 |
Previous Article | Next Article 
The Journal of Neuroscience, November 1, 2002, 22(21):9244-9254
Pituitary Adenylate Cyclase-Activating Polypeptide and Sonic
Hedgehog Interact to Control Cerebellar Granule Precursor Cell
Proliferation
Arnaud
Nicot1,
Vincent
Lelièvre2,
Jimmy
Tam2,
James A.
Waschek2, and
Emanuel
DiCicco-Bloom1, 3
1 Department of Neuroscience and Cell Biology,
University of Medicine and Dentistry of New Jersey/Robert Wood Johnson
Medical School, Piscataway, New Jersey 08854, 2 Department
of Psychiatry, Mental Retardation Research Center, University of
California, Los Angeles, Los Angeles, California 90024, and
3 Department of Pediatrics, University of Medicine and
Dentistry of New Jersey/Robert Wood Johnson Medical School, New
Brunswick, New Jersey 08901
 |
ABSTRACT |
Although positive and negative signals control neurogenesis in the
embryo, factors regulating postnatal proliferation are less well
characterized. In the vertebrate cerebellum, Sonic Hedgehog (Shh) is an
efficacious mitogen for cerebellar granule neuron precursors (GNPs),
and mutations activating the Shh pathway are linked to medulloblastoma,
a tumor derived from GNPs. Although the mitogenic effects of Shh can be
blocked by increasing cAMP or protein kinase A activity, the
physiological factors antagonizing this stimulation are undefined. In
the embryo, pituitary adenylate cyclase-activating polypeptide
(PACAP) receptor 1 (PAC1) signaling regulates neural precursor
proliferation. We now show that in the developing cerebellum, PAC1 mRNA
colocalizes with gene transcripts for Shh receptor Patched 1 and target
gene Gli1 in the external germinal layer. We
consequently investigated the interactions of PACAP and Shh in
proliferation of purified GNPs in culture. Shh exhibited mitogenic
activity in both rat and mouse cultures, stimulating DNA synthesis
~10-fold after 48 hr of exposure. PACAP markedly inhibited
Shh-induced thymidine incorporation by 50 and 85% in rat and mouse
GNPs, respectively, but did not significantly affect the stimulation
induced by other mitogens. This selective effect was reproduced by the
specific PAC1 agonist maxadilan, as well as by the adenylate cyclase
activator forskolin, suggesting that PAC1 provides a potent inhibitory
signal for Shh-induced proliferation in developing cerebellum. In
contrast, in the absence of Shh, PACAP and maxadilan modestly
stimulated DNA synthesis, an effect reproduced by activating protein
kinase C. These observations suggest that G-protein-coupled receptors,
such as PAC1, serve as sensors of environmental cues, coordinating
diverse neurogenetic signals.
Key words:
neurogenesis; cerebellum; neuronal precursors; GPCR; serpentine receptors; neuropeptide; proliferation; medulloblastoma
 |
INTRODUCTION |
During the first two postnatal weeks
in rodent cerebellum, granule neuron precursor (GNP) cells proliferate
in the external germinal cell layer (EGL) and migrate past Purkinje
neurons to form the internal granule cell layer (IGL), where they
mature into granule neurons (Altman and Bayer, 1996 ). The EGL
precursors themselves originate prenatally from the roof of the fourth
ventricle, in the rhombic lip (Alder et al., 1996 ). Although the
sequence of cerebellar development is well described, the molecular
mechanisms governing the GNP shift from proliferation to
differentiation are not well characterized. Purkinje neurons apparently
control granule cell number by regulating GNP expansion (Smeyne et al., 1995 ) and by providing trophic support for mature granule neurons (Vogel et al., 1989 ). Sonic Hedgehog (Shh), which is produced by
Purkinje neurons, is an important mitogen for GNPs (Dahmane and
Ruiz-i-Altaba, 1999 ; Wallace, 1999 ; Wechsler-Reya and Scott, 1999 ).
Indeed, mutations that activate the Hedgehog pathway contribute to the
formation of medulloblastoma, a human tumor likely derived from granule
cell precursors (for review, see Wechsler-Reya and Scott, 2001 ). Shh
binds to a receptor complex composed of the transmembrane proteins
Patched (Ptc) and Smoothened (Smo) (Marigo et al., 1996 ; Stone et al.,
1996 ), which are expressed by GNPs (Traiffort et al., 1999 ), leading to
the activation of transcriptional targets (Ruiz i Altaba, 1999 ).
Although Shh responses can be antagonized by increasing cAMP levels and
PKA activity (Fan et al., 1995 ; Hammerschmidt et al., 1996 ),
extracellular signals increasing cAMP and inhibiting Shh action remain
undefined. The neuropeptide pituitary adenylate cyclase-activating
polypeptide (PACAP), which regulates cAMP (Harmar et al., 1998 ), may be
one such factor, because it provides antimitogenic activity for
prenatal hindbrain and cortical neuroblasts (Lu and DiCicco-Bloom,
1997 ; Waschek et al., 1998 ; Suh et al., 2001 ), although mitogenic
effects in the developing cerebellum, especially postnatal
neurogenesis, are unknown.
PACAP belongs to a peptide family that includes secretin, glucagon,
growth hormone-releasing factor, and vasoactive intestinal peptide
(VIP) and interacts via three G-protein-coupled receptors (Harmar et
al., 1998 ); VPAC1 and VPAC2 have high affinity for both VIP and
PACAP, whereas PACAP receptor 1 (PAC1) binds only PACAP with high
affinity. Activation of the three PACAP receptors typically leads to a
robust Gs-mediated cAMP elevation, whereas PAC1
can also link to other transduction pathways, such as phospholipase C
(PLC) and calcium mobilization (Arimura, 1998 ). In previous studies,
differential pathway activation has been linked to different PAC1
splice isoforms (Spengler et al., 1993 ; Chatterjee et al., 1996 ; Nicot
and DiCicco-Bloom, 2001 ).
The presence of PACAP ligand and receptors during the first 2 postnatal
weeks in rodents suggests a role for PACAP in cerebellar neurogenesis
(Nielsen et al., 1998 ; Skoglosa et al., 1999 ; Basille et al., 2000 ;
Jaworski and Proctor, 2000 ). Although PACAP promotes granule cell
survival (Cavallaro et al., 1996 ; Gonzalez et al., 1997 ; Villalba et
al., 1997 ; Vaudry et al., 1999 ), its effects on GNP mitotic activity
are undefined. Here, we show that PAC1 receptors are expressed by
granule precursors coincident with gene transcripts for Ptc1 and target
gene Gli1. Furthermore, we identify context-dependent mitogenic actions
of PACAP and potent inhibition of Shh-induced mitogenic signaling in
cultured GNPs.
 |
MATERIALS AND METHODS |
In situ hybridization. Frozen brains were sectioned
sagittally at 10-12 µm thickness, mounted on Superfrost Plus slides
(Fisher Scientific, Houston, TX), and then stored at 70°C until
use. Sense and antisense 33P-labeled
riboprobes were prepared from linearized plasmids containing cDNAs for
the rat PAC1 receptor (Pisegna and Wank, 1993 ), mouse gli1 (1.6 kb
EcoRI fragment from Dr. A. Joyner, New York University, New
York, NY), mouse ptc1 (M2-3 containing 841 bp EcoRI
fragment from Dr. M. Scott, Stanford University, Stanford, CA), and
mouse sonic hedgehog (642 bp EcoRI fragment,
cloned into pBluescript II SK, provided by Dr. A. McMahon, Harvard
University, Cambridge, MA) (Echelard et al., 1993 ). In
situ detection was performed as described previously (Waschek et
al., 1998 ). Slides were dipped in Kodak NTB2 emulsion (Rochester, NY).
After development, slides were examined with a Zeiss Axiovert 135M
microscope equipped with the Spot Cooled Color Digital Camera
(Diagnostic Instruments, Sterling Heights, MI).
Reverse transcription-PCR. Reverse transcription (RT)
reactions were performed using 0.5 µg of total RNA per reaction and the Retroscript RT-PCR kit (Ambion, Austin, TX). The conditions for
detection of PAC1 mRNA splice isoforms and for VPAC1 and VPAC2 mRNAs
were identical to those described previously (Lelievre et al., 2002 ).
Primer sets were designed to recognize both rat and mouse receptor
sequences with 35 cycles of amplification. The primer sequences were
the following: For PAC1: sense, GGATGCTGGGATATGAATGACAGCACAGC, which
recognized the sequences 1035-1064 and 1027-1035 of the mouse and rat
cDNAs, respectively (GenBank accession numbers D82935 and D14909);
reverse, CCTTCCAGCTCCTCCATTTCCTCT, which recognized the
sequences 1495-1472 and 1466-1452 of the same cDNAs. For VPAC1: sense, CGGAAGTACTTCTGGGGGTAC, which recognized the sequences 757-777 and 765-785 of the mouse and rat cDNAs, respectively (GenBank accession numbers MN011703 and MN012685); reverse,
CCTGCAGATGCCAACGCCGCCAC, which recognized specifically the regions
1234-1212 and 1242-1220 of the same cDNAs. For VPAC2: sense,
GCCTGGTATTCTTCCAGTACTG, which recognized the sequences 663-684 and
726-747 of mouse and rat VPAC2 receptor cDNAs, respectively (GenBank
accession numbers NM009511 and NM017238); reverse,
CAGTTCACGCTGTACCTCACTG, which corresponded to the sequences 1207-1186
and 1270-1249 of the same cDNAs. To confirm the specificity of the DNA
amplifications, Southern blot analyses were undertaken using
[32P]-end-labeled specific
oligonucleotides as described previously (Lelievre et al., 2002 ).
