Previous Article | Next Article 
The Journal of Neuroscience, November 1, 2002, 22(21):9331-9339
Alternative Splicing of a
4 Subunit Proline-Rich
Motif Regulates Voltage-Dependent Gating and Toxin Block of
Cav2.1 Ca2+ Channels
Thomas D.
Helton1,
Douglas J.
Kojetin2,
John
Cavanagh2, and
William A.
Horne1
Departments of 1 Molecular Biomedical Sciences and
2 Molecular and Structural Biochemistry, North Carolina
State University, Raleigh, North Carolina 27606
 |
ABSTRACT |
Ca2+ channel
subunits modify
1 subunit gating properties through direct interactions
with intracellular linker domains. In a previous report (Helton and
Horne, 2002
), we showed that alternative splicing of the
4 subunit had
1 subunit subtype-specific
effects on Ca2+ channel activation and fast
inactivation. We extend these findings in the present report to include
effects on slow inactivation and block by the peptide toxin
-conotoxin (CTx)-MVIIC. N-terminal deletion and site-directed
mutagenesis experiments revealed that the effects of alternative
splicing on toxin block and all aspects of gating could be attributed
to a proline-rich motif found within N-terminal
4b amino
acids 10-20. Interestingly, this motif is conserved within the third
postsynaptic density-95 (PSD-95)/Discs large/zona occludens-1
domain of the distantly related membrane-associated guanylate
kinase homolog, PSD-95. Sequence identity of ~30% made possible the building of
4a and
4b
three-dimensional structural models using PSD-95 as the target
sequence. The models (1) reveal that alternative splicing of the
4 N terminus results in dramatic differences in surface
charge distribution and (2) localize the proline-rich motif of
4b to an extended arm structure that flanks what would
be the equivalent of a highly modified PSD-95 carboxylate binding
loop. Northern blot analysis revealed a markedly different pattern of distribution for
4a versus
4b
in the human CNS. Whereas
4a is distributed throughout
evolutionarily older regions of the CNS,
4b is
concentrated heavily in the forebrain. These results raise interesting
questions about the functional role that alternative splicing of the
4 subunit has played in the evolution of complex neural networks.
Key words:
calcium channel;
4 subunit; PSD-95; alternative splicing; gating; N terminus;
-CTx-MVIIC
 |
INTRODUCTION |
Voltage-gated
Ca2+ channels participate in an extensive
array of cellular activities including excitation-contraction
coupling, transcription, and neurotransmitter release. Neuronal
Cav2 channels are assemblies of up to five
subunits,
1,
2/
,
, and
. The
1 subunit consists of four
homologous repeats (I-IV) of six helices (S1-S6) that arrange to form
the selectivity filter and pore. The 24 transmembrane helices are
connected by a series of alternating intracellular and extracellular
loops. These loops are targets for a host of modifying proteins,
including
subunits, G-proteins, calmodulin, and syntaxin, as well
as the peptide toxins of venomous spiders and marine snails (Catterall,
2000
). Interaction of these proteins with
1
subunits typically alters the voltage dependency and kinetics of
channel gating, which in turn modifies
Ca2+ entry into neurons.
Ultimately, gating behavior is determined by the interactions of
individual amino acid side chains with the electrostatic forces within
their microenvironments. This is especially true for the positively
charged S4 helical segments that constitute the voltage sensors in
Na+, Ca2+,
and K+ channels. Biophysical studies have
shown that depolarization disrupts S4 side-chain interactions of Shaker
K+ channels to the extent that S4 helices
rotate 180° along their axes (Cha et al., 1999
; Glauner et al.,
1999
). This motion likely triggers a cascade of side-chain disruptions
that ultimately leads to rotation and separation of the intracellular
S6 segments that form the K+ channel gate
(Bezanilla, 2000
). Such a mechanism is supported by recent studies
delineating the conformational changes associated with open and closed
states of bacterial two-membrane-spanning K+ channels (Jiang et al., 2002b
) and is
generally applicable to Na+ and
Ca2+ channel gating.
Attempts have been made to assign specific gating functions to
individual Ca2+ channel homology domains.
Early chimera studies indicated that the IS6 segment was critical for
setting the rate of fast inactivation (Zhang et al., 1994
); however,
substitution of IIS6 and IIIS6 of the Cav2.3
channel into the slow inactivating Cav1.2 channel caused a leftward shift in the voltage dependence of inactivation and
increased the rate of Cav1.2 channel inactivation
to near Cav2.3 rates (Stotz et al., 2000
).
Effects on gating have been reported for amino acid substitutions in
IS3 (Zhong et al., 2001
), the I-II linker (Berrou et al., 2001
), IIS6
(Stotz and Zamponi, 2001
), extracellular linkers IIIS3-S4 (Lin et al.,
1997
), and IVS3-S4 (Hans et al., 1999
), and IVS6 (Berjukow et al.,
2001
). Additive effects on Cav1.2 channel
inactivation were reported recently for individual IS6, IIS6, IIIS6,
and IVS6 substitutions (Shi and Soldatov, 2002
). Together, these data
support a structural model of
1 subunits in
which individual transmembrane segments are interdependently entwined
(Horn, 2000
).
Our results indicate that this model also applies to
subunit
interactions with
1 subunit intracellular
linkers. We have shown previously that
4
subunit alternative splicing had
1
subtype-specific effects on voltage-dependent activation and
inactivation (Helton and Horne, 2002
). In this report, we extend these
findings to include effects on slow inactivation and block by
-conotoxin (CTx)-MVIIC; we also identify a
proline-rich motif in
4b that is responsible
for the observed differences in effects.
 |
MATERIALS AND METHODS |
Deletion mutants. Truncation of the
4b N terminus in 10 aa increments was
performed using PCR and custom oligonucleotide primers [Integrated DNA
Technologies (IDT), Coralville, IA]. All nucleotide and amino acid
positions for primers and restriction enzymes correspond to the
4b sequence (GenBank accession number U95020).
