 |
Previous Article | Next Article 
The Journal of Neuroscience, 2002, 22:RC209:1-5
RAPID COMMUNICATION
Lack of Tumor Necrosis Factor-Related Apoptosis-Inducing
Ligand But Presence of Its Receptors in the Human Brain
Jan
Dörr1, *,
Ingo
Bechmann2, *,
Sonia
Waiczies1, *,
Orhan
Aktas1,
Henning
Walczak3,
Peter H.
Krammer4,
Robert
Nitsch2, *, and
Frauke
Zipp1, *
1 Department of Neurology, Division of Neuroimmunology
and 2 Institute of Anatomy, Department of Cell- and
Neurobiology, Charité Neuroscience Research Center, 10098 Berlin,
Germany, and Divisions of 3 Apoptosis Regulation and
4 Immunogenetics, Tumour Immunology, German Cancer Research
Center, 69009 Heidelberg, Germany
 |
ABSTRACT |
Apoptosis mediated by members of the tumor necrosis factor
(TNF)-nerve growth factor superfamily plays a crucial role in
the interaction of the nervous and the immune system. On the one hand, it is involved in the defense mechanisms of the brain, the immune privilege. On the other hand, it is involved in the induction of
glial-neuronal cell death in neuroinflammatory diseases. Here, we show
that in contrast to the other known death ligands, TNF-related apoptosis-inducing ligand (TRAIL) is not constitutively expressed in
the human brain, whereas both apoptosis-mediating and
apoptosis-blocking TRAIL receptors are found on neurons, astrocytes,
and oligodendrocytes. Thus, the brain differs from other
immune-privileged organs, such as the placenta, with the TRAIL
receptor-TRAIL system not being part of the immune privilege of the
brain. Conversely, this death receptor-ligand system might well play
an important role in T cell-mediated autoimmune diseases of the
CNS such as multiple sclerosis.
Key words:
TRAIL; TRAIL receptor; apoptosis; immune privilege; brain; MS
 |
INTRODUCTION |
The
CNS is an immune-privileged organ like the placenta, anterior chamber
of the eye, and testes. One mechanism of maintaining immune privilege
is that invading T cells undergo apoptosis (Pender et al., 1991 ;
Schmied et al., 1993 ), mediated via death receptor-ligand interactions. This was shown for both the tumor necrosis factor (TNF)
receptor-TNF (Bachmann et al., 1999 ) and the CD95-CD95 ligand (Gold
et al., 1997 ; Bechmann et al., 1999 , 2000 ; Flügel et al., 2000 )
systems. Furthermore, as a potent inducer of apoptosis, TNF-related
apoptosis-inducing ligand (TRAIL, also known as APO-2L) (Wiley et al.,
1995 ; Pitti et al., 1996 ), a member of the TNF superfamily, has been
demonstrated to be involved in providing and maintaining immune
privilege in human placenta (Phillips et al., 1999 ). For TRAIL, both
apoptosis-inducing and nonapoptosis-inducing membrane-bound receptors
have been described. The ability for transmission of a death signal is
restricted to TRAIL receptor 1 (TRAIL-R1, DR4) (Pan et al., 1997a ) and
TRAIL-R2 (DR5) (Sheridan et al., 1997 ; Walczak et al., 1997 ). TRAIL-R3
(DcR1, TRID) and TRAIL-R4 (DcR2, TRUNDD) are truncated and have been
suggested to act as decoy receptors by binding TRAIL without
transmitting a death signal, thereby inhibiting apoptosis (Sheridan et
al., 1997 ; Pan et al., 1997b ; Degli-Esposti et al., 1997a ,b ).
Depending on the localization of the ligand and its receptors, the
TRAIL system can act in two ways: death ligands expressed on resident
parenchymal cells can induce apoptosis in infiltrating lymphocytes, or
conversely, infiltrating lymphocytes may induce apoptosis in resident
parenchymal cells via death ligands. The TRAIL receptor-TRAIL system
thus could play a role in the control of T cell invasion as well as
their destructive actions in the brain. Because of its
particular properties, including membranous expression of
apoptosis-mediating and apoptosis-blocking receptors and
apoptosis-independent antiproliferative mechanisms (Song et al., 2000 ;
Hilliard et al., 2001 ), this system might be involved in the
pathogenesis of T cell-mediated autoimmune diseases such as multiple
sclerosis (MS). In fact, TRAIL was found to be upregulated in
peripheral immune cells of MS patients (Huang et al., 2000 ). Upregulation of TRAIL on human antigen-specific T cells after activation (Wendling et al., 2000 ), as well as the induction of apoptosis in acute brain slices after TRAIL application (Nitsch et al.,
2000 ), further indicate a possible role for this system in
glial-neuronal damage in T cell-mediated disorders such as MS.
