 |
Previous Article | Next Article 
The Journal of Neuroscience, December 15, 2002, 22(24):10662-10670
ProInflammatory Mediators, Stimulators of Sensory Neuron
Excitability via the Expression of Acid-Sensing Ion Channels
Julien
Mamet,
Anne
Baron,
Michel
Lazdunski, and
Nicolas
Voilley
Institut de Pharmacologie Moléculaire et Cellulaire, Centre
National de la Recherche Scientifique-Unité Mixte de Recherche
6097, Sophia Antipolis, 06560 Valbonne, France
 |
ABSTRACT |
Tissue acidosis is an important feature of inflammation. It is a
direct cause of pain and hyperalgesia. Protons activate sensory neurons
mainly through acid-sensing ion channels (ASICs) and the subsequent
membrane depolarization that leads to action potential generation. We
had previously shown that ASIC transcript levels were increased in
inflammatory conditions in vivo. We have now found that
this increase is caused by the proinflammatory mediators NGF,
serotonin, interleukin-1, and bradykinin. A mixture of these mediators
increases ASIC-like current amplitude on sensory neurons as well as the
number of ASIC-expressing neurons and leads to a higher sensory neuron
excitability. An analysis of the promoter region of the ASIC3 encoding
gene, an ASIC specifically expressed in sensory neurons and associated
with chest pain that accompanies cardiac ischemia, reveals that gene
transcription is controlled by NGF and serotonin.
Key words:
acid-sensing ion channel; ASIC; inflammation; nociception; neuronal excitability; NGF; proinflammatory mediators; ASIC3; promoter; DRG
 |
INTRODUCTION |
Inflammation represents a protective
defense reaction induced by external or internal trauma such as tissue
injury, infection, or tumor growth. However, it represents one of the
major causes of pain. The numerous inflammatory and pain mediators that
are involved, released by fibroblasts, neurons, and immune cells, include neurotrophins (such as NGF), histamine, bradykinin, prostanoids (PGE2, LTB4), serotonin,
protons, cytokines [interleukin (IL)-1, IL-6], peptides (substance
P), and free radicals (Dray, 1995 ). They can have a direct action or
stimulate the release of other chemicals, activate the immune system,
facilitate vasodilatation and plasma extravasation, and sensitize the
nociceptive system. This latter action is accomplished by their binding
to receptors on sensory neurons, leading to downstream second-messenger
cascades and modulation of ion channel gating. Some of these mediators can change gene expression, modifying the phenotype of these neurons (Woolf and Costigan, 1999 ). Inflammation is thus accompanied by short-term modifications in the excitation and sensitization of peripheral sensory terminals (Rang et al., 1991 ; Cesare and McNaughton, 1997 ) and longer-term changes in the properties of these afferent neurons innervating the inflamed tissue (Neumann et al., 1996 ; Woolf,
1996 ), leading to a decrease in their excitability threshold. Combined
with an increase in excitability of spinal neurons (McMahon et al.,
1993 ), this facilitated nociceptive transduction leads to hyperalgesia
(i.e., responses to noxious stimuli are enhanced) and allodynia (i.e.,
innocuous stimuli produce pain).
Tissue acidosis is an important feature of inflammation in which
extracellular pH can drop to values as low as 5.4 (Jacobus et al.,
1977 ). The protons are released by lysed cells along with degranulation
of different mediators, or they come from a hypoxic metabolism.
Acidosis has been shown to be directly linked to the feeling of pain
in vivo in normal tissues and to contribute to sustained
pain and hyperalgesia in inflammation (Steen and Reeh, 1993 ; Steen et
al., 1995 ; Issberner et al., 1996 ; Reeh and Steen, 1996 ). Protons are
one of the most effective substances for the activation of nociceptors
(Steen et al., 1990 , 1992 ).
Protons directly gate depolarizing cationic channels on sensory neurons
(Krishtal and Pidoplichko, 1981 ; Bevan and Yeats, 1991 ), which
correspond to the now well characterized acid-sensing ion channels
(ASICs) (Waldmann et al., 1996 ; Waldmann and Lazdunski, 1998 ).
Different isoforms of the ASICs arrange in homotetramers and
heterotetramers to form functional channels: ASIC1a and 1b, ASIC2a and
2b, and ASIC3 (Waldmann et al., 1996 ; Garcia-Anoveros et al., 1997 ;
Lingueglia et al., 1997 ; Waldmann et al., 1997a ,b ; Chen et al., 1998 ;
Babinski et al., 2000 ; Benson et al., 2002 ). In sensory neurons, the
expression of the genes coding for specific ASICs is increased in the
case of inflammation, and therapeutic doses of nonsteroid
anti-inflammatory drugs can prevent ASIC transcription increase by
inflammation (Voilley et al., 2001 ).
This paper reports for the first time the cloning of an ASIC-encoding
gene promoter region. It analyzes the contributions and possible mode
of action of the different inflammatory mediators responsible for the
change in mRNA levels of the different ASICs and correlates this change
to an increase in sensory neuron excitability through an augmentation
in ASIC channel activity. These different modifications could
participate in the setting of inflammatory hyperalgesia.
 |
MATERIALS AND METHODS |
Dorsal root ganglion neuron primary culture and RT-PCR
experiments. Cultures were prepared, and RNA purification and
RT-PCR were performed as described previously (Voilley et al., 2001 ) with 35 cycles (saturation being reached after 42 cycles). The proinflammatory and control substances tested individually (Sigma, St.
Louis, MO) were incubated on the cells for 8 or 24 hr. The tested
substances were as follows: 5 ng/ml IL-1 , 5 ng/ml IL-3, 5 ng/ml
IL-6, 1500 ng/ml IL-8, 5 ng/ml IL-12, 5 ng/ml interferon , 5 ng/ml
TNF , 5 ng/ml TGF , 100 ng/ml NGF, 2000 ng/ml histamine, 2000 ng/ml
serotonin, 1000 ng/ml bradykinin, 400 ng/ml calcitonin gene-related
peptide, and 100 ng/ml substance P.
Patch-clamp recording on dorsal root ganglion sensory
neurons. Ion currents were recorded using the whole-cell
patch-clamp technique. Data were sampled at 500 Hz and low-pass
filtered at 3 kHz using pClamp8 software (Axon Instruments, Foster
City, CA). The statistical significance of differences between sets of
data was estimated by the single-sided Student's test. The pipette solution contained (in mM): 140 KCl, 5 NaCl, 2 MgCl2, 5 EGTA, 2 K2ATP, 10 HEPES, pH 7.35, and the bath solution contained (in mM): 150 NaCl, 5 KCl, 2 MgCl2, 2 CaCl2, 10 glucose,
10 HEPES, pH 7.45. CNQX (20 µM) and kynurenic
acid (10 µM) (Sigma) were added to inhibit
glutamate-induced currents. 2-[N-morpholino]ethanesulfonic acid was used instead of HEPES to buffer bath solution pH
ranging from 6 to 5. Changes in extracellular pH were induced by
shifting one of eight outlets of a microperfusion system in front of
the cell. Experiments were performed at room temperature. Bovine serum albumin (0.1%) was added in extracellular solutions containing the
spider toxin PcTX1. The toxin was applied at least 1 min before the pH
drop. Capsaicin (Sigma) was used at 10 µM.
Cultured dorsal root ganglion (DRG) neurons were treated overnight with
the mixture of proinflammatory factors, and currents were recorded from
a similar number of control and treated neurons. Capsaicin- and proton-induced currents were recorded on primary cultured DRG neurons
2 d after the enzymatic dissociation. The PcTX1 toxin was used to
determine the fraction of homomeric ASIC1a current (Escoubas et al.,
2000 ). Current densities (picoamperes per picoFarads) and proportions
of neurons expressing each current type were measured from control and
treated neurons from each cell culture and pulled together. Statistical
analysis of the data was performed with GraphPad Prism 3.03 (GraphPad
Software). Current densities showed a Gaussian distribution and were
expressed as mean ± SEM, and the significance was thus tested
using the unpaired Student's t test.
Transcription start site determination and promoter
isolation. The transcription start site (TSS) study was done with
the Smart Race cDNA amplification kit (Clontech, Cambridge, UK) on rat
DRG total RNA using the indications provided by the supplier. Two PCR
rounds were realized using at first the forward universal primer and
the reverse 5'-CTGTTCCAGAAATACCCCAGGAC ASIC3 (GenBank accession number
AF013598) primer and for the second round the forward nested universal
primer and the reverse 5'-GCCGCCAGCGACAGGAGCACA ASIC3 primer.
