 |
 Previous Article | Next Article 
The Journal of Neuroscience, March 1, 2002, 22(5):1784-1793
Adult Rodent Neurogenic Regions: The Ventricular Subependyma
Contains Neural Stem Cells, But the Dentate Gyrus Contains Restricted
Progenitors
Raewyn M.
Seaberg and
Derek
van
der Kooy
Department of Anatomy and Cell Biology, University of Toronto,
Toronto M5S 1A8, Canada
 |
ABSTRACT |
Neurogenesis persists in two adult brain regions: the ventricular
subependyma and the subgranular cell layer in the hippocampal dentate
gyrus (DG). Previous work in many laboratories has shown explicitly
that multipotential, self-renewing stem cells in the subependyma are
the source of newly generated migrating neurons that traverse the
rostral migratory stream and incorporate into the olfactory bulb as
interneurons. These stem cells have been specifically isolated from the
subependyma, and their properties of self-renewal and multipotentiality
have been demonstrated in vitro. In contrast, it is a
widely held assumption that the "hippocampal" stem cells that can
be isolated in vitro from adult hippocampus reside in
the neurogenic subgranular layer and represent the source of new
granule cell neurons, but this has never been tested directly. Primary
cell isolates derived from the precise microdissection of adult rodent
neurogenic regions were compared using two very different commonly used
culture methods: a clonal colony-forming (neurosphere) assay and a
monolayer culture system. Importantly, both of these culture methods
generated the same conclusion: stem cells can be isolated from
hippocampus-adjacent regions of subependyma, but the adult DG proper
does not contain a population of resident neural stem cells. Indeed,
although the lateral ventricle and other ventricular subependymal
regions directly adjacent to the hippocampus contain neural stem cells
that exhibit long-term self-renewal and multipotentiality, separate
neuronal and glial progenitors with limited self-renewal capacity are
present in the adult DG, suggesting that neuron-specific progenitors
and not multipotential stem cells are the source of newly generated DG
neurons throughout adulthood.
Key words:
hippocampus; subgranular zone; subependyma; stem cells; progenitor cells; neurospheres
| |
INTRODUCTION |
There are two regions in the adult
rodent brain where neurogenesis occurs. Precursors from the subependyma
surrounding the lateral ventricles proliferate and migrate along a
rostral migratory stream to the olfactory bulbs, where they
differentiate into granule cell interneurons (Lois and Alvarez-Buylla,
1993 , 1994; Luskin, 1993). Second, precursors reside in the subgranular
cell layer of the dentate gyrus (DG) in the hippocampus. These cells
proliferate and migrate into the granule cell layer, where they
differentiate into hippocampal granule cells (Altman and Das, 1965,
1966; Cameron et al., 1993; Kuhn et al., 1996; Palmer et al., 2000). We
isolated the precursors from the subependyma and DG to test directly
whether they exhibit similar properties in vitro and
specifically to test whether they both exhibit stem cell
characteristics. We define "stem cells" as single cells with
long-term self-renewal (self-renewal throughout the lifetime of the
animal) and multipotentiality, "progenitors" as cells that exhibit
less self-renewal ability and unipotentiality or multipotentiality, and
we use the term "precursor" to refer more generally to either a
mixed or unknown proliferating population (Weiss et al., 1996).
The precursors that reside in the adult subependyma include a
subpopulation of cells that exhibit the fundamental properties of
neural stem cells: long-term self-renewal and multipotentiality (Potten
and Loeffler, 1990; Weiss et al., 1996). These subependymal cells
display stem cell characteristics in vitro (Reynolds and Weiss, 1992; Morshead et al., 1994; Gritti et al., 1996; Tropepe et
al., 1997; Chiasson et al., 1999), as well as self-renewal throughout
the lifetime of the animal, even into senescence (Tropepe et al.,
1997). In vivo, subependymal stem cells give rise to the progenitors that differentiate into olfactory bulb neurons (Lois and
Alvarez-Buylla, 1993, 1994; Luskin, 1993).
Precursors exhibiting stem cell characteristics that reside in the
adult hippocampus have also been isolated in vitro (Gage et
al., 1995; Palmer et al., 1995, 1997). However, it has not been shown
explicitly that these hippocampal stem cells reside in the subgranular
cell layer of the DG, the site of adult neurogenesis. In
vitro reports to date (Palmer et al., 1995, 1997) have studied cells derived from the dissociation of the entire hippocampus and thus
have not separately investigated the properties of cells derived from
the DG and those from neighboring subependymal neurogenic regions
directly adjacent to the hippocampus. These regions include the third
ventricle, posterior lateral ventricle, and the "hippocampal arch,"
which appears dorsally as a remnant of the caudal embryonic lateral
ventricle that is not patent in the adult.
To test directly whether hippocampal stem cells reside in the DG, and
whether they share properties with the subependymal stem cells, we
specifically isolated precursors from these neurogenic regions in adult
animals and compared their behavior using two different culture assays:
a colony-forming (neurosphere) assay (Reynolds and Weiss, 1992;
Chiasson et al., 1999) and a monolayer culture method (Gage et al.,
1995; Palmer et al., 1995, 1997) that have been used for the isolation
and study of subependymal and "hippocampal" stem cells, respectively.
| |
MATERIALS AND METHODS |
Dissection and tissue preparation. Adult
male CD1 mice (Charles River, St. Constant, Quebec, Canada), ages 6-8
weeks, and adult male Wistar rats (Charles River), ages 8-10 weeks,
were used as indicated. Adult mice were killed by cervical dislocation; rats were deeply anesthetized with sodium pentobarbital and
decapitated. The brains were removed, placed rostral-side up in 35 mm
Petri dishes, and then covered with a 1.5% solution of low-gelling
temperature agarose (Sigma, St. Louis, MO) at 38-40°C and then
immediately placed at 4°C to harden the agarose solution. This
supported the brain, permitting anatomy to remain intact and
facilitating sectioning on a vibratome. Each brain was cut on a
vibratome into viable 500 µm coronal sections in ice-cold oxygenated
artificial CSF (aCSF) that contained (in
mM): 124 NaCl, 5 KCl, 1.3 MgCl2, 2 CaCl2, 26 NaHCO3, and 10 D-glucose.
Sections were placed into Petri dishes containing aCSF; rostral
sections containing anterior lateral ventricle were kept separate from
those containing dentate gyrus.
Under a Zeiss dissecting microscope, various brain regions
from each section were precisely removed with fine surgical
instruments. From the rostral sections, a 1.8 × 0.2 mm strip of
tissue containing both ependyma and subependyma was removed from the
striatal (lateral) aspect of the anterior lateral ventricles. For all
analyses, only subependymal spheres were counted, passaged, and
differentiated (Chiasson et al., 1999). From more caudal sections
containing hippocampus, the following regions were dissected: a
2.5 × 0.2 mm strip of tissue just ventral to the corpus callosum,
the hippocampal arch, a 1.3 × 0.2 mm strip of tissue surrounding
the posterior lateral ventricle, a 0.8 × 1.2 mm piece of tissue
surrounding the third ventricle, and a 1.3 × 0.5 mm block of
tissue containing both blades of the DG (and the entire subgranular
cell layer) but excluding its most medial tip, which was included in
the third ventricle dissection (see Fig.
1A,B). Dissected tissue from each region was placed into a test tube containing an enzyme solution as
described previously (Chiasson et al., 1999) for 90 min at 37°C to
facilitate dissociation of the cells. Tissues were then centrifuged at
1500 rpm for 5 min. The enzyme solution was removed, and serum-free
media containing trypsin inhibitor (15 mg/ml ovamucoid; Roche,
Indianapolis, IN) was added. The tissues were mechanically triturated
into a single-cell suspension with sterile fire-polished Pasteur
pipettes and centrifuged again at 1500 rpm for 5 min. The ovamucoid
solution was removed and replaced with chemically defined serum-free
media (SFM) as described previously (Reynolds and Weiss, 1992; Tropepe
et al., 1997).
For experiments involving early postnatal animals, pregnant CD1 mice
and pregnant Wistar rats (Charles River) were obtained. The day of
birth was counted as postnatal day (PND) 0, and all experiments were
performed on PND1 or PND10. Newborn mice and rats were killed by
decapitation, and the brains were removed under a dissecting
microscope. The vibratome tissue preparation procedure for PND1 and
PND10 animals followed that used for adults except that PBS was used
instead of aCSF, and primary tissue was triturated in SFM into a
single-cell suspension without previous enzyme treatment.