Granule cell isolation and cell culture. Isolation of
granule cells (>98% pure) was performed as described previously (Tao et al., 1996 ) from Sprague Dawley rats (Hilltops Labs, Philadelphia, PA) or mice (housed C57BL/6J × 129/Sv). Cleaned rat or mouse
cerebella were incubated in trypsin-DNase solution (mixture of 1%
trypsin and 0.1% DNase; Worthington, Lakewood, NJ) for 3 min and
dissociated in DNase solution (0.05% in DMEM) by trituration. After
pelleting, cells were filtered (30 µm nylon mesh; Tekton, Tarrytown,
NY), resuspended, and centrifuged at 3200 rpm on a Percoll (Sigma, St.
Louis, MO) 35:60% step gradient (Hatten, 1985 ; Gao et al., 1991 ).
Cells at the 35:60% interface were collected and washed in phosphate
buffer. For RT-PCR studies, RNA was obtained from isolated cells from
postnatal day 5 (P5) P7, and P10 rats, using RNAqueous kit (Ambion).
For cultures, cells isolated from P6 to P7 rats (three per experiment)
or mice (six to seven per experiment) were plated onto a
poly-D-lysine (20 µg/ml)-coated 60 mm culture dish in defined medium (DM) composed of a 1:1 mixture of F12 and DMEM,
10 ng/ml insulin, 100 µg/ml transferrin, 10 mg/ml bovine serum
albumin, 100 µM putrescine, 20 nM progesterone, 30 nM
selenium, 6 mg/ml glucose, 50 U/ml penicillin, and 50 µg/ml
streptomycin. After 1 hr of preplating to remove adherent flat cells
(representing no more than 2% of the cells), small round (granule)
cells were dislodged by gentle pipetting and plated at ~2 × 105/cm2. For
thymidine incorporation studies, cells were cultured in poly-D-lysine-coated 24 well plates in DM, DM
plus high insulin (5 µg/ml, corresponding to the concentration found
in classical N2 supplemented medium), DM plus B27 supplement (2%), or
DM containing 3 µg/ml (150 nM) recombinant
mouse Shh-N (N indicates the N-terminal fragment; #461-SH; R & D
Systems, Minneapolis, MN). The next day (12-16 hr later), cells were
treated with vehicle, PACAP1-38 (10 nM; American
Peptide, Sunnyvale, CA), maxadilan (10 nM, a gift from E. Lerner, Harvard University, Cambridge, MA), or forskolin (30 µM; Sigma) for 6 or 24 hr. For RT-PCR and
bromodeoxyuridine (BrdU) labeling studies, P7 rat or mouse cells were
plated in poly-D-lysine-coated 35 mm dishes
in DM or DM plus Shh-N for 24 or 48 hr.
DNA synthesis. Incorporation of
[3H]thymidine
([3H]dT) was used to assess DNA
synthesis (DiCicco-Bloom et al., 2000 ). Cells were incubated with
[3H]dT during the final 2 hr of
incubation, and incorporation was assayed by scintillation
spectroscopy. Experiments were performed two to four times, with three
to four samples per group per experiment. Mean values for control and
treated cultures were compared using one-way ANOVA followed by Sheffe
post hoc or using Student's t test when appropriate.
BrdU labeling index. To visualize cells synthesizing DNA,
cells were exposed to the S phase marker BrdU (10 µM; Sigma) during the final 4 hr of incubation.
After fixation, cells were exposed to 2N HCl (30 min), rinsed twice in
PBS, incubated overnight in monoclonal anti-BrdU (1:100; Dako,
Carpinteria, CA) in PBS/0.3% Triton X-100, followed by 1 hr of
incubation with a biotinylated anti-mouse secondary antibody. Staining
was visualized using a Vectastain avidin-biotin complex kit and Vector
SG peroxidase substrate (Vector Laboratories, Burlingame, CA). The
labeling index, defined as the proportion of total cells incorporating BrdU into the nucleus, was determined by scoring the cells in five
randomly selected, nonoverlapping fields in each of the two to five
dishes per group per experiment.
 |
RESULTS |
PACAP and Shh system expression during embryonic and postnatal
cerebellar development
Previously, we characterized expression of the high-affinity
PACAP-preferring PAC1 receptors in the ventricular zone (VZ) throughout
the mouse hindbrain at embryonic day 10.5 (E10.5) and found that PACAP
inhibited DNA synthesis and Gli1 expression in cultured hindbrain
precursors (Waschek et al., 1998 ). To determine whether the PACAP
ligand/receptor system also plays a role in the developing cerebellum,
in situ hybridization was performed on sagittal sections of
embryonic mice. At E12.5, PAC1 gene transcripts were found to be
abundant in the emerging rhombic lip (Fig.
1A), which later
expands to become the EGL. In contrast, PAC1 gene transcripts were
expressed at low levels or were absent in the cerebellar plate VZ,
which gives rise to Purkinje cells and, at later times, to several
other neural cell types. However, PAC1 gene expression was clearly
detected in both cerebellar germinal centers 2 d later (Fig.
1B,C). In contrast to receptor
transcripts, PACAP expression was prominent in the lateral cerebellar
primordium, adjacent to the VZ and rhombic lip (Fig.
1D,E). From this location, PACAP
might signal to GNPs to regulate their development, although effects on
other precursors would also be possible.

View larger version (74K):
[in this window]
[in a new window]
|
Figure 1.
PAC1 receptor and PACAP ligand gene
expression during embryonic development detected by in
situ hybridization. A, Bright-field micrograph
showing PAC1 gene expression in the hindbrain ventricular zone and
rhombic lip (RL) but absent in the cerebellar plate
(CbP) in a sagittal section from an E12.5 mouse. Scale
bar, 1 mm. B, C, Micrographs showing PAC1
gene expression in E14.5 hindbrain and cerebellar area sagittal
sections. B, Bright field; C,
corresponding dark field. Scale bars, 500 µm. D,
E, In situ hybridizations (bright fields)
showing PACAP gene expression in a transverse hemisection at the level
of the cerebellar primordium at E14.5. E, Higher-power
micrograph from the box in D. Scale bars:
D, 500 µm; E, 25 µm. No significant
hybridization signals were seen with sense probes. CbP,
Cerebellar plate; CbPr, cerebellar primordium;
CP, choroid plexus; Is, isthmus;
LR, lateral recess of fourth ventricle;
Med, medulla; RL, rhombic lip;
Tg, tegmentum; 4V, fourth ventricle.
|
|
One possible action of PACAP on GNPs is to regulate their
proliferation. At birth, the EGL consists of a multicell layer of undifferentiated precursors that undergo extensive proliferation, generating a large precursor pool during the next few days. To define
possible functions in postnatal neurogenesis, PAC1 gene transcript
expression in the EGL was compared with localization of the Shh
receptor Ptc1 and the target gene Gli1. At P1, GNPs are located in the
EGL, whereas relatively few cells have migrated past the Purkinje
neurons to form the IGL. Ptc1 and Gli1 gene transcripts were highly
expressed in both the EGL and presumptive Purkinje layer (Fig.
2A/D,B/E),
as shown by others (Dahmane and Ruiz-i-Altaba, 1999 ;
Traiffort et al., 1999 ; Wallace, 1999 ). PAC1 gene transcripts also
exhibited intense expression in the EGL on P1 (Fig.
2C/F), suggesting possible interactions. During
subsequent postnatal development, Purkinje cells express increasing
levels of Shh (Traiffort et al., 1999 ) as granule precursors undergo extensive proliferation (Altman and Bayer, 1996 ). Concurrently, postmitotic differentiating granule neurons migrate from the inner EGL
(iEGL) to the IGL. Expression studies support continuing factor interactions as neurogenesis increases at P6-P7, because Ptc1 (Fig.
3C), Gli1 (Fig.
3D), and PAC1 (Fig. 3E) transcripts remain colocalized in the EGL. However, although Ptc1 hybridization signal is
uniformly localized in both the outermost part of the EGL (oEGL) and
the iEGL, the Gli1 hybridization signal is more intense in the oEGL, as
reported previously (Traiffort et al., 1999 ), whereas the PAC1
hybridization signal is most abundant in iEGL, raising the possibility
of sequential or opposing functions. Finally, PACAP gene expression was
detected diffusely in the Purkinje layer and more strongly in deep
cerebellar nuclei (data not shown), as reported previously (Nielsen et
al., 1998 ; Skoglosa et al., 1999 ). Because both PAC1 and Shh receptors
are colocalized in the postnatal EGL, cognate ligand interactions may
coordinate GNP proliferation.

View larger version (113K):
[in this window]
[in a new window]
|
Figure 2.
Localization of Ptc1 (A,
D), Gli1 (B, E), and PAC1
(C, F) gene expression in
postnatal day 1 rat brain by in situ hybridization.
Dark-field photomicrographs of sagittal sections of cerebellum are
shown in A-C (scale bar, 500 µm). Bright-field views
of corresponding boxes at higher magnification are shown
in D-F (scale bar, 50 µm). PL,
Purkinje cell layer; SC, spinal cord.
|
|

View larger version (130K):
[in this window]
[in a new window]
|
Figure 3.