PCR products were then purified, subcloned in pCR2.1-TOPO vector
(Invitrogen, Gaithersburg, MD), and sequenced. The rat promoter region
was obtained by PCR on genomic DNA with reverse oligonucleotides
designed from ASIC3 transcript and forward ones from the 5' region of
ASIC3 gene on the mouse genome (provided by R. Waldmann, Institut de
Pharmacologie Moléculaire et Cellulaire). Two PCR rounds
were realized (using the Taq Platinium; Invitrogen): the
first round with the forward CCTAGCCTTTGTGAGAGTCT and the reverse
CCGCTCAGCCACCTGGTAGAG primers, the second half-nested round with the
forward CCTAGCCTTTGTGAGAGTCT and the reverse GCCGCCAGCGACAGGAGCACA primers. PCR products were then purified, cloned in pCR2.1-TOPO vector, and sequenced. With this method, ~3 kb were cloned. In parallel, the use of a Rat Genome Walker Kit (Clontech) only allowed the isolation of a 1.5 kb fragment (matching with the 3' end of the 3 kb fragment). Analysis of the DNA sequence was done with MatInspector
Professional 5.2 (Quandt et al., 1995 ). Four deletions of the 3 kb
sequence were realized by PCR, using Takara LA Taq polymerase. The PCR products were purified and subcloned in pBlue TOPO
(Invitrogen) in the 5' of the -galactosidase reporter gene. The
3/2925 CAAT mutant consisted of the deletion of the CCAAT box matrix
( 405 to 416) generated by PCR.
Transfection and reporter gene activity measurements.
Transient transfection of 1-d-old primary culture of DRG cells was
performed with Exgen 500 (Euromedex), according to the supplier's
protocol. pBlue-TOPO vectors containing the constructs were
cotransfected with a pSEAP2 vector containing the gene coding for the
secreted alkaline phosphatase (SEAP) under a constitutive promoter
(Clontech). After transfection, the primary cultured neurons were
either left in normal medium or treated with different combinations of
the following factors: NGF, IL-1 , bradykinin, serotonin, or anti-NGF antibody (1:1000; Sigma). -galactosidase activity was measured with
the Galacto-Star kit (Tropix), and SEAP activity was measured with the
Great EscAPe SEAP detection kit (Clontech), according to the protocols
provided by the suppliers, 24 hr after transfection and treatment. The
measures were realized with a Biorbit 1253 luminometer. For each
sample, the -galactosidase activity was normalized with the SEAP
activity (reflecting the transfection level) and the amount of proteins
(measured with the Bio-Rad protein assay). Background level was
measured with the -galactosidase vector with no added promoter
sequence. Statistical analysis was performed with Origin41. Comparison
of the means was done using Student's t test.
 |
RESULTS |
Action of proinflammatory mediators on ASIC gene expression in
DRG neurons
We had shown previously that inflammation conditions increased
in vivo the transcript levels of ASICs (Voilley et al.,
2001 ). To find which inflammatory factors were implicated, we tested different mediators on DRG neurons in primary culture and measured the
levels of ASIC mRNAs by semiquantitative RT-PCR. Among the different
compounds tested (see Materials and Methods), 10 had no effect (even at
concentrations 5-150× the EC50 given by the supplier), and 4 were able to mimic the increase observed in
vivo: NGF, serotonin, interleukin-1, and bradykinin. The
concentrations used for these four compounds (which were 2-10× the
EC50 given by the supplier) were in the range of
concentration usually used in the literature or based on levels found
in inflamed tissues (Ristimaki et al., 1994 ; Bevan and Winter, 1995 ;
Mössner and Lesch, 1998 ; Petersen et al., 1998 ; Stucky et al.,
1998 ; Habelt et al., 2000 ). The induction factors ranged from 3- to
10-fold the basal expression (Table 1)
for ASIC1a, -1b, -2b, and -3. We also measured the level of the
vanilloid receptor VR1 transcript, because this cation channel is also
sensitive to protons (Tominaga et al., 1998 ) and is also an important
pain sensor (McCleskey and Gold, 1999 ; Caterina and Julius, 2001 ). The
level of VR1 was unchanged, as observed previously (Hu-Tsai et al.,
1996 ; Habelt et al., 2000 ; Voilley et al., 2001 ). We thus used a
mixture of NGF, serotonin, interleukin-1, and bradykinin in the
following studies and referred to this mixture as the proinflammatory
mix.
View this table:
[in this window]
[in a new window]
|
Table 1.
Induction factors of the levels of ASIC transcripts
measured by semiquantitative RT-PCR on DRG neurons in primary culture
obtained after treatment with proinflammatory mediators
|
|
Effects of proinflammatory mediators on H+-gated
currents in DRG neurons
Capsaicin- and proton-induced currents were recorded on primary
cultured DRG neurons. The PcTX1 toxin was used to specifically inhibit
homomeric ASIC1a channels (Escoubas et al., 2000 ). Typical recordings
obtained from a neuron expressing VR1, homomeric ASIC1a, and ASIC3-like
currents are shown in Figure
1A. The inhibition of
ASIC1a current by application of PcTX1 (10 nM)
revealed a biphasic ASIC3-like current activated by a pH drop from 7.4 to 6. DRG neurons were highly variable in their expression of ASIC and
VR1 currents. The proportion of neurons expressing the different
current types was determined in control and treated neurons from each
of five different cell cultures and pooled together (Fig.
1B). Treatment with the proinflammatory mix increased
the number of neurons expressing an ASIC current from 32.3 to 55.8% of
the recorded neurons (Fig. 1B, Table
2), without increasing the number of
neurons expressing a capsaicin-activated current (67.6% of control
neurons; 58.8% of treated neurons). The treatment increased the
proportions of neurons expressing ASIC1a or ASIC3-like currents from
17.6 to 30% and 26.5 to 38.2%, respectively. This effect produced an
increase in the probability of coexpression of ASIC and VR1 currents,
from 11.7% in control neurons to 17.6% in treated neurons, associated with a decrease in the probability of expression of VR1 alone, from 50 to 32.3% (Table 2). Figure 1C shows that the treatment with
the proinflammatory mix increased the mean peak ASIC current activated
at pH 5 from 36.9 ± 10.5 to 58.3 ± 13.1 pA/pF without affecting the VR1 current density (Table 2). ASIC1a and ASIC3-like current densities were also increased. Even with the high variability of current density values, this effect was significant
(p < 0.05) for the ASIC3-like current, reaching
34.9 ± 8.2 pA/pF from the control value of 15.1 ± 3.5 pA/pF. The density of the sustained ASIC current was not significantly
modified by the treatment and neither was the mean cell capacitance of
neurons expressing an ASIC-like current (control: 35 ± 3 pF,
n = 37; treated: 41 ± 4 pF, n = 35). A previous study showed a diminished acid-triggered transient
current amplitude on DRG neurons on NGF deprivation, but without any
change in the number of pH-responsive neurons (Bevan and Winter, 1995 ).

View larger version (24K):
[in this window]
[in a new window]
|
Figure 1.
Effect of proinflammatory mediators on
proton-gated currents in rat DRG neurons. A, Original
current traces from a DRG neuron expressing capsaicin-activated VR1
current (left) and PcTX1-sensitive ASIC1a current and
ASIC3-like current (right). This neuron was treated
overnight with the proinflammatory mix. Holding potential was 50 mV.
B, Percentage of recorded neurons
expressing an ASIC-like current (ASIC), a
PcTX1-sensitive ASIC1a current (ASIC1), an ASIC3-like
current (ASIC3), and a capsaicin-activated VR1 current
(VR1), in control neurons (white bars)
and in neurons treated overnight with the proinflammatory mix
(dark gray bars). Some neurons can express a mixture of
these different current types because each current type (VR1, ASIC1a,
or ASIC3-like) could be found alone or associated with one or two of
the others. The proportion of neurons expressing each current type,
whether alone or associated with one or two other types, was
determined. The total number of recorded neurons was 34 for each
condition, from 5 different cell cultures in which similar numbers of
control and treated neurons were recorded. C, Mean
current density (picoamperes per picoFarads) of ASIC-like current
(ASIC), PcTX1-sensitive ASIC1a current
(ASIC1), ASIC3-like current (ASIC3), and
capsaicin-activated VR1 current (VR1), in control
neurons (white bars) and in neurons treated overnight
with the proinflammatory mix (dark gray bars). Holding
potential was 50 mV; ASIC current amplitudes were measured at pH 5. Mean ± SEM is shown; n ranges from 8 to 23 from 5 different cell cultures. *p < 0.05; significantly
different from the control value.
|
|
To estimate the effect of such an increase in ASIC3-like peak current
density on neuronal excitability, membrane potential variations were
recorded on neurons expressing mainly an ASIC3-like current. Figure
2 presents typical recordings from two
neurons expressing only an ASIC3-like current insensitive to the PcTX1 toxin (10 nM; data not shown) and no capsaicin-induced
current (shown for the treated neuron) (Fig. 2B).