Each forward primer sequence contained an idealized Kozak (1991)
sequence and start codon corresponding to the beginning of each of the
deleted 10 amino acids as follows:
4b
1-10F, 5'-GCCACCATGACCGCGGACGGGCCG;
4b
1-20F, 5'-GCCACCATGCAGGTGGCCCGAGGC. Both reactions included a common
4 reverse
primer,
4b 732R
(5'-TGACGGCCCCACTAACACC). Full-length
4b was used as the template for these
reactions. The
4b
10-20 deletion mutant
was generated with the primer
4b
10-20F (5'-GCCACCATGTCCTCCTCCTCCTACGCCAAGAACTCG) paired
with
4b 732R using the
4b
1-20 mutant as the template. Annealing temperature for PCR was 56°C with Gene Choice Taq DNA
polymerase (PGC Scientific, Durham, NC). Correctly sized PCR fragments
were cloned into the pT-Advantage vector (Clontech, Palo Alto, CA). PCR-based cycle sequencing (FS chemistry; Applied Biosystems, Foster
City, CA) was used with an ABI Prism 310 Genetic Analyzer. The data
were analyzed using ABI Prism DNA sequencing software (version 2.12;
PerkinElmer Biosystems), and sequence alignments and restriction maps
were generated using Lasergene Software (DNA Star, Madison, WI).
Correct clones were digested with BamHI (Roche Molecular
Biochemicals, Indianapolis, IN), and the corresponding ~530 bp
fragments were ligated into BamHI (nucleotide position 550)
-digested
4b in pBluescript II
S/K+ (Stratagene, La Jolla, CA). Each
4b deletion mutant was sequenced to confirm
correct reading frame and proper N-terminal orientation.
Site-directed mutagenesis. For all
4b site-directed mutants, full-length
4b cDNA (U95020) was used as the template
unless otherwise indicated. All site-directed mutagenesis reactions
were performed using a QuikChange site-directed mutagenesis kit
(Stratagene) and custom forward and reverse compliment oligonucleotide
primers (IDT):
4bG10A,D13A,
5'-ACGCCAAGAACGCGACCGCGGCCGGGCCGCAC;
4bP15A,P18A, 5'-GCGGACGGGGCGCACTCCGCCACCTCGCAGGTG;
4bG10A,D13A,P15A,P18A, 5'-ACGCCAAGAACGCGACCGCGGCCGGGGCGCAC
(
4bP15A,P18A used as template);
4bG10A,P15A,
5'-TACGCCAAGAACGCGACCGCGGACGGGGCGCACTCCCCCACCTCGCAGGTG;
4bH16A, 5'-ACCGCGGACGGGCCGGCCTCCCCCACCTC;
4bG10A,P18A,
5'-TACGCCAAGAACGCGACCGCGGACGGGCCGCACTCCGCCACCTCGCAGGTG;
4bD13A,P15A, 5'-TACGCCAAGAACGGGACCGCGGCCGGGGCGCACTCCCCCACCTCGCAGGTG;
4bD13A,P18A, 5'-TACGCCAAGAACGGGACCGCGGCCGGGCCGCACTCCGCCACCTCGCAGGTG;
4bH16A, 5'-ACCGCGGACGGGCCGGCCTCCCCCACCCTCG; and
4bT11A,S17A,T19A,S20A, 5'-CAAGAACGGGGCCGCGGACGGGCCGCACGCCCCCGCCGCGCAGGTGGCC. Each of the
mutant clones was sequenced to confirm reaction fidelity.
Electrophysiology. cRNAs were synthesized in
vitro using an mMessage mMachine RNA transcription kit from Ambion
(Austin, TX) (T3 or T7 depending on clone orientation in
pBluescript II S/K+). Standard
Xenopus laevis oocyte expression methods were used to
characterize
deletion and site-directed mutants. Briefly, full-length
1,
2/
-1, and
4 cRNAs were
injected in equimolar ratios (5.6 ng of
1A, 2.4 ng of
2/
-1, and 1.6 ng of
4 in 46 nl) into defolliculated oocytes (stage
V-VI). The BI-2 (
1A) and
2/
-1 clones used in this study were
provided by T. Tanabe (Tokyo Medical and Dental University, Tokyo,
Japan). Calcium channel currents were recorded 2-4 d after oocyte
injection by standard two-electrode voltage clamp using a Warner
amplifier (OC-725B) at 20-22°C, and data were collected using
pClamp6 software (Axon Instruments, Foster City, CA). Microelectrodes
were filled with 3 M KCl, and the resistances of
the current and voltage electrodes were 0.3-1.5 M
. Data were
filtered at 2 kHz and sampled at 10 kHz. Currents were recorded in a
chloride-free bath containing (in mM): 5 Ba(OH)2, 5 HEPES, 85 TEA-OH, and 2 KOH, pH
adjusted to 7.4 with methanesulfonic acid. In experiments with the
peptide toxin
-CTx-MVIIC (Peptide Institute Inc. Osaka, Japan), the
5 mM Ba2+ solution
was supplemented with 0.1 mg/ml cytochrome c to saturate nonspecific peptide binding sites. Cytochrome c at 0.1 mg/ml
had no noticeable effect on recorded Ba2+
currents. Peptides were reconstituted according to the manufacturer's instructions (100 µM stock solutions in
sterile, deionized water). Fresh dilutions of the peptide were made
immediately before use. Currents typically ranged between 0.8 and 2.5 µA, and leak currents were between 20 and 100 nA. Data were analyzed
using pClamp6 software (Axon Instruments) and Excel 7.0 (Microsoft
Corp., Redmond, WA). The leak and capacitive currents were subtracted
on line using a standard P/4 protocol. Curve fitting was performed with
SigmaPlot version 5.0 (SSPS Inc., Chicago, IL).