In this study, RT-PCR, Western blot analysis, and double-labeling
immunocytochemistry were applied to study the expression of TRAIL and
the distribution of its membrane-bound receptors on the transcriptional
and translational level in human brain tissue obtained from individuals
undergoing craniotomy because of epilepsy. Whereas TRAIL expression was
not detected in the brain, both apoptosis-inducing and
nonapoptosis-inducing receptors were found.
 |
MATERIALS AND METHODS |
Cell lines, brain, and placenta tissues. CV-1/EBNA
cells were purchased from American Type Culture Collection (Manassas,
VA) and were cultured in DMEM. The medium was supplemented with
10% fetal bovine serum, 5 mM
L-glutamine, 100 U/ ml penicillin, and 100 µg/ml streptomycin. Cells were kept at 37°C in a 5%
CO2 atmosphere.
Because no antibody available achieved staining in postmortem tissue,
all human brain tissue samples (n = 10) used in this study were fresh ex vivo material obtained from four
different individuals undergoing temporal lobe resection because of
epilepsy. Tissue was either frozen in liquid nitrogen and stored at
80°C or immediately taken up in RNA isolation buffer (see
"RT-PCR"). Human placenta was used as positive control. Fresh
placenta was washed in PBS and thereafter stored at 80°C.
RT-PCR. Total RNA was isolated according to standard
protocols using the PeqGold TriFast isolation kit (Peqlab, Erlangen, Germany). Fresh brain tissue was taken up in TriFast reagent and separated by syringe and cannula. Frozen brain material (to confirm data) and placenta were ground in a mortar in the presence of liquid
nitrogen to avoid RNA degradation and subsequently taken up in the
TriFast reagent. Contamination with genomic DNA was excluded by
performing DNA-digestion using DNase I (Boehringer Mannheim, Mannheim,
Germany). Subsequently, RNA was quantified photometrically by
absorbance at 260 nm. We used 1 µg of RNA as a template for
random-primed cDNA synthesis using a first-strand cDNA synthesis kit
(Pharmacia Biotech, Freiburg, Germany). To exclude amplification
of any remaining genomic DNA, a no-RT control was
performed. A negative control without template cDNA was run with every
PCR. No specific PCR signal was detected under these control
conditions. PCR was accomplished in a final volume of 50 µl using a
recombinant Taq polymerase kit (Invitrogen, Karlsruhe, Germany). The PCR conditions were as follows:
glyceraldehyde-3-phosphate-dehydrogenase (G3PDH): 26 cycles, 45 sec/95°C, 45 sec/54°C, 60 sec/72°C, primer sequences
GTCAACGGATTTGGTCGTATT and AGTCTTCTGGGTGGCAGTGAT (NM002046, nucleotides 97-118 and 616-636); TRAIL-R1: 35 cycles, 45 sec/95°C, 45 sec/60°C, 60 sec/72°C, primer sequences
ACTCGCTGTCCACTTTCGTCTCTGA and CATCCCCTGGGCCTGCTGCTGTA (U90875,
nucleotides 911-935 and 1200-1219); TRAIL-R2: 35 cycles, 45 sec/95°C, 45 sec/60°C, 60 sec/72°C, primer sequences
GGGAGCCGCTCATGAGGAAGTT and CTGGGTGATGTTGGATGGGAGAGT (AF012535,
nucleotides 1113-1134 and 1495-1518); TRAIL-R3: 33 cycles, 45 sec/95°C, 45 sec/72°C, 45 sec/72°C, primer sequences GAAGAATTTGGTGCCAATGCCACT and CTCTTGGACTTGGCTGGGAGATGT (AF016267, nucleotides 638-662 and 1224-1248); TRAIL-R4: 32 cycles, 45 sec/95°C, 45 sec/64°C, 60 sec/72°C, primer sequences
CAACTGGTGGGCTCCGAAAAG and ACCGCATGTGGCCTAAAACGAC (AF029761, nucleotides
11175-1195 and 1500-1521); TRAIL: 26 cycles, 45 sec/95°C, 45 sec/55°C, 60 sec/72°C, primer sequences CACATTGTCTTCTCCAAACTC and
GTCCATGTCTATCAAGTGCTC (U37518, nucleotides 489-509 and 874-894). As a
control for TRAIL expression, an additional primer set was used as
described by Frank et al. (1999) , 30 cycles, 45 sec/95°C, 45 sec/52°C, 60 sec/72°C, primer sequences TGGGACCAGAGGAAGAAG and
TTGGGAATAGATGTA (U37518, nucleotides 467-485 and 634-648).
