinal interneurons, respectively (Fig.
3e-h).
 |
DISCUSSION |
To advance our understanding of the molecular mechanisms that
underlie the concerted and specific expression of ion channels, we
considered the detailed physiological characterization of the development of excitability performed in Xenopus primary
spinal neurons. Although conservation of general mechanisms through
phylogeny is expected, comparison of our results with those obtained in mammalians must consider that in amphibians, a subpopulation of neurons
(primary neurons) withdraws from the mitotic cycle during early
embryogenesis and forms a circuit that controls early larval behavior.
In Xenopus embryos, primary neurons undergo their last round
of division during neurulation (around stage 15) and then differentiate
(Hartenstein, 1989 ). Our study focuses exclusively on this population.
At the time at which we examine expression of xNaV1.2 transcripts,
primary spinal neurons are in final stages of their differentiation,
although the embryo is still undergoing developmental processes
previous to organogenesis. In contrast, secondary neuron precursors
continue replicating until stage 35 or later. Much less is known about
the physiological development of this population.
We explored the role of REST/NRSF in the onset of the expression of
xNaV1.2. Considering the current view about REST/NRSF function, and the
widespread expression of xREST/NRSF before the onset of the expression
of xNaV1.2, we postulated that a decrease in the expression of REST at
the time of primary neuron differentiation would allow the function of
activators of the transcription of this and other neural genes.
However, we observed a maintained expression of the REST/NRSF
transcript throughout neurogenesis, which does not preclude the
expression of neural-specific transcripts and the acquisition of the
differentiated phenotype in primary spinal neurons. In contrast,
conditional expression of the full-length REST/NRSF protein in PC12
cells inhibits the neuronal differentiation normally triggered by nerve
growth factor in this cell line (Ballas et al., 2001 ). Furthermore, we
observed that the expression of xREST-DBD associates with a marked
repression of three different neural genes in primary spinal neurons of
Xenopus embryos, and we did not observe ectopic expression
of the studied genes. The results obtained by the injection of
morpholino-modified antisense oligonucleotides targeted against
xREST/NRSF support the possibility that the repression is a consequence
of decreased activity of the endogenous protein.
Because these results contrast with those obtained in mice embryos
bearing the homozygous deletion of the REST/NRSF gene, it is
necessary to emphasize that the developmental stages that we analyzed
are comparable with murine embryonic day (E) 7.5-8 and that studies of
REST/NRSF expression in mouse embryos have focused on later stages
(Chong et al., 1995 ; Schoenherr and Anderson, 1995 ; Chen et al., 1998 ).
Significant abnormalities in REST/NRSF-deficient embryos are observed
starting at E9.5-10, and 100% lethality is observed at E11.5.
Therefore, early different roles of REST/NRSF may have been missed.
A plausible mechanism that can reconcile the well described repressor
role and our observations is the differential recruitment of
corepressor or coactivator complexes to the promoters that bear the
RE-1 motif. This differential recruitment could depend on the cell type
or developmental stage-specific expression of the activators or
repressors, the differential accessibility or conformation of
chromatin, which in turn may allosterically modulate the function of
the transcription factor, or a combination of them. Although there are
antecedents for the bifunctionality of transcription factors (Rao,
2001 ), a detailed biochemical analysis demonstrating this for REST/NRSF
has not been communicated. Nevertheless, REST/NRSF can interact with
the nuclear receptor corepressor (NCoR), and in turn recruitment of
HDAC3 by NCoR has been associated to activation of transcription
(Jepsen et al., 2000 ). Regarding the differences in expression patterns
of possible components of complexes that include REST/NRSF, it must be
noted that CoREST, described as a REST-associated corepressor, displays
a predominantly neural expression pattern at very early stages of both
murine and amphibian development (Grimes et al., 2000 ; De la
Calle-Mustienes et al., 2002 ), although at later stages, non-neural
expression is observed. This fact is compatible with the idea that
REST-CoREST complexes may play a role in gene expression in the very
early nervous system different from the role of repressors in
non-neural cells at later stages.
The capability of REST/NRSF to ensemble diverse complexes able to
modulate transcription may be used to restrict the expression of some
genes to neurons, as well as to silence their non-neural expression.
This general mechanism may account for the regulated expression of
sodium channels and, thus, the onset of electrical excitability in
developing neurons.
 |
FOOTNOTES |
Received April 11, 2002; revised June 14, 2002; accepted July 22, 2002.
*
R.A. and R.F. contributed equally to this work.
This work was supported by Fondo Nacional de Desarrollo
Científico y Tecnológico 2980063, 4000031, 1961084, and
1000824; Fundación G. Puelma; fellowships from The Company of
Biologists Ltd. and Fundación de Estudios Biomédicos
Avanzados; and a graduate Comisión Nacional de Deserollo
Científico y Tecnológico Scholarship (R.A.). We
thank Dr. G. Mandel and J. Sierralta for continuous support, A. Figueroa and F. Vergara for excellent technical assistance, and Dr.