These sensory neurons had a resting potential at approximately 58 mV,
which was not significantly different between control and treated
neurons (control: 57.4 ± 2.6 mV, n = 15;
treated: 59.8 ± 3.0 mV, n = 9), and no spontaneous action potentials (APs). A pH drop from 7.4 to 6 induced a
biphasic depolarization, with a transient and a plateau phase, which is
compatible with the kinetics of the ASIC3-like current (Fig.
2A,B). However, effects of pH on
other ionic channels that could also contribute to membrane potential
changes cannot be ruled out. Interestingly, no APs were triggered
during the plateau of the depolarization, even for small pH drops,
contrary to what was reported in hippocampal neurons (Baron et al.,
2002 ). The transient depolarization induced by pH 6 could trigger
bursts of APs in the neuron treated by the proinflammatory mix, as
shown in enlargements in Figure 2B, whereas the AP
threshold was not reached by the transient depolarization induced by pH
6.6. In the control neuron (Fig. 2A), the membrane
depolarization induced by the smaller ASIC3-like current could not
trigger any action potential, even at pH 6. This increase in
excitability after treatment with the proinflammatory mix was not
caused by a shift in the ASIC3-like current pH dependency, which was
not different in control and treated neurons (Fig. 2C). The
mean depolarization induced by the pH drop was increased in treated
neurons for each pH value (Fig. 2D). The mean AP
threshold (Fig. 2D, gray bar) was not
significantly different for control ( 25.4 ± 2.6 mV;
n = 11) and treated neurons ( 29.8 ± 2.4 mV;
n = 10); neither was the relationship between the
ASIC3-like current density and the membrane depolarization induced by
the same pH drop on the same neuron (Fig. 2E). Thus, the increase in neuronal excitability induced by the proinflammatory mix appeared to be related to the increase in ASIC3-like current amplitude and in the subsequent depolarization that triggers APs when
reaching the threshold value. Indeed, the number of neurons in which
APs could be triggered by a pH drop was increased by the
proinflammatory mix treatment (Fig. 2F), particularly
for small pH changes activating submaximal ASIC3-like currents that depolarized the neuron near the AP threshold (Fig.
2D). A pH drop from 7.4 to 6.3 triggered APs in
54.5% of the treated neurons compared with 27.3% of the control
neurons, whereas a pH drop from 7.4 to 6 triggered APs in 75% of the
treated neurons compared with 46% of the control neurons. Thus, our
results clearly show that a higher ASIC3 transcript level is
accompanied by a higher ASIC3 current amplitude leading to higher
neuronal excitability.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 2.
Effect of the proinflammatory mediators on the
excitability of DRG neurons containing an ASIC3-like current.
A, Original current and potential
recordings from a control DRG neuron. Top, Voltage-clamp
recording of ASIC3-like current induced by a pH drop from 7.4 to 6, whereas capsaicin induced no VR1 current (data not shown). Holding
potential was 50 mV. Middle, Current-clamp recording
(I = 0 pA) of the depolarization induced by a pH
drop from 7.4 to 6. No action potential was triggered by the membrane
depolarization. The dashed line represents the 0 mV
level. Bottom, Enlargement of the initial depolarization
induced by the pH drop. B, Original current and
potential recordings from a proinflammatory mix-treated DRG neuron.
Top, Voltage-clamp recording of ASIC3-like current
induced by pH drop from 7.4 to 6, whereas capsaicin induced no VR1
current (right). Holding potential was 50 mV.
Middle, Current-clamp recording (I = 0 pA) of the depolarization induced by a pH drop from 7.4 to 6 and 6.6. Action potentials were triggered by the membrane depolarization induced
by pH 6 but not by pH 6.6. Bottom, Enlargement of the
initial depolarization induced by the pH drop, showing action potential
bursts. C, pH-dependent activation of the peak
ASIC3-like current in control ( ) and treated ( ) neurons. Holding
potential was 50 mV. The current amplitude was expressed as a
fraction of the current induced by pH 5 (I/I pH 5) and plotted as mean ± SEM; n ranges from 5 to 19. The data could be fitted by
a sigmoid with a pH0.5 = 6.2 and a Hill slope factor
of 1.7. D, Mean peak membrane depolarization as a
function of extracellular pH in control ( ) and treated ( )
neurons, measured from current-clamp recordings (I = 0 pA). The resting potential was 57.4 ± 2.6 mV
(n = 15) and 59.8 ± 3.0 mV
(n = 9) in control and treated neurons,
respectively. The depolarization values during APs were excluded from
measurements. The membrane potential area corresponding to the AP
threshold is indicated by a gray bar (see Results
for value). Mean ± SEM values are shown; n ranges
from 4 to 19. *p < 0.05; significantly different
from the control value. E, Membrane depolarization as a
function of ASIC3-like current density activated by the same pH drop on
the same neuron. The membrane potential was measured by current-clamp
(I = 0 pA), and the depolarization values during
APs were excluded from measurements. ASIC3-like current density
(picoamperes per picoFarads) was subsequently measured on the same
neuron, at a holding potential similar to the resting potential
measured in current clamp (I = 0). Membrane
potential and ASIC3-like current density were measured during the
transient peak ( , control; , treated neurons) and during the
sustained plateau phase ( , control; , treated neurons) for the
same pH value. F, Percentage of recorded neurons in
which APs were triggered by various pH drops (white
bars, control; dark gray bars, treated
neurons).
|
|
Regulation by proinflammatory mediators of ASIC3 promoter
region activity
To determine the transcription start site of the ASIC3
encoding gene, we performed 5' rapid amplification of cDNA ends
(RACE)-PCR on RNA from rat DRGs. The longest fragment obtained was 343 nucleotides long from the ATG. It could correspond to the transcription
start site. Smaller fragments were also obtained, suggesting
more proximal start points or strong secondary structures in the 5'
noncoding region of the mRNA. Whether the RNA was extracted from normal DRGs or from DRGs under inflammatory conditions [from an animal under
a Complete Freund's adjuvant (CFA)-induced inflammation], the
sizes of the fragments obtained were similar. This means that the same
promoter region is used in both conditions. We then used rat genomic
DNA to isolate the promoter region of the gene. We cloned a 3174 bp
fragment upstream of the ATG. This sequence appeared in GenBank under
accession number AF527175. The analysis of this fragment revealed no
TATA box, no initiator element (Inr), and no GC box, but several
CCAAT boxes along the sequence. The most probable CCAAT box
corresponded to an inverted nonconsensus box at 62 bp from the TSS
( 405 from the ATG). In TATA-less promoters with inverted CCAAT box,
the functional site is found at the average position of 63 ± 29 to the TSS (Mantovani, 1998 ). The 343-base 5' untranslated region
(UTR) of the mRNA was compared with the genomic sequence. It
contained no intron, and the possibility of multiple transcription
start sites was highly probable because many TATA-less promoters
lacking initiator elements use multiple start sites, and the 5' UTR
contains a multiple start site element downstream-1-like sequence,
named MED-1, an element necessary for multiple start
utilization, at position 305 from the ATG (Ince and Scotto, 1995 ). A
2925 bp DNA fragment (from 249 to 3174 from the ATG) and different
deletion constructs obtained from this fragment were subcloned before
the -galactosidase reporter gene and transfected into primary
cultures of DRG neurons along with a SEAP-containing vector.
Figure 3 shows the results regarding the
activities of different parts of the promoter region in control
medium and with the proinflammatory mix. The full-length sequence of
the ASIC3 promoter region 3/2925 conferred a basal activity that was
significantly increased by proinflammatory mediators (the
-galactosidase activity augmented from 1.9 ± 0.4 to
4.6 ± 1.0; p < 0.05). When the putative inverted
CCAAT box within the complete clone was deleted (construct 3/2925 CAAT), there was a total loss of the transcriptional activity (i.e., to the background level, which corresponds to the activity of
the -galactosidase vector with no added promoter sequence), showing
the importance of this element in ASIC3 encoding gene transcription.