Antibody specificity. Specificity of antibodies was tested
using CV-1/EBNA cells selectively expressing solely TRAIL or one of its
receptors, respectively. CV-1/EBNA cells were transiently cotransfected
essentially as described (Walczak et al., 1997 ). Here, we transfected
the cells on cover slides and used a mix of three different plasmids in
each transfection: (1) either one of the following five plasmids:
pCDNA3 (Invitrogen, San Diego, CA) or pCDNA3.1 that encoded full-length
human TRAIL-R1 to -R4 or full-length human TRAIL, respectively; (2) a
plasmid that encodes the anti-apoptotic Baculovirus protein p35, and
(3) pSV3-Neo that encodes the large T antigen necessary for the
replication of pCDNA3 in CV-1/EBNA cells. Forty-eight hours after
transfection, the cells were washed twice with PBS and were then fixed
for 10 min at room temperature in PBS containing 4% paraformaldehyde.
Last, the cells were washed again twice with PBS, and the cover slides were then dried and stored at room temperature. The cells were subjected to immunocytochemical stainings using the same antibodies and
fluorescence labeling protocol as used for immunocytochemical stainings
of human brain slices (see below).
Western blot. Triton-X protein extracts were obtained by
homogenization of frozen brain tissue in the presence of protease inhibitors (0.5 µg/ml leupeptin, 1 µg/ml pepstatin, and 0.2 mM phenylmethylsulfonyl fluoride), centrifugation
at 1000 × g for 10 min to remove nuclei and
undissolved material, and a further 20 min centrifugation at
17,000 × g. Homogenization and protein handling were
always performed in a 4°C environment. Lysates equivalent to 50 µg
of protein, as determined by the bicinchoninic acid (BCA) method
(Pierce, Rockford, IL), were separated using 10% polyacrylamide gel
electrophoresis and blotted onto nitrocellulose membranes using
standard procedures. After 2 hr incubation at room temperature in a blocking cocktail (5% milk powder, 2% BSA in 0.01 M Tris-HCl, and 0.1% Tween 20), membranes were
incubated overnight at 4°C or for 1 hr at room temperature with the
following specific primary antibodies: polyclonal rabbit anti-TRAIL-R1
(AB1139 from Alexis, San Diego, CA) and polyclonal rabbit anti-TRAIL-R2
(AB16942 from Chemicon, Hofheim, Germany) were used at a concentration
of 2 µg/ml, polyclonal goat anti-TRAIL-R3 (210-744-R100 from Alexis) at 1 µg/ml, and polyclonal rabbit anti-TRAIL-R4 (AB16943 from Chemicon International) at 1 µg/ml. Antibodies were diluted in solutions of blocking buffer in PBS-Tween 20. After a series of washing steps, the membranes were incubated for 1 hr with 1.3 µg/ml
anti-rabbit secondary antibody or 0.17 µg/ml anti-goat secondary antibody, coupled to horseradish peroxidase (both Dako, Hamburg, Germany). Specific bands were detected using the ECL-plus system (Amersham Pharmacia Biotech, Uppsala, Sweden).
Immunocytochemistry. Directly after removal from the skull
(brain) or postpartum (placenta), the tissue was fixed in 4%
paraformaldehyde in 0.1 M phosphate buffer (PB)
for 6 hr at 4°C. Twenty-micrometer-thick sections were cut on a
vibratome. These sections were then incubated in 10%
H2O2 for 10 min to block
endogenous peroxidases, washed several times in PB, and stored for 30 min in a solution containing 10% serum from the species of the
secondary antibodies in 0.1 M phosphate buffer to
minimize background staining. The tissue was then incubated overnight
at 4°C in a solution containing 0.1% Triton X-100, 1% serum, and
the primary antibodies. Antibody concentration was optimized using
increasing dilutions of each antibody, respectively. Final dilutions of
antibodies used in this study were as follows: anti-TRAIL: D3 1:100,
H257 1:200, M19 1:100 (all Santa Cruz Biotechnology, Santa Cruz, CA),
B35-1 1:500 (PharMingen, San Diego, CA), 210-732-R100 1:75 (Alexis);
anti-TRAIL-R1: AB1139 1:100 (Alexis); anti-TRAIL-R2: AB16942 1:50
(Chemicon); anti-TRAIL-R3: AB210-744-R100 1:200 (Alexis); and
anti-TRAIL-R4: AB16943 1:250 (Chemicon). Controls were performed by
omitting the primary antibodies and using isotype control antibodies (mouse, FLOPC-21, Sigma, Deisenhofen, Germany; rabbit, X 0936, Dako). Under these conditions, no specific immunostaining was observed in our material.
