 |
Previous Article | Next Article 
The Journal of Neuroscience, March 15, 2002, 22(6):2206-2214
Neuregulin Expression at Neuromuscular Synapses Is Modulated by
Synaptic Activity and Neurotrophic Factors
Jeffrey A.
Loeb1,
Abdelkrim
Hmadcha1,
Gerald
D.
Fischbach3,
Susan J.
Land2, and
Vaagn L.
Zakarian1
1 Department of Neurology and Center for Molecular
Medicine and Genetics and 2 Institute of Environmental
Health Sciences, Wayne State University School of Medicine, Detroit,
Michigan 48201, and 3 Columbia University, College of
Physicians and Surgeons, New York, New York 10032
 |
ABSTRACT |
The proper formation of neuromuscular synapses requires ongoing
synaptic activity that is translated into complex structural changes to
produce functional synapses. One mechanism by which activity could be
converted into these structural changes is through the regulated
expression of specific synaptic regulatory factors. Here we demonstrate
that blocking synaptic activity with curare reduces synaptic neuregulin
expression in a dose-dependent manner yet has little effect on synaptic
agrin or a muscle-derived heparan sulfate proteoglycan. These changes
are associated with a fourfold increase in number and a twofold
reduction in average size of synaptic acetylcholine receptor clusters
that appears to be caused by excessive axonal sprouting with the
formation of new, smaller acetylcholine receptor clusters. Activity
blockade also leads to threefold reductions in brain-derived
neurotrophic factor and neurotrophin 3 expression in muscle without
appreciably changing the expression of these same factors in spinal
cord. Adding back these or other neurotrophic factors restores synaptic
neuregulin expression and maintains normal end plate band architecture
in the presence of activity blockade. The expression of neuregulin protein at synapses is independent of spinal cord and muscle neuregulin mRNA levels, suggesting that neuregulin accumulation at synapses is
independent of transcription. These findings suggest a local, positive
feedback loop between synaptic regulatory factors that translates
activity into structural changes at neuromuscular synapses.
Key words:
neuregulin; neuromuscular; synapse; neurotrophin; BDNF; activity; GDNF; NT-3
 |
INTRODUCTION |
During synaptogenesis, an excess
number of synaptic connections are reduced to a smaller number of
functional connections dependent on their degree of activity; those
connections that are more active become more stable, and those that are
less active deteriorate. One of the best studied synapses is this
regard is that between a motor neuron and a muscle cell or the
neuromuscular junction (NMJ; Sanes and Lichtman, 1999 ). In addition to
many presynaptic and postsynaptic proteins important for acetylcholine signal transduction, a growing list of regulatory factors have been
discovered that may provide the necessary modulatory signals to aid in
this selection process.
In the anterograde direction, motor neurons promote the accumulation of
acetylcholine receptors (AChRs) at NMJs through at least two regulatory
factors, including a specific form of agrin that leads to the
clustering of preexisting AChRs (Ruegg and Bixby, 1998 ) and
AChR-inducing activity (ARIA), which is made in motor neurons,
transported down axons (Loeb et al., 1999 ), and released and
concentrated in the synaptic basal lamina (Burgess et al., 1995 ;
Goodearl et al., 1995 ; Loeb and Fischbach, 1995 ; Loeb et al., 1998 ,
1999 ; Meier et al., 1998 ; Wang et al., 2000 ). There it induces the
synthesis of new AChRs necessary to maintain proper synaptic function
(Sandrock et al., 1997 ). ARIA is derived from the NRG-1 gene
and belongs to a large family of alternatively spliced growth and
differentiation factors now called neuregulins (NRGs; Fischbach and
Rosen, 1997 ).
A number of retrograde regulatory factors are produced in muscle;
however, their individual effects on NMJ development are less clear.
Brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4,
and glial cell line-derived neurotrophic factor (GDNF) are expressed in
muscle during synaptic development (Funakoshi et al., 1995 ; Moore et
al., 1996 ; Sanchez et al., 1996 ) and transported to motor neuron cell
bodies (Koliatsos et al., 1993 ; Leitner et al., 1999 ; Watson et al.,
1999 ). They support the survival of motor neurons (Henderson et al.,
1993 , 1994 ; Koliatsos et al., 1993 ; Moore et al., 1996 ; Sanchez et al.,
1996 ; Alcantara et al., 1997 ) and, for BDNF and NT-4, promote synaptic
differentiation (Gonzalez et al., 1999 ).
Electrical activity is critical in orchestrating the normal formation
of neuromuscular synapses. Blocking muscle activity with curare
prevents motor neuron cell death, the pruning of early synaptic
connections, and the loss of extrajunctional AChRs (Chang et al., 1975 ;
Burden, 1977 ; Oppenheim et al., 1989 ; Hory-Lee and Frank, 1995 ). One
way that activity may be translated into synaptic structure is through
the regulated expression of these regulatory factors. For example, NT-4
expression in postnatal rat muscle increases with activity (Funakoshi
et al., 1995 ), and the neurotrophic factors BDNF, NT-3, NT-4, and GDNF
rapidly and selectively increase NRG in cultured motor neurons, raising
the possibility that this may be part of a positive feedback loop (Loeb
and Fischbach, 1997 ).
To determine the relationship among synaptic activity, neurotrophic
factors, and synaptic structure, we developed an in vivo experimental system in which we measure regulatory factor expression on
both sides of the synapse in the presence and absence of normal synaptic activity. Despite early embryonic expression of NRG in chick
motor neuron axons at embryonic day 3 (E3), NRG is not detectable in
the synaptic basal lamina until E16 during synapse elimination (Burden,
1977 ; Loeb et al., 1999 ). This late accumulation is concurrent with a
concentration of basal lamina heparan sulfate proteoglycans (HSPGs),
including agrin (Fallon and Gelfman, 1989 ; Loeb et al., 1999 ), that
bind to the heparin-binding domain of NRG (Loeb and Fischbach, 1995 ;
Meier et al., 1998 ) and thus focally enrich it at synapses. Using this
system, we demonstrate that synaptic NRG can be regulated by an
interplay between synaptic activity and neurotrophic factors. Activity
blockade with curare significantly reduces synaptic NRG accumulation,
reduces muscle neurotrophic factor expression, and produces a dramatic
change in end plate band architecture. Both NRG accumulation and normal
end plate band architecture were restored by adding back exogenous
neurotrophic factors. The accumulation of NRG was independent of
transcription, suggesting that local cues at individual synaptic
contacts may contain all of the signaling information necessary to
release NRG.
 |
MATERIALS AND METHODS |
Reagents and antibodies. All pharmacologic agents
were purchased from Sigma (St. Louis, MO) unless stated otherwise.
Rhodamine and Bodipy-labeled -bungarotoxin were from Molecular
Probes (Eugene, OR); secondary antibodies coupled with either Cy2 or
Cy3 were from Amersham Biosciences (Piscataway, NJ). Affinity-purified polyclonal antiserum against the extracellular domain of NRG (183N) was
prepared as described previously (Loeb et al., 1999 ). Monoclonal antibodies against SV2 were a generous gift from Kathy Buckley (Harvard Medical School, Boston, MA), and those against agrin (6D2)
were a generous gift from Willi Halfter (University of Pittsburgh, Pittsburgh, PA). Mouse monoclonal IgG supernatant against
neurofilaments (RT-97) was obtained from the Developmental Studies
Hybridoma Bank at the University of Iowa (Iowa City, IA) under contract N01-HD-7-3263 from the National Institute of Child Health and Human
Development. BDNF, NT-3, and GDNF were generous gifts from Amgen
(Thousand Oaks, CA) and were diluted in 0.2% BSA and PBS before use.