The shorter construct 3/1423 displayed an activity in the range of the
background level both in normal and in treated conditions. This
activity seemed lower than the basal activity of the full-length
promoter region (1.2 ± 0.1 vs 1.9 ± 0.4; p = 0.1). Construct 3/1066 displayed basal activity that was twofold higher than that of construct 3/2925 (4.0 ± 0.6 compared with 1.9 ± 0.4; p = 0.07) and four times higher than
the background level. Treatment with the proinflammatory mix multiplied
its basal activity by 3 (from 4.0 ± 0.6 to 12.2 ± 1.4;
p = 0.002), bringing a 12-fold increase from the
background level. The proinflammatory mix-induced activity of construct
3/1066 was approximately three times higher than that of construct
3/2925 under the same conditions (12.2 ± 1.4 compared with
4.6 ± 1.0; p = 0.006). Construct 3/1066 basal
activity was not significantly different from construct 3/2925-induced
activity (4.0 ± 0.6 compared with 4.6 ± 1.0). The shortest
construct 3/452 had a control activity significantly lower than
construct 3/2925 (0.7 ± 0.2 vs 1.9 ± 0.4; p = 0.02), which had an activity corresponding to the background level,
and the proinflammatory mix did not induce any change. Activities of
construct 3/2925 m, which lacked the middle fragment, 1315 to
1672, were similar in control conditions (3.5 ± 0.8) and after the proinflammatory treatment (4.0 ± 0.8) and corresponded to the
maximal activity of the full-length clone 3/2925. Construct 3/2925 mp, lacking the sequence from 701 to 1672, showed
comparable activities in control and inflammatory conditions (basal:
5.2 ± 1.0; treated: 5.0 ± 2.0).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3.
ASIC3 gene promoter region study by reporter gene
assays. The activities of different constructs of the promoter region
of the ASIC3 gene were tested using -galactosidase as a
reporter gene. The clones were transfected into DRG neurons in primary
culture, and the cells were either maintained in the regular medium
(white bars) or treated with the proinflammatory mix
(NGF, bradykinin, IL-1, and serotonin) (dark gray bars)
shown to mimic inflammation action on ASIC encoding gene transcription.
NGF antibody corresponds to incubation with the anti-NGF antibody.
Results are normalized on SEAP activity (which takes into account the
transfection yield) and the amount of proteins. They are expressed as
the ratio of a treated condition with the background level (given by
the -galactosidase vector basal activity; i.e., without any promoter
region insert added) and are given as mean ± SEM. The following
constructs were studied: the full-length sequence of ASIC3 encoding
gene promoter region (the 2925-base long fragment, named
3/2925, from 249 to 3174), three shorter fragments
(3/1423, from 249 to 1672; 3/1066,
from 249 to 1315; and 3/452, from 249 to 701),
and three deletion fragments
(3/2925 CAAT, lacking the putative
CCAAT box from 405 to 416;
3/2925 m, lacking from 1315 to
1672; 3/2925 mp, lacking from 701
to 1672). n 3; corresponds to a
significant difference (p < 0.05) between
the control and the treated conditions for the same clone, corresponds to a significant difference (p < 0.05), and ( ) corresponds to a difference with
p < 0.1, between the control of clone 3/2925 and
any other condition.
|
|
These results indicate that different parts of the promoter region have
different functional roles in the basal transcription of the ASIC3
encoding gene and the presence of inflammatory mediators.
We then tested the proinflammatory factors individually on the
constructs displaying a transcriptional activity (Fig.
4). On the full-length clone 3/2925, NGF
alone was sufficient to induce a maximal expression almost tripling the
activity (4.9 ± 1.0 vs 1.9 ± 0.4; p = 0.04). The addition of anti-NGF antibodies, which blocked the NGF
present in the culture medium or produced by the cells in culture,
induced a decrease of the basal activity to the background level (a
reduction from 1.9 ± 0.4 to 0.6 ± 0.1; p = 0.01). The total induction of ASIC3 encoding gene transcription by NGF
represented then an eightfold increase and was in the same range as the
mRNA level induction measured by RT-PCR (7.3 ± 1.3-fold) (Table
1). Serotonin, bradykinin, and interleukin-1 had no effect on 3/2925
expression. Construct 3/1066 showed a different pattern of activity.
Serotonin was able to fully activate its expression (from 4.0 ± 0.6 to 9.7 ± 2.2; p = 0.05), but in a
NGF-dependent manner, because anti-NGF antibodies completely abolished
serotonin action. However, the simultaneous addition of NGF, which had
no enhancing activity alone, along with serotonin, prevented serotonin action. Bradykinin and IL-1 had no action on 3/1066 expression. Construct 3/2925 m and construct 3/2925 mp showed comparable
expression profiles. Their expression level was the same as the basal
level of construct 3/1066, with or without proinflammatory mediators. The addition of anti-NGF antibodies tended to decrease the basal level
(from 3.5 ± 0.8 to 1.8 ± 0.4, p = 0.1, for
construct 3/2925 m; from 5.2 ± 1.0 to 2.1 ± 0.3 for
construct 3/2925 mp, p = 0.06).

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4.
Effects of the different active proinflammatory
mediators on ASIC3 encoding gene transcription. The same constructs as
in Figure 3 are tested in the same system with the mediators used
individually. Results are given as in Figure 3 (mean ± SEM) with
n 3. corresponds to a significant difference
(p < 0.05), and ( ) corresponds to a
difference with p < 0.1, between the control and
the treated conditions for the same clone. NGFAb, NGF
antibody; BK, bradykinin; 5HT,
serotonin.
|
|
 |
DISCUSSION |
Extracellular acidification is an important factor in inflammatory
pain and hyperalgesia (Steen et al., 1990 ; Issberner et al., 1996 ; Reeh
and Steen, 1996 ; Sutherland et al., 2000 ). The main
H+ sensors are the ASICs (Waldmann et al.,
1997a ; Waldmann and Lazdunski, 1998 ; McCleskey and Gold, 1999 ). They
are expressed in DRG sensory neurons and particularly in nociceptors
(Chen et al., 1998 ; Olson et al., 1998 ; Petruska et al., 2000 ;
Garcia-Anoveros et al., 2001 ; Voilley et al., 2001 ). They are strong
candidates for acid-evoked nociceptive responses and especially for
cardiac nociception associated with ischemia (Sutherland et al., 2001 ).
They may also be involved in mechanosensation (Price et al., 2001 ).
Heterogeneity of sensory neurons expressing
H+-gated currents
We have found that 32.3% of DRG neurons express an ASIC current,
17.6% express an ASIC1a current, 26.5% express an ASIC3-like current,
and 67.6% express a VR1 current, each current type being expressed
either alone or associated with one or two of the others. A mixture of
an ASIC1a and an ASIC3-like current is present in 9% of the neurons,
which represents almost one-third of ASIC-expressing neurons, whereas a
VR1 current is coexpressed with an ASIC current in 11.7% of the
neurons, which represents approximately one-half of the ASIC-expressing
neurons. Petruska and colleagues (2000) reported similar results, with
28% of ASIC-like-expressing neurons and 47% of VR1-expressing
neurons, but these authors reported a lower proportion of
ASIC3-like-expressing neurons (8%) and no coexpression of ASIC-like
current and VR1 current. Taken together, all of these results indicate
a functional diversity of H+-gated
currents in rat DRG neurons and suggest a functional specialization of
sensory fibers depending on their H+-gated
channel expression pattern.
Effect of proinflammatory mediators on H+-gated
channels in DRG neurons
We had shown previously that ASIC transcript levels in sensory
neurons were increased in inflammatory conditions in vivo
(Voilley et al., 2001 ). Among the large panel of mediators that we
tested and that come into play in such conditions, we have shown that NGF, serotonin, bradykinin, and IL-1 are the only factors that are able
to increase ASIC mRNA levels. It is well known that these locally
released proinflammatory factors can activate and sensitize sensory
neurons and produce hyperalgesia (Ferreira et al., 1988 ; Taiwo and
Levine, 1992 ; Lewin and Mendell, 1993 ; Watkins et al., 1994 ; Dray,
1995 ; McMahon, 1996 ). NGF induces strong and long-lasting changes in
sensory neurons through regulation of gene expression (Zur et al.,
1995 ; McMahon, 1996 ; Woolf, 1996 ; Fitzgerald and Dolphin, 1997 ;
Petersen et al., 1998 ; Waxman et al., 1999a ). Serotonin and IL-1 induce
the expression of inflammation-associated genes (Ristimaki et al.,
1994 ; Stroebel and Goppelt-Struebe, 1994 ; Dinarello, 1996 ; Humblot et
al., 1997 ). We have shown that in the same conditions a mix of these
inflammatory mediators does not change VR1 mRNA levels.