In vitro cell culture. The primary cell culture
technique used for this study was the neurosphere assay (Reynolds and
Weiss, 1992). Growth factors were used in SFM at final concentrations of 10 ng/ml fibroblast growth factor (FGF)2 (human recombinant; Sigma),
2 µg/ml heparin (Sigma), and 20 ng/ml epidermal growth factor (EGF)
(mouse submaxillary; Sigma) unless noted otherwise. B27 supplement
(Invitrogen, Burlington, ON, Canada) was added to primary tissue and
passaged cultures unless noted otherwise. Cell viability was assessed
using trypan blue exclusion (0.4%, Sigma), and was >85%, regardless
of tissue region dissected or culture conditions used. Primary tissue
was plated at 20 viable cells per microliter (10,000 cells per well) in
uncoated 24-well culture plates (Nunc, Naperville, IL). It has been
demonstrated previously by mixing marked and unmarked cells that
culturing cells at this density will result in clonal neurosphere
colonies, as form in single-cell cultures, and that neurospheres do not arise as a result of cell aggregation at the cell culture densities used here (Morshead et al., 1998b; Tropepe et al., 2000). The total
number of spheres that formed in each well was counted after 7 d
in vitro (DIV) unless specified otherwise. New neurospheres (that were not present after 1 week) did not form after culturing tissue for longer time periods (up to 3 weeks) and repeatedly adding
fresh media to the cultures (data not shown). The data are reported as
the mean number of spheres plus the SEM formed per 10,000 cells or as
the total number of spheres formed per brain dissection. To determine
whether the spheres formed from each brain region were derived from
stem cells, we assayed for self-renewal (single sphere passaging) as
described previously (Tropepe et al., 1999). Self-renewal was also
assayed (where indicated) by dissociating spheres in bulk and
reculturing the cells at a constant density of 20 cells per microliter.
Control experiments were performed to exclude the
possibility that the results obtained were a function of the
neurosphere assay and not generalizable to other cell culture
techniques. Thus, dissections were performed as described, and the
tissue was plated in tissue culture flasks (Nunc) coated with
polyornithine (Sigma) and laminin (Invitrogen) (Palmer et al., 1995,
1997) or in uncoated flasks (Gage et al., 1995). For the first 24 hr
the cells were cultured in SFM containing 10% fetal bovine serum
(FBS) (Hyclone, Logan, UT), and the following day the media was
replaced with SFM containing N2 supplement (Invitrogen) and 20 ng/ml
FGF2. The procedure that we followed was identical to that described previously (Gage et al., 1995; Palmer et al., 1995, 1997). Control experiments with adult rat hippocampal-derived
progenitor(AHP)-conditioned media were performed to exclude
the possibility that inadequate glycosylated cystatin C
(CCg) levels confounded our results; AHP-conditioned media
was prepared as described (Taupin et al., 2000) and with the kind
advice of T. D Palmer (Stanford University, Stanford, CA).
Subsequently, the neurosphere assay was performed as described above,
but with the absence of B27 supplement. Neurosphere assays were
performed as well with AHPs (a gift from Dr. F. H. Gage and J. Ray, Salk Institute, Palo Alto, CA).
Immunocytochemistry. Multipotentiality was
assayed by transferring single spheres to 24-well culture plates coated
with MATRIGEL basement membrane matrix (15.1 mg/ml stock solution
diluted 1:50 in SFM; Becton Dickinson, Bedford, MA) in SFM containing
1% FBS. Various combinations of FBS, FGF2, B27, and other adhesive
substrates (polyornithine and laminin) were tested, but 1% FBS on
MATRIGEL was found to most reliably generate neurons and glia from
subependymal neurospheres (data not shown). Wells were processed 7-8 d
later using immunocytochemistry as described (Chiasson et al., 1999; Tropepe et al., 1999) for neurons and astrocytes. In contrast, for
oligodendrocytes, the cultures were processed after 24 hr, and the cell
permeabilization step was omitted. The following antibodies were used:
anti-microtubule associated protein 2 (MAP2) mouse monoclonal (IgG)
(1:1000; Roche), anti- -tubulin isotype III mouse monoclonal (IgG)
(1:500, Sigma), anti-glial fibrillary acidic protein (GFAP) rabbit
polyclonal (IgG) (1:400; Chemicon, Temecula, CA), anti-O4 monoclonal
(IgM) (1:100; Chemicon), FITC goat anti-rabbit (1:200; Jackson
ImmunoResearch, West Grove, PA), rhodamine (TRITC)-conjugated goat
anti-mouse (1:200; Jackson ImmunoResearch); anti-MAP2 mouse monoclonal
(IgG1) (1:5000; RBI, Natick, MA), guinea pig anti-GFAP (1:500; Advanced
ImmunoChemical, Long Beach, CA), FITC donkey anti-guinea pig
(Chemicon), and Hoechst 33258 nuclear stain (0.015 mg/ml stock solution
diluted to 0.001 mg/ml; Roche). Secondary-only wells were processed
simultaneously using the identical protocol except that solutions did
not contain primary antibodies. All secondary-only controls were
negative for staining. The numbers of neurons and
astrocytes generated per neurosphere were determined by counting the
numbers of MAP2+ and
GFAP+ cells, respectively, as a percentage
of Hoescht-positive nuclei in at least 14 random fields of
differentiated cells. Fluorescence was visualized using a Nikon diaphot
inverted microscope, and images were recorded with a Nikon COOLPIX
digital camera.
RT-PCR. Total RNA was extracted from frozen differentiated
sphere colonies (RNeasy extraction kit, Qiagen, Mississauga,
Canada) and reverse transcribed. PCR for GFAP was performed
with Taq DNA polymerase (MBI Fermentas, Burlington, Canada)
in a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA)
using one step at 94°C, 2 min; 35 cycles (94°C, 1 min; 55°C, 1 min; 72°C, 1 min) and one extension step (72°C, 10 min). PCR for
neurofilament heavy-subunit (NF-H) was performed using one step at
95°C, 2 min; 28 cycles (95°C, 0.5 min; 56°C, 0.5 min; 72°C, 0.5 min) and one extension step (72°C, 7 min). mRNA was treated with
DNase (Qiagen) to exclude false results by DNA contamination. Forward
and reverse primers used were (5'-3'): GTTGTGAAGGTCTATTCCTGGC and
TCCCTTAGCTTGGAGAGCAA for GFAP (Bush et al., 1998) and
AGCCTGAGGAGAAGCCCAAA and CGTAGCGTTCAGCATACATC for NF-H (Pernas-Alonso
et al., 1996). The lengths of the amplified fragments were
150 and 452 bp for GFAP and NF-H, respectively.
| |
RESULTS |
Adult dentate gyrus cultures yield a very small number of
sphere colonies
Neurospheres can be generated from single neural stem cells that
reside around the anterior lateral ventricle in the adult subependyma
(Morshead et al., 1994; Chiasson et al., 1999). These neurospheres
demonstrate the fundamental stem cell properties of self-renewal and
multipotentiality; after dissociation of a single, clonally derived
neurosphere, a few single cells proliferate to form new neurospheres
(self-renewal) and when plated in differentiation conditions other
cells from the single, clonally derived neurospheres differentiate to
produce neurons and glia (multipotentiality). To determine whether the
adult mouse DG contains stem cells that are similarly capable of
generating neurospheres, we precisely isolated this region by
microdissection of viable vibratome sections. Neurogenic brain regions
containing subependymal cells are located directly adjacent to the
hippocampus, and thus we dissected and separately cultured tissue from
the posterior lateral ventricle, third ventricle, and hippocampal arch
as part of our effort to avoid subependymal cell contamination of the
DG culture (Fig. 1A,B).
The hippocampal arch appears to be a remnant of the caudal embryonic
lateral ventricle, which is not patent in the adult but contains a
proliferating cell population that incorporates bromodeoxyuridine [as
seen in Palmer et al. (2000) and our unpublished observations].
We have also dissected regions CA1 and CA3 of the hippocampus and the
ventral pial surface for this assay and found that these regions never
gave rise to spheres (data not shown).
View larger version (120K):
[in this window]
[in a new window]
|
Figure 1.
Dissection and rate of sphere formation of adult
mouse neurogenic regions. A, B, Atlas
images of adult mouse brain sections (Franklin and Paxinos, 1997)
adapted to show the microdissection of viable 500 µm vibratome
sections used to isolate tissue from neurogenic regions.