M. E. Andrés for comments on this manuscript.
Correspondence should be addressed to Manuel Kukuljan,
Programa de Fisiología y Biofísica, Instituto de
Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile,
Independencia 1027, Santiago, Chile. E-mail:
kukuljan{at}neuro.med.uchile.cl.
 |
REFERENCES |
-
Andrés ME,
Burger C,
Peral-Rubio MJ,
Battaglioli E,
Anderson ME,
Grimes J,
Dallman J,
Ballas N,
Mandel G
(1999)
CoREST: a functional corepressor required for regulation of neural-specific gene expression.
Proc Natl Acad Sci USA
96:9873-9878[Abstract/Free Full Text].
-
Ballas N,
Battaglioli E,
Atouf F,
Andrés ME,
Chenoweth J,
Anderson ME,
Burger C,
Moniwa M,
Davie JR,
Bowers WJ,
Federoff HJ,
Rose DW,
Rosenfeld MG,
Brehm P,
Mandel G
(2001)
Regulation of neuronal traits by a novel transcriptional complex.
Neuron
31:353-365[Web of Science][Medline].
-
Bessis A,
Champtiaux N,
Chatelin L,
Changeux JP
(1997)
The neuron-restrictive silencer element: a dual enhancer/silencer crucial for patterned expression of a nicotinic receptor gene in the brain.
Proc Natl Acad Sci USA
94:5906-5911[Abstract/Free Full Text].
-
Burger C,
Ribera AB
(1996)
Xenopus spinal neurons express Kv2 potassium channel transcripts during embryonic development.
J Neurosci
16:1412-1421[Abstract/Free Full Text].
-
Chen ZF,
Paquette AJ,
Anderson DJ
(1998)
NRSF/REST is required in vivo for repression of multiple neuronal target genes during embryogenesis.
Nat Genet
20:136-142[Web of Science][Medline].
-
Chong JA,
Tapia-Ramirez J,
Kim S,
Toledo-Aral JJ,
Zheng Y,
Boutros MC,
Altshuller YM,
Frohman MA,
Kraner SD,
Mandel G
(1995)
REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons.
Cell
80:949-957[Web of Science][Medline].
-
de la Calle-Mustienes E,
Moldolell J,
Gómez-Skarmeta JL
(2002)
The Xiro-repressed gene CoREST is expressed in Xenopus neural territories.
Mech Dev
110:209-211[Medline].
-
Desarmenien MG,
Clendening B,
Spitzer NC
(1993)
In vivo development of voltage-dependent ionic currents in embryonic Xenopus spinal neurons.
J Neurosci
13:2575-2581[Abstract].
-
Grimes JA,
Nielsen SJ,
Battaglioli E,
Miska EA,
Speh JC,
Berry DL,
Atouf F,
Holdener BC,
Mandel G,
Kouzarides T
(2000)
The co-repressor mSin3A is a functional component of the REST-CoREST repressor complex.
J Biol Chem
275:9461-9467[Abstract/Free Full Text].
-
Gurantz D,
Ribera AB,
Spitzer NC
(1996)
Temporal regulation of Shaker- and Shab-like potassium channel gene expression in single embryonic spinal neurons during K+ current development.
J Neurosci
16:3287-3295[Abstract/Free Full Text].
-
Hartenstein V
(1989)
Early neurogenesis in Xenopus: the spatio-temporal pattern of proliferation and cell lineages in the embryonic spinal cord.
Neuron
3:399-411[Web of Science][Medline].
-
Huang Y,
Myers SJ,
Dingledine R
(1999)
Transcriptional repression by REST: recruitment of Sin3A and histone deacetylase to neuronal genes.
Nat Neurosci
2:867-872[Web of Science][Medline].
-
Jepsen K,
Hermanson O,
Onami TM,
Gleiberman AS,
Lunyak V,
McEvilly RJ,
Kurokawa R,
Kumar V,
Liu F,
Seto E,
Hedrick SM,
Mandel G,
Glass CK,
Rose DW,
Rosenfeld MG
(2000)
Combinatorial roles of the nuclear receptor corepressor in transcription and development.
Cell
102:753-763[Web of Science][Medline].
-
Kallunki P,
Edelman GM,
Jones FS
(1998)
The neural restrictive silencer element can act as both a repressor and enhancer of L1 cell adhesion molecule gene expression during postnatal development.
Proc Natl Acad Sci USA
95:3233-3238[Abstract/Free Full Text].
-
Kraner SD,
Chong JA,
Tsay HJ,
Mandel G
(1992)
Silencing the type II sodium channel gene: a model for neural-specific gene regulation.
Neuron
9:37-44[Web of Science][Medline].
-
Kuwahara K,
Saito Y,
Ogawa E,
Takahashi N,
Nakagawa Y,
Naruse Y,
Harada M,
Hamanaka I,
Izumi T,
Miyamoto Y,
Kishimoto I,
Kawakami R,
Nakanishi M,
Mori N,
Nakao K
(2001)
The neuron-restrictive silencer element-neuron-restrictive silencer factor system regulates basal and endothelin 1-inducible atrial natriuretic peptide gene expression in ventricular myocytes.
Mol Cell Biol
21:2085-2097[Abstract/Free Full Text].