Slow inactivation. Oocytes were held at
80 mV for ~2 min
before a 300 msec reference pulse (IR)
to 0 mV (
4b) or +10 mV
(
4a). After
IR, the membrane potential was stepped
immediately to a conditioning pulse potential ranging from
100 mV to
20 mV (20 mV increments) and held for 5 min. During the conditioning
pulse, a 300 msec test pulse (IT) to 0 mV (
4b) or +10 mV
(
4a) was applied every 15 sec. Data were
normalized as the ratio of the maximum current at time T
(IT) divided by the maximum reference
current (IR). Data were fit to the
double-exponential equation
IT/IR = A1e
x/
1 + A2e
x/
2,
where IT equals current at time T,
IR equals maximum reference current, x
equals time in seconds, and A1 and
A2 are components for the time
constants
1 and
2,
respectively. The SEM is shown for each data point unless the values
are smaller than the symbol.
Recovery from slow inactivation. Currents were stabilized at
80 mV or
100 mV for ~2 min before a 300 msec reference pulse (IR) to 0 mV
(
4b) or +10 mV (
4a).
After a 100 msec step to either
80 mV or
100 mV, the oocytes were
held at a conditioning pulse potential of
30 mV for 5 min.
Immediately after the conditioning pulse, a 300 msec test pulse was
applied (I1), and then the holding potential was stepped back to either
80 mV or
100 mV and 300 msec
test pulses (I2-12) were applied at
15 sec intervals starting at time 0 for a total of 3 min. Data were
normalized as the ratio of the maximum current at time T
(IT) divided by the maximum reference
current (IR). Data were fit to the
single exponential equation
IT/IR = I
+ Ae
x/
, where
IT equals current at time point T,
IR equals maximum reference current,
I
equals current remaining at end of
protocol, x equals time in seconds, and A is the component
for the time constant
.
Voltage dependence of activation and inactivation. Voltage
dependency of activation data was generated from I-V
curves. Maximal currents were obtained from 300 msec depolarizations
from a holding potential of
80 mV to various test potentials (
40 to
+10 mV in 5 mV increments). Each individual recording was then
normalized, inverted, and fit to the Boltzmann equation
%IBa = 1/[1 + exp(
(Vtest
V1/2)/k)], where
Vtest equals I-V test
potential, Vpre equals prepulse
potential, V1/2 equals midpoint of
activation or inactivation, and k equals slope factor. The
fit curves, V1/2, and k
values were then averaged and plotted as a function of membrane voltage.
Voltage dependency of inactivation data was obtained from peak currents
elicited by a 300 msec maximal current test depolarization after a 20 sec conditioning prepulse to voltages ranging from
80 to +20 mV. Each
individual recording was then normalized and fit to the Boltzmann
equation %IBa = 1/[1 + exp([Vpre
V1/2]/k)], where
Vtest equals I-V test
potential, Vpre equals prepulse
potential, V1/2 equals midpoint of
activation or inactivation, and k equals slope factor. The
fit curves, V1/2, and k
values were then averaged and plotted as a function of prepulse potential.
Pharmacology. Oocytes were held at a potential of
80 mV
with maximal currents elicited by 150 msec test pulses to 0 mV
(
4b) or +10 mV (
4a)
every 15 sec for a total of 10 min. During recordings, oocytes were
perfused at a constant rate of ~0.5 ml/min. Average current sizes for
4a and
4b complexes
were 1.9 ± 0.2 µA (4-5 d of incubation) and 2.3 ± 0.3 µA (2-3 d of incubation), respectively. The data were fit to the
single-exponential equation
IT/IR = I
+ Ae
x/
, where
IT equals maximum current at time
point T, IR equals maximum current at
time point 0, I
equals residual current at
end of protocol, x equals time in seconds, and A is the
component for the time constant,
. The averaged rate constants
(1/
) for the four
-CTx-MVIIC concentrations (0.2, 0.6, 2, and 6 µM) were plotted as a log function of their
concentration and were fit well by the equation
(
)
1 = kon[Tx] + koff.
Northern blot analysis. A commercially available human
neuronal tissue Northern blot [Multiple Tissue Northern (MTN)
Blot brain II; Clontech] was probed with a nonspecific
4 subunit probe (
4
N; nucleotides 215-1628 plus ~300 bp
of 3' untranslated). A 32P-labeled
4 subunit probe was made with a nick
translation kit (Promega, Madison, WI) using the
4
N mutant as the template. The
4
N mutant is missing the first coding 147 bp corresponding to the 49 aa N terminus of
4
[clone from Helton and Horne (2002)
]. The MTN blot was hybridized
overnight at 42°C in hybridization buffer [5× SSC, 5% w/v blocking
reagent (Roche), 0.1% N-lauroylsarcosine, 0.02% w/v SDS,
50% w/v formamide] plus 100 µg/ml herring sperm DNA (Promega). The
probe concentration was 1 million counts/ml. The blot was washed with
successive stringency washes (four washes, 15 min each at 37°C)
ranging from 2× SSC/0.1% SDS to 0.1× SSC/0.1% SDS. The blot was
then exposed to radiographic film for 12 hr at
80°C. One microgram
of cRNA for both
4a and
4b was run out on a 1% denaturing
formaldehyde gel along with a poly(A)-tailed cRNA mass ladder (RNA
Molecular Weight Marker 1; Roche). The
4a cRNA
is longer than the
4b cRNA because of the
additional ~400 nt of 5' untranslated sequence.