Eggs and in ovo treatments. Fertilized chicken
eggs were obtained from Michigan State University Poultry Farms (East
Lansing, MI) and incubated at 37°C in a Kuhl (Flemington, NJ) rocking
humidified incubator at 50% humidity. Addition of chemical agents and
neurotrophic factors was made by opening the egg on the top and tearing
a small hole through the air sac without damaging underlying blood
vessels. The eggs were sealed after each treatment using transparent
plastic packing tape. At indicated times, tissues were processed for
total RNA or immunohistochemistry as described below.
Activity blockade. Stock solutions of
D-tubocurarine were prepared in sterile saline at 20 mg/ml.
Aliquots containing the indicated total amounts were added daily
together with or without neurotrophic factors. The total amount of
liquid added each day for a given experiment was the same for all eggs.
Activity blockade was assessed daily before and after the addition of
curare by noting the absence of any movements over a 2 min period. The
paralytic concentration of curare used produced complete paralysis in
most embryos at all times examined by these measurements. No attempts were made to quantify numbers of movements in partially paralyzed animals, as described recently by Oppenheim et al. (2000) .
Curare concentrations were determined empirically and from previous
literature requiring 3 mg/d for complete paralysis and 0.3 mg/d for
partial activity blockade (Hory-Lee and Frank, 1995 ). Similarly, 50 µg/d -bungarotoxin was required for paralysis.
Immunohistochemistry and quantitative analysis of synapses.
Anterior latisimus dorsi (ALD) muscles were exposed by removing the
skin, and a small piece of Kimwipe soaked in fresh 4% paraformaldehyde in PBS was placed on top of the muscles for 40 min to fix the muscle
in situ to maintain normal muscle shape. Overfixation or underfixation led to a reduction in NRG staining with 183N antisera. This was followed by overnight washing twice in cold PBS and then placing in 30% sucrose before preparing 20 µm frozen sections on
Superfrost slides (Fisher Scientific, Pittsburgh, PA) on a cryostat.
Sections were washed in PBS for 20 min, followed by blocking with 10%
normal goat serum in PBS for 30 min. Antibody solutions prepared in the
same blocking solution were added in a humidified chamber as described
previously (Loeb et al., 1999 ). The following dilutions were used: 183N
at 1:100, SV2 at 1:10, RT-97 (neurofilament) at 1:10, 6D2 at 1:1, goat
anti-mouse Cy3 or Cy2 at 1:500, and goat anti-rabbit Cy3 or Cy2 at
1:500. For each experiment and figure, all sections were derived from
the same experiment and stained in parallel and repeated at least three times.
Digital images were obtained on a Nikon Eclipse 600 epifluorescent
microscope using rhodamine or FITC filters, unless stated otherwise,
with a Princeton Instruments Micromax 5 MHz cooled CCD camera.
Quantitation of synaptic number and size were performed using Metamorph
Software (Universal Imaging, West Chester, PA). To count the number and
average size of synapses per 10,000 µm2,
nonsaturated images of ALD muscle stained with -bungarotoxin were
captured digitally for the same time. To normalize for staining intensity differences from slide to slide, the threshold of each image
was adjusted to account for the relative background intensity of the
muscle so that only synapses were selected as objects. For each image,
the total intensity (sum of each pixel intensity within a region) and
total area measurements of ~40 synapses were selected that could be
seen in their entirety. This result yielded an average synapse size and
intensity for these whole synapses. This value was used to measure the
total number of synapses an image by dividing the total intensity of
signal greater than the thresholded value by the average intensity for
a single synapse. Finally, the total muscle surface area was measured,
and the ratio of total number of synapses per 10,000 µm2 was thus calculated and found to
represent best the number of synapses obtained by counting manually.
This process was repeated for at least three images for each condition
analyzed and expressed as an average ± 1 SD. Statistical
significance was defined as p < 0.05 using a
two-tailed t test assuming unequal variances.
Real-time quantitative PCR. We measured mRNA levels of BDNF,
NT-3, and GDNF using reverse transcription (RT)-PCR. Total RNA was
isolated by homogenization in Ultraspect (Biotecx Labs, Houston, TX)
and prepared according to the manufacturer's instructions. RNA samples
used for RT-PCR were cleaned up further and treated with DNase using
RNeasy columns purchased from Qiagen (Valencia, CA) and quantified
using the Ribogreen method of Molecular Probes. We used a real-time
kinetic analysis for PCR products using the SYBR green system by
Applied Biosystems (Foster City, CA) on an Applied Biosystems Prism
7700 sequence detection system in quadruplicate using samples from
multiple animals. On chick muscle, this system gives linear
measurements over three orders of magnitude for each of the primer sets
and for chick glyceraldehyde-3-phosphate dehydrogenase (GAPDH). To
adjust for RNA/cDNA concentration differences, each sample (in
quadruplicate) was normalized to the rate of chicken GAPDH amplicon
synthesis from the same RNA sample. Minus RT reactions (adding the same
amount of RNA with RT treatment) were performed routinely in parallel
to be certain that our samples were not contaminated with genomic DNA.
The following primer pairs were selected using Applied Biosystems
Primer-Express software: GDNF chick-172 forward (F),
ATGCCAGAGGATTACCCAGATC; GDNF chick-317 reverse (R),
TCTACGTTTGTGGCTGCACTTT; BDNF chick-233F, AGCCCAGTGAGGAAAACAAGG; BDNF chick-363R, CATGTTTGCAGCATCCAGGT; NT-3 chick-431F,
CACCACTGTACCTCACAGAGGATT; NT-3 chick-578R, GATGATTTGTCCGTGACCCATA;
GAPDH chick-445F, TGATGGGTGTCAACCATGAGA; and GAPDH chick-591R,
TGGCATGGA CAGTGGTCATAA.
Northern blot analysis and quantitation. Northern blots for
NRG using a full-length proARIA-1 2.3 kb probe (Falls et al., 1993 )
were performed as described previously and normalized to GAPDH
(Loeb and Fischbach, 1997 ). Data were quantified either using a
PhosphorImager (Amersham Biosciences) or on nonsaturated x-ray films
using Metamorph image analysis software (Universal Imaging).
 |
RESULTS |
We examined the effects of nonparalytic (low-dose) and paralytic
(high-dose) concentrations of the AChR antagonist curare, applied daily
from E14 through E18, on synaptic structure of the polyinnervated ALD
muscle. Dose-dependent changes in synaptic structure were observed both
presynaptically, stained for SV2, and postsynaptically, stained with
-bungarotoxin (Fig.
1A), as described
previously (Srihari and Vrbova, 1978 ; Oppenheim et al., 1989 ). On
low-power magnification, there was a marked disorganization of end
plate band architecture that increased with curare dose. Where ordered,
linear arrays of synapses depicting the course of the nerve across the
muscle were clearly seen in the control muscle, synapses in muscles
treated with high-dose curare were distributed haphazardly, making it
almost impossible to predict the course of the nerve. The low-dose
curare showed a pattern in between the control and high-dose
curare-treated muscle. Higher-magnification views (Fig.
