 |
Previous Article | Next Article 
The Journal of Neuroscience, February 1, 2002, 22(3):698-707
Process Outgrowth of Oligodendrocytes Is Promoted by Interaction
of Fyn Kinase with the Cytoskeletal Protein Tau
Corinna
Klein1,
Eva-Maria
Krämer1,
Anne-Marie
Cardine2,
Burkhardt
Schraven2,
Roland
Brandt1, and
Jacqueline
Trotter1
Departments of 1 Neurobiology and
2 Immunology, University of Heidelberg, 69120 Heidelberg,
Germany
 |
ABSTRACT |
Fyn kinase plays an important role during myelination and has been
shown to promote morphological differentiation of cultured oligodendrocytes. We analyzed the downstream targets of Fyn kinase in
oligodendrocytes. Because process outgrowth and wrapping of axons
involve cytoskeletal rearrangement, we focused on cytoskeletal proteins
linked to Fyn. Here we demonstrate that Fyn binds to the cytoskeletal
proteins Tau and -Tubulin in oligodendrocytes. Tau interacts with
the Fyn SH3 domain whereas -Tubulin binds to the Fyn SH2 and SH3
domains. To study the function of the Fyn-Tau interaction in
oligodendrocytes, we designed a Tau deletion mutant that would compete
with endogenous Tau-Fyn binding in transfected cells. The mutant Tau
protein binds to the Fyn SH3 domain but lacks the microtubuli
interaction domain and thus cannot bind to microtubuli. In the presence
of the mutant Tau protein, a reduction of the process number and
process length in oligodendroglial cells was observed. This effect is
likely to be caused by interference with the Fyn-Tau-microtubuli
cascade rather than inactivation of the kinase, because Fyn bound to
the mutant Tau retains activity. A similar inhibition of process
outgrowth was observed when oliogodendroglial cells were cultured in
the presence of Fumonisin B1, an inhibitor of sphingolipid synthesis
that prevents the formation of rafts. Because ligation of the cell
adhesion molecule F3 on oligodendrocytes leads to activation of Fyn
kinase localized in rafts, these findings suggest that recruitment of
Tau and Tubulin to activated Fyn kinase in rafts is an important step
in the initiation of myelination.
Key words:
myelination; oligodendrocytes; Fyn kinase; cytoskeleton; Tau; glycosphingolipid-rich rafts
 |
INTRODUCTION |
The myelination of axons by
oligodendrocytes involves the coordinated recognition of the axonal
surface, ensheathment of the axonal process, and ultimately compaction
of the wrappings of oligodendroglial membrane to generate the myelin
sheath. The interplay of the adhesion molecules expressed by
oligodendrocytes and axons as well as the downstream signal
transduction cascades mediating these complex cellular interactions
still remain primarily unelucidated (Pedraza et al., 2001 ).
Substantial evidence exists that Fyn expressed by oligodendrocytes
plays an important role in myelination. Mice deficient for Fyn kinase
are hypomyelinated (Umemori et al., 1994 ; Sperber and McMorris, 2001 ;
Sperber et al., 2001 ). In addition, knock-in mice expressing a
kinase-defective Fyn protein that cannot be activated because of a
mutation in the ATP-binding site of Fyn show severe myelination defects
(Sperber et al., 2001 ). Inhibition of the Fyn activity in cultured
oligodendrocytes using kinase inhibitors or dominant negative Fyn
constructs inhibited the process outgrowth of the cells (Osterhout et
al., 1999 ). We have shown that in oligodendrocytes [as in neurons
(Zisch et al., 1995 )] the F3 adhesion molecule is complexed to the
Src-family tyrosine kinase Fyn and that this association takes place
within glycosphingolipid (gsl)/cholesterol-rich microdomains (Kramer et
al., 1999 ), generally called rafts (Simons and Ikonen, 1997 ).
Antibody-mediated cross-linking of F3 on the cell surface of the
oligodendroglial cell line Oli-neu leads to the activation of Fyn
kinase exclusively within the rafts (Kramer et al., 1999 ). All of these
experiments raise the question of the identity of downstream targets of
Fyn. Fyn shares a common domain structure with all nine Src-family
members, including the protein binding domains SH2 (binding to
phosphorylated tyrosine moieties) and SH3 [recognizing a core
consensus sequence of PXXP (for review, see Thomas and Brugge, 1997 )].
Because process outgrowth involves cytoskeletal rearrangements, Fyn
kinase is likely to be linked directly or indirectly to the cell cytoskeleton.
The microtubule-associated protein Tau interacts with components
of the neuronal plasma membrane in addition to microtubules (Brandt et
al., 1995 ; Maas et al., 2000 ). Tau induces microtubule assembly and
bundle formation leading to process formation (for review, see Brandt,
1996 ). In a neuroblastoma cell line, Tau has been shown to associate
with the Fyn SH3 domain (Lee et al., 1998 ). Tau is expressed primarily
by neurons but is expressed additionally by oligodendrocytes in
vivo and in vitro (LoPresti et al., 1995 , 2001 ; Muller
et al., 1997 ; Richter-Landsberg and Gorath, 1999 ; Richter-Landsberg,
2000 ; Song et al., 2001b ).
In this report we show that in oligodendrocytes Fyn is associated with
Tau and -Tubulin. Overexpression of a Tau deletion protein in
cultured oligodendrocytes reduces the length and number of processes,
most likely by disrupting Fyn-Tau binding. Inhibition of gsl synthesis
and consequently raft formation similarly inhibits process outgrowth of
oligodendrocytes. These results demonstrate that the interaction of Fyn
and Tau is an important component of oligodendroglial process growth.
Furthermore, activation of raft-associated Fyn may be a critical factor
initiating the recruitment and rearrangement of cytoskeletal components
such as Tau and Tubulin to the site of process outgrowth.
 |
MATERIALS AND METHODS |
Animals. NMRI mice of both sexes were obtained
from the central animal facilities of the University of Heidelberg.
Materials and antibodies.
L-[35S]-Met/Cys
in vitro labeling mix,
[32P]-ATP, and ECL reagents were from
Amersham Biosciences (Braunschweig, Germany); human recombinant
PDGF(AA) and bFGF were from TEBU (Frankfurt, Germany); Triton X-100,
NP-40, and Na-deoxycholate were from Sigma (Deisenhofen,
Germany); Protein A-Sepharose CL4B was from Amersham Biosciences
(Freiburg, Germany); Bradford reagent for protein assays was from
Bio-Rad (München, Germany); and polyvinylidene difluoride (PVDF)
membrane was from Millipore (Bedford, MA).
The following rabbit polyclonal antibodies were used: against F3
[Ig-fraction of a serum raised against the N-terminal F3 peptide (Koch
et al., 1997 )], against Fyn and Lyn (Santa Cruz, Heidelberg, Germany),
and Tau [pNtau, raised against a recombinant human Tau comprising
amino acids (aa) 1-223]. The following monoclonal antibodies were
used: murine monoclonal antibody against Fyn (BD Transduction
Laboratories, Heidelberg, Germany), murine antibodies against
-Tubulin (DM1A; Sigma, Munich, Germany) and against the Myc epitope,
clone 9E10 (Sigma), murine antibodies against Tau [Tau-5, BD
Bioscience, PharMingen, Heidelberg, Germany; Tau-1 (Binder et al.,
1985 )], and murine monoclonal antibody O4 recognizing a late stage of
oligodendroglial progenitors and mature oligodendrocytes (Sommer and
Schachner, 1981 ; Trotter and Schachner, 1989). Secondary antibodies
were from Dianova (Hamburg, Germany).
Primary cell cultures and metabolic labeling. Primary
cultures of oligodendrocytes were prepared from embryonic day 14-16 mice as described (Sontheimer et al., 1989 ; Trotter et al., 1989 ). In
short, oligodendrocytes growing on top of astrocyte monolayers were
shaken off and plated in modified Sato medium (Trotter et al., 1989 )
containing 1% horse serum (HS) on
poly-L-lysine-coated dishes. To promote survival
of the cells, 10 ng/ml human recombinant platelet-derived growth factor
(AA) and 5 ng/ml basic fibroblast growth factor were added immediately
after plating and after 24 hr in vitro. Oligodendrocytes
were kept for 5 d in vitro without additional growth
factors before harvesting. The resulting population is enriched for
differentiated oligodendrocytes but contains a fraction of progenitor
cells (Trotter and Schachner, 1989). The cell line Oli-neu (Jung et
al., 1995 ) was cultured in Sato medium containing 1% HS. For metabolic
labeling, primary oligodendrocytes or transient transfected cells were
incubated for 1 hr in SO4/Met/Cys-free DMEM and
further incubated for 4 hr with 100 µCi/ml
L-[35S]Met/Cys.