When DRG neurons are submitted to proinflammatory mediators, there is
an increase both in the ASIC current density (~1.6-fold) and in the
proportion of neurons expressing ASIC currents (~1.7-fold). Both
ASIC1a and ASIC3-like current densities are increased (~1.7-fold and
2.3-fold, respectively), as are proportions of ASIC1a- and ASIC3-expressing neurons (~1.7-fold and 1.4-fold, respectively). The
density of capsaicin-induced (VR1) current and the proportion of
neuronal cells expressing this channel type were essentially the same
in control and treated conditions. These changes in ASIC expression are
expected to facilitate H+-induced
excitation of ASIC-expressing sensory neurons as well as induce an acid
pH sensitivity of newly ASIC-expressing neurons.
Correlation between stimulated ASIC3 expression and
neuronal excitability
The increase in ASIC current densities and in ASIC-expressing cell
proportion by proinflammatory mediators directly modifies the
excitability of DRG neurons expressing an ASIC current.
In DRG neurons, the biphasic ASIC3-like current triggers a biphasic
depolarization. APs are induced only on the peak phase and not on the
plateau of ASIC3-induced depolarization. Actually, both tetrodotoxin
(TTX)-sensitive and TTX-resistant voltage-dependent Na+ channels are involved in the control
of the excitability of sensory neurons (Rush et al., 1998 ; Gold, 1999 ;
Baker and Wood, 2001 ) and could be recruited during extracellular
acidification-induced depolarization. It is interesting to note that
although the relation between the current densities and the
depolarization is the same for the peak and the plateau phases, APs are
triggered only by the peak in DRG neurons. This is different from what
occurs in the hippocampus, where a similar relation exists but where
APs appear on both the peak and the plateau phases (Baron et al., 2002 ). This reinforces the role of the TTX-resistant
Na+ channels that are expressed
exclusively in sensory neurons and not in the CNS (Gold, 1999 ). Indeed,
TTX-resistant channels activate and inactivate with higher membrane
potential thresholds than TTX-sensitive channels. For example, >95%
of TTX-sensitive channels are inactivated by potentials more positive
than 40 mV, whereas >90% of TTX-resistant channels are still
available at 40 mV (Rush et al., 1998 ).
The amplitude of the depolarization induced by ASIC3 currents follows a
nonlinear saturating relation. Thus, a small current (for example 40 pA/pF, which is only one-fourth of the maximal current in these
experiments) (Fig. 2E) is able to induce an almost maximal depolarization of ~50 mV, which brings the neuron membrane potential to 0 mV and is mostly sufficient to trigger APs. The consequence is that small ASIC3 currents triggered by changes to pH
values between 7 and 6 would bring the membrane potential in the range
of the AP triggering threshold. Thus, a moderate change of these ASIC3
currents will have major consequences on neuronal excitability and AP
triggering. By inducing a greater depolarization, the increase of
current density by the proinflammatory mediators can double the number
of APs triggered at pH 6.3 without changing the resting potential, the
AP-triggering threshold, or the current density/depolarization
relation. Clearly, a same external acidification will have more impact
on neuron excitability after sensory cells have been exposed to
proinflammatory mediators. ASIC channels can thus be important in
inflammatory hyperalgesia through the hypersensitivity to acid that we
have observed in nociceptors. In addition to this effect on neuronal
excitability, proinflammatory mediators also increase the proportion of
ASIC-expressing neurons. This increase in pH-responding cell number can
participate in allodynia. ASIC channels are not the only ion channels
that are modified in inflammatory conditions and by inflammatory
mediators (like NGF). Voltage-dependent
Na+ and Ca2+
channels were also shown to be upregulated (Zur et al., 1995 ; Fitzgerald and Dolphin, 1997 ; Waxman et al., 1999a ,b ).
Regulation of ASIC3 gene promoter activity by
proinflammatory mediators
ASIC3 is a particularly important ion channel for nociception
(McCleskey and Gold, 1999 ; Sutherland et al., 2001 ; Chen et al., 2002 ).
We have now shown that inflammatory mediators directly modulate ASIC3
encoding gene expression through its promoter region. This particular
region is controlled by an essential inverted CCAAT box and can be
divided into three main domains.
The transcription start site proximal domain confers a high basal
expression of ASIC3 through endogenously produced NGF. It also confers
a high potential of regulation by the proinflammatory mediator
serotonin, which is the only factor to induce a maximal expression,
through an NGF-dependent mechanism. A basal activity attributable to
endogenous NGF is necessary for serotonin action (Fig. 4,
3/1066) because this action is suppressed by anti-NGF antibody treatment. Addition of NGF in higher concentrations along with
serotonin prevents the serotonin-inducing action as if the two
proinflammatory mediators were competing for a common intermediate element in their transduction pathway. This result suggests that different mechanisms, which remain to be identified, regulate basal and
stimulated expression associated with different levels of NGF.
The middle domain completely suppresses the transcriptional activity of
the proximal domain. When it is removed, none of the inflammatory
mediators can have an inducing action on the ASIC3 encoding gene
expression, but the basal activity is high and maintained by NGF (Fig.
4, 3/2925 m and
3/2925 mp). When the distal domain is present,
which corresponds to the in vivo situation, some
transcriptional activity is regained by the action of NGF. This factor
has a low basal action and alone can enhance the expression, which,
however, can only reach the basal level observed with the proximal
domain alone. Numerous putative responsive elements can be detected in the ASIC3 promoter region. A detailed study will be necessary to better
identify the sites and the transcription factors implicated.
Proinflammatory mediators like NGF and serotonin can thus directly
enhance the transcriptional activity of the ASIC3 encoding gene. The
silencing role of the middle domain would be to limit an overexpression
of ASIC3 to allow its regulation by proinflammatory mediators and the
subsequent increase in neuronal excitability. Conversely, VR1
expression was shown to be maximal at physiological levels of NGF
(Hu-Tsai et al., 1996 ; Szallasi and Blumberg, 1999 ), and indeed we
observed no further increase in VR1 transcript level and current
density induced by proinflammatory mediators (Fig. 1C,
Tables 1, 2). ASICs thus appear to be better candidates than VR1 to
underlie the well-described hypersensitization of sensory neurons
during inflammation (Rang et al., 1991 ; Cesare and McNaughton, 1997 ;
Woolf and Costigan, 1999 ).
Bradykinin and IL-1 have no effect on ASIC3 gene promoter activity.
This result seems surprising because the RT-PCR results have shown an
increase in ASIC3 mRNA level after bradykinin or IL-1 treatment. We
suggest that these mediators act on the half-life of the transcripts,
as it has been described for the regulation of
cyclooxygenase-2 by IL-1 (Ristimaki et al., 1994 ). It is
noteworthy that the 3' UTR of ASIC3 mRNA, which is only 87 bases long
before the polyA tail, contains a predicted stem loop formed by 54 bases (a hairpin of 20 bases long, with two small loops). This stable structure could participate in the regulation of mRNA stability (Pesole
et al., 2000 ; Putland et al., 2002 ).
 |
CONCLUSIONS |
This work shows that NGF and to a lesser extent serotonin are key
elements for both the basal expression and the transcriptional regulation of the ASIC3 encoding gene. Endogenous NGF is known to
participate in the determination of the sensitivity of primary afferent
nociceptors (Bennett et al., 1998 ), and we now demonstrate that it
allows basal ASIC3 expression in these sensory neurons. An increase in
NGF level, similar to what happens during inflammation (McMahon, 1996 ),
enhances ASIC3 encoding gene expression. This effect is directly
correlated to an increase (1) in ASIC current amplitude in sensory
neurons, (2) in the number of ASIC-expressing neurons, and (3) in
neuronal excitability. The important role of NGF in the onset of
inflammation-induced hyperalgesia and sensitization of the nociceptive
system suggests that reducing NGF concentration or blocking its effect
could provide a clinical advantage in some inflammatory pain states
(Djouhri et al., 2001 ).
 |
FOOTNOTES |
Received Aug. 14, 2002; revised Oct. 2, 2002; accepted Oct. 2, 2002.
This work was supported by the Centre National de la Recherche
Scientifique (CNRS), the Association de la Recherche contre le Cancer,
the Association Française contre les Myopathies, AstraZenecaAB Research Area CNS/Pain, and the Programme "Molécules et Cibles Thérapeutiques" CNRS-Institut National de la Santé et de
la Recherche Médicale. We are grateful to P. Gaudray and E. Deval for fruitful discussion, to R. Waldmann for providing the mouse ASIC3
genomic sequence, and to M. Jodar for technical assistance.