A, Coronal section through the anterior lateral
ventricle (aLV) with the dissected region
highlighted. Note that this dissection includes both subependymal and
ependymal tissue, but for the purposes of this study ependymal sphere
formation was ignored. B, Coronal section through the
hippocampus. Note that the dentate gyrus (DG) dissection
excludes all regions containing subependymal tissue; these regions were
dissected and cultured separately. 3rd V, Third
ventricle; pLV, posterior lateral ventricle;
HA, hippocampal arch. This dissection scheme was used
for both rats and mice.
|
|
The adult DG cultures did generate a very low number of spheres that
were fewer in number (per 10,000 cultured cells, i.e., density of 20 cells per microliter) and significantly (p < 0.01) smaller in diameter (135.11 ± 7.53 µm) than those derived
from the subependyma (263.63 ± 7.71 µm) of the anterior lateral
ventricle, third ventricle, posterior lateral ventricle, or hippocampal
arch. The average number of spheres generated from the DG per 10,000 cells was 0.54 ± 0.1 (Fig.
2A). This is a rate of
sphere formation ~120-fold lower than that of anterior lateral
ventricle subependymal cells.
View larger version (18K):
[in this window]
[in a new window]
|
Figure 2.
A, Comparison of the numbers of
primary spheres generated from different neurogenic regions in the
adult mouse brain. The data are expressed as the mean (+SEM) number of
spheres generated per 10,000 cells plated (i.e., per well; density = 20 cells per microliter). Tissue from each region
(aLV, anterior lateral ventricle; pLV,
posterior lateral ventricle; 3rd V, third ventricle;
HV, hippocampal arch; DG, dentate gyrus)
was dissociated into single cells and plated in serum-free media
containing EGF + FGF2 and B27 supplement; spheres were counted at 7 DIV. Note that the aLV cells generate neurospheres at a
rate ~120-fold higher than the DG cells (0.54 ± 0.1), on the basis of data from n > 120 animals
and 10 separate experiments. B, Comparison of the number
of spheres generated from adult dentate gyrus at different rostrocaudal
levels. Rostral, middle, and caudal sections through the DG yield a
similar number of sphere colonies. Tissue from each individual 500 µm
section (n = 85 sections from >20 animals) through
the DG was separately dissociated into single cells and cultured at 20 cells per microliter; spheres were counted at 7 DIV.
|
|
A similar small number of spheres are derived from dentate gyrus
sections at each rostrocaudal level
Usually, four to six coronal DG sections were obtained from a
single animal, and the tissue fragments were pooled. To verify that the
spheres did not arise from the accidental inclusion of a small amount
of subependymal tissue in one of the sections, the DG tissue retrieved
from individual vibratome sections was cultured separately (rather than
pooling tissue from multiple sections). We reasoned that if the spheres
arising from DG cultures were a product of dissection error, they would
more likely be derived from a single vibratome section that mistakenly
included some subependymal cells rather than evenly distributed
across rostrocaudal levels throughout the DG. In fact, the DG spheres were derived equally from rostral, middle, and caudal sections as
revealed by one-factor ANOVA: F(2,81) = 0.19; p > 0.01 (Fig. 2B). This
supports the idea that these colonies were truly formed by DG-derived
cells and not by contaminating subependymal cells. Furthermore, as
revealed in subsequent results described below, the DG and subependymal
sphere colonies display different in vitro behavior,
indicating that this small number of spheres was generated by DG and
not subependymal cells.
It is important to emphasize that sphere formation is not in itself
evidence of neural stem cell identity, as has been shown previously.
For example, oligodendroglial progenitors have been shown to form
free-floating "oligospheres," but these progenitors are not neural
stem cells, because they exhibit limited self-renewal ability and
produce only oligodendrocytes (Zhang et al., 1998). Additionally, a
subpopulation of cells derived only from the embryonic neural retina in
the eye have the capacity to form spheres in vitro but are
not capable of self-renewal and thus also do not represent neural stem
cells (Tropepe et al., 2000).
In light of this, spheres were manipulated in vitro to assay
for the stem cell properties of self-renewal and multipotentiality. In
addition, a monolayer culture assay was used to ensure that results and
subsequent conclusions were not specific to only one type of in
vitro assay, as discussed below.
Adult dentate gyrus-derived spheres do not demonstrate the stem
cell property of self-renewal
To determine whether the cells that had initiated the DG sphere
colonies shared similar self-renewal characteristics with subependymal
neural stem cells, primary spheres were individually dissociated into
single cells and replated in identical media conditions. Through the
use of this passaging assay, self-renewal ability is assessed by the
formation of clonally derived secondary sphere colonies. The longevity
of self-renewal ability can be investigated further by passaging single
secondary spheres and assessing the formation of tertiary spheres, and
so on. The number of spheres that form at each passage is an index of
the number of times the primary sphere-initiating cell has
symmetrically divided in vitro during primary sphere colony
formation (Reynolds and Weiss, 1996). Our results indicate that
although virtually 100% of single, dissociated subependymal stem
cell-derived anterior lateral ventricle neurospheres were capable of
generating numerous new neurosphere colonies over multiple passages
(Morshead et al., 1994; Tropepe et al., 1997; Chiasson et al., 1999),
dissociated DG-derived spheres never gave rise to any secondary sphere
colonies (Fig.
3A,B).
Indeed, neurospheres derived from all dissected regions containing
subependymal cells (posterior lateral ventricle, third ventricle, and
hippocampal arch) were capable of giving rise to secondary
neurospheres, demonstrating the self-renewal capability of the
neurosphere-initiating cell from the subependyma. The only adult region
studied from which nonpassagable spheres were generated was the DG;
this strongly suggested that the cells from which DG spheres arise are
not capable of self-renewal.
View larger version (22K):
[in this window]
[in a new window]
|
Figure 3.
A, B, Comparison of
the self-renewal ability of adult anterior lateral ventricle
(subependymal) and dentate gyrus spheres. A, The data
are expressed as the mean (+SEM) number of spheres generated per single
sphere dissociation. At each passage, individual spheres
(n > 60 spheres per condition) were dissociated
per tissue culture well, and the number of sphere colonies that formed
was counted after 7 DIV. Although the adult aLV neurosphere-initiating
cells demonstrated self-renewal by giving rise to secondary and
tertiary neurospheres (as did the adult pLV, 3rd V, and HA
neurospheres; data not shown), the adult DG sphere-initiating cells did
not demonstrate self-renewal and did not give rise to secondary sphere
colonies. Individual spheres were dissociated and replated in identical
media conditions as were used for primary culture (EGF + FGF2 with B27
supplement). B, The data are expressed as the percentage
of individual spheres that passaged to generate new spheres. Procedures
were followed as described for A. Note that nearly 100%
of adult aLV spheres give rise to new spheres at each passage.
|
|
We considered the possibility that variability in cell density
confounded the result that the relatively smaller DG spheres did not
yield secondary colonies. A recent report (Taupin et al., 2000) has
illustrated that at very low cell densities, factors elaborated by
cultured cells are at insufficient concentrations for cell
proliferation. Specifically, this report indicated that at cell
densities of <200 cells per well (of a 96-well culture plate), cells
required exogenous CCg. To control for the possibility that such
a factor was at an insufficient level in cultures of individually
dissociated adult DG spheres, we pooled primary spheres derived from
the anterior lateral ventricle and DG, dissociated them into single
cells, and plated them at a constant density of 20 cells per microliter
(4000 viable cells per well). Again, in contrast to the subependymal
neural stem cell-derived colonies, the DG spheres did not give rise to
any secondary sphere colonies. To more directly investigate whether
insufficient CCg levels were responsible for the lack of self-renewing
DG cells in our cultures, we prepared AHP-conditioned media (which does
contain sufficient CCg for cell proliferation) (Taupin et al., 2000)
and used it to supplement primary and secondary DG cell cultures. Even
when cultured in AHP-conditioned medium, DG spheres did not give rise to secondary sphere colonies. This result further suggests that the DG
sphere-initiating cells are not capable of long-term self-renewal and
thus fail to meet one of the cardinal criteria for neural stem cells.
The adult dentate gyrus contains separate neuronal and glial
progenitors, but does not contain a population of
neurosphere-initiating cells that demonstrate multipotentiality
To determine whether the DG sphere-initiating cells (like
subependymal neural stem cells) have the ability to generate multiple neural cell lineages, individual spheres from each neurogenic region
were plated in differentiation conditions and then processed with
immunocytochemistry to determine the relative percentages of neurons,
astrocytes, and oligodendrocytes. Although 100% of individual adult
anterior lateral ventricle neurospheres generated III-tubulin+ neurons,
GFAP+ astrocytes, and
O4+ oligodendrocytes, all of the adult DG
spheres generated astrocytes but did not generate any neurons (i.e.,
did not express MAP2 or III-tubulin) or oligodendrocytes (Fig.
4, Table
1).
View larger version (53K):
[in this window]
[in a new window]
|
Figure 4.
A, B, Comparison of
the size of primary spheres derived from adult anterior lateral
ventricle (subependyma) (A) and dentate gyrus
(B). Note that the DG spheres are smaller than
the aLV spheres. Scale bars, 100 µm.