1A, insets), together with neurofilament
double-labeling studies (shown in Fig. 6A), suggest
that this disorganization with activity blockade is attributable to
increased branching and sprouting of terminal axons. The
higher-magnification views also reveal that activity blockade produces
more numerous AChR clusters of variable size, most of which are
associated with nerve endings. Although there may also be some AChR
clusters not associated with nerve endings, most of these clusters
appear to have been produced from the sprouting of distal axons to
produce new synapses. Quantitation of the number of synapses per unit
area and the average size of AChR clusters using digital morphometric
analysis revealed a fourfold increase in the total number of synapses
with a corresponding twofold reduction in average size of the AChR
clusters with the high dose of curare (Fig. 1B,C).
Although there was some atrophy in muscle thickness seen with only with
the high curare concentration, the total surface area of sections taken
through the muscle was not appreciably reduced and cannot fully account
for the changes seen.

View larger version (105K):
[in this window]
[in a new window]
|
Figure 1.
Activity blockade with curare results in a
disorganized end plate band architecture with an increase in number and
a decrease in average synaptic size. A, Chick embryos were
treated daily with saline (CONTROL), a nonparalytic
concentration (0.3 mg/d) of D-tubocurarine (LOW
CURARE), or a paralytic dose (3 mg/d) of
D-tubocurarine (HIGH CURARE) for 4 d
from E14 to E18. ALD muscles at E18 were double-labeled with rhodamine
-bungarotoxin (BTX), which labels AChRs, and
SV2, which labels synaptic vesicles in the nerve terminals.
Insets, Higher-magnification views of AChR clusters and
nerve terminals showing that with curare treatment, a mixture of AChR
clusters of variable size is seen, and most of these are associated
with nerve terminals. Scale bar, 50 µm. Quantitation of the number
(B) and size (C) of
postsynaptic AChRs stained with -bungarotoxin revealed a fourfold to
fivefold increase in the number of postsynaptic AChR clusters
and a twofold reduction in the average size of the AChR clusters.
*Significantly different from the control; p = 0.0018 (B, HIGH CURARE), 0.048 (C, LOW CURARE), and 0.016 (C, HIGH CURARE).
|
|
As a first step toward determining the molecular mediators of this
change in synaptic organization, we monitored synaptic NRG expression
in these muscles (Fig. 2, top
panel). With increasing amounts of curare, a dose-dependent
reduction in synaptic NRG protein expression was seen so that, at
paralytic concentrations of curare, little to no NRG could be detected
at synapses. A paralytic dose of another nondepolarizing antagonist,
-bungarotoxin, also reduced the accumulation of NRG at synapses
(data not shown). To be certain that the reduction in NRG expression
was not attributable to changes in the synaptic basal lamina that might
reduce NRG-binding sites, we labeled adjacent muscle sections with
antibodies against two synaptic HSPGs: agrin and a muscle-specific HSPG
(Bayne et al., 1984 ), shown in Figure 2, bottom four panels.
Each of these was double-labeled with -bungarotoxin to colocalize
HSPG staining to synaptic regions, because these proteoglycans are
expressed both synaptically and extrasynaptically. These results show
that both HSPGs remain concentrated at synapses with activity blockade and, in fact, often showed a more intense pattern of staining at higher
curare concentrations. The same result for agrin was observed using a
different antibody, 5B1 (data not shown; Fallon and Gelfman, 1989 ).

View larger version (156K):
[in this window]
[in a new window]
|
Figure 2.
Activity blockade blocks synaptic NRG expression
in a dose-dependent manner but has little effect on synaptic HSPGs. NRG
immunoreactivity (top panel) at neuromuscular
synapses was assessed with affinity-purified 183N antisera on the same
ALD muscle sections shown in Figure 1 treated with saline or low or
high doses of curare. A dose-dependent reduction in NRG
immunoreactivity was noted so that, at paralytic doses of curare,
little to no NRG immunoreactivity was detected. Agrin immunoreactivity
at neuromuscular synapses was measured using the monoclonal antibody
6D2 double-labeled with Bodipy- -bungarotoxin (BTX;
middle two panels), and a muscle HSPG antibody
(33) was double-labeled with Bodipy- -bungarotoxin
(bottom two panels). Scale bars, 50 µm.
|
|
The effect of activity blockade on synaptic NRG accumulation was
examined further and is shown in Figure
3. In this experiment, replicate embryos
were treated with either paralytic doses of curare or saline as a
control from E14 to E17. Some embryos were analyzed at E17, showing
that those treated with curare had no NRG at synapses, but those with
the saline control had low but detectable levels of synaptic NRG. On
subsequent days from E17 to E19, animals were either further treated
with the same agents or reversed so that some initially treated with
curare now were switched to saline and those in saline were switched to
curare. In each of these conditions, activity blockade was confirmed
each day by noting the absence or presence of movements of the
curare-treated embryos. Embryos with continued treatment with curare
showed no detectable NRG immunoreactivity at synapses, and those
treated with saline from E14 to E19 showed an intense pattern of NRG
staining, indicating additional NRG accumulation at synapses from E17
to E19. The embryos initially treated with saline and then curare showed no additional increase in NRG staining, suggesting that no
additional NRG accumulation occurred after the addition of curare. The
embryos first treated with curare and then saline showed that with
reversal of the activity blockade, NRG accumulation at synapses
resumed. These results demonstrate that NRG accumulation at synapses is
closely coupled to synaptic activity and can resume once activity
blockade is discontinued, but once released into the synaptic cleft,
NRG remains concentrated there through interactions with the synaptic
basal lamina.

View larger version (94K):
[in this window]
[in a new window]
|
Figure 3.
Synaptic NRG expression resumes after reversal of
activity blockade. Chicken embryos were treated with either paralytic
concentrations of curare (3 mg/d) or the same volume of saline from E14
to E17. Some of the embryos were examined on E17, showing that activity
blockade blocked the appearance of NRG immunoreactivity compared with
untreated embryos that expressed submaximal, synaptic NRG levels. All
muscle sections were double-labeled at the same time with 183N
antibodies against NRG and -bungarotoxin (BTX)
for localization of synapses. Each group was either continued with the
same treatment or switched to the opposite treatment from E17 to E19.
Those that were in saline for the entire period from E14 to E19 had
maximal NRG staining, whereas curare treatment from E17 to E19
prevented any additional increase in NRG staining. Those animals
maintained in curare for the entire period had no NRG staining at
synapses, whereas those switched from curare to saline recovered their
ability to release NRG at synapses. Scale bar, 20 µm.
|
|
We have shown previously that the neurotrophic factors BDNF, NT-3, and
GDNF, which are expressed in muscle during synaptogenesis, regulate NRG
mRNA and protein expression in motor neurons in vitro (Loeb
and Fischbach, 1997 ). Because they may have similar effects in
vivo, we investigated here whether these neurotrophic factors are
also regulated by electrical activity. If so, we might predict that
blocking synaptic activity postsynaptically would result in a reduction
of muscle neurotrophic factor expression that, in turn, may lead to a
reduction of presynaptic NRG expression in motor neurons. Consistently,
using real-time, quantitative RT-PCR on ALD muscle, we found threefold
reductions in BDNF and NT-3 mRNA levels in curare-treated muscles
compared with saline-treated controls (Fig.