Immunolabeling of TRAIL and its receptors was visualized with
fluorescein isothiocyanate-coupled secondary antibodies (1:500; Sigma).
These sections were then counterstained for neurons, oligodendrocytes, astrocytes, and microglial cells using antibodies against
microtubule-associated protein (mouse anti-MAP-2, 1:500; Sigma),
phospholipoprotein (rabbit anti-PLP, 1:1000; Serotec, Oxford, UK),
glial fibrillary acidic protein (rabbit anti-GFAP, 1:1000; Dako), and
CD68 (mouse anti-CD68, 1:100; Dako), respectively. These markers were
visualized using trimethylrhodamine-coupled secondary antibodies
(diluted 1:500).
 |
RESULTS |
To detect and localize TRAIL receptor/TRAIL expression in human
brain, RT-PCR, Western blot analysis, and immunocytochemistry were
performed on brain tissue freshly obtained from epilepsy surgery. Both,
apoptosis-mediating (TRAIL-R1 and -R2) and nonapoptotis-mediating (TRAIL-R3 and-R4) TRAIL receptors were expressed in the adult brain,
exemplarily demonstrated in Figure
1a. Bands of the expected sizes were detected for TRAIL-R1 to -R4. Conversely, no TRAIL expression could be identified in all brains analyzed. We confirmed TRAIL expression on the RNA level in human placenta, which we subsequently used as positive control (Fig. 1a). Moreover,
the lack of TRAIL was confirmed by RT-PCR using previously
published TRAIL-specific oligonucleotides (Frank et al., 1999 ). These
authors demonstrated TRAIL expression in human brain tumors and in
brain samples adherent to removed debris from patients with
severe penetrating brain injuries, which they assessed as normal
CNS tissues. In our material, even raising the cycle numbers did
not result in the detection of TRAIL mRNA by RT-PCR of freshly isolated
human brain, whereas TRAIL mRNA was readily detected with this method in T cells (Wendling et al., 2000 ).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 1.
Expression pattern of TRAIL receptors and TRAIL in
human brain. a, RNA isolated from human brain tissue was
analyzed by RT-PCR with primers specific for TRAIL-R1 to R4 and TRAIL.
Functionality of the TRAIL-specific primer pair is demonstrated by a
signal obtained from TRAIL-positive placenta material.
b, The lack of TRAIL expression in the human brain is
demonstrated by immunocytochemistry. No TRAIL-specific signal could be
detected in human brain sections derived from epilepsy patients with
any of the five anti-TRAIL antibodies (see Materials and Methods).
c, To exclude that the lack of TRAIL signals in the
brain is caused by methodological problems of the immunocytochemistry,
the antibodies were tested in human placenta. All tested antibodies
clearly recognized TRAIL on cells in the human placenta. The picture
shows staining with M19 antibodies. Magnifications: b,
c, 20×.
|
|
Immunocytochemically, using five different antibodies, no TRAIL was
detected in the parenchyma either (Fig. 1b). Intense signals in the same tissue on some perivascular and pial macrophages known to
express TRAIL as well as in human placenta, as a positive control (Fig.
1c), ruled out the possibility of methodological restrictions.
Western blot analysis demonstrated the presence of all four TRAIL
receptors in the human brain (Fig.
2a-d). To evaluate whether TRAIL receptor expression was restricted to distinct cell populations in the brain, subsequent immunocytochemical double-staining experiments were performed (Fig.
3a-l). Immunostaining
with the AB1139 antibody specific for human TRAIL-R1 revealed a
specific fluorescence signal (Fig. 3a) that could be
localized to astrocytes by GFAP costaining (Fig. 3b).
TRAIL-R2 was identified on both oligodendrocytes as demonstrated by
double-fluorescence staining with AB16942 and PLP antibody (Fig.