Localization of Shh (A,
B), Ptc1 (C), Gli1
(D), and PAC1 (E) gene
expression in postnatal days 5-6 rat brain by in situ
hybridization. A, Bright-field photomicrograph of a
sagittal cerebellar section (scale bar, 100 µm). This section has
been hybridized with the Shh probe, which localizes to the Purkinje
layer. The box indicates the position of the
bright-field views at higher magnification in B-E
(scale bar, 35 µm). ML, Molecular layer;
PL, Purkinje cell layer.
|
|
Comparison of PACAP receptors in cerebellar populations
Because PACAP may activate PAC1, VPAC1, and VPAC2, the occurrence
of mRNAs for these receptors was investigated by RT-PCR followed by
Southern blot in freshly isolated granule cells (lower phase of the
gradient; see Materials and Methods) and was compared with cells in the
upper phase of the gradient (mostly glia and Purkinje cells). Both mice
and rats expressed mRNAs for PAC1 receptor, primarily short (null) and
hop isoforms (the hip isoform was barely detected by Southern blot) in
granule and glial/Purkinje cells (Fig.
4). VPAC1 and VPAC2 mRNAs were also
expressed in both phases in rats and mice with the signals appearing
much less intense in granule cells (Fig. 4, bottom panels).
These patterns of receptor gene expression in isolated granule cells
did not change appreciably in P5, P7, or P10 animals (data not shown),
suggesting that the PACAP-selective PAC1 receptor is the predominant
response system in GNPs during postnatal neurogenesis.

View larger version (86K):
[in this window]
[in a new window]
|
Figure 4.
Expression of PAC1, VPAC1, and VPAC2
receptors by cells isolated from postnatal mouse and rat cerebellum
defined by RT-PCR. Total RNA was extracted from embryonic cerebral
cortex (1) or from glial/Purkinje cell
(2) and granule cell (3)
fractions of P6-P7 mouse and rat cerebellum and subjected to RT-PCR.
Results in mouse fractions (left side) are compared with
E13.5 mouse cortex. Results in rat (right side) are
compared with E14.5 rat cortex. Shown for each receptor is the ethidium
bromide-stained gel (EB) and the Southern blot analyses
directly below (S) using PAC1 splice variant-,
VPAC1-, and VPAC2-specific internal probes. For PAC1, both the short
isoform (bottom band, 430 bp) and the hop isoform
(top band, 460 bp) were detected, whereas the hip insert
was barely detected by Southern blot. For VPAC1 and VPAC2, only one
mRNA form was detected (480 and 545 bp bands, respectively). RT-PCRs
performed in the absence of reverse transcriptase
( RT) are shown as an indicator of absence of
genomic DNA contamination. Band sizes were estimated using commercially
available DNA ladder (M).
|
|
Proliferative activity of mouse and rat cerebellar neuroblasts:
effects of medium composition
Although the foregoing expression studies suggest that PACAP
signaling may regulate both prenatal and postnatal granule cell production, we focused on postnatal development because isolated granule precursors from P6 to P7 rodents serve as a well characterized model to define regulatory mechanisms. Before examining PACAP and Shh
interactions, we investigated the effects of defined media and
components on precursor mitosis, thereby allowing comparison with
diverse previous studies. Although most studies of Shh were performed
on mouse cerebellar cells in media containing B27 or N2 supplements
(Dahmane and Ruiz-i-Altaba, 1999 ; Wallace, 1999 ; Wechsler-Reya and
Scott, 1999 ; Kenney and Rowitch, 2000 ), the actions of PACAP have been
defined in rat cultures in N2 or serum-supplemented media (Gonzalez et
al., 1997 ; Villalba et al., 1997 ; Vaudry et al., 1999 ). To compare
directly mitotic activity in different media, both mouse and rat P6-P7
cerebellar GNPs were incubated for 24-48 hr in defined medium
containing only low insulin (10 ng/ml, a concentration with metabolic
but not mitogenic activity) (DM), DM supplemented with high insulin (5 µg/ml, the concentration present in N2 media), DM containing B27
supplement, or DM supplemented with Shh. In contrast to most previous
studies examining PACAP (Gonzalez et al., 1997 ; Villalba et al., 1997 ;
Vaudry et al., 1999 ) or Shh (Kenney and Rowitch, 2000 ; Klein et al.,
2001 ; Pons et al., 2001 ; Solecki et al., 2001 ), we did not use 20-25
mM KCl, because KCl-induced depolarization inhibits basal
proliferation of cerebellar precursors (Cui and Bulleit, 1998 ) and
induces PACAP expression in differentiating cells (Tabuchi et al.,
2001 ). Furthermore, we found that in serum-free media, KCl addition was
not required to support survival, at least for 3 d, confirming
previous results (Kingsbury et al., 1985 ). We measured
[3H]dT incorporation as a marker of DNA
synthesis (Fig. 5). In all conditions,
mouse GNPs exhibited fourfold to 10-fold less mitotic activity compared
with rat cells when plated at equivalent cell number. The addition of
high concentrations of insulin (5 µg/ml), which stimulate
insulin-like growth factor-I (IGF-I) receptors, elicited a fourfold to
10-fold increase in [3H]dT incorporation
at 1 d in vitro (DIV1), consistent with the trophic and
proliferative effects of IGF-I in various neuroblast populations,
including cerebellar granule cells (DiCicco-Bloom et al., 1989 ; Gao et
al., 1991 ; D'Mello et al., 1993 ; Ye et al., 1996 ; Lin and Bulleit,
1997 ). Basal GNP mitotic activity in B27-containing medium was even
more pronounced, likely reflecting the actions of mitogenic hormones,
such as retinoic acid (Wohl and Weiss, 1998 ) and thyroid hormone T3
(Lezoualc'h et al., 1995 ), that are present in this supplement
(Brewer, 1995 ). However, after sustained exposure (48 hr, DIV2),
effects were reduced, consistent with differentiation induction by
IGF-I or B27 supplements (Brewer, 1995 ; Morrione et al., 2000 ; Niblock
et al., 2000 ). In marked contrast, although initial effects were
modest, Shh alone provided sustained mitogenic activity from DIV1 to
DIV2; Shh produced 2.5-fold and ~10-fold increases in DNA synthesis
at DIV1 and DIV2, respectively, in agreement with previous reports
(Wechsler-Reya and Scott, 1999 ).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5.
Effect of medium composition on rat and mouse GNP
DNA synthesis. GNPs from P6 to P7 rat or mouse cerebella were cultured
at 3 × 105 cells per well for 24 hr (DIV1) or
48 hr (DIV2) in DM or DM supplemented with 5 µg/ml insulin
(HI), 2% B27 (B27), or 3 µg/ml Shh (SHH). Cultures were exposed to
[3H]dT during the final 2 hr of culture to assess
DNA synthesis. Although HI and B27 media at DIV1 markedly stimulated
[3H]dT incorporation, longer exposure (DIV2)
resulted in lower counts. In contrast, Shh elicited a moderate but
sustained increase in GNP mitotic activity on both DIV1 and DIV2.
Values are expressed as mean counts per minute per well ± SEM
(6-12 wells per group).
|
|
PACAP differentially regulates DNA synthesis in GNP cultures
To define the effects of PACAP on DNA synthesis, we
analyzed [3H]dT incorporation in cells
exposed to PACAP for 6 and 24 hr. We used the 6 hr paradigm to better
identify mitogenic signals separate from possible trophic activity.
Specifically, because little cell death occurs in just 6 hr,
survival-promoting activity cannot be observed. Therefore, increases in
DNA synthesis and in the proportion of cells exhibiting BrdU nuclear
labeling primarily reflect progression from G1
into S phase (Lu et al., 1996 ; Lu and DiCicco-Bloom, 1997 ). In
contrast, 24 hr of treatment allows assessment of prolonged and/or
cumulative effects on proliferation.
To facilitate comparisons of the effect of PACAP in the presence of
different mitogens, we normalized data to the percentage of the vehicle
control response, although groups receiving only vehicle exhibit
different baseline incorporation (Fig.
6E) as reported above
(Fig. 5). In the 6 hr paradigm, PACAP elicited a modest (20-30%)
increase in [3H]dT incorporation in DM
(no mitogen), DM plus high insulin, or DM plus B27 supplements in rat
cultures (Fig. 6A), whereas it had no significant
effect in mouse GNP cultures (Fig. 6B). The fact that
we detected consistent increases in thymidine incorporation as soon as
6 hr after PACAP addition suggests that PACAP exerts mitotic activity.
To confirm this, we analyzed cell numbers and performed BrdU-labeling
experiments after 6 hr of PACAP treatment (Fig.
7). PACAP increased the BrdU labeling
index by 32% in the absence of altered cell numbers, indicating that
the peptide did not promote survival of cells possibly undergoing cell
death. Rather, increased thymidine incorporation (Fig.
6A) reflected more cells entering S phase. This
increased G1 to S phase progression is consistent
with direct mitogenic activity. However, this effect does not seem to
be to sufficient to sustain proliferation, as indicated by diminished
incorporation observed after longer PACAP treatment (Fig.
6C).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 6.
Effects of PACAP treatment on DNA synthesis.
Purified P6-P7 cerebellar GNPs were plated at 250,000 cells per well
in various media. The next day (DIV1), cells were treated with 10 nM PACAP (Pa) or vehicle
(Veh) for 6 hr (A, B) or
24 hr (DIV2) (C, D). Cultures were pulsed
with [3H]dT for the final 2 hr and processed for
[3H]dT incorporation. A, PACAP
treatment stimulated rat GNP mitosis in DM (no mitogen), DM plus
insulin (5 µg/ml) (HI), and B27-supplemented
medium (B27), whereas the peptide slightly
reduced Shh-induced [3H]dT incorporation.