4). GDNF mRNA levels were unchanged or
modestly increased. Spinal cords from the same animals showed no
changes in mRNA levels of these same three factors, suggesting that
activity blockade with curare selectively regulates these neurotrophic factors in muscle but not in the spinal cord containing motor neurons.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 4.
Activity blockade results in altered neurotrophic
factor expression in muscle but not in spinal cord. Using real-time
RT-PCR methods normalized to chicken GAPDH, both BDNF and NT-3 mRNAs
were reduced by approximately threefold with paralytic concentrations
of curare from E14 to E18 relative to saline-treated ALD muscle. In
contrast, GDNF expression increased slightly in muscle. None of these
neurotrophic factors was changed in spinal cords from the same animals,
suggesting that curare is working postsynaptically to induce its
effects on these factors. Each point represents the
average ± 1 SD from RT-PCR measurements from three independent
animals, and each RT-PCR from each animal was performed in
quadruplicate.
|
|
Because activity blockade with curare results in a reduction of
neurotrophic factor mRNA in muscle, we would predict that adding back
neurotrophic factors in the presence of curare would restore the
accumulation of NRG in the synaptic basal lamina. This in fact was seen
and is shown in Figure 5, where curare
treatment alone blocked NRG staining at synapses, but the addition of
20 ng/ml BDNF, NT-3, or GDNF with curare restored synaptic NRG
expression. This effect could also be seen with 10-fold lower
concentrations of BDNF or with combinations of BDNF and GDNF (data not
shown). Giving these same neurotrophic factors alone had no clear
effects on synaptic NRG (Fig. 5).

View larger version (86K):
[in this window]
[in a new window]
|
Figure 5.
Neurotrophic factors restore synaptic NRG
expression in the presence of activity blockade. Chick embryos were
treated daily with saline (CONTROL), a paralytic dose of
curare (3 mg/d; CURARE) or the same dose of curare with
1 µg (~20 ng/ml) of BDNF, NT-3, or GDNF for 4 d from E14 to
E18. ALD muscles at E18 were double-labeled for NRG (183N) and
acetylcholine receptors ( -bungarotoxin; BTX)
to localize synapses. Although the curare alone blocked NRG expression,
each of these neurotrophic factors restored NRG expression in the
presence of activity blockade. The neurotrophic factors alone had no
effect. Scale bar, 20 µm.
|
|
Not only did these trophic factors restore NRG expression, but they
also preserved synaptic structure (Fig.
6). High-power views of synapses
double-labeled for AChRs and terminal axons demonstrated that curare
treatment promotes massive axon terminal sprouting that was prevented
by BDNF, NT-3, or GDNF (Fig. 6A). When combined
together or given alone, BDNF and GDNF treatment with curare produced
AChR cluster densities and an end plate band architecture
indistinguishable from controls (Fig. 6B,C). BDNF and
GDNF alone, without activity blockade, had no effect on synaptic organization. Taken together, these results suggest that
activity-dependent expression of neurotrophic factors in muscle may be
needed both for the release of NRG at synapses and to maintain normal
end plate band architecture, perhaps by preventing the unregulated sprouting of new axon terminals.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 6.
Neurotrophic factors maintain normal end plate
band architecture in the face of activity blockade. A,
High-magnification views of synapses treated with saline
(CONTROL), high-dose curare (CURARE), or
high-dose curare plus BDNF, NT-3, or GDNF (1 µg/d) double-labeled
with -bungarotoxin (green) and neurofilaments
and synaptic terminals (red) using a mixture of RT-97
and SV2 antibodies. This reveals that the increased number of smaller
synapses seen with curare is attributable to excessive sprouting of the
terminal axons and that this sprouting is suppressed by the coaddition
of BDNF, NT-3, or GDNF. Scale bar, 10 µm. B,
Examination of AChR patterns in ALD with -bungarotoxin at lower
magnification reveals that BDNF (2 ng/ml) plus GDNF (20 ng/ml) in the
presence of paralytic doses of curare helps maintain a normal
architecture. These factors given without curare had no effects. Scale
bar, 100 µm. C, Quantitation of the number of AChR
clusters per 10,000 µm2 revealed increased numbers
with curare alone (as in Fig. 1) that normalized to control levels with
BDNF and GDNF (BG). The density with curare treatment
was significantly increased from controls (p = 0.010) and the curare with BDNF and GDNF treatment was significantly
lower than with curare alone (p = 0.014).
|
|
Activity-dependent accumulation of NRG into the synaptic cleft could be
mediated by transcriptional or post-transcriptional processes. To see
the contribution of transcriptional control mechanisms on the
regulation of NRG expression at synapses, we measured NRG mRNA levels
by Northern blot analysis in spinal cord and muscle with activity
blockade with curare with or without added neurotrophic factors (Fig.
7A,B). We have found that most NRG mRNA and protein in spinal cord is in motor neurons and that there
is a close correlation between NRG mRNA and protein levels during
development (Loeb et al., 1999 ). Despite the absence of NRG
accumulation at synapses treated with curare, we found a dose-dependent increase in NRG mRNA in spinal cord and no change in the lower levels
of NRG mRNA expressed in muscle. -Bungarotoxin had similar stimulatory effects on NRG in spinal cord. This suggests that, while
synaptic activity appears to regulate NRG mRNA expression in spinal
cord but not in muscle, the mechanism that translates synaptic activity
into NRG concentration at synapses is independent of transcription.
Addition of BDNF and GDNF, with or without curare, produced an even
greater, fivefold to eightfold, increase in NRG mRNA in spinal cord
(Fig. 7B). This confirms previous in vitro observations, now in vivo, that neurotrophic factors
increase NRG mRNA levels (Loeb and Fischbach, 1997 ) and raises the
possibility that neurotrophic factors have additional effects on
post-transcriptional processes that lead to the accumulation of NRG at
synapses.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 7.
NRG mRNA levels are increased in spinal cord with
activity blockade and neurotrophic factors but are unchanged in muscle.
A, Total RNA from lumbar spinal cords and gastrocnemius
muscles taken from the embryos described previously were analyzed for
NRG mRNA by Northern blot analysis using a full-length pro-NRG probe
revealing two transcripts. Note that considerably less NRG mRNA is
expressed in muscle compared with spinal cord. Although there were
significant increases in NRG mRNA for both low and high doses of
curare, no differences were noted in muscle. Positions of the ribosomal
RNA bands are indicated by arrows on the
left. B, The top, 7 kb
transcript shown in A together with data from similar
Northern blots were quantified and normalized to the level of chicken
GAPDH mRNA (shown in the bottom of A) and
summarized as the mean ± SD for spinal cord samples on the
left and gastrocnemius and ALD muscles on the
right. Although curare alone produced a twofold
induction of NRG mRNA levels, BDNF and GDNF alone or together with
curare produced a fivefold to eightfold induction of NRG mRNA. No
difference was noted between gastrocnemius and ALD muscles. The numbers
of animals in each condition were as follows: Control,
n = 32; Low Curare,
n = 8; High Curare,
n = 13; -Bungarotoxin,
n = 2; BDNF/GDNF + Curare, n = 6;
BDNF/GDNF, n = 2; Control
Gas, n = 2; Low Curare Gas,
n = 3; High Curare Gas,
n = 5; Control ALD,
n = 4; and High Curare ALD,
n = 2.
|
|
 |
DISCUSSION |
Activity-dependent accumulation of NRG at NMJs
In this report we have examined how activity at chick
neuromuscular synapses may be translated into changes in synaptic
structure and organization through an interplay between presynaptic and postsynaptic regulatory factors. We chose to look at a specific developmental stage when synapse elimination occurs, because at this
time we are able to make direct assessments of NRG accumulation at
synapses together with measurements of both NRG and neurotrophic factor
mRNA expression and to correlate these with synaptic structure. Our
results are consistent with a model in which acetylcholine-induced depolarization of muscle results in increased levels of muscle neurotrophic factors that, in turn, promote both the synthesis and
release of NRG from motor neurons. NRG then acts to increase the local
synthesis of AChRs that helps maintain synaptic function (Sandrock et
al., 1997 ).