Molecular modeling. The sequences for rat
postsynaptic density-95 (PSD-95) (DLG4_rat) and human
4 (CACNB4) were obtained (accession
numbers P31016 and U95020) from the Swiss-prot database. Amino
acids 10-96 of
4b were aligned to residues
303-390 of PSD-95 based on secondary structure prediction (nnPredict) and visual inspection. For
4a, amino acids
50-96 of
4b were aligned to residues 345-390
of PSD-95. Using default parameters, the program MODELLER 6 (Sali and Blundell, 1993
) was used to produce 50 models each of
4b and
4a structure
based on the solved structure of the third PSD-95/Discs large/zona
occludens-1 (PDZ) domain of PSD-95 (1BEF). Five models each were chosen
for additional analysis based on the molecular probability density
function (PDF) output from MODELLER and stereochemical analysis
obtained through Ramachandran output from PROCHECK-NMR
(Laskowski et al., 1993
). The interactions between different atom types
within these models and C
root mean square deviation (RMSD)
comparisons between the models and 1BEF were characterized with
ERRAT (Colovos and Yeates, 1993
). The
4a and
4b models
chosen for comparison had the fewest disallowed residues
(Ramachandran), lowest molecular PDF and RMSD values, and highest
percentage of residues in acceptable conformations based on ERRAT and
PROCHECK-NMR analysis. Models were visualized with the program
MOLMOL (Koradi et al., 1996
).
 |
RESULTS |
Alternative splicing of the
4 subunit affects slow
inactivation of Cav2.1 Ca2+ channels
In a previous study (Helton and Horne, 2002
), we showed that
Cav2.1 complexes containing the longer form of an
alternatively spliced
4 subunit N terminus,
4b (49 aa), inactivated at more negative
potentials in response to 20 sec conditioning prepulses than complexes
containing a shorter form,
4a (15 aa). To
determine whether this response extended to slower types of
inactivation, we examined in the present study the effects of
4a and
4b on Cav2.1 cumulative inactivation elicited by 5 min
conditioning prepulses combined with stimulation at 0.25 Hz. Oocytes
were stabilized at
80 mV before a 300 msec reference pulse
(IR) to potentials that were
predetermined to give peak inward currents
(
4b, 0 mV;
4a, +10
mV). The membrane potential was then stepped to and held at the
conditioning prepulse potential (ranging from
100 to
20 mV) for 5 min. A 300 msec test pulse (IT) was
elicited from the conditioning prepulse potential every 15 sec
(I5 equals test pulse at 5 min). The
kinetics of entry to slow inactivation for Cav2.1 complexes containing either
4a or
4b at
40 mV is shown in Figure 1A. For comparison
purposes, we fit the data points for both
4a and
4b to two exponentials (smooth curves in
the figure). The time constants for the fast component of entry
(
1) for
4a and
4b were 28.6 ± 2.6 and 18.9 ± 1.2 sec, respectively, and the time constants for the slow component of
entry (
2) were 769 ± 23.6 and 384 ± 14.8 sec, respectively. Overall, the
IT/IR
ratio for Cav2.1 complexes containing
4b decreased to 0.5 in ~70 sec, whereas
those containing
4a required ~380 sec (data
not shown). This indicated that
4b caused a
more than fivefold acceleration of the kinetics of slow inactivation.
Representative current traces for reference and 5 min test pulses from
a conditioning potential of
40 mV for Cav2.1
complexes containing
4a (top) and
4b (bottom) are shown in Figure
1B. As seen in the figure and as described in our
previous study, Cav2.1 complexes containing
4a underwent open-state fast inactivation
faster than did complexes containing
4b. After
5 min at
40 mV, the rate of fast inactivation was unaltered for
complexes containing
4a, and slowed only
somewhat for complexes containing
4b. The
absence of any appreciable tail-current indicated that deactivation was
not affected by prolonged depolarization. The
I5/IR
ratio is plotted against the range of conditioning potentials (
100 to
20 mV) in Figure 1C. The figure illustrates that the voltage dependence of Cav2.1 slow inactivation is
shifted to the left for complexes containing
4b relative to those containing
4a. Half-maximal inactivation occurred at
approximately
50 mV for complexes containing
4b and
35 mV for
4a. These values are ~10 mV
(
4b) and 5 mV (
4a)
more negative than were determined for inactivation in response to 20 sec conditioning prepulses (Helton and Horne, 2002
). Figure
1D shows that recovery from 5 min of slow
inactivation at
30 mV is nearly complete when the membrane potential
is stepped back to
80 mV, and that there is no difference in the time
course of recovery for Cav2.1 complexes containing either
4a or
4b. Recovery was somewhat faster and more
complete when the membrane potential was stepped back to
100 mV. The
recovery data at both potentials fit well to single exponentials. The
time constants for recovery for
4a and
4b at
80 mV were 28.6 ± 2.0 and
27.8 ± 1.6 sec, respectively, and at
100 mV, 18.9 ± 0.5 and 17.2 ± 0.4 sec, respectively.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 1.
Effects of 4a and 4b
on slow inactivation and recovery from slow inactivation of
Cav2.1 Ca2+ channels. Studies were
performed with Xenopus oocytes expressing
1A, 2/ -1, and either
4a or 4b. Reference
(IR) and test current
(IT) traces were generated by 300 msec step depolarizations from various holding potentials to either 0 mV ( 4b) or +10 mV ( 4a).
Maximum values from 300 msec IR and
IT current traces were used to calculate
IT/IR
where indicated. Barium (5 mM) was used as the charge
carrier. A, Influence of 4a and
4b on the development of slow inactivation at a
conditioning potential (CP) of 40 mV. After a
reference pulse (IR) measured from a
holding potential of 80 mV, oocytes were held at 40 mV for 5 min.