3c,d) and neurons counterstained with MAP-2 antibody (Fig.
3e,f). TRAIL-R3 protein, stained with 210-744-R100, was predominantly found on cells exhibiting the typical morphology of
neurons (Fig. 3g,h). TRAIL-R4 protein detected by AB16943
was heavily expressed on oligodendrocytes (Fig. 3i,j) and on
neurons (Fig. 3k,l). Interestingly, we were unable to
detect expression of TRAIL receptor protein on microglial cells, as
confirmed by anti-CD68 counterstaining (data not shown).

View larger version (88K):
[in this window]
[in a new window]
|
Figure 2.
Western blot analysis of TRAIL receptors in the
human brain. Presence of TRAIL-R1 is demonstrated by a specific band
(~60 kDa) obtained with AB1139 (a), of TRAIL-R2
(~50 kDa) with AB16942 (b), of TRAIL-R3 (~75
kDa, oligomer) with 210-744-R100 (c), and of
TRAIL-R4 (~35 kDa) with AB16943 (d).
|
|

View larger version (125K):
[in this window]
[in a new window]
|
Figure 3.
Human brain sections were double stained
with antibodies against TRAIL receptors and neuronal
(MAP), astrocyte (GFAP), or
oligodendrocyte (PLP) markers to detect colocalization.
Arrows point to those cells that are clearly double
stained, whereas arrowheads indicate monolabeled
structures indicating specificity of fluorescence filters. Expression
of TRAIL-R1 was detected with AB1139 (a) and
could be localized to astrocytes by GFAP costaining
(b). TRAIL-R2 was identified by AB16942
(c, e) and can be found on both oligodendrocytes
(d) and neurons (f).
TRAIL-R3 was found on neurons by using 210-744-R100
(g, h). TRAIL-R4 was detected by
using the AB16943 (i, k).
Expression of this receptor could also be attributed to both
oligodendrocytes and neurons (j,
l). Magnifications: a-f, 40×;
g, h, 20×; i-l,
40×.
|
|
 |
DISCUSSION |
Performing RT-PCR and using five different anti-TRAIL antibodies,
we failed to detect the ligand in nontransformed, noninflammatory human
brains (Fig. 1) while demonstrating the presence of TRAIL receptors in
the brain (Fig. 2) localized on neurons, astrocytes, and
oligodendrocytes (Fig. 3). Because all antibodies available could not
be used in autopsy material, we used fresh biopsy tissue obtained from
epilepsy patients undergoing temporal lobe resection. We are aware of
the fact that in epilepsy animal models, neuronal apoptosis has been
described (Tuunanan et al., 1999 ). However, all these studies refer to
status epilepticus-induced neuronal damage, which was not the case in
the brains used in our study. The absence of TRAIL in the human brain
reported here is in line with a lack of TRAIL expression in peritumoral
brain tissue (Rieger et al., 1999 ). This is with the exception of
reactive astrocytes in the area surrounding brain malignancies, as
immunocytochemically demonstrated.
For a death receptor-death ligand system involved in the mechanisms of
immune privilege, one would expect constitutive expression of the
ligand in the respective immune-privileged tissue allowing removal of
infiltrating T cells as already shown for TRAIL in human placenta
(Phillips et al., 1999 ) and for CD95 ligand in human eye (Griffith et
al., 1995 ), brain (Bechmann et al., 1999 ), and testes (Bellgrau and
Duke, 1999 ). Thus, the lack of TRAIL expression in the human brain
argues against its role as a self-defense mechanism involved in immune
privilege. On the other hand, presence of TRAIL receptors on neurons,
astrocytes, and oligodendrocytes points to a unique role of this
apoptosis-regulating system for the brain when compared with other
systems, such as TNF receptor-TNF and CD95-CD95 ligand. The
expression of the apoptosis-mediating TRAIL receptors on neurons,
astrocytes, and oligodendrocytes indicates their possible
susceptibility to TRAIL-mediated apoptosis. The scenario might be that
T cells, which upregulate TRAIL after activation (Wendling et al.,
2000 ), invade the brain and induce cell death of parenchymal cells via
TRAIL receptor-TRAIL interaction. These activated T cells downregulate
agonistic TRAIL receptors and are not susceptible to undergoing
TRAIL-mediated apoptosis (Wendling et al., 2000 ). In fact, we were able
to demonstrate glioma cell death induced by T cells via TRAIL
receptor-TRAIL interaction (Dörr et al., 2001 ). Moreover,
induction of apoptosis in brain parenchymal cells including neurons,
astrocytes, and oligodendrocytes by TRAIL has been observed in acute
human brain slices (Nitsch et al., 2000 ). The present data thus provide
a molecular basis for these findings because death-mediating TRAIL
receptors are present on parenchymal cells in the brain which, under
physiological conditions, lacks the death-inducing ligand.