Correspondence should be addressed to Prof. Michel Lazdunski, Institut
de Pharmacologie Moléculaire et Cellulaire, Centre National de la
Recherche Scientifique-Unité Mixte de Recherche 6097, 660 route
des Lucioles, Sophia Antipolis, 06560 Valbonne, France. E-mail:
ipmc{at}ipmc.cnrs.fr.
 |
REFERENCES |
-
Babinski K,
Catarsi S,
Biagini G,
Seguela P
(2000)
Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+.
J Biol Chem
275:28519-28525[Abstract/Free Full Text].
-
Baker MD,
Wood JN
(2001)
Involvement of Na+ channels in pain pathways.
Trends Pharmacol Sci
22:27-31[Medline].
-
Baron A,
Waldmann R,
Lazdunski M
(2002)
ASIC-like, proton-activated currents in rat hippocampal neurons.
J Physiol (Lond)
539:485-494[Abstract/Free Full Text].
-
Bennett DL,
Koltzenburg M,
Priestley JV,
Shelton DL,
McMahon SB
(1998)
Endogenous nerve growth factor regulates the sensitivity of nociceptors in the adult rat.
Eur J Neurosci
10:1282-1291[Web of Science][Medline].
-
Benson CJ,
Xie J,
Wemmie JA,
Price MP,
Henss JM,
Welsh MJ,
Snyder PM
(2002)
Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons.
Proc Natl Acad Sci USA
99:2338-2343[Abstract/Free Full Text].
-
Bevan S,
Winter J
(1995)
Nerve growth factor (NGF) differentially regulates the chemosensitivity of adult rat cultured sensory neurons.
J Neurosci
15:4918-4926[Abstract].
-
Bevan S,
Yeats J
(1991)
Protons activate a cation conductance in a sub-population of rat dorsal root ganglion neurones.
J Physiol (Lond)
433:145-161[Abstract/Free Full Text].
-
Caterina MJ,
Julius D
(2001)
The vanilloid receptor: a molecular gateway to the pain pathway.
Annu Rev Neurosci
24:487-517[Web of Science][Medline].
-
Cesare P,
McNaughton P
(1997)
Peripheral pain mechanisms.
Curr Opin Neurobiol
7:493-499[Web of Science][Medline].
-
Chen CC,
England S,
Akopian AN,
Wood JN
(1998)
A sensory neuron-specific, proton-gated ion channel.
Proc Natl Acad Sci USA
95:10240-10245[Abstract/Free Full Text].
-
Chen CC,
Zimmer A,
Sun WH,
Hall J,
Brownstein MJ
(2002)
A role for ASIC3 in the modulation of high-intensity pain stimuli.
Proc Natl Acad Sci USA
99:8992-8997[Abstract/Free Full Text].
-
Dinarello CA
(1996)
Biologic basis for interleukin-1 in disease.
Blood
87:2095-2147[Abstract/Free Full Text].
-
Djouhri L,
Dawbarn D,
Robertson A,
Newton R,
Lawson SN
(2001)
Time course and nerve growth factor dependence of inflammation-induced alterations in electrophysiological membrane properties in nociceptive primary afferent neurons.
J Neurosci
21:8722-8733[Abstract/Free Full Text].
-
Dray A
(1995)
Inflammatory mediators of pain.
Br J Anaesth
75:125-131[Abstract/Free Full Text].
-
Escoubas P,
De Weille JR,
Lecoq A,
Diochot S,
Waldmann R,
Champigny G,
Moinier D,
Menez A,
Lazdunski M
(2000)
Isolation of a tarantula toxin specific for a class of proton-gated Na+ channels.
J Biol Chem
275:25116-25121[Abstract/Free Full Text].
-
Ferreira SH,
Lorenzetti BB,
Bristow AF,
Poole S
(1988)
Interleukin-1 beta as a potent hyperalgesic agent antagonized by a tripeptide analogue.
Nature
334:698-700[Medline].
-
Fitzgerald EM,
Dolphin AC
(1997)
Regulation of rat neuronal voltage-dependent calcium channels by endogenous p21-ras.
Eur J Neurosci
9:1252-1261[Web of Science][Medline].
-
Garcia-Anoveros J,
Derfler B,
Neville-Golden J,
Hyman BT,
Corey DP
(1997)
BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels.
Proc Natl Acad Sci USA
94:1459-1464[Abstract/Free Full Text].
-
Garcia-Anoveros J,
Samad TA,
Zuvela-Jelaska L,
Woolf CJ,
Corey DP
(2001)
Transport and localization of the DEG/ENaC ion channel BNaC1
to peripheral mechanosensory terminals of dorsal root ganglia neurons.
J Neurosci
21:2678-2686[Abstract/Free Full Text]. -
Gold MS
(1999)
Tetrodotoxin-resistant Na+ currents and inflammatory hyperalgesia.
Proc Natl Acad Sci USA
96:7645-7649[Abstract/Free Full Text].
-
Habelt C,
Kessler F,
Distler C,
Kress M,
Reeh PW
(2000)
Interactions of inflammatory mediators and low pH not influenced by capsazepine in rat cutaneous nociceptors.
NeuroReport
11:973-976[Web of Science][Medline].
-
Humblot N,
Esteve L,
Burgun C,
Aunis D,
Zwiller J
(1997)
5-Hydroxytryptamine induces TIS8/egr-1 and c-fos expression in PC12 cells. Involvement of tyrosine protein phosphorylation.
Eur J Neurosci
9:84-92[Web of Science][Medline].
-
Hu-Tsai M,
Woolf C,
Winter J
(1996)
Influence of inflammation or disconnection from peripheral target tissue on the capsaicin sensitivity of rat dorsal root ganglion sensory neurones.
Neurosci Lett
203:119-122[Web of Science][Medline].
-
Ince TA,
Scotto KW
(1995)
A conserved downstream element defines a new class of RNA polymerase II promoters.
J Biol Chem
270:30249-30252[Abstract/Free Full Text].
-
Issberner U,
Reeh PW,
Steen KH
(1996)
Pain due to tissue acidosis: a mechanism for inflammatory and ischemic myalgia?
Neurosci Lett
208:191-194[Web of Science][Medline].
-
Jacobus WE,
Taylor GJ,
Hollis DP,
Nunnally RL
(1977)
Phosphorus nuclear magnetic resonance of perfused working rat hearts.
Nature
265:756-758[Medline].
-
Krishtal OA,
Pidoplichko VI
(1981)
Receptor for protons in the membrane of sensory neurons.
Brain Res
214:150-154[Web of Science][Medline].
-
Lewin GR,
Mendell LM
(1993)
Nerve growth factor and nociception.
Trends Neurosci
16:353-359[Web of Science][Medline].
-
Lingueglia E,
de Weille JR,
Bassilana F,
Heurteaux C,
Sakai H,
Waldmann R,
Lazdunski M
(1997)
A modulatory subunit of acid sensing ion channels in brain and dorsal root ganglion cells.
J Biol Chem
272:29778-29783[Abstract/Free Full Text].
-
Mantovani R
(1998)
A survey of 178 NF-Y binding CCAAT boxes.
Nucleic Acids Res
26:1135-1143[Abstract/Free Full Text].
-
McCleskey EW,
Gold MS
(1999)
Ion channels of nociception.
Annu Rev Physiol
61:835-856[Web of Science][Medline].
-
McMahon SB
(1996)
NGF as a mediator of inflammatory pain.
Philos Trans R Soc Lond B Biol Sci
351:431-440[Web of Science][Medline].
-
McMahon SB,
Lewin GR,
Wall PD
(1993)
Central hyperexcitability triggered by noxious inputs.
Curr Opin Neurobiol
3:602-610[Medline].
-
Mössner R,
Lesch KP
(1998)
Role of serotonin in the immune system and in neuroimmune interactions.
Brain Behav Immun
12:249-271[Web of Science][Medline].
-
Neumann S,
Doubell TP,
Leslie T,
Woolf CJ
(1996)
Inflammatory pain hypersensitivity mediated by phenotypic switch in myelinated primary sensory neurons.
Nature
384:360-364[Medline].
-
Olson TH,
Riedl MS,
Vulchanova L,
Ortiz-Gonzalez XR,
Elde R
(1998)
An acid sensing ion channel (ASIC) localizes to small primary afferent neurons in rats.
NeuroReport
9:1109-1113[Web of Science][Medline].
-
Pesole G,
Grillo G,
Larizza A,
Liuni S
(2000)
The untranslated regions of eukaryotic mRNAs: structure, function, evolution and bioinformatic tools for their analysis.