During this time, 300 msec test pulses
(IT) were applied every 15 sec. Each
point represents the mean value of
IT/IR from
11 ( 4a) or 10 ( 4b)
different recordings. The SEM is shown for each point
unless the values were smaller than the symbol. The
solid lines represent double-exponential fits to the
data. B, Representative reference
(IR) and 5 min
(I5) current traces from
Cav2.1 complexes containing either 4a
(top) or 4b (bottom)
generated as described in A. C, Voltage
dependence of slow inactivation. The ratio of
I5 to IR,
generated as in A, plotted as a function of conditioning
potential for Cav2.1 complexes containing either
4a or 4b. Data points
represent the means of at least six determinations at a given membrane
potential. Lines serve only to connect the data
points. D, Influence of 4a and
4b on the time course of recovery from slow
inactivation. After a 300 msec reference pulse
(IR) measured from a holding
potential of either 80 or 100 mV, oocytes were held at 30 mV for
5 min. The membrane potential was then returned to either 80 or 100
mV, and sequential test pulses (IT)
were applied at 15 sec intervals for a total of 3 min. Each
point represents the mean of at least seven different
recordings. Solid lines represent the single-exponential
fits of the data.
|
|
Alternative splicing of the
4 subunit affects
-CTx-MVIIC block of Cav2.1 Ca2+
channels
The results to this point indicate that changes in the structure
of the
4 subunit N terminus impact
1A subunit structures that are important for
many aspects of gating, including activation, open-state inactivation,
and fast and slow closed-state inactivation. Given that recent evidence
indicates that cytosolic determinants of two-membrane-spanning
K+ channel gating are coupled to changes
in outer vestibule structure (Perozo et al., 1999
; Jiang et al.,
2002a
,b
), we next sought to determine whether alternative splicing of
the
4 subunit would affect the block of
Cav2.1 channels by a marine snail peptide conotoxin,
-CTx-MVIIC. Conotoxin interactions with voltage-gated Ca2+ channels are entirely extracellular
and occur through binding sites located near H5 (P) helices in several
of the six helix transmembrane-spanning motifs (Ellinor et al., 1994
).
Figure 2A shows the
effects of 2 µM
-CTx-MVIIC on
Cav2.1 Ca2+ channel
complexes expressed in Xenopus oocytes in the presence of
either
4a or
4b. The
oocytes were held at
80 mV for 10 min and stimulated every 15 sec.
Under these conditions,
-CTx-MVIIC associated with
Cav2.1 complexes containing
4b at a faster rate (
= 50 ± 0.75 sec) than complexes containing
4a
(
= 200 ± 16 sec). The loss of
Ca2+ current resulting from slow
inactivation over 10 min at
80 mV (<15%) was subtracted from the
data plotted in the figure. Figure 2B demonstrates
that as expected for a first-order reaction, the rate constants
(
1) for toxin block were linearly
dependent on toxin concentration as described by the equation
(
)
1 = kon [Tx] + koff. Slopes of linear fits to the
data for Cav2.1 complexes containing either
4a and
4b were
3.7 × 10
6
M
1 · sec
1 and 1.1 × 10
5
M
1 · sec
1, respectively. This indicated that
the on-rate (kon) for toxin block was
approximately threefold faster for Cav2.1
complexes containing
4b than for those
containing
4a.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 2.
Effects of 4a and 4b
on the blockade of Cav2.1 channels by -CTx-MVIIC.
Studies were performed with Xenopus oocytes expressing
1A, 2/ -1, and either
4a or 4b. A, Onset and
degree of block by a 10 min exposure to 2 µM
-CTx-MVIIC for Cav2.1 subunit combinations at a holding
potential (HP) of 80 mV. Each point
represents the mean of seven ( 4a) or eight
( 4b) different recordings. The SEM is shown for
each data point unless smaller than the
symbol. Onset of block for both subunit combinations was
fit (line) to a single-exponential time course plus a
constant. B, The rate constants for the time course of
the onset of toxin block were determined from steady-state degree of
block from single exponential fits at four different toxin
concentrations (0.2, 0.6, 2, and 6 µM) for
Cav2.1 complexes containing either 4a or
4b. The averaged rate constants were plotted as a
function of toxin concentration (minimum of n = 7, ±SEM). The line represents a linear fit to the
data.
|
|
The molecular determinants of alternatively spliced
4 subunit differential effects on gating and
pharmacology are located within amino acids 10-20 of
4b
Having characterized many of the functional consequences of
alternative splicing of the
4 A domain, we
focused next on identifying the key structural determinants underlying
the observed differences in effects. It was of particular interest to
determine whether or not the effects of alternative splicing on gating
and pharmacology could be assigned to separate structural entities. To
accomplish this, we first created a series of
4b deletion mutants in which the N terminus
was shortened by multiples of 10 aa (
4b
1-10 through
4b
1-49) and
characterized their effects on gating and pharmacology of
Cav2.1 complexes. Figure
3A-D shows that, relative to
full-length
4b, deletion of the first 10 aa
(
4b
1-10) had no effect on the voltage
dependence of activation (Fig. 3A), isochronal (20 sec
prepulse) inactivation (Fig. 3B), onset into slow
inactivation (Fig. 3C), or susceptibility to block by 2 µM
-CTx-MVIIC (Fig. 3D). However,
when amino acids 1-20 were removed (
4b
1-20), both the voltage dependence of activation (Fig.