The profound changes observed in synaptic number, size, and
organization with activity blockade are a testament to the importance of normal synaptic activity during development and may result from an
imbalance of normal neurotrophic factor signaling. Paralytic doses of
curare (or -bungarotoxin) produced a disordered array of synapses
with approximately fourfold more synapses per square micrometer of
muscle that were of variable size, on average, half the size of those
in untreated muscle. Nonparalytic doses of curare produced an
intermediate response. These changes appear to be attributable to
excessive new sprouting of axons. In other studies, axonal sprouting
has been observed with activity blockade or denervation and may
represent a general response to perturbations in neurotrophic factor
expression (Duchen and Strich, 1968 ; Srihari and Vrbova, 1978 ; Brown et
al., 1981 ; Holland and Brown, 1981 ; Zhao and Nonet, 2000 ).
Consistently, increased proximal nerve branching is observed with the
overexpression or underexpression of synaptic regulatory factors,
including NRGs, neurotrophins, and agrin (Funakoshi et al., 1995 ;
DeChiara et al., 1996 ; Gautam et al., 1996 ; Riethmacher et al., 1997 ;
Nguyen et al., 1998 ; Gonzalez et al., 1999 ; Morris et al., 1999 ; Lin et
al., 2000 ; Wolpowitz et al., 2000 ). Finally, during the period of
synapse elimination, activity blockade prevents the loss of multiply
innervated end plates that may also contribute to this hyperinnervated
appearance (Srihari and Vrbova, 1978 ; Colman and Lichtman, 1993 ).
In our experimental system, activity blockade greatly reduced the
normal deposition of NRG in the synaptic basal lamina. However, agrin
expression at synapses was preserved if not increased. These effects on
NRG and agrin correlate with changes in synaptic size and number
observed: the increase in the number of acetylcholine clusters is
associated with agrin expression at many new synaptic sites, yet the
smaller size of each of these clusters could be attributable to a lack
of NRG. Consistently, mice partially deficient in NRG had a reduced
density in synaptic AChRs and a corresponding reduction in
neuromuscular transmission (Sandrock et al., 1997 ). These results lend
further support for complimentary roles of agrin and NRG in
concentrating synaptic AChRs, in which agrin is critical for forming
new AChR clusters, NRG may build up the density and size of these
clusters on the basis of their level of activity.
The accumulation of synaptic NRG in the synaptic basal lamina is a
unique feature of this developmental stage that enabled us to monitor
synaptic NRG expression as a function of activity. This likely results
through interactions between the NRG heparin-binding, Ig-like domain
and HSPGs in the synaptic cleft (Goodearl et al., 1995 ; Jo et al.,
1995 ; Loeb and Fischbach, 1995 ; Loeb et al., 1999 ). We have shown that
NRG-HSPG interactions promote sustained erbB receptor phosphorylation
required to induce AChR synthesis (Li and Loeb, 2001 ). Agrin also binds
heparin and is itself an HSPG present in the basal lamina (Tsen et al.,
1995 ) that can bind directly to the heparin-binding domain of NRG
(Meier et al., 1998 ). In fact, it is only one of several synaptic HSPGs
made by both muscle and nerve (Anderson et al., 1984 ; Bayne et al., 1984 ; Sanes et al., 1986 ; Sanes, 1989 ; Peng et al., 1999 ). A critical observation here is that the absence of NRG at NMJs with activity blockade does not appear to be attributable to a lack of HSPGs, because
both agrin and another, muscle-derived HSPG are expressed at NMJs at
the same or higher levels than controls. Therefore, our results imply
that the absence of NRG staining is in fact attributable to a failure
of mechanisms that release NRG into the synaptic cleft rather than an
absence of NRG binding sites.
When expressed ectopically in muscle, neural agrin is capable of
inducing clusters of AChRs with associated increases in local AChR
transcription (Meier et al., 1998 ). There is some evidence to suggest
that these ectopic AChR clusters are associated with NRG
immunoreactivity, raising the possibility that muscle-derived NRG may
also be recruited to NMJs.
Presynaptic versus postsynaptic effects of activity on NRG and
neurotrophic factor expression
One advantage of studying synaptogenesis at peripheral NMJs is the
relative ease of differentiating presynaptic from postsynaptic events.
Our observations here that synaptic activity blockade selectively
changes neurotrophic factor expression in muscle but not in spinal cord
and changes NRG expression in spinal cord but not in muscle help define
the directionality of activity-dependent neurotrophic factor signaling
at NMJs. Consistently, neurotrophic factors increase both NRG mRNA and
protein release from cultured motor neurons (Loeb and Fischbach, 1997 ).
However, the exact sites of action and source of each of these factors
are not without ambiguity. Although NRG is most highly expressed in
spinal motor neurons by both in situ hybridization and
immunostaining (Loeb et al., 1999 ), significantly lower levels are
expressed in muscle (Ng et al., 1997 ) (Fig. 7). Thus, the preponderance
of evidence suggests that synaptic NRG is released from motor nerve
endings in an activity-dependent manner; however, contributions of NRG from muscle are possible.
Similarly, although the primary sites of action of curare and
-bungarotoxin are postsynaptic, it has been suggested that curare-induced motor neuron survival may be mediated through
presynaptic, neuronal nicotinic AChRs (Hory-Lee and Frank, 1995 ).
Arguing against this possibility, Oppenheim et al. (2000) found that
programmed cell death could be prevented only with antagonists that
block muscle AChRs and that the previous study did not adequately
assess the extent of muscle paralysis. Although we suspect that the
primary actions of curare and -bungarotoxin are postsynaptic, we
cannot rule out additional, presynaptic effects.
Finally, a growing number of target-derived, "survival" factors for
motor neurons have been identified, including BDNF, NT-3, NT-4, GDNF,
cardiotrophin-1, and hepatocyte growth factor/scatter factor (Ebens et
al., 1996 ; Oppenheim, 1996 ). It is becoming evident that these factors
are expressed at different stages of development and have both
redundant and distinct activities on motor neuron survival.