B, In mouse cultures, PACAP was not sufficient to
stimulate GNP mitosis but reduced Shh-induced
[3H]dT incorporation by 20%. C,
PACAP treatment slightly stimulated rat GNP mitosis in DM, whereas the
peptide reduced Shh-mediated proliferation by 50%. D,
In mouse cultures, PACAP was not sufficient to maintain GNP
proliferation in DM (<50 cpm in both controls and treated groups).
However, in the presence of Shh, PACAP inhibited mitosis by 85%. Data
are expressed as a percentage of vehicle control for each medium (9-12
wells per group). *p < 0.05;
***p < 0.001. E, counts per
minute values from control cultures (vehicle treated) are indicated as
mean ± SEM (n = 3-4 independent experiments
for each medium).
|
|

View larger version (119K):
[in this window]
[in a new window]
|
Figure 7.
PACAP stimulates BrdU labeling. P7 rat cells were
cultured for 24 hr in DM and exposed to 10 nM PACAP for the
final 6 hr. After a pulse of 10 µM BrdU for the final 4 hr, cells were processed for BrdU immunocytochemistry.
A, B, Cells are visualized by phase
(A) or bright-field (B)
microscopy after immunocytochemical staining. Cells were counted in
five random fields per dish at 3, 18, and 24 hr of culture (5 dishes
per group), and data are presented in a table
(C). PACAP treatment did not affect cell number
but increased BrdU (BrdUrd) labeling index, indicating
that PACAP treatment for 6 hr increased S phase entry independent of
possible survival effects. Cell number per field in corresponding
cultures and BrdU index are expressed as mean ± SEM.
**p < 0.01, PACAP effect. Scale bar, 35 µm.
|
|
In marked contrast, in medium containing Shh, 6 hr of treatment with
PACAP inhibited DNA synthesis by 20-30% in both species (Fig.
6A,B). Furthermore, the decrease
was even more pronounced after 24 hr of treatment, with PACAP
inhibiting Shh-induced [3H]dT
incorporation by 50 and 85% in rat and mouse cultures, respectively (Fig. 6C,D). To determine whether the decrease
was attributable to inhibition of proliferation or negative effects on
cell survival, we followed the same treatment paradigm and analyzed
cell number and the BrdU labeling index of mouse cells cultured for
2 d in DM or DM plus Shh. Mouse cells in DM (or DM plus PACAP)
were never labeled with BrdU, whereas in the presence of Shh, 6.9 ± 0.7% of the cells exhibited nuclear immunoreactivity (Fig.
8). The Shh-induced increase in BrdU
labeling was associated with a 1.4-fold and fourfold increase in cell
number at DIV1 and DIV2, respectively, indicating that Shh stimulates
GNP proliferation. Strikingly, the addition of PACAP to Shh-treated
cultures resulted in virtually no BrdU incorporation (labeling index,
0.3 ± 0.3%) and prevented Shh-induced proliferation. Similar
BrdU labeling indices were obtained when PACAP was added as soon as 1 hr after seeding (SHH-treated cells, 6.1 ± 0.1%; SHH plus
PACAP-treated cells, 0.15 ± 0.13%; three determinations). These
results indicate that PACAP can both prevent SHH mitogenic action as
well as block ongoing SHH-induced proliferation.

View larger version (90K):
[in this window]
[in a new window]
|
Figure 8.
PACAP inhibits BrdU labeling in Shh-treated GNPs.
Phase-contrast (A-C) and bright-field
(A'-C') photographs of cells after BrdU
immunocytochemistry. P7 mouse cells were cultured for 2 d in
defined medium (Control) (A,
A') or defined medium with 3 µg/ml Shh
(B, B'). C, C',
Shh-treated cells exposed to 10 nM PACAP for the last 24 hr. Cultures were pulsed with 10 µM BrdU for the final 4 hr and processed for BrdU immunocytochemistry. D, Cell
number per field in corresponding cell cultures expressed as mean ± SEM. Scale bar, 35 µm.
|
|
In aggregate, these results indicate that PACAP differentially affects
GNP mitogenesis, as a function of growth factor context and animal
species. In particular, PACAP elicits modest promitogenic effects in
rat cells, acting either alone or in the presence of factors in
standard medium supplements, such as N2 and B27, whereas the peptide
exhibits strong antimitogenic activity in Shh-stimulated mouse or rat
GNP cultures.
PAC1 activation mediates regulation of GNP mitogenesis
Because PACAP binds multiple receptors, including PAC1, VPAC1, and
VPAC2, we determined whether the foregoing differential ligand actions
(mitogenic vs antimitogenic) depended on distinct PACAP receptors. As a
first step, we examined the effects of maxadilan, a specific PAC1
agonist (Moro and Lerner, 1997 ), on proliferation of rat precursor
mitogenesis. Maxadilan reproduced fully the differential effects of
PACAP, stimulating DNA synthesis in DM and inhibiting Shh-induced
mitogenesis (Fig. 9). In contrast, 10 nM VIP, a concentration that selectively activates VPAC1 or
VPAC2, did not affect thymidine incorporation in defined medium but
inhibited Shh-induced incorporation by 20% at 48 hr (data not shown).
These observations suggest that, in GNPs, PAC1 mediates inhibitory or
stimulatory mitotic effects depending on the presence of Shh, whereas
VPAC1 and/or VPAC2 activation contributes only to inhibition. Finally,
based on previous studies (Nicot and DiCicco-Bloom, 2001 ), differential
PACAP effects may depend on the relative expression of PAC1 splice
isoforms, including the short (null) and hop variants. However,
quantitative RT-PCR of the PAC1 isoforms, using PAC1short/PAC1hop
plasmids in different ratios as standards, did not support this
hypothesis; the ratio of PAC1short to PAC1hop mRNA signals was 1 ± 0.1 (ratio ± SEM, three experiments) in both control and 24 hr
Shh-treated rat GNPs.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 9.
Effect of the PAC1-selective agonist maxadilan on
GNP DNA synthesis. Rat (P7) cells were incubated in DM, DM plus insulin
(5 µg/ml) (HI), or Shh (3 µg/ml)
(SHH) for 16 hr and treated for an additional 24 hr with 10 nM maxadilan (Max). Cultures were
pulsed with [3H]dT for the final 2 hr and
processed for [3H]dT incorporation. Data are
expressed as a percentage of control (Veh, vehicle).
Data are derived from two to three experiments (8-12 wells per group).
***p < 0.001.
|
|
Adenylate cyclase pathway activation differentially inhibits
GNP mitogenesis
Because PACAP receptors classically couple to adenylate cyclase
(Arimura, 1998 ) and the adenylate cyclase activator forskolin can
suppress Shh-induced mitosis in mouse retinal (Jensen and Wallace,
1997 ) and cerebellar (Wechsler-Reya and Scott, 1999 ) precursors in
culture, we defined the effects of forskolin in the different media.
Forskolin treatment elicited significant decreases in
[3H]dT incorporation at both 6 and 24 hr
in media supplemented with high insulin, B27, or Shh in rat and mouse
cell cultures, although the drug was without effect at 6 hr in DM,
which lacks mitogens (Table 1). The drug
was indeed active, because a 15 min forskolin exposure induced
phosphorylation of nuclear cAMP response element-binding protein (CREB)
(control, 0.1 ± 0.1%; forskolin-treated, 92 ± 2%; percentage of cells exhibiting nuclear phospho-CREB immunoreactivity) (data not shown). Strikingly, forskolin induced far greater inhibition of DNA synthesis in mouse than in rat cultures, leading to an 85%
reduction in Shh-induced mitosis at 24 hr. Thus, mouse GNPs are
apparently more sensitive to cAMP stimulation than rat neuroblasts, potentially accounting for the more pronounced PACAP inhibitory effects
observed. These observations are consistent with previous reports of
greater forskolin-induced inhibition of Shh mitogenesis in mice (Jensen
and Wallace, 1997 ; Wechsler-Reya and Scott, 1999 ; Kenney and Rowitch,
2000 ) than in rats (Pons et al., 2001 ). Although it is unclear whether
response differences in the foregoing cited studies depended on species
or culture media, our comparative studies with forskolin (and PACAP)
using identical media indicate that mouse GNPs are indeed more
sensitive to cAMP-mediated inhibition than rat precursors under several
culture conditions.
Opposing effects of the adenylate cyclase and PLC/protein
kinase C pathways
Previous studies indicate that PACAP stimulates adenylate cyclase
as well as phospholipase C in cerebellar cultures (Basille et al.,
1995 ). Moreover, in cerebral cortical precursor cultures, activation of
these two pathways has opposite effects on proliferation (Nicot and
DiCicco-Bloom, 2001 ). Thus, we compared the effect of 6 hr of treatment
with forskolin and the protein kinase C (PKC) activator PMA on the
mitotic activity of mouse GNPs. In the presence of high insulin,
forskolin treatment elicited a 50% decrease in incorporation, whereas
PMA stimulated DNA synthesis by 40% (Fig. 10). These observations support the
antagonistic actions of these two pathways in cerebellar neuroblasts.
Consequently, the relative balance between adenylate cyclase and
phospholipase C pathways may explain the lack of effect of PACAP on
mitogenesis observed in mouse cells, in contrast to rat cells, which
are less sensitive to cAMP-induced inhibition (Table 1). These data may
also account for the promitogenic effects of PAC1 receptor activation,
which stimulates PLC, whereas activation of VPAC1/2 receptors (which couple to adenylate cyclase but not PLC) only leads to antimitogenic effects.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 10.