-
Mori N,
Schoenherr C,
Vandenbergh DJ,
Anderson DJ
(1992)
A common silencer element in the SCG10 and type II Na+ channel genes binds a factor present in nonneuronal cells but not in neuronal cells.
Neuron
9:45-54[Web of Science][Medline].
-
Naruse Y,
Aoki T,
Kojima T,
Mori N
(1999)
Neural restrictive silencer factor recruits mSin3 and histone deacetylase complex to repress neuron-specific target genes.
Proc Natl Acad Sci USA
96:13691-13696[Abstract/Free Full Text].
-
O'Dowd DK,
Ribera AB,
Spitzer NC
(1988)
Development of voltage-dependent calcium, sodium, and potassium currents in Xenopus spinal neurons.
J Neurosci
8:792-805[Abstract].
-
Olson EC
(1996)
Onset of electrical excitability during a period of circus plasma membrane movements in differentiating Xenopus neurons.
J Neurosci
16:5117-5129[Abstract/Free Full Text].
-
Palm K,
Belluardo N,
Metsis M,
Timmusk T
(1998)
Neuronal expression of zinc finger transcription factor REST/NRSF/XBR gene.
J Neurosci
18:1280-1296[Abstract/Free Full Text].
-
Paquette AJ,
Perez SE,
Anderson DJ
(2000)
Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo.
Proc Natl Acad Sci USA
97:12318-12323[Abstract/Free Full Text].
-
Rao A (2001) New functions for DNA binding domains.
http://stke.sciencemag.org/cgi/content/full/sigtrans;2001/81/pe1.
-
Ribera AB
(1990)
A potassium channel gene is expressed at neural induction.
Neuron
5:691-701[Web of Science][Medline].
-
Ribera AB,
Spitzer NC
(1989)
A critical period of transcription required for differentiation of the action potential of spinal neurons.
Neuron
2:1055-1062[Web of Science][Medline].
-
Schoenherr CJ,
Anderson DJ
(1995)
The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes.
Science
267:1360-1363[Abstract/Free Full Text].
-
Schoenherr CJ,
Paquette AJ,
Anderson DJ
(1996)
Identification of potential target genes for the neuron-restrictive silencer factor.
Proc Natl Acad Sci USA
93:9881-9886[Abstract/Free Full Text].
-
Scholl T,
Stevens MB,
Mahanta S,
Strominger JL
(1996)
A zinc finger protein that represses transcription of the human MHC class II gene, DPA.
J Immunol
156:1448-1457[Abstract].
-
Seth KA,
Majzoub JA
(2001)
Repressor element silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF) can act as an enhancer as well as a repressor of corticotropin-releasing hormone gene transcription.
J Biol Chem
276:13917-13923[Abstract/Free Full Text].
-
Sive HL,
Grainger RM,
Harland RM
(2000)
In: Early development of Xenopus laevis: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
-
Spitzer NC,
Lamborghini JE
(1976)
The development of the action potential mechanism of amphibian neurons isolated in culture.
Proc Natl Acad Sci USA
73:1641-1645[Abstract/Free Full Text].
-
Vincent A,
Lautermilch NJ,
Spitzer NC
(2000)
Antisense suppression of potassium channel expression demonstrates its role in maturation of the action potential.
J Neurosci
20:6087-6094[Abstract/Free Full Text].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22198347-05$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
W. J. Brackenbury, M. B.A. Djamgoz, and L. L. Isom
An Emerging Role for Voltage-Gated Na+ Channels in Cellular Migration: Regulation of Central Nervous System Development and Potentiation of Invasive Cancers
Neuroscientist,
December 1, 2008;
14(6):
571 - 583.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Abramovitz, T. Shapira, I. Ben-Dror, V. Dror, L. Granot, T. Rousso, E. Landoy, L. Blau, G. Thiel, and L. Vardimon
Dual Role of NRSF/REST in Activation and Repression of the Glucocorticoid Response
J. Biol. Chem.,
January 4, 2008;
283(1):
110 - 119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Olguin, P. Oteiza, E. Gamboa, J. L. Gomez-Skarmeta, and M. Kukuljan
RE-1 silencer of transcription/neural restrictive silencer factor modulates ectodermal patterning during Xenopus development.
J. Neurosci.,
March 8, 2006;
26(10):
2820 - 2829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Dallman, J. Allopenna, A. Bassett, A. Travers, and G. Mandel
A Conserved Role But Different Partners for the Transcriptional Corepressor CoREST in Fly and Mammalian Nervous System Formation
J. Neurosci.,
August 11, 2004;
24(32):
7186 - 7193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Belyaev, I. C. Wood, A. W. Bruce, M. Street, J.-B. Trinh, and N. J. Buckley
Distinct RE-1 Silencing Transcription Factor-containing Complexes Interact with Different Target Genes
J. Biol. Chem.,
January 2, 2004;
279(1):
556 - 561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kukuljan, A. Taylor, H. Chouinard, P. Olguin, C. V. Rojas, and A. B. Ribera
Selective Regulation of xSlo Splice Variants During Xenopus Embryogenesis
J Neurophysiol,
November 1, 2003;
90(5):
3352 - 3360.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|