The expression of apoptosis-mediating TRAIL receptors, as described in
our study, indicates that neurons, astrocytes, and oligodendrocytes are
potentially susceptible to an attack by TRAIL-expressing T cells.
Because both apoptosis-mediating as well as apoptosis-blocking receptors are present on the different brain parenchymal cells, the
actual regulation of receptor subtype expression might be crucial for
the fate of an individual cell. It is conceivable that dysregulation of
this expression under pathological conditions can substantially affect
their survival in the circumstance of an inflammatory T cell invasion.
Induction of cell death by TRAIL in the human brain (Nitsch et al.,
2000 ), together with our present data, indicate a potential role for
the TRAIL receptor-TRAIL system as an effector mechanism in
neuroinflammation such as MS rather than a role in defense mechanisms
of the immune-privileged brain. These findings render the TRAIL system
an efficient therapeutic target in neuroinflammation, which circumvents
the shortcomings of TNF-targeted strategies that have failed (van
Oosten et al., 1996 ; The Lenercept MS Study Group, 1999 ), presumably
because of the dual role of TNF in brain damage and defense.
 |
FOOTNOTES |
Received Oct. 30, 2001; revised Oct. 30, 2001; accepted Nov. 21, 2001.
*
J.D., I.B., S.W., R.N., and
F.Z. contributed equally to this work.
Correspondence should be addressed to Dr. Frauke Zipp, Department of
Neurology, Division of Neuroimmunology, Neuroscience Research Center
NWFZ 2680, Charité Campus Mitte, Schumannstrasse 20/21, 10117 Berlin, Germany. E-mail: frauke.zipp{at}charite.de.
This work was supported by Gemeinnützige Hertie-Stiftung and
Deutsche Forschungsgemeinschaft Grants ZI 448/7-1 (F.Z.), BE 2272/1-1
(I.B.), and SFB 507/C1 (R.N.), and the Bundesministerium für
Bildung und Forschung to H.W. (BioFuture). We thank T. N. Lehmann from the Neurosurgery Department and F. v. Landeghem from the
Neuropathology Department for providing fresh human brain material, K. Hertwig for providing fresh human placenta material, and Heiko Stahl
for excellent technical assistance.
This article is published in
The Journal of Neuroscience, Rapid Communications Section,
which publishes brief, peer-reviewed papers online, not in print. Rapid
Communications are posted online approximately one month earlier than
they would appear if printed. They are listed in the Table of Contents
of the next open issue of JNeurosci. Cite this article as:
JNeurosci, 2002, 22:RC209 (1-5). The
publication date is the date of posting online at
www.jneurosci.org.
 |
REFERENCES |
-
Bachmann R,
Eugster HP,
Frei K,
Fontana A,
Lassmann H
(1999)
Impairment of TNF-receptor-1 signaling but not fas signaling diminishes T-cell apoptosis in myelin oligodendrocyte glycoprotein peptide-induced chronic demyelinating autoimmune encephalomyelitis in mice.
Am J Pathol
154:1417-1422[Abstract/Full Text].
-
Bechmann I,
Mor G,
Nilsen J,
Eliza M,
Nitsch R,
Naftolin F
(1999)
FasL (CD95L, Apo1L) is expressed in the normal rat and human brain: evidence for the existence of an immunological brain barrier.
Glia
27:62-74[Medline].
-
Bechmann I,
Lossau S,
Steiner B,
Mor G,
Gimsa U,
Nitsch R
(2000)
Reactive astrocytes upregulate fas (CD95) and fas ligand (CD95L) expression but do not undergo programmed cell death during the course of anterograde degeneration.
Glia
32:25-41[Medline].
-
Bellgrau D,
Duke RC
(1999)
Apoptosis and CD95 ligand in immune privileged sites.
Int Rev Immunol
18:547-562[Medline].
-
Degli-Esposti MA,
Dougall WC,
Smolak PJ,
Waugh JY,
Smith CA,
Goodwin RG
(1997a)
The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain.