Opposing effects of adenylate cyclase and
phospholipase C pathways on DNA synthesis. P6-P7 mouse cells were
cultured in the presence of high insulin for 16 hr and treated for 6 hr
with 30 µM forskolin (Forsk), vehicle
(Con, control; 0.05% DMSO, 0.05% ethanol),
phorbol ester PMA (0.2 µM), or inactive enantiomer
PMA. Cultures were pulsed with [3H]dT for the
final 2 hr and processed for [3H]dT incorporation.
Data are expressed as a percentage of vehicle (9 wells per group).
***p < 0.001 versus control.
|
|
 |
DISCUSSION |
Our observations indicate that cerebellar GNPs express functional
G-protein-coupled receptors of the PACAP/VIP system and primarily PAC1,
which colocalizes with the Shh receptor, Ptc1, and its target gene Gli1
in the developing EGL. Moreover, as PAC1 initiates cAMP signaling in
mitotic neuroblasts, PAC1 agonists, including PACAP and maxadilan,
elicit robust inhibition of Shh-induced GNP proliferation in both rat
and mouse precursors, suggesting important interactions during
development. Finally, because PACAP can stimulate GNP mitosis in the
absence of Shh, these studies demonstrate a critical role for
G-protein-coupled receptors as sensors of environmental levels of
regulatory signals, potentially providing mechanisms for coordinating
brain neurogenesis.
PACAP receptors and regulation of neural development
The PACAP/VIP systems regulate diverse aspects of neural
development in the embryo, as indicated by studies of expression and
experimental manipulation in culture. PACAP and its receptors are
widely expressed in neurons of the embryonic and neonatal brain,
exhibiting region-specific and developmentally regulated patterns
(Nielsen et al., 1998 ; Waschek et al., 1998 ; Basille et al., 2000 ;
Jaworski and Proctor, 2000 ). Furthermore, PACAP agonist and antagonist
studies demonstrate peptide regulation of neuroblast proliferation and
differentiation in both the peripheral nervous system and CNS (Lu and
DiCicco-Bloom, 1997 ; Waschek et al., 1998 ; DiCicco-Bloom et al., 2000 ;
Suh et al., 2001 ). In addition to neurogenesis, the PACAP/VIP systems
are important in neuroprotection, acting directly or via glial release
of neurotrophic signals, as well as in glial function (for review, see
Lindholm et al., 1998 ; Waschek, 2002 ).
Our current studies provide new evidence for a role in cerebellar
neurogenesis. During postnatal development, PACAP is expressed by
Purkinje cells (Skoglosa et al., 1999 ), and PACAP-immunoreactive fibers
approach GNPs in the EGL (Nielsen et al., 1998 ). We now show that PAC1
is expressed by GNPs in the developing EGL at its inception prenatally
in the rhombic lip, at P0-P1 when cell proliferation in the EGL
commences, and at P5-P7, the peak of precursor pool proliferation and
granule neuron generation. These studies are consistent with recent
transcript expression and ligand-binding studies (Basille et al., 2000 ;
Jaworski and Proctor, 2000 ), providing a molecular basis for regulatory
functions. Previous work indicated that PACAP promotes survival of
cerebellar granule cells in culture (Gonzalez et al., 1997 ; Villalba et
al., 1997 ), an effect that may account for PACAP-induced growth of the
IGL in vivo (Vaudry et al., 1999 ). However, our present data
suggest additional roles of PACAP and a novel interaction with Shh in
regulating cerebellar GNP proliferation.
PAC1 isoforms in developing cerebellum
Because PAC1 receptor isoforms may determine the stimulatory or
inhibitory action of the peptide, characterization of isoform expression may suggest the role of PACAP in postnatal neurogenesis. Previous RT-PCR expression studies of PAC1 variants using whole rat
cerebellar extracts indicated a preponderance of the hop variant at P4
and of the short isoform after P8 (D'Agata et al., 1996 ; Jaworski,
2000 ). Both short and hop isoforms were identified in isolated granule
neurons in vitro (Cavallaro et al., 1996 ; Villalba et al.,
1997 ), whereas the short form predominated in cultured cerebellar glia
(Campard et al., 1997 ) and specifically astrocytes (Jaworski, 2000 ).
Our RT-PCR studies of freshly purified GNPs indicate that both isoforms
are expressed with no change in relative abundance from P5 to P10.
Thus, we speculate that the ontogenetic switch in receptor isoform
reported previously and detected in whole cerebellar extracts reflects
expression changes in other neuronal or glial populations and is not
responsible for the complex proliferative regulation we observe.
Integration of antimitogenic and promitogenic signals for granule
neuron production in the cerebellum
Locally produced or peripherally circulating growth factors, such
as fibroblast growth factor (FGF), epidermal growth factor (EGF), and
IGF-1, have been shown to promote granule cell proliferation or
survival (Gao et al., 1991 ; Tao et al., 1996 ; Ye et al., 1996 ; Lin and
Bulleit, 1997 ; Traiffort et al., 1999 ; Cheng et al., 2001 ). Secreted by
Purkinje cells, Shh is also an efficacious mitogen for GNPs. The fact
that GNPs exit the cell cycle in the middle of the EGL, just as they
approach a putatively primary source of Shh (Purkinje neurons),
suggests that antimitogenic signals must overcome the stimulatory
effects of an increasing Shh concentration. How these cells establish
and maintain their differentiation program in this Shh-rich mitogenic
environment is not well understood. Our data suggest that PACAP may
provide an antimitogenic signal. This inhibitory action is specific to
Shh, because it was not observed in the presence of other mitogens
present in N2- or B27-containing media. Indeed, PACAP is a significant
promitogenic factor in rat granule cultures in the absence of Shh.
Thus, the effects of PACAP on GNP proliferation depend on the mitogenic
environment. One mediating mechanism could be that environmental cues
modulate the relative expression of PAC1 isoforms. In previous work, we
demonstrated a link between PAC1 receptor isoform (short vs hop)
expression and activation of intracellular signaling pathways and
proliferation (Lu et al., 1998 ; Nicot and DiCicco-Bloom, 2001 ). By
analogy, a switch in the ratio of PAC1 splice isoforms in GNPs may
account for Shh-dependent effects on proliferation. However, we found
that GNPs cultured with or without Shh express both isoforms equally.
Rather, our data favor an alternative mechanism. The specific pathways
activated by PACAP might instead depend on environmental context. When
dividing GNPs migrate through the EGL toward the IGL, they
are exposed to a Shh-rich milieu provided by Purkinje neurons. Because
Shh can act by antagonizing PKA-dependent processes, the cells might be particularly sensitive to factors stimulating cAMP/PKA at this stage.
Indeed, our data suggest that PAC1 activation may be sufficient at the
EGL/molecular and Purkinje layer interface to counteract the mitogenic
effects of Shh, potentially serving to maintain the quiescence of
granule cells in the IGL (Cunningham and Roussel, 2001 ).
However, in the EGL near the pia mater, adenylate cyclase activity may
be strongly inhibited by factors such as the chemokine stromal-derived
factor-1 (SDF-1), which is highly expressed by the pia mater during
the first postnatal days and acts on EGL precursors through the
Gi-coupled serpentine receptor CXCR4 (Klein et al.,
2001 ). Thus, in this location, PACAP may exert only its promitogenic
activity through PLC and/or other pathway activation (Fig.
11). Moreover, other mechanisms
involving cell-cell contact may also participate in regulation of GNP
proliferation (Gao et al., 1991 ). Finally, the outer versus the
innermost portions of the EGL and the Purkinje cell layer exhibit
striking differences in the composition of extracellular matrix
glycoproteins and their integrin receptors, which may provide specific
modulation of peptide mitogenic or antimitogenic signaling (Pons et
al., 2001 ).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 11.
Model of PACAP regulation of granule
precursor proliferation. Granule precursors are depicted in the outer
EGL (A) and inner EGL (B),
with the complex of soluble, extracellular signals and their receptors,
including Shh/Ptc-Smo, SDF-1/CXCR4, and PACAP/PAC1 (adapted from Klein
et al., 2001 ). A, Near the pia matter during the first
postnatal week, granule cell proliferation is high. Prominent
expression of SDF-1/CXCR4 blocks adenylate cyclase activity and cAMP
via G i coupling, thereby promoting
Shh-induced proliferation. PAC1 activation may moderately stimulate
mitogenesis via the Gq/phospholipase C/protein
kinase C pathway. B, In the inner EGL as development
progresses, SDF-1 and CXCR4 levels decrease. In turn, the proliferative
action of Shh is now blocked by PACAP via Gs activation of
adenylate cyclase through PAC1 (and possibly VPAC1) receptors. PACAP
may be derived from nerve fibers emerging from the Purkinje layer or
brainstem nuclei. ML, Molecular layer;
PL, Purkinje cell layer; PM, pia
matter.
|
|
Potential mechanisms of Shh-PACAP interactions
Because PACAP markedly inhibits Shh mitogen action (but not
proliferation induced by high insulin or B27), the peptide likely acts
selectively on the Hedgehog pathway, which is highly dependent on cAMP
signaling. Such signaling interaction may include actions on Ptc1, Smo,
and Gli1 signaling, as well as unrelated pathways. Although the
ras-extracellular signal-regulated kinase pathway regulates cell
proliferation in a variety of cell types and may be governed by cAMP
(Grewal et al., 1999 ), it is not involved in the proliferative
effects of Shh in GNPs (Kenney and Rowitch, 2000 ). Thus, this pathway
is an unlikely target for the antimitogenic effects of PACAP, although
it plays a postmitotic role in PACAP-mediated survival of cerebellar
granule neurons (Gonzalez et al., 1997 ; Villalba et al., 1997 ).