All samples were analyzed by SDS-PAGE, and radioactive protein bands
were detected by a Phosphoimager (Fuji Bas 1000; Fuji Medical
Systems USA Inc., Stanford, CA).
Immunofluorescence. For double staining of primary
oligodendrocytes with the oligodendroglial markers O4, myelin
associated glycoprotein (MAG), AN2, and Tau or Fyn, cells on
coverslips were fixed in 4% paraformaldehyde, blocked, and
incubated with the primary antibody in blocking solution (1% BSA/PBS)
for 30 min. The cells were permeabilized for 10 min with 0.1% Triton
X-100, fixed for 10 min, and incubated with Tau or Fyn antibodies and subsequently with labeled secondary antibodies and mounted in Moviol.
Cells were analyzed by fluorescence light microscopy (Axiophot; Zeiss,
Göttingen, Germany).
Preparation of detergent extracts and sucrose density gradient
centrifugation. Detergent extracts were prepared as described (Kramer et al., 1999 ). In brief, primary oligodendrocytes (2-3 × 106) were suspended at 4°C in 0.5 ml
extraction buffer: 150 mM NaCl, 80 mM
Na2HPO4 2×
H2O, 17 mM
NaH2PO4 × H2O, pH 7.2, 1 mM PMSF, and
2% NP-40 (PBS/NP-40). The extracts were shaken for 30 min at 4°C.
Detergent extracts were adjusted to 40% sucrose by adding equal
volumes of 80% sucrose in PBS/NP-40 and loaded into an ultracentrifuge tube. A step gradient of 30 and 10% or a continuous gradient of 30 to
5% sucrose was layered on top of the lysate. Gradients were centrifuged for 12 hr at 35,000 rpm at 4°C in a Beckman SW 40 TI
rotor or Beckman SW 60 TI rotor (218,000 × g). The
floating fraction (raft fraction) and the bottom fractions (non-raft
fraction) were harvested. Light gradient fractions containing floating
GPI-anchored proteins, glycosphingolipids, and cholesterol
(rafts) were collected, diluted with ddH2O, and
pelleted for 1 hr at 218,000 × g and 4°C. Isolated
rafts were subjected to SDS-PAGE, immunoblotting, and immunoprecipitation.
Immunoblotting. Proteins were blotted onto PVDF membrane
(Amersham Biosciences), which was incubated in 4% milk powder/0.05% Tween in PBS. Proteins were detected by incubation with primary antibodies overnight at 4°C. The blots were incubated with a second anti-species antibody conjugated with HRP for 30-60 min at room temperature. The blots were developed with ECL reagents (Amersham Biosciences) according to the manufacturer's instructions.
In some cases, membranes were stripped with 100 mM glycine,
pH 2, for 30 min, blocked, and reprobed with antibodies.
Immunoprecipitation. Isolated raft fractions and non-raft
fractions were resuspended in 0.5 ml PBS/NP-40 buffer, precleared with
protein A-Sepharose, incubated with antibodies overnight at 4°C on a
head-over-tail rotator for 2 hr with protein A-Sepharose, and washed
three times under stringent conditions in RIPA-buffer (50 mM Tris/HCl, pH 7.4, 1% Triton X-100, 1%
Na-deoxycholate, 0.1% SDS, 1 mM
dithioerythnol) containing phosphatase inhibitors (100 µM
Na3VO4, 10 mM NaF) and once with PBS. The
immunoprecipitations were subjected to SDS-PAGE and immunoblotting.
In vitro kinase assay. Immune complexes were
resuspended in 50 µl kinase buffer (20 mM HEPES, pH 7.4, 5 mM MgCl2, 1 mM
MnCl2, 100 µM
Na3VO4) and incubated with
2 µCi [32P]-ATP for 30 min at
37°C. The samples were washed and subjected to SDS-PAGE and autoradiography.
Expression of glutathione S-transferase-Fyn
constructs and binding assay. Glutathione S-transferase
(GST)-Fyn-SH3 cDNA and GST-Fyn-SH2 cDNA were prepared as described
(Marie-Cardine et al., 1995 ), GST-Amphiphysin-SH3 was kindly provided
by Dr. A. Schmidt (CNRS, Paris, France). GST fusion proteins
were prepared and purified as described (Smith and Johnson, 1988 ). For
precipitation of interacting partners, primary oligodendrocytes were
lysed in PBS/NP-40 and shaken for 30 min at 4°C. To free the
postnuclear lysates from proteins binding unspecifically to GST
Sepharose beads, samples were incubated with GST-Sepharose beads for 1 hr at 4°C before incubation with GST-Fyn-SH3, GST-Fyn-SH2 or
GST-Amphiphysin-SH3 Sepharose beads overnight at 4°C (preclear). The
precipitates were washed with RIPA buffer and subjected to SDS-Page and immunoblotting.
Construction of Tau deletion mutants. Eukaryotic expression
plasmids were constructed in the pCMV vector (Invitrogen, Groningen, The Netherlands). Inserts for all plasmids were obtained by PCR using cDNA from adult rat brain. PCR primers contained restriction sites, a Kozak sequence, and stop codons as needed. A myc tag was added
to the amino terminal end. The following oligonucleotides were used to
generate the deletion constructs: Tau forward:
GCGAATTCAAAGACATGGCTGAACCCCGCCAGGAGTTTGACATGGCTGAACCCCGCCAGGAG; Tau reverse +PXXP: CGCAAGCTTCTAACTGGCAGACGGTGACTTAGG; Tau reverse PXXP: CGCAAGCTTCTAAACCACTGCCACCTTTTTGGGCTC.
The constructs were verified by sequencing. Plasmids prepared for the
studies were as follows: pCMV + PXXP: myc tag and adult rat Tau from
amino acid 1-227 containing the SH3 binding motif for Fyn; pCMV
PXXP: myc tag and adult rat Tau from amino acid 1-223 lacking the
SH3 binding motif for Fyn.
Transfection and analysis of transfected cells. Oli-neu
cells (Jung et al., 1995 ) were released from the culture dishes with trypsin. Primary oligodendrocytes were transfected directly after shaking. For each electroporation, 1.5 × 106 Oli-neu cells or 3-4 × 106 primary oligodendrocytes were used.
Fifteen micrograms of DNA of Tau plasmids were used in each
electroporation. Tau plasmids were cotransfected with the pCMV-enhanced
green fluorescent protein (EGFP) plasmid (2 µg DNA; Clontech
Heidelberg, Germany) to control electroporation and identify positive
cells. Transient transfected cells were analyzed live using an inverted
fluorescent microscope (Leitz, DM IRB; Leica, Bensheim, Germany) with
an attached digital camera (Quantics Photometrics; Visitron Systems,
Puckheim, Germany) and the software IPlab 3.2.2. (Scananalytics,
Inc., Visitron Systems). The number of processes per cell and the
process length were measured for Oli-neu cells and primary
oligodendrocytes. Processes longer than half the diameter of the cell
soma were included in the measurements. In each experiment, 50-100
EGFP-positive Oli-neu cells or 30-50 EGFP-positive primary
oligodendrocytes were analyzed. Three individual experiments per cell
type were performed. The data were pooled, and a nonparametric
Mann-Whitney rank sum test was applied to analyze the results because
it cannot be assumed that the number and length of cellular processes
follow a Gaussian distribution.
Inhibition of sphingolipid synthesis in Oli-neu cells with
Fumonisin B1. Oli-neu cells were incubated for up to 5 d with
50 µM Fumonisin B1 (FB1) (Sigma). Cells were
passaged on the third day and incubated in the presence of FB1 for 2 more days. For recovery, Oli-neu cells, after 5 d of culture with
FB1, were washed twice with Sato 1% HS and incubated for 2 additional
days. Cells were fixed with 2.5% glutaraldehyde for 1 hr and
stained with toluidine blue to visualize processes.
Lipid analysis. Primary oligodendrocytes were treated with
50 µM FB1 directly after the shake for 5 d
and subjected to continuous sucrose density gradient separation (see
above). As controls, untreated primary oligodendrocytes were analyzed.
From each gradient fraction lipids were extracted (Bligh and Dyer,
1957 ), and dried samples were dissolved in 10-20 µl of
chloroform/methanol (1:1, w/v) and spotted on activated Silica Gel 60 F254 plates (Merck, Darmstadt, Germany). After
resolution of the lipids in
chloroform/methanol/H2O (65:25:4, v/v),
the plates were air dried and lipids were visualized after exposure of
the plates to 10% sulfuric acid, 5% methanol, and charring.
 |
RESULTS |
Oligodendrocytes in culture express Tau and Fyn
Primary oligodendrocyte cultures enriched in mature
oligodendrocytes were costained with antibodies to the oligodendroglial markers AN2/NG2, O4, and MAG, and pNTau antibody (Fig.