C-G, Comparison of the ability of adult
aLV- and DG-derived primary spheres to contribute to different neural
cell lineages. Primary adult aLV neurospheres generate both
GFAP+ astrocytes (C) and
III-tubulin+ neurons (E),
whereas adult DG spheres generate only GFAP+
astrocytes (D). Small adult DG clumps generate
only III-tubulin+ neurons
(F). Note that although both cell types can be
derived from adult aLV or DG cultures, the aLV-derived neurons and glia
are generated by a common precursor, whereas the DG-derived neurons and
glia are derived from separate progenitors. Individual spheres or
clumps were plated on MATRIGEL basement membrane matrix in 1% FBS for
7-8 DIV and then processed for immunocytochemistry. Scale bars, 50 µm. G, Neuronal and glial gene expression were
confirmed using RT-PCR. RNA was isolated from differentiated aLV and DG
sphere colonies. Primers were used to detect GFAP (150 bp) and NF-H
(452 bp). Sphere colonies derived from subependymal tissue
(aLV) generate both neuronal
(NF-H) and glial (GFAP) progeny,
whereas colonies derived from dentate gyrus cells (DG)
generate differentiated progeny that express GFAP but do not express
NF-H. Data are representative of at least three separate
experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Mean percentages of neurons, astrocytes, and
oligodendrocytes generated from adult dentate gyrus and anterior
lateral ventricle neurospheres (mean % ± SEM)
|
|
To further confirm the multipotentiality and unipotentiality of
subependymal and DG sphere-initiating cells, respectively, we assayed
differentiated sphere colonies for neuronal and glial gene expression
using RT-PCR. We found that, in agreement with the aforementioned
immunocytochemistry results, the subependymal sphere-initiating cell is
multipotential because its differentiated progeny consist of both
astrocytes (GFAP) and neurons (NF-H) (Fig. 4G). In contrast,
the DG sphere-initiating cell is unipotential, because its
differentiated progeny express GFAP but do not express NF-H.
The lack of neuron generation by adult DG spheres in vitro
was unexpected, because it is well documented that there are cells in
the adult DG that give rise to new neurons in vivo (Altman and Das, 1965, 1966; Cameron et al., 1993; Kuhn et al., 1996; Palmer et
al., 2000). To determine whether neuronal precursors were present in
the primary adult DG cultures, we isolated small (4-16 cells) clones
from these 7 d cultures that had proliferated to a limited degree
(in addition to the few DG spheres that formed, as described above).
Small clones were distinguished from sphere colonies primarily by their
low cell numbers, but also by morphology. Samples of these small clones
were plated in differentiation conditions to determine which cell
lineages could be derived from them. The small clones that survived
immunocytochemical processing generated III-tubulin+ neurons exclusively (Fig.
4F). Additional experiments were performed to
determine whether isolates from other hippocampal regions intermediate between the subependyma and DG contained neuronal clones. Neuronal clones were not detected in isolates containing the hippocampal region
CA3 or posterior lateral ventricle. However, a recent in vivo study detected a relatively small number of mitotically
active neuronal cells in CA regions of the adult hippocampus (Rietze et
al., 2000).
To assay for self-renewal, the small neuronal colonies were
dissociated, but like the glia-producing DG spheres, they never produced secondary colonies. Thus, it was possible to isolate both
neuronal and glial progenitors from adult DG tissue in
vitro, but these two cell types were not generated from a common
precursor cell. The adult DG does not contain neurosphere-initiating
cells that are capable of giving rise to multiple cell lineages, but it
does contain separate populations of restricted progenitors.
The absence of a self-renewing, multipotential cell population in
the adult dentate gyrus is not an artifact of species or of cell
culture technique
Previous reports (Gage et al., 1995; Palmer et al., 1995, 1997)
have suggested that the adult DG contains a population of self-renewing, multipotential cells, often called AHPs (Suhonen et al., 1996). There are three main differences between the protocol in
the referenced reports and that used in this study. The first is a
difference in dissection: previous reports (Palmer et al., 1995, 1997)
have used a gross dissection method that involved isolation of the
entire hippocampus with no reported attempt to exclude surrounding
subependymal tissues. Gage et al. (1995) reported an attempt to avoid
the "subventricular zone," but we feel that this is difficult to
accomplish reliably during gross hippocampal dissection. In contrast,
our study has more precisely isolated the multiple neurogenic zones in
the region of the hippocampus by microdissection of vibratome slices.
The present dissection would appear to allow much better anatomical
distinction of cell sources. Indeed, as a simple test of this in the
present study, gross hippocampal dissection was performed, and
multipotential, self-renewing spheres were isolated that were not
generated from more precise DG microdissection. This is an important
result because it replicates the findings of Gage et al. (1995) and
Palmer et al. (1995, 1997) using a different (neurosphere) culture
assay: gross hippocampal dissection and culture lead to the isolation of a multipotential, self-renewing cell population. The key finding in
the present study is that when the hippocampus is further divided into
specific neurogenic regions, the neural stem cells are more precisely
and correctly localized to regions adjacent to the hippocampus, rather
than to the DG itself.
The second difference is that previous reports (Gage et al., 1995;
Palmer et al., 1995, 1997) used rats, and the data presented here to
this point have been derived from mice. The third major difference is in the use of monolayer cell culture techniques (Gage et
al., 1995; Palmer et al., 1995, 1997) in previous reports, and the use
of nonadherent neurosphere culture conditions in the present study.
We have addressed the species difference by performing identical
experiments in rats as well as mice, and the results remain unchanged.
Adult rat DG yielded a very small number of spheres (1.5 ± 0.3 spheres per 10,000 viable cells) in comparison to regions containing
subependyma, such as the anterior lateral ventricle (199 ± 13 spheres per 10,000 viable cells). Furthermore, these sphere colonies
did not passage to generate secondary spheres, and in differentiation
conditions they produced GFAP+ astrocytes
but did not produce neurons. In contrast, adult rat subependymal cells
from the anterior lateral ventricle (and posterior lateral ventricle,
third ventricle, and hippocampal arch) gave rise to neurospheres that
were multipotential and capable of generating secondary neurospheres
(data not shown). Therefore, we can conclude that the difference
between previous results and the results of the present study is not
attributable to a species difference; indeed, our adult rat data extend
our initial findings from adult mice.
To address the potential confounding effect of different (monolayer vs
neurosphere) cell culture techniques, we applied the identical culture
techniques and media conditions as used in aforementioned reports
[techniques followed according to both Gage et al. (1995) and Palmer
et al. (1995, 1997); see Materials and Methods] to adult tissue
isolated by our dissection methods. It seemed possible that the use of
serum, higher growth factor concentration, different media supplement,
or perhaps an adherent substrate permitted the survival of a
multipotent, self-renewing cell population from the DG that did not
survive the serum-free, nonadherent culture conditions of the sphere
assay. After following the referenced monolayer culture method (testing
both coated and uncoated tissue culture plates), the adult subependymal
cell-containing cultures became confluent, whereas the adult DG cell
cultures, even when maintained for an extended period of time, never
became >40-50% confluent, perhaps suggesting a lower proliferative
or self-renewal potential of the DG cells. After 3-4 weeks of
monolayer culture, the surviving cells were transferred to our standard
neurosphere assay conditions. These adult mouse anterior lateral
ventricle subependymal cell cultures generated multipotential
neurospheres, whereas the adult mouse DG cell cultures did not.
Importantly, the same result was derived from both of these different
culture protocols (Table 2).
Interestingly, the AHPs derived from monolayer cultures of entire
hippocampi (Gage et al., 1995; Palmer et al., 1995, 1997; Suhonen et
al., 1996) readily formed many sphere colonies in vitro, as
discussed below.
View this table:
[in this window]
[in a new window]
|
Table 2.
Summary of dissection technique and culture conditions used
for the comparison of adult subependymal and dentate gyrus primary cell
isolates
|
|
A clonal cell line of adult hippocampal precursors displays
different in vitro characteristics compared with primary
adult rat dentate gyrus cultures
Our data strongly suggest that the adult mouse DG does not contain
a population of neurosphere-initiating cells with neural stem cell
characteristics. However, as discussed above, other studies have
reported the generation of self-renewing, multipotential AHPs derived
from adult rats and the maintenance of these progenitors as clonal cell
lines (Gage et al., 1995; Suhonen et al., 1996; Palmer et al., 1997).
To help understand these fundamental differences between our primary
adult rat cell cultures and monolayer-cultured AHPs, we compared them
directly by plating the cells in a constant density neurosphere assay
in both the presence and absence of growth factors. In contrast to the
prevalent (although unpublished) notion that hippocampal cells do not
readily form neurospheres, in our hands, AHPs generated a large number
of spheres even in the absence of growth factors (789 ± 57).