3A) and inactivation (Fig. 3B) of
Cav2.1 complexes shifted to more depolarized
potentials. As shown in the figure, the acquired gating properties were
essentially identical those for Cav2.1 complexes
containing
4a. Cav2.1
complexes containing
4b
1-20 also had a
slower onset into slow inactivation (Fig. 3C) and were less
susceptible to block by 2 µM
-CTx-MVIIC (Fig. 3D). The effects of constructs
4b
1-30,
4b
1-40, and
4b
1-49 were identical to
those of
4b
1-20 (data not shown). As a
first attempt at determining whether the effects of
4b
1-20 were simply the result of a
decreased size of the
4b N terminus, we
reintroduced amino acids 1-10 to the N terminus of
4b
1-20 to create the construct
4b
10-20. As shown in Figure
3A,B, this did not restore the
V1/2 of either activation or
inactivation to the hyperpolarized potentials characteristic of
Cav2.1 complexes containing
4b. Together, these results indicated that the
molecular determinants responsible for the observed differences between Cav2.1 complexes containing
4a versus
4b were
located in amino acids 10-20 of
4b. Moreover,
it was apparent that their influence extended to changes in both gating
and pharmacology.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3.
Localization of differential effects on
Cav2.1 gating and pharmacology to 4b
N-terminal amino acids 10-20. The first 10 ( 4b
1-10), first 20 ( 4b 1-20), or second 10 ( 4b 10-20) aa of the N terminus of the
4b subunit were removed using PCR. The deletion mutants
as well as 4a or 4b were expressed with
1A and 2 -1 in Xenopus
oocytes. A, Effects of the N-terminal deletion mutants
on the voltage dependency of activation of Cav2.1 channels.
Plots were derived from averaged I-V data up to +10 mV
for each 4 subunit combination. Data points
represent the means of the normalized data at a given membrane
potential for a minimum of nine different recordings. Smooth
lines represent single Boltzmann fits to the averaged data.
B, Normalized, averaged isochronal inactivation curves
for Cav2.1 complexes containing the various
4 subunits. Points represent the means of
the normalized data at a given membrane potential for a minimum of nine
different recordings. Smooth lines represent single
Boltzmann fits to the averaged data. C, Effects of
4 N-terminal deletion mutants on the development of slow
inactivation at a conditioning potential (CP) of 40
mV. Reference (IR) and test
(IT) currents were generated as in
Figure 1A. Each point represents
the mean value of
IT/IR from
13 ( 4b 1-10) or nine ( 4b 1-20)
different recordings. The solid lines represent
double-exponential fits to the data. D, Onset and degree
of block by a 10 min exposure to 2 µM -CTx-MVIIC for
Cav2.1 complexes containing 4b 1-10 or
4b 1-20. Data were generated as in Figure
2A. Each point represents the
average of a minimum of seven recordings. The solid
lines represent single-exponential fits to the data.
|
|
The
4 A domain is a distant homolog of the third PDZ
domain of PSD-95
With the results of the deletion experiments highlighting a
specific location for the molecular determinants of
4b gating and pharmacology effects, and with
the observation that the
1b A domain resembles
PDZ domains (Hanlon et al., 1999
), we began a systematic comparison of
the
4b sequence with similar regions of a
number of PDZ domains. Unexpectedly, we found that the entire
4b A domain was weakly homologous to the third
PDZ domain of PSD-95 (Fig.
4A). Of the 87 aa that
have been shown by x-ray crystallography to form the modular PDZ
structure of PSD-95 (Doyle et al., 1996
), 27 of these (~31%) are
conserved in the
4b sequence. Most
importantly, these identities are conserved within key secondary
structural elements, such as
-strand C and
-helix 2 of PSD-95.
Also of note is the conservation of an RG(S/T)T motif in what would be the equivalent of the carboxylate binding loop (CBL) between
-strands A and B of PSD-95 and the loss of the GLGF motif
that is extremely common among PDZ domain subtypes (Bezprozvanny and
Maximov, 2001
; Harris and Lim, 2001
). Four of
4b amino acids 10-20 (G10, D13, P15, and P18)
were found in PSD-95. We used these as a starting point for further
defining key
4b residues involved in setting Cav2.1 gating parameters.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4.
The 4 subunit is a
distant homolog of PSD-95. Identification of a conserved GXXDXPXXP
motif critical to Cav2.1 gating. A, Amino
acid alignment of the A domains of the human spinal cord
4a (amino acids 1-63) and 4b (amino
acids 1-97) subunits with the third PDZ domain (amino acids 294-391)
of PSD-95. Vertical bars denote identical amino acids
between 4b and PSD-95. Important amino acids involved in
modulating the leftward shift in the voltage dependence of activation
and inactivation of 4b (GXXDXPXXP) are highlighted.
Arrows and hatched bars represent
predicted -helices and -strands of the third PDZ domain of
PSD-95, respectively. B, Differences in the
V1/2 values of activation and inactivation
of 4a, 4b, and
4b N-terminal amino acid mutants. Solid
bars represent average V1/2 values
of a minimum of nine different recordings for each 4
subunit variant. Positive or negative shifts in the
V1/2 values (in millivolts) of activation
and inactivation of 4a and 4b mutants are
relative to the V1/2 values of activation
and inactivation of 4b. Currents were generated as
described in Figure 3, A and B. The SEM
for each bar is shown. Asterisks denote statistical
significance (p < 0.05) by a Student's
two-sample equal variance t test.
|
|
Figure 4B lists a series of site-directed mutants
(left), along with their effects on the voltage dependence
(V1/2) of activation (middle) and inactivation (right) of
Cav2.1 complexes. The
V1/2 values for complexes containing
4a and
4b are
included for comparison. Interestingly, the first site-directed
4b mutant tested, G10A, D13A, P15A, P18A, in
which all four of the amino acids in common with PSD-95 were altered,
displayed activation and inactivation properties similar to that of
4a. To determine whether this was a specific
effect, we altered four different amino acids in the
4b 10-20 sequence to create the mutant, T11A,
S17A, T19A, S20A. As shown in Figure 4B,
Cav2.1 gating properties changed little in
response to these mutations. Cav2.1 complexes
containing the G10A, D13A, P15A, P18A mutant also had
4a-like slow inactivation and pharmacological
properties (data not shown). This indicates that the conserved amino
acids are playing a defining role in the gating motif. To delineate the
structure in more detail, we subsequently characterized six of the
possible G10, D13, P15, P18 amino acid pairs for their effects on
gating. Surprisingly, none of the pairs were absolutely essential for
maintaining wild-type
4b gating behavior,
although small but statistically significant hyperpolarizing effects on
activation were noted for five of the six pairs. To complete the
alanine substitution study, we created the mutant H16A, which had a
small but statistically significant effect on inactivation but not activation.