1A). All AN2/NG2-positive oligodendrocyte progenitor cells were strongly Tau
positive (Fig. 1A,a,b).
Approximately 70% of all O4-positive oligodendrocytes were stained
with pNTau (Fig.
1A,c,d). Cell somata as
well as primary membrane processes were strongly Tau positive, whereas
very small processes and the process tips were less stained. The same
distribution was observed when the cultures were stained with
antibodies to MAG and pNTau (Fig.
1A,e,f). These
results are in agreement with previously published data (LoPresti et
al., 1995 ; Muller et al., 1997 ) and demonstrate that cultured
oligodendroglial precursor cells and more mature oligodendrocytes
express Tau.

View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
Cultured oligodendrocytes express Tau.
A, Immunofluorescence staining. Primary oligodendrocytes
were stained with antibodies to oligodendroglial markers and Tau
(a-f) or with Fyn and Tau
(g, h). All AN2-positive
oligodendrocyte precursor cells (a) stain for Tau
(b). Tau is expressed in the cell soma as well as
in the processes. Primary oligodendrocytes were costained with
antibodies to the oligodendroglial markers O4 (c)
or MAG (e) and Tau (d, f).
Cell somata as well as large membrane processes are positive for Tau,
whereas the tips of very small processes are unstained. O4 and MAG
staining are distributed all over the cell surface including small
processes and membrane protrusions. B, Western blot
analysis. Both primary oligodendrocytes (pr. OL)
and the precursor cell line Oli-neu express Tau. Cell lysates of
Oli-neu cells (lanes 1, 3) and primary
oligodendrocytes (lanes 2, 4) were
resolved by SDS-PAGE and immunoblotted with the antibodies Tau-5
(lanes 1, 2) recognizing an unphosphorylated epitope and Tau-1 (lanes
3, 4) recognizing a dephosphorylated
serine at aa 199 (human nomenclature). Several isoforms are detected by
both antibodies running between 45 and 65 kDa. Oli-neu cells may
express additional isoforms compared with primary oligodendrocytes, or
alternatively the isoforms are subjected to different posttranslational
modifications. wb, Western blot.
|
|
Fyn is expressed by oligodendrocytes as shown previously (Umemori et
al., 1994 ; Kramer et al., 1999 ; Osterhout et al., 1999 ). Fyn expression
was observed in the cell body as well as in the tips of the processes
and is coexpressed with Tau in the main processes and in the soma (Fig.
1A,g,h).
Many isoforms of Tau have been reported (Goedert et al., 1989 ). Western
blots on oligodendroglial cell lysates showed that several isoforms of
molecular weights between 45 and 66 kDa can be detected (Fig.
1B). The oligodendroglial cell line Oli-neu appeared
to express additional bands of higher molecular weight compared with
primary oligodendrocytes; whether these are additional Tau isoforms or
modifications (e.g., phosphorylation) of the isoforms present in
primary cells is not clear.
Fyn associates with Tau and Tubulin in
primary oligodendrocytes
Fyn is known to be tightly associated with other proteins in
a functional signaling complex in T cells (Marie-Cardine et al., 1995 ;
Marie-Cardine and Schraven, 1999 ; Marie-Cardine et al., 1999 ) and is
associated with GPI-anchored adhesion molecules in oligodendrocytes in
rafts (Kramer et al., 1999 ). Rafts can be collected as
detergent-insoluble membrane domains from light fractions of sucrose
density gradients (raft fractions), whereas other cellular components
accumulate in bottom fractions (non-raft fractions). To determine
downstream partners of Fyn in oligodendrocytes, immunoprecipitations with antibodies against Fyn were performed from raft and non-raft fractions and assayed by Western blot for coprecipitating candidate proteins (Fig. 2, lanes 1,
2). Tau and  Tubulin were associated with the Fyn
immunoprecipitates from both raft and non-raft fractions (Fig. 2).
These interactions were resistant to high-stringency washing. Lyn
(another Src family member) did not coprecipitate with Fyn (Fig. 2,
lanes 1, 2), although it is present in total raft
fractions (and also non-raft fractions; lanes 3,
4). This demonstrates that Fyn interacts in a
specific complex with Tau and Tubulin. Vice versa, Tau
immunoprecipitates from total lysates of primary oligodendrocytes also
contained Fyn (data not shown).

View larger version (46K):
[in this window]
[in a new window]
|
Figure 2.
Fyn is associated with Tau and Tubulin in
primary oligodendrocytes. Raft fractions and bottom gradient fractions
of sucrose density gradients from primary oligodendrocytes were
subjected to immunoprecipitation (IP) using antibodies
to Fyn followed by SDS-PAGE (lanes 1, 2)
or were analyzed directly by SDS-PAGE (lanes 3,
4) followed by Western blot (wb)
analysis using monoclonal antibodies against Fyn, Lyn, Tau, and
-Tubulin. Fyn associates with Tau and -Tubulin in the raft
fraction as well as in the bottom gradient fraction. Lyn, which is also
found in the raft fraction (Lyn, lane 3),
is not associated with this complex, either in the raft fraction
(lane 1) or in the non-raft fraction (lane
2).
|
|
The Fyn SH3 and SH2 domains are sites of interaction with
cytoskeletal proteins
To analyze the Fyn-Tau and Fyn-Tubulin interaction in more
detail and to identify the regions of Fyn that are involved,
precipitation assays were performed using GST fusion proteins of the
Fyn-SH2 and Fyn-SH3 protein interaction domains. The Western blot
analysis of these precipitations with antibodies against Tau or Tubulin revealed that Tau binds specifically to the GST-Fyn-SH3 fusion protein, whereas -Tubulin binds to both GST-Fyn-SH3 and
GST-Fyn-SH2 fusion proteins (Fig. 3).
The binding is specific for the Fyn-SH3 domain because neither Tau nor
-Tubulin binds to a GST fusion protein of the Amphiphysin-SH3 domain
or GST alone (Fig. 3).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 3.
The SH3 and SH2 domains of Fyn interact with
cytoskeletal proteins. Primary oligodendrocyte lysates were incubated
with the different GST-fusion proteins and subjected to SDS-PAGE
followed by Western blot analysis (wb). Tau precipitates
specifically with fusion proteins containing the SH3 domain of Fyn
(lane 4); -Tubulin precipitates with the
fusion proteins containing the SH2 or SH3 domain of Fyn (lanes
3, 4). Neither Tau nor -Tubulin binds
to the SH3 domain of Amphiphysin (lane 2) or to GST
alone (lane 1).
|
|
Reduction of process number and process length in oligodendroglial
cells after expression of a Fyn-binding Tau deletion protein
We subsequently addressed the function of the Fyn-Tau interaction
in living cells. Previous studies (Lee et al., 1998 ) had delineated the
last of seven PXXP motives on Tau as the functional and sufficient
Fyn-SH3 binding motif. We thus generated two Tau deletion mutant cDNA
constructs by RT-PCR (Fig.
4A): one dominant negative construct (+PXXP; amino acid 1-227 of rat Tau), which should
disrupt the endogenous Tau-Fyn interaction when overexpressed in
cells, and a control construct ( PXXP; amino acids 1-223 of rat Tau)
lacking the Fyn binding motif, which should not interfere with the
Fyn-Tau interaction. Both constructs were tagged at the N terminus
with a myc epitope to allow discrimination of the mutant protein from
endogenous Tau. To demonstrate that the constructs function as
expected, Oli-neu cells were transfected with the Tau deletion
constructs, and the truncated myc Tau proteins were immunoprecipitated
from metabolically labeled cells using anti-myc antibodies. As
expected, endogenous Fyn coimmunoprecipitates with the +PXXP Tau
protein, whereas it does not coprecipitate with PXXP Tau (Fig.
4B). The transfection efficiency and expression level
of each cDNA construct within the analyzed cells were equal, as shown
by anti-myc Western blots on an equal number of cells (Fig.
4B, bottom panel). Myc precipitates
of Oli-neu cells that were transfected with the +PXXP construct
contained substantial Fyn kinase activity evidenced by
autophosphorylation of Fyn in a kinase assay, whereas myc precipitates
from cells transfected with the PXXP construct or vector alone
(MOCK) did not (Fig. 4C, lanes
1-3). Active Fyn kinase is also immunoprecipitated with endogenous Tau from lysates of untransfected cells (lane
4). In conclusion, +PXXP Tau binds Fyn in the transfected
cells and is thus likely to act as a competitor of the endogenous
Tau-Fyn interaction.