Furthermore, the AHPs produced higher numbers of spheres than primary
rat tissue, as might be expected of a cell line enriched for neural
progenitors (Fig. 5). Most interesting
was the comparison between primary adult rat DG and anterior lateral
ventricle and AHPs. In the absence of growth factors, the primary adult
DG did not produce any spheres. However, the primary adult anterior
lateral ventricle-derived subependymal cells and AHPs both generated
sphere colonies in the absence of growth factors. These data suggest
that the behavior of AHPs more closely resembles that of primary adult
rat subependymal cells than primary adult rat DG cells and that the
previous reports of adult hippocampal stem cells in fact may have
assayed cells derived from adjacent subependymal tissue and not from
the DG itself.
View larger version (20K):
[in this window]
[in a new window]
|
Figure 5.
Comparison of the sphere-forming ability of
primary tissue from adult rat neurogenic regions and a clonal cell line
of adult hippocampal progenitors in the presence and absence of growth
factors (GF). The data are expressed as the mean
(+SEM) number of spheres generated per 10,000 cells plated (i.e., per
well; density = 20 cells per microliter). Cells were plated in
either serum-free media (no GF) or serum-free
media with EGF and FGF2 (GF). AHPs were compared
with primary adult rat tissue (DG, dentate gyrus;
aLV, anterior lateral ventricle). Resultant spheres were
counted at 7 DIV. Note that both AHPs and primary aLV spheres (12 ± 2) were generated in no GF, whereas zero spheres
arose from adult DG in the absence of growth factors (0.0 ± 0.0).
A small number of DG spheres were generated in GF
(1.5 ± 0.3).
|
|
The early postnatal (PND1) dentate gyrus contains a population of
neurosphere-initiating cells that demonstrate multipotentiality; this
population declines with postnatal age
Because the sphere-initiating cell is relatively rare in the adult
DG, we reasoned that it might be possible to isolate a larger number of
progenitor cells by dissecting out the DG during a stage of development
when a large number of new cells are being born. Most (85%) of the DG
granule cell neurons are generated postnatally, but by the end of the
first 2 postnatal weeks the rate of granule cell birth has diminished
(Schlessinger et al., 1975). In light of these findings, we decided to
isolate the DG (and the subependyma-containing regions: anterior
lateral ventricle, third ventricle, and posterior lateral ventricle)
from early postnatal (PND1) mice in a manner identical to that
described for the adult experiments. Indeed, the PND1 DG generated
30-fold more spheres than the adult DG. To control for differences in
the numbers of postmitotic cells present in the neurogenic regions at
different ages, sphere numbers were compared in terms of the total
number of spheres generated per entire dissected region from each
individual animal (rather than the average number per 10,000 viable
cells) (Fig. 6). These DG spheres were
similar in size (p > 0.01) to those derived
from PND1 anterior lateral ventricle (212.0 ± 9.4 and 216.4 ± 8.4 µm, respectively). Moreover, spheres from both regions
generated neurons, astrocytes, and oligodendrocytes when placed in
differentiation conditions (data not shown). This result provided a
positive control for the adult DG data and, interestingly, suggested
that although the adult DG does not contain multipotential progenitors,
a subpopulation of such cells may be present transiently in the early
postnatal DG. Similarly, it has recently been demonstrated that
oligodendrocyte progenitors from early postnatal optic nerve cultures
can generate multipotential spheres after extensive growth factor
manipulation in vitro (Kondo and Raff, 2000).
Oligodendrocyte progenitors from the optic nerve thus may also
represent a transient progenitor population that can be isolated from
the early postnatal animal but is not maintained into adulthood
(unpublished observations).
View larger version (24K):
[in this window]
[in a new window]
|
Figure 6.
Comparison of the numbers of spheres formed from
PND1, PND10, and adult anterior lateral ventricle (subependyma) and
dentate gyrus. The data are expressed as the mean (+SEM) number of
spheres generated per brain dissection. Tissue was dissected from
adult, PND1, and PND10 brains (n > 40 animals from
5 separate experiments) from viable vibratome sections and cultured in
EGF + FGF2 with B27 supplement at 20 cells per microliter. Spheres were
counted at 7 DIV. Cells from the PND1 DG generated 30-fold more spheres
than adult DG cells, whereas cells from the PND1, PND10, and adult aLV
did not generate significantly different numbers of spheres.
|
|
To test whether the number of multipotential sphere-initiating cells
that can be isolated from the immature DG changes over the first 2 postnatal weeks, we isolated and assayed the DG of PND10 animals. The
number of spheres that can be isolated from the PND10 DG was
intermediate between the PND1 and adult numbers (Fig. 6). The PND1 and
PND10 anterior lateral ventricle also generated more sphere colonies
than adult anterior lateral ventricle, but the difference between the
numbers of anterior lateral ventricle neurospheres generated at these
three ages was not statistically significant, as revealed by one-factor
ANOVA: F(2,76) = 0.99; p > 0.01. In contrast to the anterior lateral
ventricle neurospheres, the numbers of spheres isolated from the DG
show a progressive decrease from PND1 to PND10 to adult
(F(2,65) = 13.03; p < 0.01). Thus, the large decline in the number of multipotential
sphere-initiating cells as a function of postnatal age is specific to
the DG. Furthermore, no remnant of this multipotential population
persists in the DG into adulthood; this stands in direct contrast to
the self-renewing, multipotential stem cell population that can be
isolated from the subependyma throughout postnatal life and does not
undergo diminution with age, even in senescent animals (Tropepe et al., 1997).
| |
DISCUSSION |
The results of this study demonstrate that the adult DG contains a
discrete subpopulation of cells that can form sphere colonies when
isolated in vitro. However, these sphere-initiating cells do
not self-renew in culture and generate only glial progeny; this
subpopulation of cells does not exhibit the fundamental stem cell
properties of long-term self-renewal and multipotentiality. We also
have isolated adult DG neuronal progenitors that similarly show very
limited self-renewal ability and are restricted to the neuronal
lineage. Moreover, we have replicated these results with a monolayer
culture technique. This result appears to be in direct contrast to
previous studies that reported the isolation of hippocampal neural stem
cells (Palmer et al., 1995, 1997) and implies that the new neurons
generated in vivo in the adult DG (Altman and Das, 1965,
1966; Cameron et al., 1993; Kuhn et al., 1996; Palmer et al., 2000)
arise from a population of restricted neuronal progenitors rather than
from a population of stem cells.
In an attempt to explain these conflicting results, we identified and
addressed a number of potential confounding factors. These include
effects of cell density when assessing self-renewal and differences
between the protocol used in the present study and that used in
previous studies (Gage et al., 1995; Palmer et al., 1995, 1997). A
series of experiments that controlled for potential confounding effects
of cell density and CCg level (Taupin et al., 2000) when assaying for
self-renewal did not alter the aforementioned result that the adult DG
progenitors do not exhibit self-renewal in vitro and thus do
not meet one of the key neural stem cell criteria.
Other differences between previous reports of hippocampal stem cell
isolation (Gage et al., 1995; Palmer et al., 1995, 1997) and the
present study include the use of rats (previously) and of mice (in the
present study) and differences in dissection and cell culture
technique. We addressed the species issue by performing identical
experiments and replicating our results in rats. Indeed, this series of
experiments provides further confirmation and extension of our results
in mice and suggests that our findings may be generalized to a wide
range of species.
Differences in dissection and cell culture technique were addressed by
comparing both gross hippocampal dissections and monolayer culture
techniques (Gage et al., 1995; Palmer et al., 1995, 1997) with our
microdissection procedure and use of nonadherent neurosphere culture
conditions. Again, these experiments replicated our initial results:
specific DG isolates do not contain self-renewing, multipotential sphere-initiating cells, whereas gross hippocampal dissections (that
included ventricular subependyma) do contain such cells. Furthermore,
these self-renewing, multipotential cells can be detected in gross
hippocampal isolates whether the tissue is exposed to monolayer or
suspension culture techniques (Table 2).
Regardless of the source of stem cells isolated in previous reports,
there are other alternative explanations for the present results that
have not been ruled out here. These include the possibility that even
at 20 cells per microliter, our culture conditions lack a factor (other
than CCg) necessary for the survival or proliferation of adult DG cells
that is not required for the survival and proliferation of adult
subependymal cells. It is possible that stem cells do exist in the
adult DG, but our culture conditions are simply not appropriate for
their isolation or proliferation. This is an interesting possibility,
because such contrasting behavior to the subependymal neural stem cells
would suggest that there are region-specific stem cells in different
areas of the adult brain. However, this same neurosphere assay has been
sufficient for the isolation of two other very different types of
neural stem cells: those residing in the adult subependyma (Chiasson et
al., 1999) and the retinal stem cells of the adult ciliary margin
(Tropepe et al., 2000). It is possible that the putative adult DG
neural stem cell could be an exceptional case, but there is currently
no evidence to support this possibility.