However, Shh rapidly induces target genes such as Gli1 (Ruiz i Altaba,
1999 ), a transcriptional effector in skin tumors (Toftgard, 2000 ). As
the earliest target, Gli transcription factors are likely candidates
for regulating GNP proliferation, although studies remain to be
performed. For example, Gli3 is an activator of the Shh target gene
Gli1. However, in the presence of PKA stimulation, Gli3 is converted
into a transcriptional repressor (Dai et al., 1999 ), suggesting a
possible locus of PACAP action. In contrast, Gli transcription factors
share with the cAMP-responsive transcription factor CREB and the
transcriptional adapters CREB binding protein and p300 (Lundblad et
al., 1995 ; Akimaru et al., 1997 ). PACAP rapidly elicits nuclear
phospho-CREB, and CREB overexpression is sufficient to induce granule
cell differentiation in the presence of Shh (Pons et al., 2001 ). Thus,
phospho-CREB signaling may overcome Shh mitogenic action by directly
interacting or competing with Gli transcriptional complexes for the
adapter proteins. This scenario may occur in vivo, because
phospho-CREB is observed primarily in granule cells at the level of the
Purkinje cell layer, where they are engaged in differentiation (Pons et
al., 2001 ). Indeed, the high levels of PAC1 expression in the iEGL as
well as the in Purkinje layer and IGL are entirely consistent with
PACAP serving as a regulator of CREB activation and cell differentiation.
Finally, PACAP may affect pathways regulated by Shh that are
independent of the Ptc-Smo receptor and Gli transcription factors, including those involved in cell migration (Testaz et al., 2001 ), induction of hairy enhancer of split-1 transcription factor
(Solecki et al., 2001 ), and cell-cycle control, such as cyclin D1
(Kenney and Rowitch, 2000 ) and cyclin B1 (Barnes et al., 2001 ).
Although PACAP is known to rapidly elicit increased levels of
cyclin-dependent kinase inhibitor p57 to block cell-cycle progression
of cerebral cortical precursors (Carey et al., 2002 ), the peptide
inhibits all cortical mitogens, including FGF, IGF, and EGF (Lu and
DiCicco-Bloom, 1997 ). In contrast, our studies in prenatal hindbrain
(Lelievre et al., 2002 ) and postnatal cerebellum indicate selective
actions of PACAP, depending on mitogenic environment. Additional
studies are required to determine the mechanism(s) of mitogen-selective antimitotic effects of PACAP.
More generally, these studies identify a new function of
G-protein-coupled receptors as potential sensors of environmental cues
during cerebellar histogenesis. Moreover, the potent antimitogenic effects of PACAP in the context of Shh-mediated proliferation suggest
that the PAC1 receptor may be a useful therapeutic target in childhood
medulloblastoma, a granule cell malignancy driven by abnormal Shh
signaling (Dong et al., 2000 ; Zurawel et al., 2000 ; Pomeroy et al.,
2002 ).
 |
FOOTNOTES |
Received July 10, 2002; revised July 10, 2002; accepted Aug. 12, 2002.
This work was supported by National Institutes of Health Grants
HD06576, HD34475, and HD0461 (J.A.W.) and NS 32401 (E.D.-B.) and The
Children's Brain Tumor Foundation (E.D.-B.). E. D.-B. is a member
of the Cancer Institute of New Jersey, National Institute of
Environmental Health Sciences/United States Environmental Protection Agency Center for Childhood Neurotoxicology and Assessment.
*J.A.W. and E.D.-B. contributed equally to this work.
Correspondence should be addressed to Dr. Arnaud Nicot, Department of
Neuroscience and Cell Biology, University of Medicine and Dentistry of
New Jersey/Robert Wood Johnson Medical School, 675 Hoes Lane,
CABM Room 338, Piscataway, NJ 08854. E-mail: nicotar{at}umdnj.edu.
 |
REFERENCES |
-
Akimaru H,
Chen Y,
Dai P,
Hou DX,
Nonaka M,
Smolik SM,
Armstrong S,
Goodman RH,
Ishii S
(1997)
Drosophila CBP is a co-activator of cubitus interruptus in hedgehog signalling.
Nature
386:735-738[Medline].
-
Alder J,
Cho NK,
Hatten ME
(1996)
Embryonic precursor cells from the rhombic lip are specified to a cerebellar granule neuron identity.
Neuron
17:389-399[Web of Science][Medline].
-
Altman J,
Bayer SA
(1996)
In: Development of the cerebellar system in relation to its evolution, structure and functions. New York: CRC.
-
Arimura A
(1998)
Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocrine, endocrine, and nervous systems.
Jpn J Physiol
48:301-331[Web of Science][Medline].
-
Barnes EA,
Kong M,
Ollendorff V,
Donoghue DJ
(2001)
Patched1 interacts with cyclin B1 to regulate cell cycle progression.
EMBO J
20:2214-2223[Web of Science][Medline].
-
Basille M,
Gonzalez BJ,
Desrues L,
Demas M,
Fournier A,
Vaudry H
(1995)
Pituitary adenylate cyclase-activating polypeptide (PACAP) stimulates adenylyl cyclase and phospholipase C activity in rat cerebellar neuroblasts.
J Neurochem
65:1318-1324[Web of Science][Medline].
-
Basille M,
Vaudry D,
Coulouarn Y,
Jegou S,
Lihrmann I,
Fournier A,
Vaudry H,
Gonzalez B
(2000)
Comparative distribution of pituitary adenylate cyclase-activating polypeptide (PACAP) binding sites and PACAP receptor mRNAs in the rat brain during development.
J Comp Neurol
425:495-509[Web of Science][Medline].
-
Brewer G
(1995)
Serum-free B27/neurobasal medium supports differentiated growth of neurons from the striatum, substantia nigra, septum, cerebral cortex, cerebellum, and dentate gyrus.
J Neurosci Res
42:674-683[Web of Science][Medline].
-
Campard PK,
Crochemore C,
Rene F,
Monnier D,
Koch B,
Loeffler JP
(1997)
PACAP type I receptor activation promotes cerebellar neuron survival through the cAMP/PKA signaling pathway.
DNA Cell Biol
16:323-333[Web of Science][Medline].
-
Carey RG,
Li B,
DiCicco-Bloom E
(2002)
Pituitary adenylate cyclase activating polypeptide anti-mitogenic signaling in cerebral cortical progenitors is regulated by p57Kip2-dependent CDK2 activity.
J Neurosci
22:1583-1591[Abstract/Free Full Text].
-
Cavallaro S,
Copani A,
D'Agata V,
Musco S,
Petralia S,
Ventra C,
Stivala F,
Travali S,
Canonico PL
(1996)
Pituitary adenylate cyclase activating polypeptide prevents apoptosis in cultured cerebellar granule neurons.
Mol Pharmacol
50:60-66[Abstract].
-
Chatterjee TK,
Sharma RV,
Fisher RA
(1996)
Molecular cloning of a novel variant of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor that stimulates calcium influx by activation of L-type calcium channels.
J Biol Chem
271:32226-32232[Abstract/Free Full Text].
-
Cheng Y,
Tao Y,
Black IB,
DiCicco-Bloom E
(2001)
A single peripheral injection of basic fibroblast growth factor (bFGF) stimulates granule cell production and increases cerebellar growth in newborn rats.
J Neurobiol
46:220-229[Web of Science][Medline].
-
Cui H,
Bulleit RF
(1998)
Potassium chloride inhibits proliferation of cerebellar granule neuron progenitors.
Brain Res Dev Brain Res
106:129-135[Medline].
-
Cunningham JJ,
Roussel MF
(2001)
Cyclin-dependent kinase inhibitors in the development of the central nervous system.
Cell Growth Differ
12:387-396[Free Full Text].
-
D'Agata V,
Cavallaro S,
Stivala F,
Canonico PL
(1996)
Tissue-specific and developmental expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors in rat brain.
Eur J Neurosci
8:310-318[Web of Science][Medline].
-
Dahmane N,
Ruiz-i-Altaba A
(1999)
Sonic hedgehog regulates the growth and patterning of the cerebellum.
Development
126:3089-3100[Abstract].
-
Dai P,
Akimaru H,
Tanaka Y,
Maekawa T,
Nakafuku M,
Ishii S
(1999)
Sonic Hedgehog-induced activation of the Gli1 promoter is mediated by GLI3.
J Biol Chem
274:8143-8152[Abstract/Free Full Text].
-
DiCicco-Bloom E,
Cohen RE,
Black I
(1989)
Insulin growth factors regulate mitosis and survival in cultured cerebellar granule cells and precursors.
Soc Neurosci Abstr
15:328.
-
DiCicco-Bloom E,
Deutsch PJ,
Maltzman J,
Zhang J,
Pintar JE,
Zheng J,
Friedman WF,
Zhou X,
Zaremba T
(2000)
Autocrine expression and ontogenetic functions of the PACAP ligand/receptor system during sympathetic development.
Dev Biol
219:197-213[Web of Science][Medline].