One interpretation of these results is that
4b
amino acids 10-20 form a ligand motif that interacts with a binding
pocket located somewhere either on the
1A
subunit or on the
4 subunit itself. The
affinity of the ligand motif for its receptor site could be defined,
for example, by the sum of the interactions of amino acids G10, D13,
P15, and P18 with their individual targets. Any given pair may be
capable of maintaining a binding interaction under the conditions of
our experiments. As a first step toward addressing this possibility, we
created three-dimensional structural models of the
4a and
4b A domains
(Fig. 5A,B) using the
real-space optimization method used in the computer program MODELLER
(Sali and Blundell, 1993
). The models were initiated using the distance and dihedral angle restraints derived from alignments with portions of
the sequence of the third PDZ domain of PSD-95. For
4b, amino acids 10-96 were aligned with amino
acids 303-390 of PSD-95. There is 31% sequence identity over this
region, which is considered minimally acceptable for this type of
comparative modeling (Martí-Renom et al., 2000
). For
4a, amino acids 10-49 of
4b were deleted from the alignment. Thus, the
models do not include the first 15 aa of
4a
and the first 9 aa of
4b. Figure 5A
(left) shows that
4a models as a
compact structure containing three
-sheets and 2
-helices.
Stereochemical quality assessment of the model using PROCHECK-NMR
(Laskowski et al., 1993
) identified 41 residues (87.7%) in most
favored regions, 5 (10.6%) in additional and generously allowed
regions, and 1 (2.1%) in a disallowed region. Calculation of the
electrostatic surface potential using MOLMOL (Koradi et al., 1996
)
reveals that the face of the molecule as oriented in Figure
5A, left, contains a pocket of negative charge
(red residues) between the two
-helices (Fig. 5A,
right). Figure 5B, right and left, illustrates that the overall effect of alternative
splicing to form
4b is to bury the charged
pocket beneath three additional
-sheets. Interestingly, the molecule
acquires as the result of splicing a positively charged binding pocket
(blue residues) in what would be the equivalent of the CBL in PSD-95
(Fig. 4A). The stereochemical quality of the
4b model as shown is not quite as good as that
for
4a. PROCHECK-NMR identified 64 residues
(79%) in most favored regions, 11 residues (13.6%) in additional
allowed regions, and 3 residues (3.7%) each in generously allowed and disallowed regions. Two of the three disallowed residues (R30 and K34)
flank what would be the equivalent PSD-95
-sheet B. Together with
the loss of the highly conserved PDZ GLGF sequence, these results are
consistent with the notion that through evolution this region of the
4b structure has evolved away from the
capacity to bind C-terminal peptide motifs. Of most importance to our
present results, however, is the observation that
4b amino acids 10-20 model as an extended arm
(pointing to the left in Fig. 5B, right, left) that may serve as a ligand motif. Interestingly, the
orientation of the arm appears to be dictated by the isomerization
state of proline18 (data not shown).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 5.
Real-space optimization structural models of the A
domains of 4a (A) and
4b (B) based on sequence
identities with the third PDZ domain of PSD-95. Ribbon
(left) and electrostatic surface potential
(right) diagrams were created using MOLMOL (Koradi et
al., 1996 ). For ribbon diagrams, arrows indicate
-strands, and helices indicate -helices. For
surface potential diagrams, red, white,
and blue regions indicate negatively charged,
hydrophobic, and positively charged amino acids, respectively.
|
|
Differential distribution of alternatively spliced
4
subunit mRNA
We noted in our previous study (Helton and Horne, 2002
) that,
based on extensive cDNA library screening,
4a
was the predominant alternatively spliced variant of the
4 subunit expressed in human spinal cord. To
confirm this observation, we performed a comparative Northern blot
analysis using a commercially available multiple tissue Northern blot
(Human Brain II; Clontech) and a
4 cDNA probe
containing sequence common to both
4a and
4b. The mRNAs for
4a
and
4b can be readily distinguished by their
distinct migration pattern in agarose-formaldehyde gels (Fig.
6A). The results of the
Northern blot analysis, shown in Figure 6B, were striking, revealing that not only was
4a the
predominant form of
4 subunit in the spinal
cord, but also in other "reptilian" portions of the human CNS such
as the medulla and putamen. Moreover,
4a was
the predominant form of
4 subunit expressed in
evolutionarily older regions of the cerebrum, the temporal lobe, and
occipital pole. In marked contrast,
4b was
highly expressed in the most recent and most highly integrative region
of the cerebrum, the frontal lobe. The two forms of the
4 subunit were equally expressed in the
cerebellum.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6.
Differential distribution of 4a and
4b mRNA in the human CNS. A,
Electrophoresis of full-length 4a (left)
and 4b (right) cRNAs (includes 5' and 3'
untranslated) in a 1% agarose formaldehyde denaturing gel. RNA markers
(in kilobases) are indicated on the left.
B, Northern blot analysis performed with human multiple
tissue blot (Human Brain II; Clontech) and a 32P-labeled
4 subunit probe (coding nucleotides 215-1628 plus
~300 bp 3' untranslated sequence). Molecular masses on the
right correspond to labeled blot markers.
C, A human 4 subunit genome map depicting
the lengths of intron sequences (b, bases) between alternatively
spliced 4a and 4b N-terminal exons and
the beginning of exon 2. Solid lines represent exons,
and dashed lines represent introns.