View larger version (51K):
[in this window]
[in a new window]
|
Figure 4.
Tau deletion protein +PXXP bearing the
Fyn binding motif binds to active Fyn. A, Design of the
two rat Tau deletion mutants and model of action. a,
PXXP (aa 1-223), lacking the Fyn SH3 binding motif on Tau;
b, +PXXP (aa 1-227), including the Fyn SH3 binding
motif (PXXP). Both constructs carry a myc tag at the N
terminus. When overexpressed in oligodendroglial cells, the +PXXP Tau
protein competes with endogenous Tau for Fyn binding. Because the +PXXP
Tau protein is lacking the microtubuli (MT)
binding domain, the Fyn-Tau-Tubulin cascade is disrupted
(b). In contrast, when the PXXP control protein
is overexpressed in these cells, the interaction cascade is preserved
(a). B, Immunoprecipitation of
radiolabeled Oli-neu cells with antibodies to myc. Oli-neu cells
expressing either the +PXXP or PXXP Tau protein were metabolically
labeled with 35S-methionine/cysteine and subjected to
immunoprecipitation (IP) with antibodies against myc
followed by SDS-PAGE and Phosphoimager analysis. From cells
expressing the +PXXP construct, a signal for Fyn at 59 kDa is seen
(top panel, arrow, lane
1). From cells expressing the PXXP construct, no signal is
seen (lane 2). Equal numbers of transfected cells were
loaded on SDS-PAGE and analyzed by Western blot (wb)
with antibodies against myc (bottom panel),
demonstrating a similar expression level of each Tau mutant.
C, Kinase assays on the myc immunoprecipitates. Oli-neu
cells were transiently transfected with +PXXP (lane 1),
PXXP (lane 2), or empty vector (MOCK;
lane 3) and were subjected to immunoprecipitation with
antibodies to myc. As a control, untransfected Oli-neu cells were
subjected to immunoprecipitation with antibodies to Tau (lane
4) and Fyn (lane 5). An in
vitro kinase assay was performed on the precipitates followed
by SDS-PAGE and autoradiography. A strong signal for
phosphorylated and thus active Fyn is present in the myc precipitates
from cells expressing the +PXXP construct (lane 1) and
in the Tau immunoprecipitates (lane 4).
|
|
Each of the deletion constructs was cotransfected with an EGFP plasmid
(15:1 ratio) in Oli-neu cells or primary oligodendrocytes to facilitate
visualization of the transfected cells. Staining of fixed cells with
myc antibodies confirmed that every EGFP-positive cell also expressed
the truncated myc Tau protein (data not shown).
The myc Tau overexpressing cells were analyzed by measuring the number
and length of the cellular processes. In Oli-neu cells, the number of
processes of +PXXP Tau overexpressing cells was reduced compared with
cells overexpressing PXXP Tau (Fig.
5A,a) (p < 0.0001). Analysis of the process revealed
that the +PXXP overexpressing cells have shorter processes (reduction
of 16%) compared with PXXP overexpressing cells (Fig.
5A,b) (p = < 0,0001). In transfected primary oligodendrocytes the effects were
even more striking. The process length of +PXXP expressing primary cells is reduced by 49% versus PXXP expressing cells (Fig.
5B,b) (p < 0.0001). Untransfected control cells and MOCK transfected cells
appeared similar to the PXXP expressing cells. The reduction of
process growth is most likely caused by the disruption of the Fyn-Tau
interaction and not an inactivation of Fyn kinase, because Fyn activity
is retained in +PXXP overexpressing cells (Fig. 4C).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 5.
Inhibition of the interaction between Fyn and Tau
decreases process number and process length in oligodendroglial cells.
Oli-neu cells (A) or primary oligodendrocytes
(B) were transfected with the Tau deletion
constructs PXXP and +PXXP and cultured for 1 d. The process
length and number of processes were analyzed. Processes longer than
half the diameter of the cell soma were included in the measurements.
Three individual experiments were performed, and the data were
summarized and analyzed by the Mann-Whitney rank sum test. Oli-neu
cells (A,a;
p < 0.0001) as well as primary oligodendrocytes
(B,a; p < 0.0001) expressing the +PXXP construct have fewer processes compared
with the PXXP transfected controls. The process length of +PXXP
transfected Oli-neu cells is reduced by 16%
(A,b; p < 0.0001), and the process length of +PXXP transfected primary
oligodendrocytes is reduced by 49%
(B,b; p < 0.0001) compared with PXXP expressing cells and untransfected
(UT) or MOCK transfected cells.
|
|
In summary, Oli-neu cells as well as primary oligodendrocytes
expressing the +PXXP Tau protein have fewer and shorter processes compared with cells expressing the PXXP Tau. These results thus suggest that the Fyn-Tau interaction in oligodendroglial cells is
important for the generation and elaboration of cellular processes.
Inhibiting gsl synthesis and thus raft formation prevents process
outgrowth of Oli-neu cells
Because Fyn kinase activity linked to the cell adhesion molecule
F3 is restricted to rafts in oligodendroglial cells, we studied the
involvement of rafts in process outgrowth. We made use of the fungal
toxin FB1, which inhibits sphingolipid synthesis (Merrill et al.,
1993b ) and completely abolishes the formation of rafts in
oligodendroglial cells (Fig.
6A).

View larger version (95K):
[in this window]
[in a new window]
|
Figure 6.
Inhibition of glycosphingolipid synthesis prevents
raft formation in oligodendrocytes and inhibits process growth in
Oli-neu cells. A, Distribution of NCAM protein and
lipids on gradients of FB1-treated oligodendrocytes. a,
Primary oligodendrocytes were cultured for 5 d with Fumonisin B1
(FB1) and fractionated on sucrose density gradients. The
fractions were collected and analyzed by Western blot with antibodies
against NCAM (a) or were subjected to lipid
extraction and analyzed by TLC (b). Fraction
(Frakt.) 1 is the bottom gradient fraction. In cells
cultured in the presence of FB1, the GPI-anchored NCAM form NCAM 120 is
no longer localized in the raft fraction as is seen in the untreated
cells (a), but is entirely present in the
non-raft fraction. b, FB1-treated primary
oligodendrocytes do not synthesize sphingolipids. No signal for
galactocerebroside (GalC) or Sulfatide
(Sulf) can be detected in lipids of FB1-treated
cells in comparison with control cells. Chol,
Cholesterol; PE, phosphatidylethanolamine;
SM, sphingomyelin. B, FB1 inhibits
process outgrowth of Oli-neu cells. a, Oli-neu cells
were cultured for 3 d with FB1 (+) or without FB1 ( ). Raft
fractions and non-raft fractions were collected from sucrose density
gradients and subjected to SDS-PAGE followed by Western blot analysis
with antibodies against Tau. Culture in FB1 results in the absence of
Tau from low density gradient fractions; in untreated cells Tau is
localized in rafts in these gradient fractions. Oli-neu cells were
cultured in the absence of (b) or in the presence
of (c) 50 µm FB1 for several days (see Material
and Methods). After 5 d in culture in FB1 including one passage,
the cells are almost lacking processes (c).
Nevertheless they are still alive, because after further culture (2 d)
in the absence of FB1 the cells recover and regenerate processes
(d).
|
|
When primary oligodendrocytes were cultured in the presence of FB1 for
several days, the GPI-anchored protein adhesion protein neural cell
adhesion molecule (NCAM) 120, which is normally raft associated
(Kramer et al., 1997 , 1999 ), was absent from light gradient fractions
(Fig. 6A,a). FB1-treated cells lack
gsl, leading to a complete absence of raft lipids, including
cholesterol, from light gradient fractions (Fig.
6A,b). Incubation of Oli-neu cells with FB1 similarly inhibits raft formation, and thus Tau protein is no
longer found in light gradient fractions (Fig.
6B,a). Process outgrowth was
strongly diminished in Oli-neu cells cultured for 5 d in FB1,
including one passage (Fig. 6B,c).
This effect was reversible: 48 hr after removal of FB1 from the medium
allowing resynthesis of gsl, the cells had reestablished processes
(Fig. 6B,d), demonstrating that FB1
was not toxic to the cells. In conclusion, gsls are essential for
process outgrowth of oligodendrocytes; furthermore, the results suggest
that Fyn-Tau associations occurring in the raft compartment may be a
contributing factor.
 |
DISCUSSION |
Myelination of axons by oligodendrocytes is a multistep process.