-
D'Mello SR,
Galli C,
Ciotti T,
Calissano P
(1993)
Induction of apoptosis in cerebellar granule neurons by low potassium: inhibition of death by insulin-like growth factor I and cAMP.
Proc Natl Acad Sci USA
90:10989-10993[Abstract/Free Full Text].
-
Dong J,
Gailani MR,
Pomeroy SL,
Reardon D,
Bale AE
(2000)
Identification of PATCHED mutations in medulloblastomas by direct sequencing.
Hum Mutat
16:89-90[Medline].
-
Echelard Y,
Epstein DJ,
St-Jacques B,
Shen L,
Mohler J,
McMahon JA,
McMahon AP
(1993)
Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity.
Cell
75:1417-1430[Web of Science][Medline].
-
Fan CM,
Porter JA,
Chiang C,
Chang DT,
Beachy PA,
Tessier-Lavigne M
(1995)
Long-range sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway.
Cell
81:457-465[Web of Science][Medline].
-
Gao WO,
Heintz N,
Hatten ME
(1991)
Cerebellar granule cell neurogenesis is regulated by cell-cell interactions in vitro.
Neuron
6:705-715[Web of Science][Medline].
-
Gonzalez BJ,
Basille M,
Vaudry D,
Fournier A,
Vaudry H
(1997)
Pituitary adenylate cyclase-activating polypeptide promotes cell survival and neurite outgrowth in rat cerebellar neuroblasts.
Neuroscience
78:419-430[Web of Science][Medline].
-
Grewal SS,
York RD,
Stork PJ
(1999)
Extracellular-signal-regulated kinase signalling in neurons.
Curr Opin Neurobiol
9:544-553[Web of Science][Medline].
-
Hammerschmidt M,
Bitgood MJ,
McMahon AP
(1996)
Protein kinase A is a common negative regulator of Hedgehog signaling in the vertebrate embryo.
Genes Dev
10:647-658[Abstract/Free Full Text].
-
Harmar AJ,
Arimura A,
Gozes I,
Journot L,
Laburthe M,
Pisegna JR,
Rawlings SR,
Robberecht P,
Said SI,
Sreedharan SP,
Wank SA,
Waschek JA
(1998)
International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide.
Pharmacol Rev
50:265-270[Abstract/Free Full Text].
-
Hatten ME
(1985)
Neuronal regulation of astroglial morphology and proliferation in vitro.
J Cell Biol
100:384-396[Abstract/Free Full Text].
-
Jaworski DM
(2000)
Expression of pituitary adenylate cyclase-activating polypeptide (PACAP) and the PACAP-selective receptor in cultured rat astrocytes, human brain tumors, and in response to acute intracranial injury.
Cell Tissue Res
300:219-230[Medline].
-
Jaworski DM,
Proctor MD
(2000)
Developmental regulation of pituitary adenylate cyclase-activating polypeptide and PAC(1) receptor mRNA expression in the rat central nervous system.
Brain Res Dev Brain Res
120:27-39[Medline].
-
Jensen AM,
Wallace VA
(1997)
Expression of Sonic hedgehog and its putative role as a precursor cell mitogen in the developing mouse retina.
Development
124:363-371[Abstract].
-
Kenney AM,
Rowitch DH
(2000)
Sonic hedgehog promotes G(1) cyclin expression and sustained cell cycle progression in mammalian neuronal precursors.
Mol Cell Biol
20:9055-9067[Abstract/Free Full Text].
-
Kingsbury AE,
Gallo V,
Woodhams PL,
Balazs R
(1985)
Survival, morphology and adhesion properties of cerebellar interneurones cultured in chemically defined and serum-supplemented medium.
Brain Res
349:17-25[Medline].
-
Klein RS,
Rubin JB,
Gibson HD,
DeHaan EN,
Alvarez-Hernandez X,
Segal RA,
Luster AD
(2001)
SDF-1 alpha induces chemotaxis and enhances Sonic hedgehog-induced proliferation of cerebellar granule cells.
Development
128:1971-1981[Abstract/Free Full Text].
-
Lelievre V,
Hu Z,
Byun JY,
Ioffe Y,
Wachek JA
(2002)
FGF-2 converts PACAP growth action on embryonic hindbrain precursors from stimulation to inhibition.
J Neurosci Res
67:566-573[Web of Science][Medline].
-
Lezoualc'h F,
Seugnet I,
Monnier AL,
Ghysdael J,
Behr JP,
Demeneix BA
(1995)
Inhibition of neurogenic precursor proliferation by antisense alpha thyroid hormone receptor oligonucleotides.
J Biol Chem
270:12100-12108[Abstract/Free Full Text].
-
Lin X,
Bulleit RF
(1997)
Insulin-like growth factor I (IGF-I) is a critical trophic factor for developing cerebellar granule cells.
Brain Res Dev Brain Res
99:234-242[Medline].
-
Lindholm D,
Skoglosa Y,
Takei N
(1998)
Developmental regulation of pituitary adenylate cyclase activating polypeptide (PACAP) and its receptor 1 in rat brain: function of PACAP as a neurotrophic factor.
Ann NY Acad Sci
865:189-196[Web of Science][Medline].
-
Lu N,
DiCicco-Bloom E
(1997)
Pituitary adenylate cyclase-activating polypeptide is an autocrine inhibitor of mitosis in cultured cortical precursor cells.
Proc Natl Acad Sci USA
94:3357-3362[Abstract/Free Full Text].
-
Lu N,
Black IB,
DiCicco-Bloom E
(1996)
A paradigm for distinguishing the roles of mitogenesis and trophism in neuronal precursor proliferation.
Brain Res Dev Brain Res
94:31-36[Medline].
-
Lu N,
Zhou R,
DiCicco-Bloom E
(1998)
Opposing mitogenic regulation by PACAP in sympathetic and cerebral cortical precursors correlates with differential expression of PACAP receptor (PAC1-R) isoforms.
J Neurosci Res
53:651-662[Medline].
-
Lundblad JR,
Kwok RP,
Laurance ME,
Harter ML,
Goodman RH
(1995)
Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP.
Nature
374:85-88[Medline].
-
Marigo V,
Davey RA,
Zuo Y,
Cunningham JM,
Tabin CJ
(1996)
Biochemical evidence that patched is the Hedgehog receptor.
Nature
384:176-179[Medline].
-
Moro O,
Lerner EA
(1997)
Maxadilan, the vasodilator from sand flies, is a specific pituitary adenylate cyclase activating peptide type I receptor agonist.
J Biol Chem
272:966-970[Abstract/Free Full Text].
-
Morrione A,
Romano G,
Navarro M,
Reiss K,
Valentinis B,
Dews M,
Eves E,
Rosner MR,
Baserga R
(2000)
Insulin-like growth factor I receptor signaling in differentiation of neuronal H19-7 cells.
Cancer Res
60:2263-2272[Abstract/Free Full Text].
-
Niblock MM,
Brunso-Bechtold JK,
Riddle DR
(2000)
Insulin-like growth factor I stimulates dendritic growth in primary somatosensory cortex.
J Neurosci
20:4165-4176[Abstract/Free Full Text].
-
Nicot A,
DiCicco-Bloom E
(2001)
Regulation of neuroblast mitosis is determined by PACAP receptor isoform expression.
Proc Natl Acad Sci USA
98:4758-4763[Abstract/Free Full Text].
-
Nielsen HS,
Hannibal J,
Fahrenkrug J
(1998)
Expression of pituitary adenylate cyclase activating polypeptide (PACAP) in the postnatal and adult rat cerebellar cortex.
NeuroReport
9:2639-2642[Web of Science][Medline].
-
Pisegna JR,
Wank SA
(1993)
Molecular cloning and functional expression of the pituitary adenylate cyclase-activating polypeptide type I receptor.
Proc Natl Acad Sci USA
90:6345-6349[Abstract/Free Full Text].
-
Pomeroy SL,
Tamayo P,
Gaasenbeek M,
Sturla LM,
Angelo M,
McLaughlin ME,
Kim JY,
Goumnerova LC,
Black PM,
Lau C,
Allen JC,
Zagzag D,
Olson JM,
Curran T,
Wetmore C,
Biegel JA,
Poggio T,
Mukherjee S,
Rifkin R,
Califano A
(2002)
Prediction of central nervous system embryonal tumor outcome based on gene expression.
Nature
415:436-442[Medline].
-
Pons S,
Trejo JL,
Martinez-Morales JR,
Marti E
(2001)
Vitronectin regulates Sonic hedgehog activity during cerebellum development through CREB phosphorylation.
Development
128:1481-1492[Abstract].
-
Ruiz i Altaba A
(1999)
Gli proteins and Hedgehog signaling: development and cancer.
Trends Genet
15:418-425[Web of Science][Medline].
-
Skoglosa Y,
Patrone C,
Lindholm D
(1999)
Pituitary adenylate cyclase activating polypeptide is expressed by developing rat Purkinje cells and decreases the number of cerebellar gamma-amino butyric acid positive neurons in culture.
Neurosci Lett
265:207-210[Medline].
-
Smeyne RJ,
Chu T,
Lewin A,
Bian F,
S-Crisman S,
Kunsch C,
Lira SA,
Oberdick J
(1995)
Local control of granule cell generation by cerebellar Purkinje cells.
Mol Cell Neurosci
6:230-251[Web of Science][Medline].
-
Solecki DJ,
Liu XL,
Tomoda T,
Fang Y,
Hatten ME
(2001)
Activated Notch2 signaling inhibits differentiation of cerebellar granule neuron precursors by maintaining proliferation.