Numbers in parentheses below solid
lines indicate position on chromosome 2. Boxes
indicate protein sequence ( 4a in
parentheses). The first and last two amino acids of each
sequence are indicated above each box.
|
|
A basic local alignment search tool search of the human genome
(Altschul et al., 1990
) with
4 sequences
revealed that the exons coding for alternatively spliced forms of the
4 subunit A domain are distributed widely on
human chromosome 2. Figure 6C shows that, depending on the
splice variant, the coding sequence for the
4
PDZ domain is contained within three (
4a) or
four (
4b) exons spread out over ~218,000
bases. The coding sequence for the GXXDXPXXP motif is included in the
5'-most exon of a pair of short exons that code for
4b amino acids 1-49. Assembly of the
4b mRNA requires that three RNA segments (536 bases, 214,959 bases, and 2329 bases) be spliced out. The short exon
coding for the first 15 aa of
4a lies between
the
4b N-terminal exons and the exon coding
amino acids 50-89 and 16-55 of
4b and
4a, respectively. By comparison, the third PDZ
domain of PSD-95 is encoded by two exons separated by a 200 bp intron
(data not shown).
 |
DISCUSSION |
We have identified an alternatively spliced proline-rich motif in
the Ca2+ channel
4 subunit that has considerable influence over
gating of neuronal Cav2.1
Ca2+ channels. Given that the motif also
affects extracellular toxin binding, it is likely that the interaction
of this motif with its binding site has wide-reaching impact on resting
and open-state Ca2+ channel conformations.
This notion is supported by recent images of the conformational changes
that occur with gating of bacterial two-membrane-spanning
K+ channels (Liu et al., 2001
; Jiang et
al., 2002a
,b
). Like eukaryotic six-membrane-spanning
K+ channels, KcsA and MthK channels are
tetramers that pack with fourfold symmetry around a central pore (Doyle
et al., 1998
; Jiang et al., 2002a
). The principal structural elements
of KcsA and MthK from N to C terminus include an outer transmembrane
helix (M1), a pore helix (P), and an inner transmembrane helix (M2). These correspond to S5, H5, and S6 segments of voltage-gated
Ca2+ channels, respectively. In the closed
conformation of the KcsA structure, the four M2 helices are straight
and arranged such that they form the walls of an inverted teepee that
narrows from a 12 Å diameter at its center to a 4 Å pore at its tip
(Doyle et al., 1998
). After opening, the KcsA M2 helices tilt away from the permeation pathway and rotate about their helical axis (Liu et al.,
2001
). In MthK, bending and splaying of the inner helices after opening
expands the diameter of the pore threefold (Jiang et al., 2002a
,b
). The
nearly 30° bend occurs at a "gating hinge" corresponding to a
glycine residue just below the selectivity filter. Applying a
radial-outward force on the intracellular aspects of the inner helices
places a torque on the gating hinge such that a conformational change
is transmitted the full length of the M2 helix. This results in a
widening of the outer vestibule [Jiang et al. (2002b)
, see
supplementary information (movie)]. It is has been hypothesized that
similar mechanical forces are at work in the gating of voltage-gated
Ca2+ channels (Jiang et al., 2002b
).
Considered in the context of this mechanical framework, our results
suggest that an interaction of the
4b ligand
motif with an inner aspect of the Cav2.1 complex
either directly or indirectly fine-tunes the torque experienced by
1A S6 segments. In so doing, the interaction
alters the conformation of the voltage sensor or gate (or both) as well
as the outer vestibule. This would explain why alternative splicing of
the
4 subunit would affect both gating and
toxin sensitivity. Given the potential for the ligand motif interaction
to occur over a wide range (Helton and Horne, 2002
), it is not possible
from our results to pinpoint which S6 helices might be most affected.
And although our
-CTx-MVIIC binding results might be providing some
direction, a previous study has shown that
-CTx-GVIA binding
to
1B is affected by alterations in any of the
four P loops that make up the outer vestibule (Ellinor et al., 1994
). A
case can be made for an indirect effect on the IS6 helix, because the
primary
1-
4 subunit
interaction occurs on the intracellular loop between homology domains I
and II (I-II loop) (Pragnell et al., 1994
). This is consistent with a
previous study showing that IS6 is a critical determinant of
voltage-dependent inactivation in Cav2.1 and
Cav2.3 channels (Zhang et al., 1994
). However,
site-directed mutagenesis and domain-swapping studies have highlighted
the equal importance of IIS6, IIIS6, and IVS6 in
Ca2+ channel gating (for review, see Stotz
and Zamponi, 2001
; Shi and Soldatov, 2002
), making the case for direct
effects on these S6 helices equally plausible. It is interesting that
many of the proteins that have evolved to modulate
Ca2+ channel gating target
1 I-II (
subunits,
G
subunits, protein kinase C) and II-III
loops (syntaxin, synaptotagmin, and synaptosomal-associated
protein-25). The IS6 and IIS6 (but not IIIS6 or IVS6) helices of
Cav2.1, 2.1, and 2.3 Ca2+ channels have glycines in hinge
positions comparable with those present in KcsA and MthK (see
alignments in Horne et al., 1993
).
Despite extensive binding studies with
4
subunits, there is currently no evidence to support the notion that the
4b N terminus binds directly to
1A subunits (Walker et al., 1998
, 1999
). One possible explanation for this is that the interaction is too weak to be
detected in solution binding assays. The other possibility is that the
1A subunit is not the primary binding target.
The sequence of the ligand motif (GXXDXPXXP) may provide an important clue as to the nature of its own binding site. Proline-rich motifs are
common within the primary structures of many ligands important for
protein-protein interactions (for review, see Kay et al., 2000
; Ma