After initial recognition of the axon by the glial process, wrapping
necessitates the coordination of myelin membrane generation and
directed process outgrowth accompanied by reorganization of the
cytoskeleton (Wilson and Brophy, 1989 ; Pfeiffer et al., 1993 ; Kramer et
al., 1997 , 2001 ; Song et al., 2001a ). In the present study we have
shown that the interaction of the Src-family tyrosine kinase Fyn and
the microtubule-binding protein Tau is an important component of
process formation by oligodendrocytes.
Fyn activity is instructive for myelination
Fyn kinase plays an important role in myelination: in myelin the
activity peaks at early postnatal stages concomitant with the
initiation of myelination in large areas of the brain (Umemori et al.,
1994 ; Kramer et al., 1999 ). Transgenic knock-in mice expressing a Fyn
protein with a nonfunctional kinase domain (Sperber et al., 2001 )
exhibit a hypomyelinated phenotype similar to Fyn-deficient mice
(Umemori et al., 1994 ), suggesting that the kinase activity of Fyn is
important. However, both groups of mice still synthesize some myelin,
suggesting the involvement of an alternative but less efficient signal
transduction pathway. Previously, we showed that Fyn is closely
associated with the GPI-anchored cell adhesion molecules F3/Contactin
and NCAM 120 in oligodendrocyte rafts and could be activated by
ligation of F3 (Kramer et al., 1999 ). In addition, Fyn was identified
as a downstream partner of L-MAG, and Fyn can be activated
via antibody-mediated cross-linking of MAG in transfected COS
cells (Umemori et al., 1994 ). However, MAG/Fyn double-deficient mice
have a more severe phenotype than the single knock-outs, indicating
that MAG and Fyn might also act independently in myelination (Biffiger
et al., 2000 ).
Recent studies have shown that oligodendrocyte progenitor cells
and more mature cells express active Fyn kinase (Kramer et al., 1999 ;
Osterhout et al., 1999 ) and that Fyn kinase activity promotes
oligodendrocyte process formation in vitro (Osterhout et
al., 1999 ; Sperber et al., 2001 ). Inhibitors of Fyn kinase and
expression of dominant negative Fyn inhibited process outgrowth in
cultured oligodendrocytes (Osterhout et al., 1999 ). Here, we have
addressed the downstream interacting partners of Fyn in oligodendrocytes.
In oligodendrocytes, Fyn interacts with Tau and Tubulin
The microtubule-binding protein Tau has been identified as a
binding partner for Fyn in neuroblastoma cells (Lee et al., 1998 ). Oligodendrocytes, in particular progenitor cells, and more mature cells
express Tau in vitro (LoPresti et al., 1995 ; Muller et al., 1997 ; Richter-Landsberg and Gorath, 1999 ; this study) and in
vivo (LoPresti et al., 1995 ; Song et al., 2001b ). Tau is expressed mainly in the cell soma and in the large processes (LoPresti et al.,
1995 ; Muller et al., 1997 ; Song et al., 2001a ; this study). Several Tau
isoforms are expressed in vivo (Goedert et al., 1991 ) and by
oligodendrocytes in vitro (Richter-Landsberg and Gorath, 1999 ; LoPresti et al., 2001 ). The function of the different isoforms is
still unelucidated, but all contain the PXXP SH3-binding motif. We
found that Fyn is associated with Tau and Tubulin in oligodendrocytes. These interactions are of high affinity, because they resist stringent washing.
We show that Fyn binds to Tau in oligodendrocyte lysates by association
of the Fyn-SH3 domain with the PXXP motif on Tau, as reported in
neuroblastoma cells (Lee et al., 1998 ), whereas -Tubulin binds to
both the Fyn SH2 and SH3 domains. The interaction of Tubulin with the
SH2 domain of Fyn has also been described in T lymphocytes
(Marie-Cardine et al., 1995 ). Tau and Tubulin do not bind to all SH3
domains, but the binding is specific for the SH3 domain of Fyn, because
neither Tau nor Tubulin bind to the SH3 domain of Amphiphysin. In Src
family kinases, the SH2 and SH3 domains together with the regulatory
tail play a central role in regulation of the kinase. In the inactive
state, the SH2 domain is bound to the regulatory tail, and the SH3
domain interacts with sequences in the catalytic domain as well as in
the linker region between the SH3 and SH2 domains (Pawson, 1997 ;
Sicheri and Kuriyan, 1997 ; Xu et al., 1997 ; Young et al., 2001 ) (for
review, see Thomas and Brugge, 1997 ). On dephosphorylation of a
tyrosine in the regulatory tail, the intramolecular interactions are
disrupted, and the full kinase activity results from
autophosphorylation of a tyrosine residue within the catalytic domain.
The kinase structure opens up, and binding of other proteins via the
SH3 and SH2 domains is now possible (Thomas and Brugge, 1997 ). Thus, activation of Fyn is required for binding to interacting partners via
the Fyn SH2 and SH3 domains. The molecular trigger for Fyn activation
in culture in the absence of neurons is unelucidated but must entail
interactions with the culture substrate.
Overexpression of a Tau deletion mutant inhibits oligodendroglial
process formation, most likely by perturbing the Tau-Fyn
interaction
We expressed two Tau deletion mutants in Oli-neu cells and primary
oligodendrocytes. Tau contains seven putative PXXP SH3 binding motives
(Cheadle et al., 1994 ; Sparks et al., 1994 ) in the amino terminal
proline-rich domain, but only the last motif is the major Fyn SH3
binding site (Lee et al., 1998 ). The deletion constructs were designed
such that one construct contained the Fyn recognition motif (+PXXP),
enabling competition with endogenous Tau for binding to Fyn, whereas
the control construct lacked this domain ( PXXP). Both constructs
lacked the microtubule-binding region. In transfected cells, the +PXXP
construct thus should interfere with endogenous Tau linking Fyn and
microtubules (Fig. 4A). We demonstrated that the
+PXXP Tau protein indeed interacts with endogenous Fyn and that the
bound Fyn retains substantial kinase activity. Oli-neu cells as well as
primary oligodendrocytes expressing +PXXP Tau exhibited a reduced
number of processes and a reduction in process length. Our results
suggest that Fyn activity not only is important for process formation
as shown by others (Osterhout et al., 1999 ; Sperber et al., 2001 ), but
that the interaction of Tau and Fyn in oligodendrocytes is a central
element. Expression of a Tau deletion mutant that binds Fyn and
should thus disrupt this association leads to reduced process number
and process length, although Fyn is still active.
Tau regulates the assembly and stability of microtubules in neurons
(for review, see Brandt, 1996 ). In the Taiep mutant rat, the polarized
orientation of microtubules (Lunn et al., 1997 ) is abnormal, and Tau
protein accumulates in the cell body and processes of oligodendrocytes,
resulting in an intracellular accumulation of myelin proteins,
hypomyelination, and progressive demyelination (Song et al., 2001a ,b ).
This study highlights the interplay of Tau and microtubules and the
importance of microtubules in the transport of vesicles containing
myelin components to the forming sheath.
Interaction of Tau and Tubulin with Fyn in raft and
non-raft compartments
Rafts are gsl- and cholesterol-rich microdomains that form in the
trans-Golgi network. They play an instructive role in
sorting proteins and lipids to specific cellular compartments and act as signal transduction platforms via selective inclusion/exclusion of
signaling components (for review, see Harder and Simons, 1997 ; Simons
and Ikonen, 1997 ; Brown and London, 2000 ; Trotter et al., 2000 ; Ikonen,
2001 ). Active Fyn is present in both raft and non-raft fractions
(Kramer et al., 1999 ), and as we show here, it can thus associate with
binding partners such as Tau and Tubulin independent of raft
association. The Tau deletion mutant would thus interfere with Fyn-Tau
interactions inside and outside rafts. However, activation of Fyn
kinase mediated by ligation of the F3 cell adhesion molecule occurs
exclusively in rafts (Kramer et al., 1999 ). Stimulation of Fyn activity
in the raft domain would lead to an increased capacity of Fyn in rafts
to bind to downstream partners including Tau and Tubulin. Cytoskeletal
elements would thus be recruited to raft domains after ligation of raft
components. In lymphocytes, the actin cytoskeleton undergoes local
rearrangement after ligation of raft components such as CD59 (Harder
and Simons, 1999 ), IgE-receptor 1 (Holowka et al., 2000 ; Foger et al.,
2001 ), and the T cell receptor at the immunological synapse (for
review, see Viola and Lanzavecchia, 1999 ).