Brief Bioinform
1:236-249[Abstract/Free Full Text].
-
Petersen M,
Segond von Banchet G,
Heppelmann B,
Koltzenburg M
(1998)
Nerve growth factor regulates the expression of bradykinin binding sites on adult sensory neurons via the neurotrophin receptor p75.
Neuroscience
83:161-168[Web of Science][Medline].
-
Petruska JC,
Napaporn J,
Johnson RD,
Gu JG,
Cooper BY
(2000)
Subclassified acutely dissociated cells of rat DRG: histochemistry and patterns of capsaicin-, proton-, and ATP-activated currents.
J Neurophysiol
84:2365-2379[Abstract/Free Full Text].
-
Price MP,
McIlwrath SL,
Xie J,
Cheng C,
Qiao J,
Tarr DE,
Sluka KA,
Brennan TJ,
Lewin GR,
Welsh MJ
(2001)
The DRASIC cation channel contributes to the detection of cutaneous touch and acid stimuli in mice.
Neuron
32:1071-1083[Web of Science][Medline].
-
Putland RA,
Sassinis TA,
Harvey JS,
Diamond P,
Coles LS,
Brown CY,
Goodall GJ
(2002)
RNA destabilization by the granulocyte colony-stimulating factor stem-loop destabilizing element involves a single stem-loop that promotes deadenylation.
Mol Cell Biol
22:1664-1673[Abstract/Free Full Text].
-
Quandt K,
Frech K,
Karas H,
Wingender E,
Werner T
(1995)
MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res
23:4878-4884[Abstract/Free Full Text].
-
Rang HP,
Bevan S,
Dray A
(1991)
Chemical activation of nociceptive peripheral neurones.
Br Med Bull
47:534-548[Abstract/Free Full Text].
-
Reeh PW,
Steen KH
(1996)
Tissue acidosis in nociception and pain.
Prog Brain Res
113:143-151[Web of Science][Medline].
-
Ristimaki A,
Garfinkel S,
Wessendorf J,
Maciag T,
Hla T
(1994)
Induction of cyclooxygenase-2 by interleukin-1 alpha. Evidence for post-transcriptional regulation.
J Biol Chem
269:11769-11775[Abstract/Free Full Text].
-
Rush AM,
Brau ME,
Elliott AA,
Elliott JR
(1998)
Electrophysiological properties of sodium current subtypes in small cells from adult rat dorsal root ganglia.
J Physiol (Lond)
511:771-789[Abstract/Free Full Text].
-
Steen KH,
Reeh PW
(1993)
Sustained graded pain and hyperalgesia from harmless experimental tissue acidosis in human skin.
Neurosci Lett
154:113-116[Web of Science][Medline].
-
Steen KH,
Anton F,
Reeh PW,
Handwerker HO
(1990)
Sensitization and selective excitation by protons of nociceptive nerve endings in rat skin, in vitro.
Pflügers Arch
415:R106.
-
Steen KH,
Reeh PW,
Anton F,
Handwerker HO
(1992)
Protons selectively induce lasting excitation and sensitization to mechanical stimulation of nociceptors in rat skin, in vitro.
J Neurosci
12:86-95[Abstract].
-
Steen KH,
Issberner U,
Reeh PW
(1995)
Pain due to experimental acidosis in human skin: evidence for nonadapting nociceptor excitation.
Neurosci Lett
199:29-32[Web of Science][Medline].
-
Stroebel M,
Goppelt-Struebe M
(1994)
Signal transduction pathways responsible for serotonin-mediated prostaglandin G/H synthase expression in rat mesangial cells.
J Biol Chem
269:22952-22957[Abstract/Free Full Text].
-
Stucky CL,
Abrahams LG,
Seybold VS
(1998)
Bradykinin increases the proportion of neonatal rat dorsal root ganglion neurons that respond to capsaicin and protons.
Neuroscience
84:1257-1265[Web of Science][Medline].
-
Sutherland SP,
Cook SP,
McCleskey EW
(2000)
Chemical mediators of pain due to tissue damage and ischemia.
Prog Brain Res
129:21-38[Medline].
-
Sutherland SP,
Benson CJ,
Adelman JP,
McCleskey EW
(2001)
Acid-sensing ion channel 3 matches the acid-gated current in cardiac ischemia-sensing neurons.
Proc Natl Acad Sci USA
98:711-716[Abstract/Free Full Text].
-
Szallasi A,
Blumberg PM
(1999)
Vanilloid (capsaicin) receptors and mechanisms.
Pharmacol Rev
51:159-212[Abstract/Free Full Text].
-
Taiwo YO,
Levine JD
(1992)
Serotonin is a directly-acting hyperalgesic agent in the rat.
Neuroscience
48:485-490[Web of Science][Medline].
-
Tominaga M,
Caterina MJ,
Malmberg AB,
Rosen TA,
Gilbert H,
Skinner K,
Raumann BE,
Basbaum AI,
Julius D
(1998)
The cloned capsaicin receptor integrates multiple pain-producing stimuli.
Neuron
21:531-543[Web of Science][Medline].
-
Voilley N,
de Weille J,
Mamet J,
Lazdunski M
(2001)
Nonsteroid anti-inflammatory drugs inhibit both the activity and the inflammation-induced expression of acid-sensing ion channels in nociceptors.
J Neurosci
21:8026-8033[Abstract/Free Full Text].
-
Waldmann R,
Lazdunski M
(1998)
H(+)-gated cation channels: neuronal acid sensors in the NaC/DEG family of ion channels.
Curr Opin Neurobiol
8:418-424[Web of Science][Medline].
-
Waldmann R,
Champigny G,
Voilley N,
Lauritzen I,
Lazdunski M
(1996)
The mammalian degenerin MDEG, an amiloride-sensitive cation channel activated by mutations causing neurodegeneration in Caenorhabditis elegans.
J Biol Chem
271:10433-10436[Abstract/Free Full Text].
-
Waldmann R,
Champigny G,
Bassilana F,
Heurteaux C,
Lazdunski M
(1997a)
A proton-gated cation channel involved in acid-sensing.
Nature
386:173-177[Medline].
-
Waldmann R,
Bassilana F,
de Weille J,
Champigny G,
Heurteaux C,
Lazdunski M
(1997b)
Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons.
J Biol Chem
272:20975-20978[Abstract/Free Full Text].
-
Watkins LR,
Wiertelak EP,
Goehler LE,
Smith KP,
Martin D,
Maier SF
(1994)
Characterization of cytokine-induced hyperalgesia.
Brain Res
654:15-26[Web of Science][Medline].
-
Waxman SG,
Dib-Hajj S,
Cummins TR,
Black JA
(1999a)
Sodium channels and pain.
Proc Natl Acad Sci USA
96:7635-7639[Abstract/Free Full Text].
-
Waxman SG,
Cummins TR,
Dib-Hajj S,
Fjell J,
Black JA
(1999b)
Sodium channels, excitability of primary sensory neurons, and the molecular basis of pain.
Muscle Nerve
22:1177-1187[Web of Science][Medline].
-
Woolf CJ
(1996)
Phenotypic modification of primary sensory neurons: the role of nerve growth factor in the production of persistent pain.
Philos Trans R Soc Lond B Biol Sci
351:441-448[Web of Science][Medline].
-
Woolf CJ,
Costigan M
(1999)
Transcriptional and posttranslational plasticity and the generation of inflammatory pain.
Proc Natl Acad Sci USA
96:7723-7730[Abstract/Free Full Text].
-
Zur KB,
Oh Y,
Waxman SG,
Black JA
(1995)
Differential up-regulation of sodium channel alpha- and beta 1-subunit mRNAs in cultured embryonic DRG neurons following exposure to NGF.