Immunity
7:813-820[Medline].
-
Degli-Esposti MA,
Smolak PJ,
Walczak H,
Waugh J,
Huang C-P,
DuBose RF,
Goodwin RG,
Smith CA
(1997b)
Cloning and characterization of TRAIL-R3, a novel member of the emerging TRAIL receptor family.
J Exp Med
186:1165-1170[Abstract/Full Text].
-
Dörr J, Waiczies S, Wendling U, Seeger B, Zipp
F (2001) Induction of TRAIL-mediated glioma cell death by
human T cells. J Neuroimmunol, in press.
-
Flügel A,
Schwaiger FW,
Neumann H,
Medana I,
Willem M,
Wekerle H,
Kreutzberg GW,
Graeber MB
(2000)
Neuronal FasL induces cell death of encephalitogenic T lymphocytes.
Brain Pathol
10:353-364[Medline].
-
Frank S,
Kohler U,
Schackert G,
Schackert HK
(1999)
Expression of TRAIL and its receptors in human brain tumors.
Biochem Biophys Res Commun
257:454-459[Medline].
-
Gold R,
Hartung HP,
Lassmann H
(1997)
T-cell apoptosis in autoimmune diseases: termination of inflammation in the nervous system and other sites with specialized immune-defense mechanisms.
Trends Neurosci
20:399-404[Medline].
-
Griffith TS,
Herndon JM,
Lima J,
Kahn M,
Ferguson TA
(1995)
The immune response and the eye. TCR alpha-chain related molecules regulate the systemic immunity to antigen presented in the eye.
Int Immunol
7:1617-1625[Abstract].
-
Hilliard B,
Wilmen A,
Seidel C,
Liu TS,
Goke R,
Chen Y
(2001)
Roles of TNF-related apoptosis-inducing ligand in experimental autoimmune encephalomyelitis.
J Immunol
166:1314-1319[Abstract/Full Text].
-
Huang W-X,
Huang MP,
Gomes MA,
Hillert J
(2000)
Apoptosis mediators fasL and TRAIL are upregulated in peripheral blood mononuclear cells in MS.
Neurology
55:928-934[Abstract/Full Text].
-
Nitsch R,
Bechmann I,
Deisz RA,
Haas DLTN,
Wendling U,
Zipp F
(2000)
Massive cell death induced by tumor-necrosis factor-related apoptosis-inducing ligand (TRAIL) in adult human brain tissue.
Lancet
356:827-828[Medline].
-
Pan G,
O`Rourke K,
Chinnaiyan AM,
Gentz R,
Ebner R,
Ni J,
Dixit VM
(1997a)
The receptor for the cytotoxic ligand TRAIL.
Science
276:111-113[Abstract/Full Text].
-
Pan G,
Ni J,
Wei Y,
Yu G,
Gentz R,
Dixit VM
(1997b)
An antagonist decoy receptor and a death domain-containing receptor for TRAIL.
Science
277:815-818[Abstract/Full Text].
-
Pender MP,
Nguyen KB,
McCombe PA,
Kerr JFR
(1991)
Apoptosis in the nervous system in experimental allergic encephalomyelitis.
J Neurol Sci
104:81-87[Medline].
-
Phillips TA,
Ni J,
Pan G,
Ruben SM,
Wei YF,
Pace JL,
Hunt JS
(1999)
TRAIL (Apo-2L) and TRAIL receptors in human placentas: implications for immune privilege.
J Immunol
162:6053-6059[Abstract/Full Text].
-
Pitti RM,
Marsters SA,
Ruppert S,
Donahue CJ,
Moore A,
Ashkenazi A
(1996)
Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family.
J Biol Chem
271:12687-12690[Abstract/Full Text].
-
Rieger J,
Ohgaki H,
Kleihues P,
Weller M
(1999)
Human astrocytic brain tumors express AP02L/TRAIL.
Acta Neuropathol (Berl)
97:1-4[Medline].
-
Schmied M,
Breitschopf H,
Gold R,
Zischler H,
Rothe G,
Wekerle H,
Lassmann H
(1993)
Apoptosis of T lymphocytes in experimental autoimmune encephalomyelitis. Evidence for programmed cell death as a mechanism to control inflammation in the brain.
Am J Pathol
143:446-452[Abstract].