Disruption of rafts reduces process outgrowth
in oligodendrocytes
The integrity of rafts can be disrupted by manipulation of the
lipid composition either by removal of cholesterol or inhibition of the
sphingolipid synthesis using fungal toxins such as FB1 (Cerneus et al.,
1993 ; Merrill et al., 1993a ; Klein et al., 1995 ; Stevens and Tang,
1997 ; Ilangumaran and Hoessli, 1998 ). Inhibition of the sphingolipid
synthesis in oligodendroglial cells prevents the formation of rafts and
reduces process formation. The reduction of the process outgrowth
caused by FB1 is comparable to the effect seen with the Tau deletion
mutant. Recruitment of Tau (and Tubulin) to rafts after Fyn activation
would explain a role of rafts in process formation. Several studies
have shown that inhibition of sphingolipid synthesis in neurons
inhibits protein sorting and axonal and dendritic growth (Harel and
Futerman, 1993 ; Futerman et al., 1998 ; Ledesma et al., 1998 , 1999 ;
Schwarz and Futerman, 1998 ). Thus rafts may play an important role in
process formation in oligodendrocytes and neurons.
Rafts as signal transduction platforms and sites of
cytoskeletal reorganization during initial glial-axon
interaction?
Several signaling pathways are likely to cooperate in the
initiation of myelination (Biffiger et al., 2000 ), including
raft-independent signaling via MAG (Meyer-Franke and Barres, 1994 ;
Montag et al., 1994 ) and raft-dependent signaling via F3 (Kramer et
al., 1999 ). Oligodendroglial rafts are enriched in the GPI-anchored
proteins NCAM 120 and F3. They may be instrumental in orchestrating the initial axon-glial contact and may act as signaling platforms and
local sites of cytoskeletal reorganization. We suggest that in
vivo, signaling caused by ligation of glial F3 via an axonal ligand such as L1 activates oligodendroglial Fyn in the rafts, which
then recruits Tau promoting process outgrowth and strengthening the
initial axonal-glial contact. Local reorganization of the cytoskeleton
such as the polarized organization of the microtubule network toward
the contact site subsequently facilitates the directed transport of
membrane vesicles containing myelin lipids and proteins to the
expanding internode (Fig. 7).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 7.
Proposed model of the role of Fyn and Tau in
myelination. During development, oligodendrocyte processes initiate
contact with an axon. The interaction of adhesion molecules such as F3
and signaling events in both cells are necessary (1.).
Ligation of F3 by an axonal ligand activates Fyn in raft microdomains
leading to increased binding of Tau. Microtubuli
(MT) are recruited to the area of contact
(2.). Vesicular transport to the contact site is
facilitated (3.), and insertion of vesicles containing
myelin-specific lipid and proteins promotes further internodal process
elongation along and around the axon (4.).
PM, Plasma membrane; GSL,
glycosphingolipid; Chol, cholesterol.
|
|
 |
FOOTNOTES |
Received July 19, 2001; revised Oct. 3, 2001; accepted Nov. 14, 2001.
The Deutsche Forschungsgemeinschaft is thanked for financial support
(Grants SFB 317 and SFB 488 to J.T., SFB 488 to R.B.; Graduate
Kolleg Molecular and Cellular Neurobiology to C.K.).
Correspondence should be addressed to Jacqueline Trotter, Department of
Neurobiology, University of Heidelberg, Im Neuenheimer Feld 324, 69120 Heidelberg, Germany. E-mail:
jtrotter{at}sun0.urz.uni-heidelberg.de.
 |
REFERENCES |
-
Biffiger K,
Bartsch S,
Montag D,
Aguzzi A,
Schachner M,
Bartsch U
(2000)
Severe hypomyelination of the murine CNS in the absence of myelin-associated glycoprotein and fyn tyrosine kinase.
J Neurosci
20:7430-7437[Abstract/Free Full Text].
-
Binder LI,
Frankfurter A,
Rebhun LI
(1985)
The distribution of tau in the mammalian central nervous system.
J Cell Biol
101:1371-1378[Abstract/Free Full Text].
-
Bligh EG,
Dyer WJ
(1957)
A rapid method of total lipid extraction and purification.
Can J Biochem Physiol
37:911-917.
-
Brandt R
(1996)
The tau proteins in neuronal growth and development.
Front Biosci
1:d118-130[Medline].
-
Brandt R,
Leger J,
Lee G
(1995)
Interaction of tau with the neural plasma membrane mediated by tau's amino-terminal projection domain.
J Cell Biol
131:1327-1340[Abstract/Free Full Text].
-
Brown DA,
London E
(2000)
Structure and function of sphingolipid- and cholesterol-rich membrane rafts.
J Biol Chem
275:17221-17224[Free Full Text].
-
Cerneus DP,
Ueffing E,
Posthuma G,
Strous GJ,
van der Ende A
(1993)
Detergent insolubility of alkaline phosphatase during biosynthetic transport and endocytosis. Role of cholesterol.
J Biol Chem
268:3150-3155[Abstract/Free Full Text].
-
Cheadle C,
Ivashchenko Y,
South V,
Searfoss GH,
French S,
Howk R,
Ricca GA,
Jaye M
(1994)
Identification of a Src SH3 domain binding motif by screening a random phage display library.
J Biol Chem
269:24034-24039[Abstract/Free Full Text].
-
Foger N,
Marhaba R,
Zoller M
(2001)
Involvement of CD44 in cytoskeleton rearrangement and raft reorganization in T cells.
J Cell Sci
114:1169-1178[Abstract].
-
Futerman AH,
Boldin S,
Brann AB,
Schwarz A,
Zisling R
(1998)
Regulatory roles for sphingolipids in the growth of polarized neurons.
Ann NY Acad Sci
845:176-187[Web of Science][Medline].
-
Goedert M,
Spillantini MG,
Potier MC,
Ulrich J,
Crowther RA
(1989)
Cloning and sequencing of the cDNA encoding an isoform of microtubule-associated protein tau containing four tandem repeats: differential expression of tau protein mRNAs in human brain.
EMBO J
8:393-399[Web of Science][Medline].
-
Goedert M,
Crowther RA,
Garner CC
(1991)
Molecular characterization of microtubule-associated proteins tau and MAP2.
Trends Neurosci
14:193-199[Web of Science][Medline].
-
Harder T,
Simons K
(1997)
Caveolae, DIGs, and the dynamics of sphingolipid-cholesterol microdomains.
Curr Opin Cell Biol
9:534-542[Web of Science][Medline].
-
Harder T,
Simons K
(1999)
Clusters of glycolipid and glycosylphosphatidylinositol-anchored proteins in lymphoid cells: accumulation of actin regulated by local tyrosine phosphorylation.
Eur J Immunol
29:556-562[Web of Science][Medline].
-
Harel R,
Futerman AH
(1993)
Inhibition of sphingolipid synthesis affects axonal outgrowth in cultured hippocampal neurons.
J Biol Chem
268:14476-14481[Abstract/Free Full Text].
-
Holowka D,
Sheets ED,
Baird B
(2000)
Interactions between Fc(epsilon)RI and lipid raft components are regulated by the actin cytoskeleton.
J Cell Sci
113:1009-1019[Abstract].
-
Ikonen E
(2001)
Roles of lipid rafts in membrane transport.
Curr Opin Cell Biol
13:431-437[Web of Science][Medline].
-
Ilangumaran S,
Hoessli DC
(1998)
Effects of cholesterol depletion by cyclodextrin on the sphingolipid microdomains of the plasma membrane.
Biochem J
335:433-440.
-
Jung M,
Kramer E,
Grzenkowski M,
Tang K,
Blakemore W,
Aguzzi A,
Khazaie K,
Chlichlia K,
von Blankenfeld G,
Kettenmann H,
Trotter JT
(1995)
Lines of murine oligodendroglial precursor cells immortalized by an activated neu tyrosine kinase show distinct degrees of interaction with axons in vitro and in vivo.
Eur J Neurosci
7:1245-1265[Web of Science][Medline].
-
Klein U,
Gimpl G,
Fahrenholz F
(1995)
Alteration of the myometrial plasma membrane cholesterol content with beta-cyclodextrin modulates the binding affinity of the oxytocin receptor.
Biochemistry
34:13784-13793[Medline].
-
Koch T,
Brugger T,
Bach A,
Gennarini G,
Trotter J
(1997)
Expression of the immunoglobulin superfamily cell adhesion molecule F3 by oligodendrocyte-lineage cells.
Glia
19:199-212[Web of Science][Medline].
-
Kramer EM,
Koch T,
Niehaus A,
Trotter J
(1997)
Oligodendrocytes direct glycosyl phosphatidylinositol-anchored proteins to the myelin sheath in glycosphingolipid-rich complexes.