Because we can isolate very small colonies of neuron-producing
progenitors from adult DG specific cultures, we propose a model whereby
the in vivo adult neurogenesis (and gliogenesis) occurring in the DG results from the limited proliferation and differentiation of
pools of restricted neuronal (and restricted glial) progenitors. Furthermore, we suggest that large numbers of progenitors migrate into
the developing DG perinatally, each capable of only a limited number of
divisions. These separate progenitors divide sequentially in
vivo to generate new neurons (or new astrocytes) in the DG into
adulthood. Because this pool of progenitors decreases over time, DG
neurogenesis declines with age. These unipotential adult progenitor
cells may be derived from the multipotential progenitors that can be
isolated at PND1, or they may be generated perinatally directly from
ventricular zone stem cells without passing through a multipotential stage.
In support of this model, there is evidence from in vivo
studies that the cells responsible for adult DG neurogenesis exhibit properties more characteristic of restricted progenitors than of neural
stem cells. It is known from studies of progenitor and stem cell
populations in the subependyma that an age-related decrease occurs in
the number of restricted progenitors but not in the number of neural
stem cells (Tropepe et al., 1997), thus indicating that progenitor and
stem cell numbers are differentially regulated with age. Interestingly,
an age-related decrease has been found in the proliferation of cells in
the adult DG (Seki and Arai, 1995; Kuhn et al., 1996), suggesting that
this cell population is more likely to consist of restricted
progenitors than of neural stem cells (although the remaining
progenitors can be induced to proliferate after adrenalectomy in older
animals) (Cameron and McKay, 1999).
Our model is supported by the age-related decrease in the number of
multipotent, self-renewing sphere colonies that can be isolated from
the DG (results from the present study). This number declines
postnatally until in the adult DG multipotential sphere colonies can no
longer be isolated, and only separate unipotent neuronal and glial
progenitor populations with very limited self-renewal ability remain.
Importantly, the number of multipotent, self-renewing sphere colonies
isolated from the subependyma surrounding the anterior lateral
ventricle does not change significantly with age. Into adulthood, and
even into senescence (Tropepe et al., 1997), a constant population of
subependymal neurospheres that exhibit the stem cell properties of
long-term self-renewal and multipotentiality can be isolated in
vitro.
There are a number of alternatives to our proposed model. It is
possible that the PND1 DG spheres were initiated by stem cells, but by
adulthood these stem cells have migrated out of the DG proper (and thus
would not be included in the adult DG dissection) and have become
confined to the surrounding subependyma. Although there is no evidence
for this regressive model of postnatal DG stem cell migration, it
remains possible in theory. It is possible also that the surrounding
subependymal stem cells are the source of DG neuronal progenitors
in vivo. This seems unlikely, because none of the studies
that have examined ventricular cell migration with retroviral labeling
assays (Luskin, 1993; Morshead et al., 1994, 1998a; Doetsch and
Alvarez-Buylla, 1996) have reported migration of a retrovirally labeled
cell into the DG. A final alternative mentioned previously is that the
early postnatal DG progenitors are in fact neural stem cells that
persist into adulthood, but by this stage they have changed their
characteristics to the extent that they can no longer be isolated by
our surgical and culture techniques.
Recent studies have provided evidence that neural stem cells in the
adult subependyma may be GFAP+ (Doetsch et
al., 1999; Laywell et al., 2000). The results of the present study
neither support nor oppose these reports, because we did not
prospectively assay the GFAP immunoreactivity of sphere-forming cells.
Certainly, the isolation of a multipotential neurosphere-forming cell
from the adult subependyma is in agreement with the results of the
present study. However, another recent publication (Seri et al., 2001)
suggests that a subpopulation of GFAP+
cells in the adult hippocampus generate neurons. Nevertheless, none of
the experiments in this report were done clonally, and thus there is
presently no in vivo evidence that individual
GFAP+ cells in the subgranular layer are
capable of generating both differentiated neurons and differentiated
astrocytes within this hippocampal region. Indeed, our data suggest
that separate cells in the adult subgranular layer generate neurons and
astrocytes. Moreover, there is no evidence presented by Seri et al.
(2001) that the hippocampal GFAP+ cell
that they follow in vivo possesses the second stem cell characteristic of long-term self-renewal. Interestingly, in accordance with our finding of unipotential glial and neuronal progenitors in the
adult DG cell isolates, unipotential neuronal progenitors also have
been isolated in vitro from adult human DG (Roy et al., 2000).
The present results may have substantive implications for adult neural
stem cell research. We suggest that rather than two separate
(subependymal and subgranular layer) stem cell populations, there is in
fact only one population of authentic (subependymal) neural stem cells
in the adult brain, although the subependymal stem cells and
subgranular layer progenitors have a common anatomical origin during
development. This is important because the adult in vivo
stem cell niche may be restricted to a single subependymal tissue type,
perhaps aiding in the identification and characterization of neural
stem cells and their stem cell niche.
| |
FOOTNOTES |
Received July 18, 2001; revised Nov. 29, 2001; accepted Dec. 18, 2001.
This work was supported by the Canadian Institutes of Health Research.
We thank V. Tropepe, J. Ray, T. D. Palmer, and F. H. Gage as
well as members of our lab for helpful comments on this manuscript. We
also thank T. D. Palmer for helpful advice regarding AHP cell
culture and preparation of AHP-conditioned media.
Correspondence should be addressed to Raewyn M. Seaberg, 8 Taddle Creek
Road, Room 1105, Medical Sciences Building, University of Toronto,
Toronto, Ontario M5S 1A8, Canada. E-mail:
raewyn.seaberg{at}utoronto.ca.
| |
REFERENCES |
-
Altman J,
Das GD
(1965)
Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats.
J Comp Neurol
124:319-336[Web of Science][Medline].
-
Altman J,
Das GD
(1966)
Autoradiographic and histological studies of postnatal neurogenesis. I. A longitudinal investigation of the kinetics, migration and transformation of cells incorporating tritiated thymidine in neonate rats, with special reference to postnatal neurogenesis in some brain regions.
J Comp Neurol
126:337-389[Web of Science][Medline].
-
Bush TG,
Savidge TC,
Freeman TC,
Cox HJ,
Campbell EA,
Mucke L,
Johnson MH,
Sofroniew MV
(1998)
Fulminant jejuno-ileitis following ablation of enteric glia in adult transgenic mice.
Cell
93:189-201[Web of Science][Medline].
-
Cameron HA,
McKay RDG
(1999)
Restoring production of hippocampal neurons in old age.
Nat Neurosci
2:894-897[Web of Science][Medline].
-
Cameron HA,
Woolley CS,
McEwen BS,
Gould E
(1993)
Differentiation of newly born neurons and glia in the dentate gyrus of the adult rat.
Neuroscience
56:337-344[Web of Science][Medline].
-
Chiasson BJ,
Tropepe V,
Morshead CM,
van der Kooy D
(1999)
Adult mammalian forebrain ependymal and subependymal cells demonstrate proliferative potential, but only subependymal cells have neural stem cell characteristics.
J Neurosci
19:4462-4471[Abstract/Free Full Text].
-
Doetsch F,
Alvarez-Buylla A
(1996)
Network of tangential pathways for neuronal migration in adult mammalian brain.
Proc Natl Acad Sci USA
93:14895-14900[Abstract/Free Full Text].
-
Doetsch F,
Caille I,
Lim DA,
Garcia-Verdugo JM,
Alvarez-Buylla A
(1999)
Subventricular zone astrocytes are neural stem cells in the adult mammalian brain.
Cell
97:703-716[Web of Science][Medline].
-
Franklin KBJ,
Paxinos G
(1997)
In: The mouse brain in stereotaxic coordinates. San Diego: Academic.
-
Gage FH,
Coates PW,
Palmer TD,
Kuhn HG,
Fisher LJ,
Suhonen JO,
Peterson DA,
Suhr ST,
Ray J
(1995)
Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain.
Proc Natl Acad Sci USA
92:11879-11883[Abstract/Free Full Text].
-
Gritti A,
Parati EA,
Frolichsthal P,
Galli R,
Wanke E,
Faravelli L,
Morassutti DJ,
Roisen F,
Nickel DD,
Vescovi AL
(1996)
Multipotential stem cells from the adult mouse brain proliferate and self-renew in response to basic fibroblast growth factor.
J Neurosci
16:1091-1100[Abstract/Free Full Text].