-
Sheridan JP,
Marsters S,
Pitti RM,
Gurney A,
Skubatch M,
Baldwin D,
Ramakrishnan L,
Gray CL,
Baker K,
Wood WI,
Goddard AD,
Godowski P,
Ashkenazi A
(1997)
Control of TRAIL-induced apoptosis by a family of signaling and decoy receptors.
Science
277:818-821[Abstract/Full Text].
-
Song K,
Chen Y,
Goke R,
Wilmen A,
Seidel C,
Goke A,
Hilliard B
(2000)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an inhibitor of autoimmune inflammation and cell cycle progression.
J Exp Med
191:1095-1103[Abstract/Full Text].
-
The Lenercept Multiple Sclerosis Study Group,
The University of British Columbia MS/MRI Analysis Group
(1999)
TNF neutralization in MS: results of a randomized, placebo-controlled multicenter study.
Neurology
53:457-465[Abstract/Full Text].
-
Tuunanan J,
Lukasiuk K,
Halonen T,
Pitkanen A
(1999)
Status epilepticus-induced neuronal damage in the rat amygdaloid complex: distribution, time course and mechanisms.
J Neurosci
94:473-495.
-
van Oosten BW,
Barkhof F,
Truyen L,
Boringa JB,
Bertelsmann FW,
von Blomberg BM,
Woody JN,
Hartung HP,
Polman CH
(1996)
Increased MRI activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor antibody cA2.
Neurology
47:1531-1534[Abstract].
-
Walczak H,
Degli-Esposti MA,
Johnson RS,
Smolak PJ,
Waugh JY,
Boiani N,
Timour MS,
Gerhart MJ,
Schooley KA,
Smith CA,
Goodwin R,
Rauch CT
(1997)
TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL.
EMBO J
16:5386-5397[Abstract/Full Text].
-
Wendling U,
Walczak H,
Dörr J,
Jaboci C,
Weller M,
Krammer PH,
Zipp F
(2000)
Expression of TRAIL receptors in human autoreactive and foreign antigen-specific T cells.
Cell Death Differ
7:637-644[Medline].
-
Wiley SR,
Schooley K,
Smolak PJ,
Din WS,
Huang CP,
Nicholl JK,
Sutherland GR,
Smith TD,
Rauch C,
Smith CA,
Goodwin RG
(1995)
Identification and characterization of a new member of the TNF family that induces apoptosis.
Immunity
3:673-682[Medline].
Copyright © Society for Neuroscience 0270-6474//$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
M. Candolfi, K. Yagiz, D. Foulad, G. E. Alzadeh, M. Tesarfreund, A.K.M. G. Muhammad, M. Puntel, K. M. Kroeger, C. Liu, S. Lee, et al.
Release of HMGB1 in Response to Proapoptotic Glioma Killing Strategies: Efficacy and Neurotoxicity
Clin. Cancer Res.,
July 1, 2009;
15(13):
4401 - 4414.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Huang, N. Erdmann, H. Peng, S. Herek, J. S. Davis, X. Luo, T. Ikezu, and J. Zheng
TRAIL-Mediated Apoptosis in HIV-1-Infected Macrophages Is Dependent on the Inhibition of Akt-1 Phosphorylation
J. Immunol.,
August 15, 2006;
177(4):
2304 - 2313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, M. Tsuboi, K. Hikita, and N. Kaneda
Protective Effects of Neurotrophic Factors on Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-mediated Apoptosis of Murine Adrenal Chromaffin Cell Line tsAM5D
J. Biol. Chem.,
August 11, 2006;
281(32):
22503 - 22516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N Arbour, E Rastikerdar, E McCrea, Y Lapierre, J Dorr, A Bar-Or, and J P Antel
Upregulation of TRAIL expression on human T lymphocytes by interferon b and glatiramer acetate
Multiple Sclerosis,
December 1, 2005;
11(6):
652 - 657.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Spierings, E. G. de Vries, E. Vellenga, F. A. van den Heuvel, J. J. Koornstra, J. Wesseling, H. Hollema, and S. de Jong
Tissue Distribution of the Death Ligand TRAIL and Its Receptors
J. Histochem. Cytochem.,
June 1, 2004;
52(6):
821 - 831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Miura, N. Misawa, Y. Kawano, H. Okada, Y. Inagaki, N. Yamamoto, M. Ito, H. Yagita, K. Okumura, H. Mizusawa, et al.
Tumor necrosis factor-related apoptosis-inducing ligand induces neuronal death in a murine model of HIV central nervous system infection
PNAS,
March 4, 2003;
100(5):
2777 - 2782.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|