J Biol Chem
272:8937-8945[Abstract/Free Full Text].
-
Kramer EM,
Klein C,
Koch T,
Boytinck M,
Trotter J
(1999)
Compartmentation of Fyn kinase with glycosylphosphatidylinositol-anchored molecules in oligodendrocytes facilitates kinase activation during myelination.
J Biol Chem
274:29042-29049[Abstract/Free Full Text].
-
Kramer EM,
Schardt A,
Nave KA
(2001)
Membrane traffic in myelinating oligodendrocytes.
Microsc Res Tech
52:656-671[Web of Science][Medline].
-
Ledesma MD,
Simons K,
Dotti CG
(1998)
Neuronal polarity: essential role of protein-lipid complexes in axonal sorting.
Proc Natl Acad Sci USA
95:3966-3971[Abstract/Free Full Text].
-
Ledesma MD,
Brugger B,
Bunning C,
Wieland FT,
Dotti CG
(1999)
Maturation of the axonal plasma membrane requires upregulation of sphingomyelin synthesis and formation of protein-lipid complexes.
EMBO J
18:1761-1771[Web of Science][Medline].
-
Lee G,
Newman ST,
Gard DL,
Band H,
Panchamoorthy G
(1998)
Tau interacts with src-family non-receptor tyrosine kinases.
J Cell Sci
111:3167-3177[Abstract].
-
LoPresti P,
Szuchet S,
Papasozomenos SC,
Zinkowski RP,
Binder LI
(1995)
Functional implications for the microtubule-associated protein tau: localization in oligodendrocytes.
Proc Natl Acad Sci USA
92:10369-10373[Abstract/Free Full Text].
-
LoPresti P,
Muma NA,
DeVries GH
(2001)
Neu differentiation factor regulates Tau protein and mRNA in cultured neonatal oligodendrocytes.
Glia
35:147-155[Medline].
-
Lunn KF,
Baas PW,
Duncan ID
(1997)
Microtubule organization and stability in the oligodendrocyte.
J Neurosci
17:4921-4932[Abstract/Free Full Text].
-
Maas T,
Eidenmuller J,
Brandt R
(2000)
Interaction of tau with the neural membrane cortex is regulated by phosphorylation at sites that are modified in paired helical filaments.
J Biol Chem
275:15733-15740[Abstract/Free Full Text].
-
Marie-Cardine A,
Schraven B
(1999)
Coupling the TCR to downstream signalling pathways: the role of cytoplasmic and transmembrane adaptor proteins.
Cell Signal
11:705-712[Medline].
-
Marie-Cardine A,
Kirchgessner H,
Eckerskorn C,
Meuer SC,
Schraven B
(1995)
Human T lymphocyte activation induces tyrosine phosphorylation of alpha-tubulin and its association with the SH2 domain of the p59fyn protein tyrosine kinase.
Eur J Immunol
25:3290-3297[Web of Science][Medline].
-
Marie-Cardine A,
Kirchgessner H,
Schraven B
(1999)
Molecular alterations of the Fyn-complex occur as late events of human T cell activation.
Eur J Immunol
29:1175-1187[Medline].
-
Merrill Jr AH,
Wang E,
Gilchrist DG,
Riley RT
(1993a)
Fumonisins and other inhibitors of de novo sphingolipid biosynthesis.
Adv Lipid Res
26:215-234[Medline].
-
Merrill AH,
van Echten G,
Wang E,
Sandhoff K
(1993b)
Fumonisin B1 inhibits sphingosine (sphinganine) N-acyltransferase and de novo sphingolipid biosynthesis in cultured neurons in situ.
J Biol Chem
268:27299-27306[Abstract/Free Full Text].
-
Meyer-Franke A,
Barres B
(1994)
Axon myelination. Myelination without myelin-associated glycoprotein.
Curr Biol
4:847-850[Web of Science][Medline].
-
Montag D,
Giese KP,
Bartsch U,
Martini R,
Lang Y,
Bluthmann H,
Karthigasan J,
Kirschner DA,
Wintergerst ES,
Nave KA
(1994)
Mice deficient for the myelin-associated glycoprotein show subtle abnormalities in myelin.
Neuron
13:229-246[Web of Science][Medline].
-
Muller R,
Heinrich M,
Heck S,
Blohm D,
Richter-Landsberg C
(1997)
Expression of microtubule-associated proteins MAP2 and tau in cultured rat brain oligodendrocytes.
Cell Tissue Res
288:239-249[Medline].
-
Osterhout DJ,
Wolven A,
Wolf RM,
Resh MD,
Chao MV
(1999)
Morphological differentiation of oligodendrocytes requires activation of Fyn tyrosine kinase.
J Cell Biol
145:1209-1218[Abstract/Free Full Text].
-
Pawson T
(1997)
New impressions of Src and Hck.
Nature
385:582-585[Medline].
-
Pedraza L,
Huang JK,
Colman DR
(2001)
Organizing principles of the axoglial apparatus.
Neuron
30:335-344[Web of Science][Medline].
-
Pfeiffer SE,
Warrington AE,
Bansal R
(1993)
The oligodendrocyte and its many cellular processes.
Trends Cell Biol
3:191-197[Medline].
-
Richter-Landsberg C
(2000)
The oligodendroglia cytoskeleton in health and disease.
J Neurosci Res
59:11-18[Medline].
-
Richter-Landsberg C,
Gorath M
(1999)
Developmental regulation of alternatively spliced isoforms of mRNA encoding MAP2 and tau in rat brain oligodendrocytes during culture maturation.
J Neurosci Res
56:259-270[Medline].
-
Schwarz A,
Futerman AH
(1998)
Inhibition of sphingolipid synthesis, but not degradation, alters the rate of dendrite growth in cultured hippocampal neurons.
Brain Res Dev Brain Res
108:125-130[Medline].
-
Sicheri F,
Kuriyan J
(1997)
Structures of Src-family tyrosine kinases.
Curr Opin Struct Biol
7:777-785[Web of Science][Medline].
-
Simons K,
Ikonen E
(1997)
Functional rafts in cell membranes.
Nature
387:569-572[Medline].
-
Smith D,
Johnson K
(1988)
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene
67:31-40[Web of Science][Medline].
-
Sommer I,
Schachner M
(1981)
Monoclonal antibodies (O1 to O4) to oligodendrocyte cell surfaces: an immunocytological study in the central nervous system.
Dev Biol
83:311-327[Web of Science][Medline].
-
Song J,
Goetz BD,
Baas PW,
Duncan ID
(2001a)
Cytoskeletal reorganization during the formation of oligodendrocyte processes and branches.
Mol Cell Neurosci
17:624-636[Web of Science][Medline].
-
Song J,
Goetz BD,
Kirvell SL,
Butt AM,
Duncan ID
(2001b)
Selective myelin defects in the anterior medullary velum of the Taiep mutant rat.
Glia
33:1-11[Medline].
-
Sontheimer H,
Trotter J,
Schachner M,
Kettenmann H
(1989)
Channel expression correlates with differentiation stage during the development of oligodendrocytes from their precursor cells in culture.
Neuron
2:1135-1145[Web of Science][Medline].
-
Sparks AB,
Quilliam LA,
Thorn JM,
Der CJ,
Kay BK
(1994)
Identification and characterization of Src SH3 ligands from phage-displayed random peptide libraries.
J Biol Chem
269:23853-23856[Abstract/Free Full Text].
-
Sperber B,
McMorris F
(2001)
Fyn tyrosine kinase regulates oligodendroglial cell development but is not required for morphological differentiation of oligodendrocytes.
J Neurosci Res
63:303-312[Web of Science][Medline].
-
Sperber BR,
Boyle-Walsh EA,
Engleka MJ,
Gadue P,
Peterson AC,
Stein PL,
Scherer SS,
McMorris FA
(2001)
A unique role for Fyn in CNS myelination.
J Neurosci
21:2039-2047[Abstract/Free Full Text].
-
Stevens VL,
Tang J
(1997)
Fumonisin B1-induced sphingolipid depletion inhibits vitamin uptake via the glycosylphosphatidylinositol-anchored folate receptor.
J Biol Chem
272:18020-18025[Abstract/Free Full Text].
-
Thomas SM,
Brugge JS
(1997)
Cellular functions regulated by Src family kinases.
Annu Rev Cell Dev Biol
13:513-609[Web of Science][Medline].
-
Trotter J,
Bitter-Suermann D,
Schachner M
(1989)
Differentiation-regulated loss of the polysialylated embryonic form and expression of the different polypeptides of the neural cell adhesion molecule by cultured oligodendrocytes and myelin.
J Neurosci Res
22:369-383[Web of Science][Medline].