Understanding how this multiplicity of target-derived factors functions
in motor neuron programmed cell death and in synaptogenesis is far from
simple. Here we found that activity blockade with curare produced
threefold reductions in BDNF and NT-3 mRNA levels and a slight increase
in GDNF mRNA; however, all three of these factors were able to rescue
the disorganizing effects of curare when given systemically. Funakoshi
et al. (1995) found similar activity-dependent changes in NT-4 mRNA
expression, but when applied locally in muscle, NT-4 promoted
sprouting. A key question is whether changes in neurotrophic factor
mRNA levels indeed predict how much of each protein is released at
synapses. In contrast to the above findings, Gonzalez et al. (1999)
argued that anterograde signaling of neurotrophic factors, from nerve to muscle, was responsible for changes in AChR clustering in mice with
defective trkB signaling. Although there is some additional evidence
for trkB signaling in cultured muscle (Wells et al., 1999 ), most other
studies support a retrograde supply of neurotrophic factors from muscle
to nerve (Koliatsos et al., 1993 ; Leitner et al., 1999 ; Watson et al.,
1999 ).
Local cues at individual synapses
The lack of synaptic NRG accumulation despite an increase in
spinal cord NRG mRNA with activity blockade suggests that there is no
clear relationship between NRG transcription and its release at
synapses. On the other hand, we found that both spinal cord NRG mRNA
and synaptic NRG protein increased in animals given exogenous neurotrophic factors, consistent with previous in vitro
observations (Loeb and Fischbach, 1997 ). Even so, it is difficult to
imagine how transcriptional control mechanisms, which require contact with the cell nucleus, could differentially regulate the stability of
one of many individual synaptic connections made by a single motor neuron.
Taken together, our results are consistent with a mechanism whereby
activity-dependent regulation of postsynaptic neurotrophic factors
promotes the release of presynaptic NRG from individual motor nerve
terminals that is independent of motor neuron transcription. Previous
work has shown that NRG is first synthesized as a transmembrane precursor that is proteolytically cleaved and released in response to
activation of protein kinase C (Burgess et al., 1995 ; Loeb et al.,
1998 ). Through similar signaling pathways, target-derived neurotrophic
factors may stimulate NRG release at individual synapses based on the
degree of activity of a particular connection. This would form a local
feedback loop in which the directed release of neurotrophic factors
promotes the growth of connections through the reciprocal release of
NRG that, in turn, promotes AChR densities at more active synapses.
 |
FOOTNOTES |
Received July 13, 2001; revised Nov. 28, 2001; accepted Dec. 27, 2001.
This work was supported by the Children's Research Center of Michigan
(J.A.L.), by National Science Foundation Grant IBN-0092623 (J.A.L.), by
National Institutes of Health (NIH) Grants NS01659 (J.A.L.) and NS18458
(G.D.F.), and by an Osserman/Sosin/McClure fellowship from the
Myasthenia Gravis Foundation of America (A.H.). We thank Janet Robbins
and Janelle Novak for expert technical assistance and the Wayne State
University Applied Genomics Facility, where the quantitative RT-PCR
studies were performed.
Correspondence should be addressed to Dr. Jeffrey Loeb, Department of
Neurology and Center for Molecular Medicine and Genetics, Elliman 3217, 421 East Canfield Avenue, Detroit, MI 48201. E-mail: jloeb{at}med.wayne.edu.
 |
REFERENCES |
-
Alcantara S,
Frisen J,
del Rio JA,
Soriano E,
Barbacid M,
Silos-Santiago I
(1997)
TrkB signaling is required for postnatal survival of CNS neurons and protects hippocampal and motor neurons from axotomy-induced cell death.
J Neurosci
17:3623-3633[Abstract/Free Full Text].
-
Anderson MJ,
Klier FG,
Tanguay KE
(1984)
Acetylcholine receptor aggregation parallels the deposition of a basal lamina proteoglycan during development of the neuromuscular junction.
J Cell Biol
99:1769-1784[Abstract/Free Full Text].
-
Bayne EK,
Anderson MJ,
Fambrough DM
(1984)
Extracellular matrix organization in developing muscle: correlation with acetylcholine receptor aggregates.
J Cell Biol
99:1486-1501[Abstract/Free Full Text].
-
Brown MC,
Holland RL,
Hopkins WG
(1981)
Motor nerve sprouting.
Annu Rev Neurosci
4:17-42[Web of Science][Medline].
-
Burden S
(1977)
Development of the neuromuscular junction in the chick embryo: the number, distribution, and stability of acetylcholine receptors.
Dev Biol
57:317-329[Web of Science][Medline].
-
Burgess TL,
Ross SL,
Qian YX,
Brankow D,
Hu S
(1995)
Biosynthetic processing of neu differentiation factor. Glycosylation trafficking, and regulated cleavage from the cell surface.
J Biol Chem
270:19188-19196[Abstract/Free Full Text].
-
Chang CC,
Chuang ST,
Huang MC
(1975)
Effects of chronic treatment with various neuromuscular blocking agents on the number and distribution of acetylcholine receptors in the rat diaphragm.
J Physiol (Lond)
250:161-173[Abstract/Free Full Text].
-
Colman H,
Lichtman JW
(1993)
Interactions between nerve and muscle: synapse elimination at the developing neuromuscular junction.
Dev Biol
156:1-10[Web of Science][Medline].
-
DeChiara TM,
Bowen DC,
Valenzuela DM,
Simmons MV,
Poueymirou WT,
Thomas S,
Kinetz E,
Compton DL,
Rojas E,
Park JS,
Smith C,
DiStefano PS,
Glass DJ,
Burden SJ,
Yancopoulos GD
(1996)
The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo.
Cell
85:501-512[Web of Science][Medline].
-
Duchen LW,
Strich SJ
(1968)
The effects of botulinum toxin on the pattern of innervation of skeletal muscle in the mouse.
Q J Exp Physiol Cogn Med Sci
53:84-89[Abstract/Free Full Text].
-
Ebens A,
Brose K,
Leonardo ED,
Hanson Jr MG,
Bladt F,
Birchmeier C,
Barres BA,
Tessier-Lavigne M
(1996)
Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons.
Neuron
17:1157-1172[Web of Science][Medline].
-
Fallon JR,
Gelfman CE
(1989)
Agrin-related molecules are concentrated at acetylcholine receptor clusters in normal and aneural developing muscle.
J Cell Biol
108:1527-1535[Abstract/Free Full Text].
-
Falls DL,
Rosen KM,
Corfas G,
Lane WS,
Fischbach GD
(1993)
ARIA, a protein that stimulates acetylcholine receptor synthesis, is a member of the neu ligand family.
Cell
72:801-815[Web of Science][Medline].
-
Fischbach GD,
Rosen KM
(1997)
ARIA: a neuromuscular junction neuregulin.
Annu Rev Neurosci
20:429-458[Web of Science][Medline].
-
Funakoshi H,
Belluardo N,
Arenas E,
Yamamoto Y,
Casabona A,
Persson H,
Ibanez CF
(1995)
Muscle-derived neurotrophin-4 as an activity-dependent trophic signal for adult motor neurons.
Science
268:1495-1499[Abstract/Free Full Text].
-
Gautam M,
Noakes PG,
Moscoso L,
Rupp F,
Scheller RH,
Merlie JP,
Sanes JR
(1996)
Defective neuromuscular synaptogenesis in agrin-deficient mutant mice.
Cell
85:525-535[Web of Science][Medline].
-
Gonzalez M,
Ruggiero FP,
Chang Q,
Shi YJ,
Rich MM,
Kraner S,
Balice-Gordon RJ
(1999)
Disruption of Trkb-mediated signaling induces disassembly of postsynaptic receptor clusters at neuromuscular junctions.