Brain Res Mol Brain Res
30:97-105[Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/222410662-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
X. Liu, L. He, L. Stensaas, B. Dinger, and S. Fidone
Adaptation to chronic hypoxia involves immune cell invasion and increased expression of inflammatory cytokines in rat carotid body
Am J Physiol Lung Cell Mol Physiol,
February 1, 2009;
296(2):
L158 - L166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yoshiyama, H. Kobayashi, I. Araki, S. Du, H. Zakoji, and M. Takeda
Sex-related differences in activity of lower urinary tract in response to intravesical acid irritation in decerebrate unanesthetized mice
Am J Physiol Regulatory Integrative Comp Physiol,
September 1, 2008;
295(3):
R954 - R960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Guerios, Z.-Y. Wang, K. Boldon, W. Bushman, and D. E. Bjorling
Blockade of NGF and trk receptors inhibits increased peripheral mechanical sensitivity accompanying cystitis in rats
Am J Physiol Regulatory Integrative Comp Physiol,
July 1, 2008;
295(1):
R111 - R122.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C H Knowles and Q Aziz
Visceral hypersensitivity in non-erosive reflux disease
Gut,
May 1, 2008;
57(5):
674 - 683.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Drummond, S. C. Grifoni, and N. L. Jernigan
A New Trick for an Old Dogma: ENaC Proteins as Mechanotransducers in Vascular Smooth Muscle
Physiology,
February 1, 2008;
23(1):
23 - 31.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Duan, L.-J. Wu, Y.-Q. Yu, Y. Ding, L. Jing, L. Xu, J. Chen, and T.-L. Xu
Upregulation of Acid-Sensing Ion Channel ASIC1a in Spinal Dorsal Horn Neurons Contributes to Inflammatory Pain Hypersensitivity
J. Neurosci.,
October 10, 2007;
27(41):
11139 - 11148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Benoliel, J. Epstein, E. Eliav, R. Jurevic, and S. Elad
Orofacial Pain in Cancer: Part I--Mechanisms
Journal of Dental Research,
June 1, 2007;
86(6):
491 - 505.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. D. Nicol and M. R. Vasko
Unraveling the Story of NGF-mediated Sensitization of Nociceptive Sensory Neurons: ON or OFF the Trks?
Mol. Interv.,
February 1, 2007;
7(1):
26 - 41.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Mousa, B. P. Cheppudira, M. Shaqura, O. Fischer, J. Hofmann, R. Hellweg, and M. Schafer
Nerve growth factor governs the enhanced ability of opioids to suppress inflammatory pain
Brain,
February 1, 2007;
130(2):
502 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Su, Q. Li, K. Shrestha, E. Cormet-Boyaka, L. Chen, P. R. Smith, E. J. Sorscher, D. J. Benos, S. Matalon, and H.-L. Ji
Interregulation of Proton-gated Na+ Channel 3 and Cystic Fibrosis Transmembrane Conductance Regulator
J. Biol. Chem.,
December 1, 2006;
281(48):
36960 - 36968.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Poirot, T. Berta, I. Decosterd, and S. Kellenberger
Distinct ASIC currents are expressed in rat putative nociceptors and are modulated by nerve injury
J. Physiol.,
October 1, 2006;
576(1):
215 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-Z. Wang, X.-P. Chu, M.-H. Li, J. Seeds, R. P. Simon, and Z.-G. Xiong
Modulation of Acid-sensing Ion Channel Currents, Acid-induced Increase of Intracellular Ca2+, and Acidosis-mediated Neuronal Injury by Intracellular pH
J. Biol. Chem.,
September 29, 2006;
281(39):
29369 - 29378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Chanda and J. S. Mogil
Sex differences in the effects of amiloride on formalin test nociception in mice
Am J Physiol Regulatory Integrative Comp Physiol,
August 1, 2006;
291(2):
R335 - R342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Gu and L.-Y. Lee
Characterization of acid signaling in rat vagal pulmonary sensory neurons
Am J Physiol Lung Cell Mol Physiol,
July 1, 2006;
291(1):
L58 - L65.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ettaiche, E. Deval, M. Cougnon, M. Lazdunski, and N. Voilley
Silencing Acid-Sensing Ion Channel 1a Alters Cone-Mediated Retinal Function
J. Neurosci.,
May 24, 2006;
26(21):
5800 - 5809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Chen, H. Kalbacher, and S. Grunder
Interaction of Acid-sensing Ion Channel (ASIC) 1 with the Tarantula Toxin Psalmotoxin 1 is State Dependent
J. Gen. Physiol.,
February 27, 2006;
127(3):
267 - 276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Drummond, M. M. Furtado, S. Myers, S. Grifoni, K. A. Parker, A. Hoover, and D. E. Stec
ENaC proteins are required for NGF-induced neurite growth
Am J Physiol Cell Physiol,
February 1, 2006;
290(2):
C404 - C410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Deval, V. Friend, C. Thirant, M. Salinas, M. Jodar, M. Lazdunski, and E. Lingueglia
Regulation of Sensory Neuron-specific Acid-sensing Ion Channel 3 by the Adaptor Protein Na+/H+ Exchanger Regulatory Factor-1
J. Biol. Chem.,
January 20, 2006;
281(3):
1796 - 1807.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. W. Jones III, L. Xu, and G. F. Gebhart
The Mechanosensitivity of Mouse Colon Afferent Fibers and Their Sensitization by Inflammatory Mediators Require Transient Receptor Potential Vanilloid 1 and Acid-Sensing Ion Channel 3
J. Neurosci.,
November 23, 2005;
25(47):
10981 - 10989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Mogil, N. M. Breese, M.-F. Witty, J. Ritchie, M.-L. Rainville, A. Ase, N. Abbadi, C. L. Stucky, and P. Seguela
Transgenic Expression of a Dominant-Negative ASIC3 Subunit Leads to Increased Sensitivity to Mechanical and Inflammatory Stimuli
J. Neurosci.,
October 26, 2005;
25(43):
9893 - 9901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. Christensen, M. Kochukov, T. A. McNearney, G. Taglialatela, and K. N. Westlund
Proton-sensing G protein-coupled receptor mobilizes calcium in human synovial cells
Am J Physiol Cell Physiol,
September 1, 2005;
289(3):
C601 - C608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sugiura, K. Dang, K. Lamb, K. Bielefeldt, and G. F. Gebhart
Acid-Sensing Properties in Rat Gastric Sensory Neurons from Normal and Ulcerated Stomach
J. Neurosci.,
March 9, 2005;
25(10):
2617 - 2627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. P. Price, R. J. Thompson, J. O. Eshcol, J. A. Wemmie, and C. J. Benson
Stomatin Modulates Gating of Acid-sensing Ion Channels
J. Biol. Chem.,
December 17, 2004;
279(51):
53886 - 53891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. G. Jones, R. Slater, H. Cadiou, P. McNaughton, and S. B. McMahon
Acid-Induced Pain and Its Modulation in Humans
J. Neurosci.,
December 1, 2004;
24(48):
10974 - 10979.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-J. Wu, B. Duan, Y.-D. Mei, J. Gao, J.-G. Chen, M. Zhuo, L. Xu, M. Wu, and T.-L. Xu
Characterization of Acid-sensing Ion Channels in Dorsal Horn Neurons of Rat Spinal Cord
J. Biol. Chem.,
October 15, 2004;
279(42):
43716 - 43724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-P. Chu, J. A. Wemmie, W.-Z. Wang, X.-M. Zhu, J. A. Saugstad, M. P. Price, R. P. Simon, and Z.-G. Xiong
Subunit-Dependent High-Affinity Zinc Inhibition of Acid-Sensing Ion Channels
J. Neurosci.,
October 6, 2004;
24(40):
8678 - 8689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Liu, T. Yang, M. J. Bruno, O. S. Andersen, and S. A. Simon
Voltage-Gated Ion Channels in Nociceptors: Modulation by cGMP
J Neurophysiol,
October 1, 2004;
92(4):
2323 - 2332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A Scott, K M Khan, C R Roberts, J L Cook, and V Duronio
What do we mean by the term "inflammation"? A contemporary basic science update for sports medicine
Br. J. Sports Med.,
June 1, 2004;
38(3):
372 - 380.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Deval, M. Salinas, A. Baron, E. Lingueglia, and M. Lazdunski
ASIC2b-dependent Regulation of ASIC3, an Essential Acid-sensing Ion Channel Subunit in Sensory Neurons via the Partner Protein PICK-1
J. Biol. Chem.,
May 7, 2004;
279(19):
19531 - 19539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Wemmie, M. W. Coryell, C. C. Askwith, E. Lamani, A. S. Leonard, C. D. Sigmund, and M. J. Welsh
Overexpression of acid-sensing ion channel 1a in transgenic mice increases acquired fear-related behavior
PNAS,
March 9, 2004;
101(10):
3621 - 3626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mamet, M. Lazdunski, and N. Voilley
How Nerve Growth Factor Drives Physiological and Inflammatory Expressions of Acid-sensing Ion Channel 3 in Sensory Neurons
J. Biol. Chem.,
December 5, 2003;
278(49):
48907 - 48913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Coric, P. Zhang, N. Todorovic, and C. M. Canessa
The Extracellular Domain Determines the Kinetics of Desensitization in Acid-sensitive Ion Channel 1
J. Biol. Chem.,
November 14, 2003;
278(46):
45240 - 45247.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|