-
Trotter J,
Klein C,
Kramer E-M
(2000)
GPI-anchored proteins, glycosphingolipid-rafts: platforms for adhesion, signaling.
The Neuroscientist
6:271-284.
-
Umemori H,
Sato S,
Yagi T,
Aizawa S,
Yamamoto T
(1994)
Initial events of myelination involve Fyn tyrosine kinase signalling.
Nature
367:572-576[Medline].
-
Viola A,
Lanzavecchia A
(1999)
T-cell activation and the dynamic world of rafts.
Apmis
107:615-623[Web of Science][Medline].
-
Wilson R,
Brophy PJ
(1989)
Role for the oligodendrocyte cytoskeleton in myelination.
J Neurosci Res
22:439-448[Web of Science][Medline].
-
Xu W,
Harrison SC,
Eck MJ
(1997)
Three-dimensional structure of the tyrosine kinase c-Src.
Nature
385:595-602[Medline].
-
Young MA,
Gonfloni S,
Superti-Furga G,
Roux B,
Kuriyan J
(2001)
Dynamic coupling between the SH2 and SH3 domains of c-Src and Hck underlies their inactivation by C-terminal tyrosine phosphorylation.
Cell
105:115-126[Web of Science][Medline].
-
Zisch AH,
D'Alessandri L,
Amrein K,
Ranscht B,
Winterhalter KH,
Vaughan L
(1995)
The glypiated neuronal cell adhesion molecule contactin/F11 complexes with src-family protein tyrosine kinase Fyn.
Mol Cell Neurosci
6:263-279[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/223698-10$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
P.-S. Wang, J. Wang, Z.-C. Xiao, and C. J. Pallen
Protein-tyrosine Phosphatase {alpha} Acts as an Upstream Regulator of Fyn Signaling to Promote Oligodendrocyte Differentiation and Myelination
J. Biol. Chem.,
November 27, 2009;
284(48):
33692 - 33702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. White, C. Gonsior, E.-M. Kramer-Albers, N. Stohr, S. Huttelmaier, and J. Trotter
Activation of oligodendroglial Fyn kinase enhances translation of mRNAs transported in hnRNP A2-dependent RNA granules
J. Cell Biol.,
October 17, 2008;
181(4):
579 - 586.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Miyamoto, J. Yamauchi, and A. Tanoue
Cdk5 Phosphorylation of WAVE2 Regulates Oligodendrocyte Precursor Cell Migration through Nonreceptor Tyrosine Kinase Fyn
J. Neurosci.,
August 13, 2008;
28(33):
8326 - 8337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Dubois-Dalcq, A. Williams, C. Stadelmann, B. Stankoff, B. Zalc, and C. Lubetzki
From fish to man: understanding endogenous remyelination in central nervous system demyelinating diseases
Brain,
July 1, 2008;
131(7):
1686 - 1700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Reynolds, C. J. Garwood, S. Wray, C. Price, S. Kellie, T. Perera, M. Zvelebil, A. Yang, P. W. Sheppard, I. M. Varndell, et al.
Phosphorylation Regulates Tau Interactions with Src Homology 3 Domains of Phosphatidylinositol 3-Kinase, Phospholipase C{gamma}1, Grb2, and Src Family Kinases
J. Biol. Chem.,
June 27, 2008;
283(26):
18177 - 18186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Williamson, A. Usardi, D. P. Hanger, and B. H. Anderton
Membrane-bound {beta}-amyloid oligomers are recruited into lipid rafts by a fyn-dependent mechanism
FASEB J,
May 1, 2008;
22(5):
1552 - 1559.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Beacham, M. Ahn, W. A. Catterall, and T. Scheuer
Sites and Molecular Mechanisms of Modulation of NaV1.2 Channels by Fyn Tyrosine Kinase
J. Neurosci.,
October 24, 2007;
27(43):
11543 - 11551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. B. Werner, K. Kuhlmann, S. Shen, M. Uecker, A. Schardt, K. Dimova, F. Orfaniotou, A. Dhaunchak, B. G. Brinkmann, W. Mobius, et al.
Proteolipid Protein Is Required for Transport of Sirtuin 2 into CNS Myelin
J. Neurosci.,
July 18, 2007;
27(29):
7717 - 7730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N. Fewou, H. Ramakrishnan, H. Bussow, V. Gieselmann, and M. Eckhardt
Down-regulation of Polysialic Acid Is Required for Efficient Myelin Formation
J. Biol. Chem.,
June 1, 2007;
282(22):
16700 - 16711.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lee, M. Gravel, R. Zhang, P. Thibault, and P. E. Braun
Process outgrowth in oligodendrocytes is mediated by CNP, a novel microtubule assembly myelin protein
J. Cell Biol.,
August 15, 2005;
170(4):
661 - 673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Derkinderen, T. M. E. Scales, D. P. Hanger, K.-Y. Leung, H. L. Byers, M. A. Ward, C. Lenz, C. Price, I. N. Bird, T. Perera, et al.
Tyrosine 394 Is Phosphorylated in Alzheimer's Paired Helical Filament Tau and in Fetal Tau with c-Abl as the Candidate Tyrosine Kinase
J. Neurosci.,
July 13, 2005;
25(28):
6584 - 6593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Zamora-Leon, A. Bresnick, J. M. Backer, and B. Shafit-Zagardo
Fyn Phosphorylates Human MAP-2c on Tyrosine 67
J. Biol. Chem.,
January 21, 2005;
280(3):
1962 - 1970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Lu, L. Ku, Y. Chen, and Y. Feng
Developmental Abnormalities of Myelin Basic Protein Expression in fyn Knock-out Brain Reveal a Role of Fyn in Posttranscriptional Regulation
J. Biol. Chem.,
January 7, 2005;
280(1):
389 - 395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Laurent, F. J. Delfino, H. Y. Cheng, and T. E. Smithgall
The Human c-Fes Tyrosine Kinase Binds Tubulin and Microtubules through Separate Domains and Promotes Microtubule Assembly
Mol. Cell. Biol.,
November 1, 2004;
24(21):
9351 - 9358.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liang, N. A. Draghi, and M. D. Resh
Signaling from Integrins to Fyn to Rho Family GTPases Regulates Morphologic Differentiation of Oligodendrocytes
J. Neurosci.,
August 11, 2004;
24(32):
7140 - 7149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kawarabayashi, M. Shoji, L. H. Younkin, L. Wen-Lang, D. W. Dickson, T. Murakami, E. Matsubara, K. Abe, K. H. Ashe, and S. G. Younkin
Dimeric Amyloid {beta} Protein Rapidly Accumulates in Lipid Rafts followed by Apolipoprotein E and Phosphorylated Tau Accumulation in the Tg2576 Mouse Model of Alzheimer's Disease
J. Neurosci.,
April 14, 2004;
24(15):
3801 - 3809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Decker and C. ffrench-Constant
Lipid Rafts and Integrin Activation Regulate Oligodendrocyte Survival
J. Neurosci.,
April 14, 2004;
24(15):
3816 - 3825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. AVILA, J. J. LUCAS, M. PEREZ, and F. HERNANDEZ
Role of Tau Protein in Both Physiological and Pathological Conditions
Physiol Rev,
April 1, 2004;
84(2):
361 - 384.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lee, R. Thangavel, V. M. Sharma, J. M. Litersky, K. Bhaskar, S. M. Fang, L. H. Do, A. Andreadis, G. Van Hoesen, and H. Ksiezak-Reding
Phosphorylation of Tau by Fyn: Implications for Alzheimer's Disease
J. Neurosci.,
March 3, 2004;
24(9):
2304 - 2312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Setterblad, C. Roucard, C. Bocaccio, J.-P. Abastado, D. Charron, and N. Mooney
Composition of MHC class II-enriched lipid microdomains is modified during maturation of primary dendritic cells
J. Leukoc. Biol.,
July 1, 2003;
74(1):
40 - 48.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Stegmuller, H. Werner, K.-A. Nave, and J. Trotter
The Proteoglycan NG2 Is Complexed with alpha -Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors by the PDZ Glutamate Receptor Interaction Protein (GRIP) in Glial Progenitor Cells. IMPLICATIONS FOR GLIAL-NEURONAL SIGNALING
J. Biol. Chem.,
January 31, 2003;
278(6):
3590 - 3598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-H. Cho and G. V. W. Johnson
Glycogen Synthase Kinase 3beta Phosphorylates Tau at Both Primed and Unprimed Sites. DIFFERENTIAL IMPACT ON MICROTUBULE BINDING
J. Biol. Chem.,
January 3, 2003;
278(1):
187 - 193.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|

|