-
Kondo T,
Raff M
(2000)
Oligodendrocyte precursor cells reprogrammed to become multipotential CNS stem cells.
Science
289:1754-1757[Abstract/Free Full Text].
-
Kuhn HG,
Dickinson-Anson H,
Gage FH
(1996)
Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation.
J Neurosci
16:2027-2033[Abstract/Free Full Text].
-
Laywell ED,
Rakic P,
Kukekov VG,
Holland EC,
Steindler DA
(2000)
Identification of a multipotential astrocytic stem cell in the immature and adult mouse brain.
Proc Natl Acad Sci USA
97:13883-13888[Abstract/Free Full Text].
-
Lois C,
Alvarez-Buylla A
(1993)
Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia.
Proc Natl Acad Sci USA
90:2074-2077[Abstract/Free Full Text].
-
Lois C,
Alvarez-Buylla A
(1994)
Long-distance neuronal migration in the adult mammalian brain.
Science
264:1145-1148[Abstract/Free Full Text].
-
Luskin MB
(1993)
Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone.
Neuron
11:173-189[Web of Science][Medline].
-
Morshead CM,
Reynolds BA,
Craig CG,
McBurney MW,
Staines WA,
Morassutti D,
Weiss S,
van der Kooy D
(1994)
Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells.
Neuron
13:1071-1082[Web of Science][Medline].
-
Morshead CM,
Craig CG,
van der Kooy D
(1998a)
In vivo clonal analyses reveal the properties of endogenous neural stem cell proliferation in the adult mammalian forebrain.
Development
125:2251-2261[Abstract].
-
Morshead CM,
Tropepe V,
Hadjantonakis AK,
Nagy A,
van der Kooy D
(1998b)
The non-cell autonomous sphere forming ability of neural stem cells.
Soc Neurosci Abstr
24:1528.
-
Palmer TD,
Ray J,
Gage FH
(1995)
FGF-2-responsive neuronal progenitors reside in proliferative and quiescent regions of the adult rodent brain.
Mol Cell Neurosci
6:474-486[Web of Science][Medline].
-
Palmer TD,
Takahashi J,
Gage FH
(1997)
The adult rat hippocampus contains primordial neural stem cells.
Mol Cell Neurosci
8:389-404[Web of Science][Medline].
-
Palmer TD,
Willhoite AR,
Gage FH
(2000)
Vascular niche for adult hippocampal neurogenesis.
J Comp Neurol
425:479-494[Web of Science][Medline].
-
Pernas-Alonso R,
Schaffner AE,
Perrone-Capano C,
Orlando A,
Morelli F,
Hansen CT,
Barker JL,
Esposito B,
Cacucci F,
di Porzio U
(1996)
Early upregulation of neurofilament gene expression in developing spinal cord of the wobbler mouse mutant.
Mol Brain Res
38:267-275[Medline].
-
Potten CS,
Loeffler M
(1990)
Stem cells: attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt.
Development
110:1001-1020[Abstract/Free Full Text].
-
Reynolds BA,
Weiss S
(1992)
Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system.
Science
255:1707-1710[Abstract/Free Full Text].
-
Reynolds BA,
Weiss S
(1996)
Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell.
Dev Biol
175:1-13[Web of Science][Medline].
-
Rietze R,
Poulin P,
Weiss S
(2000)
Mitotically active cells that generate neurons and astrocytes are present in multiple regions of the adult mouse hippocampus.
J Comp Neurol
424:397-408[Web of Science][Medline].
-
Roy NS,
Wang S,
Jiang L,
Kang J,
Benraiss A,
Harrison-Restelli C,
Fraser RAR,
Couldwell WT,
Kawaguchi A,
Okano H,
Nedergaard M,
Goldman S
(2000)
In vitro neurogenesis by progenitor cells isolated from the adult human hippocampus.
Nat Med
6:271-277[Web of Science][Medline].
-
Schlessinger AR,
Cowan WM,
Gottlieb DI
(1975)
An autoradiographic study of the time of origin and the pattern of granule cell migration in the dentate gyrus of the rat.
J Comp Neurol
159:149-176[Web of Science][Medline].
-
Seki T,
Arai Y
(1995)
Age-related production of new granule cells in the adult dentate gyrus.
NeuroReport
6:2479-2482[Web of Science][Medline].
-
Seri B,
Garcia-Verdugo JM,
McEwen BS,
Alvarez-Buylla A
(2001)
Astrocytes give rise to new neurons in the adult mammalian hippocampus.
J Neurosci
21:7153-7160[Abstract/Free Full Text].
-
Suhonen JO,
Peterson DA,
Ray J,
Gage FH
(1996)
Differentiation of adult hippocampus-derived progenitors into olfactory neurons in vivo.
Nature
383:624-627[Medline].
-
Taupin P,
Ray J,
Fischer WH,
Suhr ST,
Hakansson K,
Grubb A,
Gage FH
(2000)
FGF-2-responsive neural stem cell proliferation requires CCg, a novel autocrine/paracrine cofactor.
Neuron
28:385-397[Web of Science][Medline].
-
Tropepe V,
Craig CG,
Morshead CM,
van der Kooy D
(1997)
Transforming growth factor-
 null and senescent mice show decreased neural progenitor cell proliferation in the forebrain subependyma.
J Neurosci
17:7850-7859[Abstract/Free Full Text]. -
Tropepe V,
Sibilia M,
Ciruna BG,
Rossant J,
Wagner EF,
van der Kooy D
(1999)
Distinct neural stem cells proliferate in response to EGF and FGF2 in the developing mouse telencephalon.
Dev Biol
208:166-188[Web of Science][Medline].
-
Tropepe V,
Coles BLK,
Chiasson BJ,
Horsford DJ,
Elia AJ,
McInnes RR,
van der Kooy D
(2000)
Retinal stem cells in the adult mammalian eye.
Science
287:2032-2036[Abstract/Free Full Text].
-
Weiss S,
Reynolds BA,
Vescovi AL,
Morshead C,
Craig CG,
van der Kooy D
(1996)
Is there a neural stem cell in the mammalian forebrain?
Trends Neurosci
19:387-393[Web of Science][Medline].
-
Zhang S-C,
Lipsitz D,
Duncan ID
(1998)
Self-renewing canine oligodendroglial progenitor expanded as oligospheres.
J Neurosci Res
54:181-190[Web of Science][Medline].
Copyright © 2002 Society for Neuroscience 0270-6474/02/2251784-10$05.00/0
This article has been cited by other articles:
|
|
|
|
 
H. Kong, Y. Fan, J. Xie, J. Ding, L. Sha, X. Shi, X. Sun, and G. Hu
AQP4 knockout impairs proliferation, migration and neuronal differentiation of adult neural stem cells
J. Cell Sci.,
December 15, 2008;
121(24):
4029 - 4036.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. G. Rabaneda, M. Carrasco, M. A. Lopez-Toledano, M. Murillo-Carretero, F. A. Ruiz, C. Estrada, and C. Castro
Homocysteine inhibits proliferation of neuronal precursors in the mouse adult brain by impairing the basic fibroblast growth factor signaling cascade and reducing extracellular regulated kinase 1/2-dependent cyclin E expression
FASEB J,
November 1, 2008;
22(11):
3823 - 3835.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. A. Bonaguidi, C.-Y. Peng, T. McGuire, G. Falciglia, K. T. Gobeske, C. Czeisler, and J. A. Kessler
Noggin Expands Neural Stem Cells in the Adult Hippocampus
J. Neurosci.,
September 10, 2008;
28(37):
9194 - 9204.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. J. Ohab and S. T. Carmichael
Poststroke Neurogenesis: Emerging Principles of Migration and Localization of Immature Neurons
Neuroscientist,
August 1, 2008;
14(4):
369 - 380.
[Abstract]
[PDF]
|
|
|
|
|
|
|
C. Galichet, F. Guillemot, and C. M. Parras
Neurogenin 2 has an essential role in development of the dentate gyrus
Development,
June 1, 2008;
135(11):
2031 - 2041.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. L. Walker, A. White, D. M. Black, R. H. Wallace, P. Sah, and P. F. Bartlett
Latent Stem and Progenitor Cells in the Hippocampus Are Activated by Neural Excitation
J. Neurosci.,
May 14, 2008;
28(20):
5240 - 5247.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kolodziej, S. Schulz, A. Guyon, D.-F. Wu, M. Pfeiffer, V. Odemis, V. Hollt, and R. Stumm
Tonic Activation of CXC Chemokine Receptor 4 in Immature Granule Cells Supports Neurogenesis in the Adult Dentate Gyrus
J. Neurosci.,
April 23, 2008;
28(17):
4488 - 4500.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Nakafuku, M. Nagao, A. Grande, and A. Cancelliere
Revisiting neural stem cell identity
PNAS,
January 22, 2008;
105(3):
829 - 830.