Neuron
24:567-583[Web of Science][Medline].
-
Goodearl AD,
Yee AG,
Sandrock Jr AW,
Corfas G,
Fischbach GD
(1995)
ARIA is concentrated in the synaptic basal lamina of the developing chick neuromuscular junction.
J Cell Biol
130:1423-1434[Abstract/Free Full Text].
-
Henderson CE,
Camu W,
Mettling C,
Gouin A,
Poulsen K,
Karihaloo M,
Rullamas J,
Evans T,
McMahon SB,
Armanini MP,
Berkemeier L,
Phillips HS,
Rosenthal A
(1993)
Neurotrophins promote motor neuron survival and are present in embryonic limb bud.
Nature
363:266-270[Medline].
-
Henderson CE,
Phillips HS,
Pollock RA,
Davies AM,
Lemeulle C,
Armanini M,
Simmons L,
Moffet B,
Vandlen RA,
Simpson LC,
Moffet B,
Vandlen RA,
Koliatsos VE,
Rosenthal A
(1994)
GDNF: a potent survival factor for motoneurons present in peripheral nerve and muscle.
Science
266:1062-1064[Abstract/Free Full Text]. [erratum (1995) 267:777]
-
Holland RL,
Brown MC
(1981)
Nerve growth in botulinum toxin poisoned muscles.
Neuroscience
6:1167-1179[Web of Science][Medline].
-
Hory-Lee F,
Frank E
(1995)
The nicotinic blocking agents d-tubocurare and alpha-bungarotoxin save motoneurons from naturally occurring death in the absence of neuromuscular blockade.
J Neurosci
15:6453-6460[Abstract/Free Full Text].
-
Jo SA,
Zhu X,
Marchionni MA,
Burden SJ
(1995)
Neuregulins are concentrated at nerve-muscle synapses and activate ACh-receptor gene expression.
Nature
373:158-161[Medline].
-
Koliatsos VE,
Clatterbuck RE,
Winslow JW,
Cayouette MH,
Price DL
(1993)
Evidence that brain-derived neurotrophic factor is a trophic factor for motor neurons in vivo.
Neuron
10:359-367[Web of Science][Medline].
-
Leitner ML,
Molliver DC,
Osborne PA,
Vejsada R,
Golden JP,
Lampe PA,
Kato AC,
Milbrandt J,
Johnson EM
(1999)
Analysis of the retrograde transport of glial cell line-derived neurotrophic factor (GDNF), neurturin, and persephin suggests that in vivo signaling for the GDNF family is GFR
coreceptor-specific.
J Neurosci
19:9322-9331[Abstract/Free Full Text]. -
Li Q,
Loeb JA
(2001)
Neuregulin-HSPG interactions produce sustained ErbB receptor activation required for the induction of AChRs in muscle.
J Biol Chem
276:38068-38075[Abstract/Free Full Text].
-
Lin W,
Sanchez HB,
Deerinck T,
Morris JK,
Ellisman M,
Lee KF
(2000)
Aberrant development of motor axons and neuromuscular synapses in erbB2-deficient mice.
Proc Natl Acad Sci USA
97:1299-1304[Abstract/Free Full Text].
-
Loeb JA,
Fischbach GD
(1995)
ARIA can be released from extracellular matrix through cleavage of a heparin-binding domain.
J Cell Biol
130:127-135[Abstract/Free Full Text].
-
Loeb JA,
Fischbach GD
(1997)
Neurotrophic factors increase neuregulin expression in embryonic ventral spinal cord neurons.
J Neurosci
17:1416-1424[Abstract/Free Full Text].
-
Loeb JA,
Susanto ET,
Fischbach GD
(1998)
The Neuregulin precursor proARIA is processed to ARIA after expression on the cell surface by a protein kinase C-enhanced mechanism.
Mol Cell Neurosci
11:77-91[Web of Science][Medline].
-
Loeb JA,
Khurana TS,
Robbins JT,
Yee AG,
Fischbach GD
(1999)
Expression patterns of transmembrane and released forms of neuregulin during spinal cord and neuromuscular synapse development.
Development
126:781-791[Abstract].
-
Meier T,
Masciulli F,
Moore C,
Schoumacher F,
Eppenberger U,
Denzer AJ,
Jones G,
Brenner HR
(1998)
Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins.
J Cell Biol
141:715-726[Abstract/Free Full Text].
-
Moore MW,
Klein RD,
Farinas I,
Sauer H,
Armanini M,
Phillips H,
Reichardt LF,
Ryan AM,
Carver-Moore K,
Rosenthal A
(1996)
Renal and neuronal abnormalities in mice lacking GDNF.
Nature
382:76-79[Medline].
-
Morris JK,
Lin W,
Hauser C,
Marchuk Y,
Getman D,
Lee KF
(1999)
Rescue of the cardiac defect in ErbB2 mutant mice reveals essential roles of ErbB2 in peripheral nervous system development.
Neuron
23:273-283[Web of Science][Medline].
-
Ng YP,
Pun S,
Yang JF,
Ip NY,
Tsim KW
(1997)
Chick muscle expresses various ARIA isoforms: regulation during development, denervation, and regeneration.
Mol Cell Neurosci
9:132-143[Web of Science][Medline].
-
Nguyen QT,
Parsadanian AS,
Snider WD,
Lichtman JW
(1998)
Hyperinnervation of neuromuscular junctions caused by GDNF overexpression in muscle.
Science
279:1725-1729[Abstract/Free Full Text].
-
Oppenheim RW
(1996)
Neurotrophic survival molecules for motoneurons: an embarrassment of riches.
Neuron
17:195-197[Web of Science][Medline].
-
Oppenheim RW,
Bursztajn S,
Prevette D
(1989)
Cell death of motoneurons in the chick embryo spinal cord. XI. Acetylcholine receptors and synaptogenesis in skeletal muscle following the reduction of motoneuron death by neuromuscular blockade.
Development
107:331-341[Abstract].
-
Oppenheim RW,
Prevette D,
D'Costa A,
Wang S,
Houenou LJ,
McIntosh JM
(2000)
Reduction of neuromuscular activity is required for the rescue of motoneurons from naturally occurring cell death by nicotinic-blocking agents.
J Neurosci
20:6117-6124[Abstract/Free Full Text].
-
Peng HB,
Xie H,
Rossi SG,
Rotundo RL
(1999)
Acetylcholinesterase clustering at the neuromuscular junction involves perlecan and dystroglycan.
J Cell Biol
145:911-921[Abstract/Free Full Text].
-
Riethmacher D,
Sonnenberg-Riethmacher E,
Brinkmann V,
Yamaai T,
Lewin GR,
Birchmeier C
(1997)
Severe neuropathies in mice with targeted mutations in the ErbB3 receptor.
Nature
389:725-730[Medline].
-
Ruegg MA,
Bixby JL
(1998)
Agrin orchestrates synaptic differentiation at the vertebrate neuromuscular junction.
Trends Neurosci
21:22-27[Web of Science][Medline].
-
Sanchez MP,
Silos-Santiago I,
Frisen J,
He B,
Lira SA,
Barbacid M
(1996)
Renal agenesis and the absence of enteric neurons in mice lacking GDNF.
Nature
382:70-73[Medline].