Neuron
31:557-568[Web of Science][Medline].
-
Spengler D,
Waeber C,
Pantaloni C,
Holsboer F,
Bockaert J,
Seeburg PH,
Journot L
(1993)
Differential signal transduction by five splice variants of the PACAP receptor.
Nature
365:170-175[Medline].
-
Stone DM,
Hynes M,
Armanini M,
Swanson TA,
Gu Q,
Johnson RL,
Scott MP,
Pennica D,
Goddard A,
Phillips H,
Noll M,
Hooper JE,
Sauvage FD,
Rosenthal A
(1996)
The tumor-suppressor gene patched encodes a candidate receptor for Sonic hedgehog.
Nature
384:129-134[Medline].
-
Suh J,
Lu N,
Nicot A,
Tatsuno I,
DiCicco-Bloom E
(2001)
PACAP is an anti-mitogenic signal in developing cerebral cortex.
Nat Neurosci
4:123-124[Web of Science][Medline].
-
Tabuchi A,
Koizumi M,
Nakatsubo J,
Yaguchi T,
Tsuda M
(2001)
Involvement of endogenous PACAP expression in the activity-dependent survival of mouse cerebellar granule cells.
Neurosci Res
39:85-93[Medline].
-
Tao Y,
Black IB,
DiCicco-Bloom E
(1996)
Neurogenesis in neonatal rat brain is regulated by peripheral injection of basic fibroblast growth factor (bFGF).
J Comp Neurol
376:653-663[Web of Science][Medline].
-
Testaz S,
Jarov A,
Williams KP,
Ling LE,
Koteliansky VE,
Fournier-Thibault C,
Duband JL
(2001)
Sonic hedgehog restricts adhesion and migration of neural crest cells independently of the Patched-Smoothened-Gli signaling pathway.
Proc Natl Acad Sci USA
98:12521-12526[Abstract/Free Full Text].
-
Toftgard R
(2000)
Hedgehog signalling in cancer.
Cell Mol Life Sci
57:1720-1731[Web of Science][Medline].
-
Traiffort E,
Charytoniuk D,
Watroba L,
Faure H,
Sales N,
Ruat M
(1999)
Discrete localizations of hedgehog signalling components in the developing and adult rat nervous system.
Eur J Neurosci
11:3199-3214[Web of Science][Medline].
-
Vaudry D,
Gonzalez BJ,
Basille M,
Fournier A,
Vaudry H
(1999)
Neurotrophic activity of pituitary adenylate cyclase-activating polypeptide on rat cerebellar cortex during development.
Proc Natl Acad Sci USA
96:9415-9420[Abstract/Free Full Text].
-
Villalba M,
Bockaert J,
Journot L
(1997)
Pituitary adenylate cyclase-activating polypeptide (PACAP-38) protects cerebellar granule neurons from apoptosis by activating the mitogen-activated protein kinase (MAP kinase) pathway.
J Neurosci
17:83-90[Abstract/Free Full Text].
-
Vogel MW,
Sunter K,
Herrup K
(1989)
Numerical matching between granule and Purkinje cells in lurcher chimeric mice: a hypothesis for the trophic rescue of granule cells from target-related cell death.
J Neurosci
9:3454-3462[Abstract].
-
Wallace VA
(1999)
Purkinje-cell-derived Sonic hedgehog regulates granule neuron precursor cell proliferation in the developing mouse cerebellum.
Curr Biol
9:445-448[Web of Science][Medline].
-
Waschek JA
(2002)
Multiple actions of pituitary adenylyl cyclase activating peptide in nervous system development and regeneration.
Dev Neurosci
24:14-23[Web of Science][Medline].
-
Waschek JA,
Casillas RA,
Nguyen TB,
DiCicco-Bloom EM,
Carpenter EM,
Rodriguez WI
(1998)
Neural tube expression of pituitary adenylate cyclase-activating polypeptide (PACAP) and receptor: potential role in patterning and neurogenesis.
Proc Natl Acad Sci USA
95:9602-9607[Abstract/Free Full Text].
-
Wechsler-Reya RJ,
Scott MP
(1999)
Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog.
Neuron
22:103-114[Web of Science][Medline].
-
Wechsler-Reya RJ,
Scott MP
(2001)
The developmental biology of brain tumors.
Annu Rev Neurosci
24:385-428[Web of Science][Medline].
-
Wohl CA,
Weiss S
(1998)
Retinoic acid enhances neuronal proliferation and astroglial differentiation in cultures of CNS stem cell-derived precursors.
J Neurobiol
37:281-290[Web of Science][Medline].
-
Ye P,
Xing Y,
Dai Z,
D'Ercole AJ
(1996)
In vivo actions of insulin-like growth factor-I (IGF-I) on cerebellum development in transgenic mice: evidence that IGF-I increases proliferation of granule cell progenitors.
Brain Res Dev Brain Res
95:44-54[Medline].
-
Zurawel RH,
Allen C,
Wechsler-Reya R,
Scott MP,
Raffel C
(2000)
Evidence that haploinsufficiency of Patch leads to medulloblastoma in mice.
Genes Chromosomes Cancer
28:77-81[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/22219244-11$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
T. Fila, S. Trazzi, C. Crochemore, R. Bartesaghi, and E. Ciani
Lot1 Is a Key Element of the Pituitary Adenylate Cyclase-activating Polypeptide (PACAP)/Cyclic AMP Pathway That Negatively Regulates Neuronal Precursor Proliferation
J. Biol. Chem.,
May 29, 2009;
284(22):
15325 - 15338.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Kessler, H. Hasegawa, S. N. Brun, B. A. Emmenegger, Z.-J. Yang, J. W. Dutton, F. Wang, and R. J. Wechsler-Reya
N-myc alters the fate of preneoplastic cells in a mouse model of medulloblastoma
Genes & Dev.,
January 15, 2009;
23(2):
157 - 170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Alvarez-Rodriguez, M. Barzi, J. Berenguer, and S. Pons
Bone Morphogenetic Protein 2 Opposes Shh-mediated Proliferation in Cerebellar Granule Cells through a TIEG-1-based Regulation of Nmyc
J. Biol. Chem.,
December 21, 2007;
282(51):
37170 - 37180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Vaillant, O. Michos, S. Orolicki, F. Brellier, S. Taieb, E. Moreno, H. Te, R. Zeller, and D. Monard
Protease nexin 1 and its receptor LRP modulate SHH signalling during cerebellar development
Development,
May 1, 2007;
134(9):
1745 - 1754.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Fogarty, B. A. Emmenegger, L. L. Grasfeder, T. G. Oliver, and R. J. Wechsler-Reya
Fibroblast growth factor blocks Sonic hedgehog signaling in neuronal precursors and tumor cells
PNAS,
February 20, 2007;
104(8):
2973 - 2978.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. DiCicco-Bloom, C. Lord, L. Zwaigenbaum, E. Courchesne, S. R. Dager, C. Schmitz, R. T. Schultz, J. Crawley, and L. J. Young
The developmental neurobiology of autism spectrum disorder.
J. Neurosci.,
June 28, 2006;
26(26):
6897 - 6906.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Choi, P. R. Borghesani, J. A. Chan, and R. A. Segal
Migration from a Mitogenic Niche Promotes Cell-Cycle Exit
J. Neurosci.,
November 9, 2005;
25(45):
10437 - 10445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Fischer, G. Omar, N. A. Walton, T. A. Verrill, and C. G. Unson
Glucagon-Expressing Neurons within the Retina Regulate the Proliferation of Neural Progenitors in the Circumferential Marginal Zone of the Avian Eye
J. Neurosci.,
November 2, 2005;
25(44):
10157 - 10166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Contestabile, T. Fila, R. Bartesaghi, and E. Ciani
Cyclic AMP-mediated Regulation of Transcription Factor Lot1 Expression in Cerebellar Granule Cells
J. Biol. Chem.,
September 30, 2005;
280(39):
33541 - 33551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. K. Meyer, C. Fischer, U. Becker, I. Gottsching, S. Boutillier, C. Baermann, G. Schmidt, N. Klugbauer, and J. Leemhuis
Pituitary Adenylyl Cyclase-activating Polypeptide 38 Reduces Astroglial Proliferation by Inhibiting the GTPase RhoA
J. Biol. Chem.,
July 1, 2005;
280(26):
25258 - 25266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Falluel-Morel, D. Vaudry, N. Aubert, L. Galas, M. Benard, M. Basille, M. Fontaine, A. Fournier, H. Vaudry, and B. J. Gonzalez
Pituitary adenylate cyclase-activating polypeptide prevents the effects of ceramides on migration, neurite outgrowth, and cytoskeleton remodeling
PNAS,
February 15, 2005;
102(7):
2637 - 2642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Canudas, V. Di Giorgi-Gerevini, L. Iacovelli, G. Nano, M. D'Onofrio, A. Arcella, F. Giangaspero, C. Busceti, L. Ricci-Vitiani, G. Battaglia, et al.
PHCCC, a Specific Enhancer of Type 4 Metabotropic Glutamate Receptors, Reduces Proliferation and Promotes Differentiation of Cerebellar Granule Cell Neuroprecursors
J. Neurosci.,
November 17, 2004;
24(46):
10343 - 10352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nicot, T. Otto, P. Brabet, and E. M. DiCicco-Bloom
Altered Social Behavior in Pituitary Adenylate Cyclase-Activating Polypeptide Type I Receptor-Deficient Mice
J. Neurosci.,
October 6, 2004;
24(40):
8786 - 8795.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|