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. A Riquelme, E. Drapeau, and F. Doetsch
Brain micro-ecologies: neural stem cell niches in the adult mammalian brain
Phil Trans R Soc B,
January 12, 2008;
363(1489):
123 - 137.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. B Dirks
Brain tumour stem cells: the undercurrents of human brain cancer and their relationship to neural stem cells
Phil Trans R Soc B,
January 12, 2008;
363(1489):
139 - 152.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. R Yeh, X. Zhang, and M. C Nagano
Establishment of a Short-Term In Vitro Assay for Mouse Spermatogonial Stem Cells
Biol Reprod,
November 1, 2007;
77(5):
897 - 904.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. V. Pfenninger, T. Roschupkina, F. Hertwig, D. Kottwitz, E. Englund, J. Bengzon, S. E. Jacobsen, and U. A. Nuber
CD133 Is Not Present on Neurogenic Astrocytes in the Adult Subventricular Zone, but on Embryonic Neural Stem Cells, Ependymal Cells, and Glioblastoma Cells
Cancer Res.,
June 15, 2007;
67(12):
5727 - 5736.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Willaime-Morawek, R. M. Seaberg, C. Batista, E. Labbe, L. Attisano, J. A. Gorski, K. R. Jones, A. Kam, C. M. Morshead, and D. van der Kooy
Embryonic cortical neural stem cells migrate ventrally and persist as postnatal striatal stem cells
J. Cell Biol.,
October 9, 2006;
175(1):
159 - 168.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
U Shivraj Sohur, J. G Emsley, B. D Mitchell, and J. D Macklis
Adult neurogenesis and cellular brain repair with neural progenitors, precursors and stem cells
Phil Trans R Soc B,
September 29, 2006;
361(1473):
1477 - 1497.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. M. Ganat, J. Silbereis, C. Cave, H. Ngu, G. M. Anderson, Y. Ohkubo, L. R. Ment, and F. M. Vaccarino
Early Postnatal Astroglial Cells Produce Multilineage Precursors and Neural Stem Cells In Vivo.
J. Neurosci.,
August 15, 2006;
26(33):
8609 - 8621.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Encinas, A. Vaahtokari, and G. Enikolopov
Fluoxetine targets early progenitor cells in the adult brain
PNAS,
May 23, 2006;
103(21):
8233 - 8238.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
X. Fontana, J. Nacher, E. Soriano, and J. A. del Rio
Cell Proliferation in the Adult Hippocampal Formation of Rodents and its Modulation by Entorhinal and Fimbria-Fornix Afferents
Cereb Cortex,
March 1, 2006;
16(3):
301 - 312.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. T. Ghashghaei, J. Weber, L. Pevny, R. Schmid, M. H. Schwab, K. C. K. Lloyd, D. D. Eisenstat, C. Lai, and E. S. Anton
The role of neuregulin-ErbB4 interactions on the proliferation and organization of cells in the subventricular zone
PNAS,
February 7, 2006;
103(6):
1930 - 1935.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. R. Smukler, S. B. Runciman, S. Xu, and D. van der Kooy
Embryonic stem cells assume a primitive neural stem cell fate in the absence of extrinsic influences
J. Cell Biol.,
January 3, 2006;
172(1):
79 - 90.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. D. Bull and P. F. Bartlett
The Adult Mouse Hippocampal Progenitor Is Neurogenic But Not a Stem Cell
J. Neurosci.,
November 23, 2005;
25(47):
10815 - 10821.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. T. Haskell and A.-S. LaMantia
Retinoic Acid Signaling Identifies a Distinct Precursor Population in the Developing and Adult Forebrain
J. Neurosci.,
August 17, 2005;
25(33):
7636 - 7647.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Merchant, M. Evangelista, S.-M. Luoh, G. D. Frantz, S. Chalasani, R. A. D. Carano, M. van Hoy, J. Ramirez, A. K. Ogasawara, L. M. McFarland, et al.
Loss of the Serine/Threonine Kinase Fused Results in Postnatal Growth Defects and Lethality Due to Progressive Hydrocephalus
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7054 - 7068.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Nakano, A. A. Paucar, R. Bajpai, J. D. Dougherty, A. Zewail, T. K. Kelly, K. J. Kim, J. Ou, M. Groszer, T. Imura, et al.
Maternal embryonic leucine zipper kinase (MELK) regulates multipotent neural progenitor proliferation
J. Cell Biol.,
August 1, 2005;
170(3):
413 - 427.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T.-W. Wang, H. Zhang, and J. M. Parent
Retinoic acid regulates postnatal neurogenesis in the murine subventricular zone-olfactory bulb pathway
Development,
June 15, 2005;
132(12):
2721 - 2732.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. N. Abrous, M. Koehl, and M. Le Moal
Adult Neurogenesis: From Precursors to Network and Physiology
Physiol Rev,
April 1, 2005;
85(2):
523 - 569.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. E. Kippin, D. J. Martens, and D. van der Kooy
p21 loss compromises the relative quiescence of forebrain stem cell proliferation leading to exhaustion of their proliferation capacity
Genes & Dev.,
March 15, 2005;
19(6):
756 - 767.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Palma, D. A. Lim, N. Dahmane, P. Sanchez, T. C. Brionne, C. D. Herzberg, Y. Gitton, A. Carleton, A. Alvarez-Buylla, and A. R. i Altaba
Sonic hedgehog controls stem cell behavior in the postnatal and adult brain
Development,
January 15, 2005;
132(2):
335 - 344.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Jin, L. Xie, S. H. Kim, S. Parmentier-Batteur, Y. Sun, X. O. Mao, J. Childs, and D. A. Greenberg
Defective Adult Neurogenesis in CB1 Cannabinoid Receptor Knockout Mice
Mol. Pharmacol.,
August 1, 2004;
66(2):
204 - 208.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. Caille, B. Allinquant, E. Dupont, C. Bouillot, A. Langer, U. Muller, and A. Prochiantz
Soluble form of amyloid precursor protein regulates proliferation of progenitors in the adult subventricular zone
Development,
May 1, 2004;
131(9):
2173 - 2181.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. A. Markakis, T. D. Palmer, L. Randolph-Moore, P. Rakic, and F. H. Gage
Novel Neuronal Phenotypes from Neural Progenitor Cells
J. Neurosci.,
March 24, 2004;
24(12):
2886 - 2897.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. E. Kippin, S. W. Cain, Z. Masum, and M. R. Ralph
Neural Stem Cells Show Bidirectional Experience-Dependent Plasticity in the Perinatal Mammalian Brain
J. Neurosci.,
March 17, 2004;
24(11):
2832 - 2836.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Palma and A. R. i Altaba
Hedgehog-GLI signaling regulates the behavior of cells with stem cell properties in the developing neocortex
Development,
January 15, 2004;
131(2):
337 - 345.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Kim and C. M. Morshead
Distinct Populations of Forebrain Neural Stem and Progenitor Cells Can Be Isolated Using Side-Population Analysis
J. Neurosci.,
November 19, 2003;
23(33):
10703 - 10709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Gustafsson, O. Lindvall, and Z. Kokaia
Intraventricular Infusion of TrkB-Fc Fusion Protein Promotes Ischemia-Induced Neurogenesis in Adult Rat Dentate Gyrus
Stroke,
November 1, 2003;
34(11):
2710 - 2715.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Imitola, E. Y. Snyder, and S. J. Khoury
Genetic programs and responses of neural stem/progenitor cells during demyelination: potential insights into repair mechanisms in multiple sclerosis
Physiol Genomics,
August 15, 2003;
14(3):
171 - 197.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Dihne, C. Bernreuther, M. Sibbe, W. Paulus, and M. Schachner
A New Role for the Cell Adhesion Molecule L1 in Neural Precursor Cell Proliferation, Differentiation, and Transmitter-Specific Subtype Generation
J. Neurosci.,
July 23, 2003;
23(16):
6638 - 6650.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. van der Flier, S. P. M. Geelen, J. L. L. Kimpen, I. M. Hoepelman, and E. I. Tuomanen
Reprogramming the Host Response in Bacterial Meningitis: How Best To Improve Outcome?
Clin. Microbiol. Rev.,
July 1, 2003;
16(3):
415 - 429.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Imura, H. I. Kornblum, and M. V. Sofroniew
The Predominant Neural Stem Cell Isolated from Postnatal and Adult Forebrain But Not Early Embryonic Forebrain Expresses GFAP
J. Neurosci.,
April 1, 2003;
23(7):
2824 - 2832.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION
Substance via MeSH