-
Sandrock Jr AW,
Dryer SE,
Rosen KM,
Gozani SN,
Kramer R,
Theill LE,
Fischbach GD
(1997)
Maintenance of acetylcholine receptor number by neuregulins at the neuromuscular junction in vivo.
Science
276:599-603[Abstract/Free Full Text].
-
Sanes JR
(1989)
Extracellular matrix molecules that influence neural development.
Annu Rev Neurosci
12:491-516[Web of Science][Medline].
-
Sanes JR,
Lichtman JW
(1999)
Development of the vertebrate neuromuscular junction.
Annu Rev Neurosci
22:389-442[Web of Science][Medline].
-
Sanes JR,
Schachner M,
Covault J
(1986)
Expression of several adhesive macromolecules (N-CAM, L1, J1, NILE, uvomorulin, laminin, fibronectin, and a heparan sulfate proteoglycan) in embryonic, adult, and denervated adult skeletal muscle.
J Cell Biol
102:420-431[Abstract/Free Full Text].
-
Srihari T,
Vrbova G
(1978)
The role of muscle activity in the differentiation of neuromuscular junctions in slow and fast chick muscles.
J Neurocytol
7:529-540[Web of Science][Medline].
-
Tsen G,
Halfter W,
Kroger S,
Cole GJ
(1995)
Agrin is a heparan sulfate proteoglycan.
J Biol Chem
270:3392-3399[Abstract/Free Full Text].
-
Wang JY,
Miller SJ,
Falls DL
(2000)
The N-terminal region of neuregulin isoforms determines the accumulation of cell surface and released neuregulin ectodomain.
J Biol Chem
275:2841-2851.
-
Watson FL,
Heerssen HM,
Moheban DB,
Lin MZ,
Sauvageot CM,
Bhattacharyya A,
Pomeroy SL,
Segal RA
(1999)
Rapid nuclear responses to target-derived neurotrophins require retrograde transport of ligand-receptor complex.
J Neurosci
19:7889-7900[Abstract/Free Full Text].
-
Wells DG,
McKechnie BA,
Kelkar S,
Fallon JR
(1999)
Neurotrophins regulate agrin-induced postsynaptic differentiation.
Proc Natl Acad Sci USA
96:1112-1117[Abstract/Free Full Text].
-
Wolpowitz D,
Mason TB,
Dietrich P,
Mendelsohn M,
Talmage DA,
Role LW
(2000)
Cysteine-rich domain isoforms of the neuregulin-1 gene are required for maintenance of peripheral synapses.
Neuron
25:79-91[Web of Science][Medline].
-
Zhao H,
Nonet ML
(2000)
A retrograde signal is involved in activity-dependent remodeling at a C. elegans neuromuscular junction.
Development
127:1253-1266[Abstract].
Copyright © 2002 Society for Neuroscience 0270-6474/02/2262206-09$05.00/0
This article has been cited by other articles:

|
 |

|
 |
 
R. M. Esper and J. A. Loeb
Neurotrophins Induce Neuregulin Release through Protein Kinase C{delta} Activation
J. Biol. Chem.,
September 25, 2009;
284(39):
26251 - 26260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fisahn, J. Neddens, L. Yan, and A. Buonanno
Neuregulin-1 Modulates Hippocampal Gamma Oscillations: Implications for Schizophrenia
Cereb Cortex,
March 1, 2009;
19(3):
612 - 618.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Loeb
Neuroprotection and repair by neurotrophic and gliotrophic factors in multiple sclerosis
Neurology,
May 29, 2007;
68(22_suppl_3):
S38 - S42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Taylor, D. J. Gifondorwa, J. M. Newbern, M. B. Robinson, J. L. Strupe, D. Prevette, R. W. Oppenheim, and C. E. Milligan
Astrocyte and Muscle-Derived Secreted Factors Differentially Regulate Motoneuron Survival
J. Neurosci.,
January 17, 2007;
27(3):
634 - 644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O.-B. Kwon, M. Longart, D. Vullhorst, D. A. Hoffman, and A. Buonanno
Neuregulin-1 Reverses Long-Term Potentiation at CA1 Hippocampal Synapses
J. Neurosci.,
October 12, 2005;
25(41):
9378 - 9383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ruiz, J. Lin, A. Forgie, D. Foletti, D. Shelton, A. Rosenthal, and L. Tabares
Treatment with trkC agonist antibodies delays disease progression in neuromuscular degeneration (nmd) mice
Hum. Mol. Genet.,
July 1, 2005;
14(13):
1825 - 1837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Esper and J. A. Loeb
Rapid Axoglial Signaling Mediated by Neuregulin and Neurotrophic Factors
J. Neurosci.,
July 7, 2004;
24(27):
6218 - 6227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Lefebvre, F. Ono, C. Puglielli, G. Seidner, C. Franzini-Armstrong, P. Brehm, and M. Granato
Increased neuromuscular activity causes axonal defects and muscular degeneration
Development,
June 1, 2004;
131(11):
2605 - 2618.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhou, Q. Nai, M. Chen, J. D. Dittus, M. J. Howard, and J. F. Margiotta
Brain-Derived Neurotrophic Factor and trkB Signaling in Parasympathetic Neurons: Relevance to Regulating {alpha}7-Containing Nicotinic Receptors and Synaptic Function
J. Neurosci.,
May 5, 2004;
24(18):
4340 - 4350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. X. S. Jiang, R. C. Y. Choi, N. L. Siow, H. H. C. Lee, D. C. C. Wan, and K. W. K. Tsim
Muscle Induces Neuronal Expression of Acetylcholinesterase in Neuron-Muscle Co-culture: TRANSCRIPTIONAL REGULATION MEDIATED BY cAMP-DEPENDENT SIGNALING
J. Biol. Chem.,
November 14, 2003;
278(46):
45435 - 45444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Wardle and M.-m. Poo
Brain-Derived Neurotrophic Factor Modulation of GABAergic Synapses by Postsynaptic Regulation of Chloride Transport
J. Neurosci.,
September 24, 2003;
23(25):
8722 - 8732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Y. Kim, Q. Sun, M. Oglesbee, and S. O. Yoon
The Role of ErbB2 Signaling in the Onset of Terminal Differentiation of Oligodendrocytes In Vivo
J. Neurosci.,
July 2, 2003;
23(13):
5561 - 5571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Auld and R. Robitaille
Perisynaptic Schwann Cells at the Neuromuscular Junction: Nerve- and Activity-Dependent Contributions to Synaptic Efficacy, Plasticity, and Reinnervation
Neuroscientist,
April 1, 2003;
9(2):
144 - 157.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Cohen-Cory
The Developing Synapse: Construction and Modulation of Synaptic Structures and Circuits
Science,
October 25, 2002;
298(5594):
770 - 776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawai, W. Zago, and D. K. Berg
Nicotinic alpha 7 Receptor Clusters on Hippocampal GABAergic Neurons: Regulation by Synaptic Activity and Neurotrophins
J. Neurosci.,
September 15, 2002;
22(18):
7903 - 7912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Brumwell, J. L. Johnson, and M. H. Jacob
Extrasynaptic alpha 7-Nicotinic Acetylcholine Receptor Expression in Developing Neurons Is Regulated by Inputs, Targets, and Activity
J. Neurosci.,
September 15, 2002;
22(18):
8101 - 8109.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|